research proposal
TRANSCRIPT
![Page 1: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/1.jpg)
TABLE OF CONTENTTABLE OF CONTENT........................................................................................................1
SUMMARY............................................................................................................................2
1.0 INTRODUCTION AND LITERATURE REVIEW....................................................3
1.1 Recommendations for malaria control in pregnancy.......................................4
1.2 Integrated Approaches........................................................................................4
1.3 Alternative Anti-malarias for IPTp...................................................................5
1.4 Drug resistance.....................................................................................................6
2.0 RESEARCH PROBLEM................................................................................................8
3.0 OBJECTIVES..................................................................................................................8
4.0 HYPOTHESIS..................................................................................................................9
5.0 JUSTIFICATION............................................................................................................9
6.0 MATERIALS AND METHODS....................................................................................9
6.1 Study Area............................................................................................................9
6.2 Study Design.......................................................................................................10
6.3 Ethical Consideration.........................................................................................11
6.4 Sample collection and screening........................................................................11
6.5 Molecular Analysis..............................................................................................12
6.6 Analysis of results................................................................................................12
6.7 Work plan.............................................................................................................13
7.0 BUDJECT.........................................................................................................................14
REFERENCES.......................................................................................................................15
CONSENT FORM I...............................................................................................................18
CONSENT FORM II.............................................................................................................20
CONSENT FORM III............................................................................................................21
QUESTIONNAIRE................................................................................................................22
Page | 1
![Page 2: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/2.jpg)
SUMMARY
The burden of malaria in pregnancy cannot be over emphasised as has been established by
authors all over the world. The bulk of the damage has been recorded here in Africa. To this
effect, the WHO recommends a three pronged approach to curb this menace; effective case
management, intermittent preventive treatment and insecticide treated bed nets. Sulphadoxine
– pyrimethamine was recommended as the drug of choice for IPT, however resistant parasites
have been isolated in some countries. This research seeks to determine the prevalence of the
molecular markers of parasite resistances to sulphadoxine – pyrimethamine in the Central
Region, Ghana. After informed consent has been sought, venous blood samples would be
collected from pregnant women that attend selected antenatal clinics in the region. Thin and
thick blood films would be prepared to estimate the parasite density, DNA would be
extracted from dried spots using the Tris – EDTA method of extraction and amplified by
Polymerase Chain Reaction (PCR) using appropriate primers. The product would also be
subjected to enzyme digestion and gel electrophoresis to determine the point mutations on the
pfdhfr and pfdhps genes which have been stated as the molecular markers of SP resistance.
Associations between the different mutations would be tested using Fisher’s Exact Test.
Guided questionnaires would be administered to determine how socio-demographic factors
relates to malaria in pregnancy and also rule out confounders. The results of this research
would go a long way to inform policy makers on the progress of SP as IPT and also its
effectiveness in clearing parasites from the bodies of pregnant women.
Page | 2
![Page 3: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/3.jpg)
1.0 INTRODUCTION AND LITERATURE REVIEW
Malaria is a parasitic disease transmitted by female mosquitoes of the genus Anopheles.
Anopheles gambiae and A. funestus are the main vectors of the disease in Africa (Steketee,
2001). It is widespread in tropical and sub-tropical regions, including parts of the Americas,
Asia and Africa (Snow et al., 2005). Malaria epidemics kill more than 2,000,000 people of all
ages every year (TASRBM, 2000). People at greatest risk are those who have been exposed
to malaria only infrequently and have developed little or no protective immunity, pregnant
women and children (Brabin, 1991). It is estimated that up to 124 million people in Africa
live in areas at risk of seasonal epidemic malaria, and many more in areas outside Africa
where transmission is less intense (Brabin, 1985). Of the four parasitic protozoa causing
malaria, Plasmodium falciparum is the most common and the most dangerous, causing
between 700,000 and 2.7 million deaths annually, most of which are in children and pregnant
women (Steketee, 2001).
Every year, approximately 50 million women living in malaria endemic areas become
pregnant; half of them in sub-Saharan Africa, many in areas of intense Plasmodium
falciparum transmission (WHO. AFR/MAL: 2004). In these regions, malaria in pregnancy is
predominantly asymptomatic and yet is a major cause of severe maternal anaemia and low
birth weight babies. There is a strong association between low birth weight and child
survival, successful control of malaria in pregnancy might prevent 75 000–200 000 infant
deaths every year (Steketee et al., 2001).
Successful control of malaria in pregnancy thus might save lives of mothers and babies, and
is a high public health priority in all endemic countries, although the optimum methods for
achieving this may vary according to local conditions. Malaria endemicity, its effect on the
Page | 3
![Page 4: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/4.jpg)
pregnant women and the unborn baby as well as the high mortality among children under the
age of five, necessitated the WHO to come out with guidelines and recommendations for
malaria control in pregnancy.
1.1 Recommendations for malaria control in Pregnancy
For sub-Saharan Africa, the WHO has developed guidelines for the control of malaria during
pregnancy. These consist of prompt and effective case management of malaria illness
combined with prevention of infection and/or disease by insecticide-treated nets and
intermittent preventive treatment in pregnancy (IPTp) (WHO. AFR/MAL: 2004).
Intermittent Preventive Treatment in Pregnancy (IPTp) was explored and developed to avoid
the limitations of daily or weekly chemoprophylaxis (Schultz et al., 1994, Praise et al., 1998)
, Ver Hoeff et al., 1998, Shulman et al., 1999). It consists of an anti-malarial treatment given
at regular intervals during pregnancy, regardless of malaria infection or disease.
Sulphadoxine-Pyrimethamine is cheap, safe in the second and third trimester, and can be
given as a single dose. In areas with stable P falciparum malaria transmission, WHO
recommends that at least two doses are given from the second trimester onwards at least 1
month apart (WHO. AFR/MAL: 2004).
1.2 Integrated Approaches
Most studies of IPTp were done before the introduction of insecticide-treated nets to
prevention policy in pregnancy. The absence of apparent risks associated with insecticide-
treated net use and the additional benefits provided to the mothers and their infants dictate
that future IPTp trials should be conducted in the context of insecticide-treated nets in Africa.
However, the limited information does not suggest a synergistic or even additive effect
between the combined effects of IPTp and insecticide-treated nets. One randomised
Page | 4
![Page 5: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/5.jpg)
controlled trial in Kenyan primigravidae and secundigravidae showed that the combination of
insecticide-treated nets and (two dose) IPTp with Sulphadoxine-Pyrimethamine was
associated with only a slightly greater reduction of anaemia than either intervention alone,
and only in primigravidae (Njagi et al., 2003). Concomitant insecticide-treated net use might
reduce the need or frequency of IPTp dosing, which may be an important advantage with new
anti-malarial combinations that are less well tolerated, involve more complex dosing
regimens, and are more expensive than Sulphadoxine-Pyrimethamine. Although this may be
attractive, insecticide-treated nets provide only partial protection against malaria, and the
operational effectiveness might be compromised by incorrect or irregular use of nets and
failure to re-impregnate the net. It was initially thought that a drug regimen based on a few
supervised doses would overcome the compliance limitations of chemoprophylaxis.
However, studies in countries where IPTp has been implemented for several years show that
the uptake of a second dose is surprisingly poor (Rogerson et al., 2000). More operational
research is needed to develop strategies to improve the uptake and effectiveness of this
promising strategy (Crawley et al., 2007).
1.3 Alternative Anti-malarials for IPTp
Defining the ideal properties for a drug to be used for IPTp will help the choice of
alternatives to Sulphadoxine-Pyrimethamine. Understanding the mechanism of action of IPTp
is a crucial first step that establishes what pharmacokinetic or Pharmacodynamic properties
are required of alternatives to Sulphadoxine-Pyrimethamine (White et al., 2005). IPTp might
provide intermittent clearance of existing asymptomatic placental infections (treatment
effect) and, with a slowly eliminated drug, might also prevent new infections by maintaining
suppressive drug levels for several weeks after each treatment (post-treatment prophylactic
effect). Although the precise mechanism of how falciparum malaria produces intrauterine
Page | 5
![Page 6: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/6.jpg)
growth retardation (IUGR) is not yet defined, IUGR tends to be greater with high placental
parasite burden and high accumulation of Monocytes and Macrophages (Menendez et al.,
2000). Thus, IPTp might also act by the suppression of parasitaemia to levels too low to
cause clinical malaria. If the duration of post-treatment prophylaxis is an important
determinant of IPTp efficacy, drugs with long-half lives are likely to be more effective
(White et al., 2005). This should be verified by comparing drugs with different
pharmacokinetic profiles. An important epidemiological feature of malaria in pregnancy is
that the adverse effects tend to decrease with increasing parity, particularly where malaria
transmission is high. In the early trials among semi-immune women, the substantial impact of
malaria chemoprophylaxis was limited to primigravidae. It was then suggested that malaria
control should target primigravidae and multigravidae (Garner et al., 2000).
1.4 Drug Resistance
The alarming increase of Sulphadoxine-Pyrimethamine resistance in Africa has raised
concerns about its use as IPTp. Pharmacokinetic modelling suggests that the suppressive
prophylactic effect of Sulphadoxine-Pyrimethamine, assuming similar pharmacokinetic
profiles as in non-pregnant adults, may last approximately 2–3 months in areas with sensitive
parasites (White et al., 2005). The period of effective post-treatment prophylaxis then
progressively shortens with increasing drug resistance, compromising the efficacy of the two-
dose regimen given at 3-month intervals (White et al., 2005). Sulphadoxine-Pyrimethamine
resistance is linked to mutations in the dihydrofolate reductase (dhfr) and dihydropteroate
synthetase (dhps) genes. Parasites with quadruple mutations in the dhfr gene, including the
164L mutation (highly prevalent in Thailand), 51I, 59R, 108N and double mutations in the
(dhps) genes at 540E and 437G are fully resistant. These point mutations have been identified
to be the molecular markers of (SP) resistance. Such parasites have already been observed in
Page | 6
![Page 7: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/7.jpg)
Malawi, Uganda, and western Kenya (McCollum et al., 2006, Hastings et al., 2002, Alker et
al., 2005, Farnet et al., 2002, Staedke et al., 2004) though their rate of spread cannot be
predicted. It might be slowed if Sulphadoxine-Pyrimethamine use in the general population is
not widespread and is limited to intermittent preventive treatment regimen (kalanda et al.,
2006, Tagbor et al., 2006).
Sulphadoxine-Pyrimethamine (S/P) act as a synergistic inhibitor of folate biosynthesis which,
in malaria parasites, is an obligatory requirement for the production of nucleotides and hence
DNA synthesis. Both compounds act synergistically, hence any loss of efficiency in either
component results in the reduction of the effectiveness of the combination as whole. The
occurrence of certain molecular polymorphisms in the dihydrofolate reductase (pfdhfr) and
dihydropteroate synthase (pfdhps) genes has been associated to in vivo S/P treatment outcome
[Wongsrichanalai et al., 2002]. Particularly in East Africa, the occurrence of pfdhfr quadruple
mutations (dhfr 51I/59R/108N/164L) have been associated with pyrimethamine resistance
and pfdhps double mutations (dhps 437G/540E) have been associated with sulphadoxine
resistance[Le Bras et al., 2003].
This research would investigate the prevalence of mutations in the pfdhfr and pfdhps gene
from samples collected from pregnant women at selected antenatal clinics in central region,
Ghana.
Page | 7
![Page 8: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/8.jpg)
2.0 RESEARCH PROBLEM
For over 5 years, Sulphadoxine-Pyrimethamine (SP) has been prescribed for pregnant women
at antenatal clinics in Ghana. This is to fulfil the requirements of the WHO for Intermittent
Preventive Treatment (IPT) of malaria in endemic areas. However, there is knowledge of
parasite mutations conferring resistances to the parasites. These mutations have been
identified on the dihydrofolate reductase (dhfr) and the dihydropteroate synthase (dhps) genes
and associated to SP resistance. These mutations have been recorded in parasite isolates from
Eastern and Southern Africa, Asia and some Western Africa countries especially Ghana,
before the introduction of IPT. If these mutant species have become prevalent among
pregnant women in Ghana, the efficacy of (SP) as prophylaxis for pregnant women will be
highly questionable.
3.0 OBJECTIVES
The main objective of this study is to determine the point mutations on pfdhfr and pfdhps
genes associated with (SP) resistance in Ghana.
Specific Objectives
To determine the predominant pfdhfr and pfdhps mutants present in pregnant women
in Central Region, Ghana.
To determine the seasonality of the prevalence of the mutants.
To identify the various mutations associated with dihydrofolate reductase gene of P.
falciparum pyrimethamine resistance.
To identify the various mutations associated with dihydropteroate synthase gene of P.
falciparum sulphadoxine resistance.
To determine the relationship between socio-demographic factors and the prevalence
of the mutants.
Page | 8
![Page 9: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/9.jpg)
4.0 HYPOTHESIS
Mutations in the dhfr and dhps genes associated with Plasmodium falciparum resistance to
(SP) are increasing in Ghana.
5.0 JUSTIFICATION
Malaria infection during pregnancy has a very important adverse effect on both the mother
and the foetus and accounts for a large number of deaths and labour complications around the
world, most especially in malaria endemic areas. To this end, integrated approach with
insecticide treated nets and intermittent preventive treatment with Sulphadoxine-
Pyrimethamine is practised in most West African countries including Ghana. However there
is knowledge of Plasmodium falciparum dihydrofolate reductase and Plasmodium falciparum
dihydropteroate synthase mutations in East and Central Africa conferring resistance to the
parasite. If these mutants become more prevalent in Ghana, especially among pregnant
women, the efficacy of (SP) as (IPT) would be jeopardised, requiring a new drug policy.
Therefore monitoring the prevalence of the molecular markers of (SP) resistance would give
a good basis for the evaluation of the effectiveness of (SP) as (IPT) in Ghana.
6.0 MATERIALS AND METHODS
6.1 STUDY AREA
Central Region (5° 30′ 0″ N, 1° 0′ 0″ W) occupies an area of 9,826 square kilometers, which
is about 6.6% of the land area of Ghana. It has an estimated population of 1,805,488 and an
annual population growth rate of 2.1% with 17 administrative districts. The region is the
second most densely populated region in the country with a population density of about 176
persons per-square kilometers; 63% of the region is rural. Generally, there are two rainy
Page | 9
![Page 10: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/10.jpg)
seasons in the region. The peak of the major season is in June. The vegetation is divided into
dry Coastal Savannah stretching about 15 km inland, and a Tropical Rain Forest with various
reserve areas. The Region is endowed with rich cultural practices like annual festivals such as
Aboakyer, Fetu Afahye, and Bakatue, among others. An international festival, Pan African
Historical Theatre Festival is also hosted by the region. The region is also endowed with
historic monuments like castles and forts. These attract lots of tourist to the region. The
people are mostly Fantis, with, Akans and Guans, but the towns have significant presence of
different tribes form other parts of the country. The major economic activities are agriculture
and fishing. Small-scale manufacturing also takes place in food-processing, ceramic wares, as
well as salt and soap industries. The region is classified among the four poorest in the
country.
6.2 STUDY DESIGN
This research would be a cross-sectional study and the cluster sampling method would be
applied. The central region has seventeen (17) administrative districts. Each district would
represent a cluster. One or two (based on population) health facilities would be selected
randomly from each district. Each selected health facility would be visited twice (rainy and
dry seasons). A guided questionnaire would be administered before venous blood is collected.
All pregnant women would be eligible to participate whether or not (SP) dose has been taken.
6.3 SAMPLE SIZE DETERMINATION
Projected number of pregnant women in Central region = 85, 347 (GHS, Central Regional
Health Directorate).
Number of Health facilities with antenatal clinic in Central Region = 225
Page | 10
![Page 11: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/11.jpg)
Number of Districts in Central Region = 17
Number of pregnant women per district = 85,347 / 17 = 5020
Number of Health Facilities Per district = 225 / 17 = 13
Number of pregnant women per Health Facility = 5020 / 13 = 386
Sample = 33% of the Population
From above, 33% of the estimated number of pregnant women would be sampled.
Thus number participants per health facility = 33% of 386 = 127
Since only one health facility would be visited per district, then
Sample size = 127 * 17(districts) = 2165
SAMPLE SIZE = 2165
6.3 ETHICAL CONSIDERATIONS
Ethical approval would be sought from the Ghana Health Service Ethical Review Committee.
All hospital and clinic heads would be briefed on the research procedures and its benefit to
the population. Informed consent would be obtained from the pregnant women that attend the
hospitals before they are included.
6.4 SAMPLE COLLECTION AND SCREENING
Page | 11
![Page 12: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/12.jpg)
Four millilitres of Peripheral blood samples would be collected into a heparinised tube by
trained and licensed laboratory technicians; 50ul of blood would be dotted on a 3 MM
Whatman filter paper and air-dried at room temperature. Thick and thin blood films would
also be prepared. Full Blood Count (FBC) would be determined using ‘Cell Dyn 1800’.
Sickling status, blood group and G6PD would also be determined. The thin film would be
fixed with Methanol and both thin and thick films would be stained with 10% Giemsa
solution. Parasite density would be estimated. The spotted filter papers and plasma would be
stored at -20 until usage.
6.5 MOLECULAR ANALYSIS
Parasite DNA would be extracted from dried spots on the filter paper using the Tris – EDTA
method (as described in MR4, 2008) and the purified DNA amplified by Polymerase Chain
Reaction (PCR) using the following primers;
Name Locus / fragment Sequence
Primary PCR amplification 5’ 3’
P5-for Dhfr TTTATGATGGAACAAGTCTGC
P5-1 rev Dhfr ATTCATATGTACTATTTATTCTAGT
P8-1 for Dhps ATTTTTGTTGAACCTAAACGTGCTGTTCA
Page | 12
![Page 13: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/13.jpg)
P8-1 rev Dhps CTTGTCTTTCCTCATGTAATTCATCT
Curled from Methods in Malaria Research. 2008
Nested PCR amplification
P5 for dhfr ACAAGTCTGCGACGTTTTCGATATTTATG
P5 rev Dhfr AGTATATACATCGCTAACAGA
P8 for Dhps TTGAAATGATAAATGAAGGTGCTAGT
P8 rev Dhps CCAATTGTGTGATTTGTCCA
. Curled from Methods in Malaria Research. 2008
After amplification, enzyme digestion and gel electrophoresis would be carried out and
visualised under U. V. To determine the mutants.
6.5 ANALYSIS OF RESULTS
The questionnaires would be analyzed using Statistical Package for Social Scientists.
Associations between the different mutations would be tested using Fisher’s Exact Test.
6.6 WORK PLAN
AUG – DEC 2009 JAN – AUG 2010
ACTIVITY A S O N D J F M A M J J A
Ethical Clearance and visits to clinics
Sample collection and screening
DNA Extraction
PCR Assay
Electrophoresis and Digestion
Page | 13
![Page 14: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/14.jpg)
Report Writing
Seminars and conferences
Submission of thesis
7.0 BUDGET
MATERIALS AND REAGENTS QTY UNIT PRICE
(GH¢)
TOTAL
PRICE (GH¢)
SAMPLE COLLECTION AND SCREENING
1. Transportation 500
2. Chromatography filter paper 20 pkgs 7.89 157.8
3. Heparinised capillary tubes 2000 pcs 0.2 400
4. Microscope slides 20 pkgs 5.0 100
5. Giemsa stain 1L 50 50
DNA EXTRACTION
1. Ethanol 1L 72.27 72.27
2. Tris-HCl (pH 9.0) 1L 48.86 48
3. EDTA 1kg 58.98 58.98
Page | 14
![Page 15: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/15.jpg)
PCR AMPLIFICATION
1. 96 well plates 10 pkgs 12.4 124
2. 10 x PCR Buffer 5 vials 27.05 135.25
3. EDTA 1kg 92.37 92.37
4. Readymix Taq PCR reaction mix 1000 units 0.605 605
5. PCR tubes 2 pkgs 45.51 91.02
6. primers 5 vials 7.0 35.00
ENZYME DIGESTION AND ELECTROPHORESIS
7. Ethidium bromide 1 vial 85 850
8. Agarose gel 5kg 12.0 60.00
TOTAL 3379.83
REFERENCES
1. WHO. A strategic framework for malaria prevention and control during pregnancy in
the African region. Geneva: World Health Organization, 2004: AFR/MAL.
2. Brabin, B. J. (1985). Epidemiology of infection in pregnancy. Review of infectious
Diseases, 7, 579-603.
3. The African summit on Roll Back Malaria, (TASRBM) Abuja, Nigeria, 25 April
2000. Geneva, World Health Organization, 2000 (document
WHO/CDS/RBM/2000.17
Page | 15
![Page 16: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/16.jpg)
4. Brabin, B. J. (1991). The Risk and Severity of Malaria in Pregnant Women. Applied
Field Research in Malaria Reports No. 1. Geneva: World Health Organization.
5. Steketee R. W., Nahlen B. L., Parise M. E., Menendez C. The burden of malaria in
pregnancy in malaria-endemic areas. Am J Trop Med Hyg 2001; 64 (suppl 1–2): 28–
35.
6. Schultz L. J., Steketee R. W., Macheso A., Kazembe P., Chitsulo L., Wirima J. J. The
efficacy of anti-malarial regimens containing Sulphadoxine-Pyrimethamine and/or
Chloroquine in preventing peripheral and placental Plasmodium falciparum infection
among pregnant women in Malawi. Am J Trop Med Hyg 1994; 51: 515–22.
7. Parise M. E., Ayisi J. G., Nahlen B. L., et al. Efficacy of Sulphadoxine-
Pyrimethamine for prevention of placental malaria in an area of Kenya with a high
prevalence of malaria and human immunodeficiency virus infection. Am J Trop Med
Hyg 1998; 59: 813–22.
8. Verhoeff F. H., Brabin B. J., Chimsuku L., Kazembe P., Russell W. B., Broadhead R.
L. An evaluation of the effects of intermittent Sulphadoxine-Pyrimethamine treatment
in pregnancy on parasite clearance and risk of low birth weight in rural Malawi. Ann
Trop Med Parasitol 1998; 92: 141–50.
9. Shulman C. E., Dorman E. K., Cutts F., et al. Intermittent sulphadoxine-
pyrimethamine to prevent severe anaemia secondary to malaria in pregnancy: a
randomised placebo-controlled trial. Lancet 1999; 353: 632–36.
10. White N. J. Intermittent presumptive treatment for malaria. PLoS Med 2005; 2: e3.
11. McCollum A. M., Poe A. C., Hamel M., et al. Antifolate resistance in Plasmodium
falciparum: multiple origins and identification of novel dhfr alleles. J Infect Dis 2006;
194: 189–97.
12. Hastings M. D., Bates S. J., Blackstone E. A., Monks S. M., Mutabingwa T. K.,
Sibley C. H. Highly pyrimethamine-resistant alleles of dihydrofolate reductase in
Page | 16
![Page 17: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/17.jpg)
isolates of Plasmodium falciparum from Tanzania. Trans R Soc Trop Med Hyg 2002;
96: 674–76.
13. Alker A. P., Mwapasa V., Purfield A., et al. Mutations associated with Sulphadoxine-
Pyrimethamine and chlorproguanil resistance in Plasmodium falciparum isolates from
Blantyre, Malawi. Antimicrob Agents Chemother 2005; 49: 3919–21.
14. Farnert A., Tengstam K., Palme I. B., et al. Polyclonal Plasmodium falciparum
malaria in travellers and selection of antifolate mutations after proguanil prophylaxis.
Am J Trop Med Hyg 2002; 66: 487–91.
15. Staedke S. G., Sendagire H., Lamola S., Kamya M. R., Dorsey G., Rosenthal P. J.
Relationship between age, molecular markers, and response to sulphadoxine-
pyrimethamine treatment in Kampala, Uganda. Trop Med Int Health 2004; 9: 624–29.
16. Kalanda G. C., Hill J., Verhoeff F. H., Brabin B. J. Comparative efficacy of
Chloroquine and Sulphadoxine-Pyrimethamine in pregnant women and children: a
meta-analysis. Trop Med Int Health 2006; 11: 569–77.
17. Tagbor H., Bruce J., Browne E., Randal A., Greenwood B., Chandramohan D.
Efficacy, safety, and tolerability of Amodiaquine and Sulphadoxine-Pyrimethamine
used alone or in combination for malaria treatment in pregnancy: a randomised trial.
Lancet 2006; 368: 1349–56.
18. Menendez C., Ordi J., Ismail M. R., et al. The impact of placental malaria on
gestational age and birth weight. J Infect Dis 2000; 181: 1740–45.
19. Garner P., Gulmezoglu A. M. Prevention versus treatment for malaria in pregnant
women. Cochrane Database Syst Rev 2000; 2: CD000169.
Page | 17
![Page 18: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/18.jpg)
20. Rogerson S. J., van den Broek N. R., Chaluluka E., Qongwane C., Mhango C. G.,
Molyneux M. E. Malaria and anaemia in antenatal women in Blantyre, Malawi: a
twelve-month survey. Am J Trop Med Hyg 2000; 62: 335–40.
21. Njagi J. K., Magnussen P., Estambale B., Ouma J., Mugo B. Prevention of anaemia in
pregnancy using insecticide-treated bed nets and Sulphadoxine-Pyrimethamine in a
highly malarious area of Kenya: a randomized controlled trial. Trans R Soc Trop Med
Hyg 2003; 97: 277–82.
22. Crawley J., Hill J., Yartey J., et al. From evidence to action? Challenges to policy
change and programme delivery for malaria in pregnancy. Lancet Infect Dis 2007; 7:
145–55.
23. Wongsrichanalai C., Pickard A. L., Wernsdorfer W. H., Meshnick S. R:
Epidemiology of drug resistant malaria. Lancet Infect Dis 2002, 2:209-218
24. Le Bras J., Durand R: The mechanisms of resistance to antimalarial drugs in
Plasmodium falciparum. Fundam Clin Pharmacol 2003, 17:147-53
Consent form (C1) for pregnancy associated malaria
Information: (To be read or translated to participants/volunteers in their own mother tongue)
Dear Sir/Madam,
We kindly ask your permission to participate in a study, which we will proceed to
describe.
We would like to stress the fact that this study is strictly voluntary. Should you decide not to
participate, it would have no consequences for you. Should you at any point during the study
Page | 18
![Page 19: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/19.jpg)
decide that you do not wish to participate any further, you are free to terminate the
participation. Any such decision will be respected without any further discussion. All
information gathered would be strictly confidential. You can also decide not to answer any
question you don’t feel comfortable with.
Summary of the study
The risk of pregnancy-associated malaria is highest among women in their first pregnancy,
with lower incidence and severity in women who have given birth to many children. The
adverse consequences include low birth weight and premature births, as well as maternal and
infant anaemia. In order to prevent this the WHO recommends that pregnant women are
given SP as prophylaxis. This has since been implemented in Ghana. However studies from
other countries had indicated and increasing resistance of parasite to SP. It is thus important
to determine the status of these mutants here in Ghana.
We are in this community for the first time but in order to have a good data we require blood
samples from pregnant women living in this community. The blood samples would be used
to determine if the (SP) given to pregnant women is effective in preventing malaria during
pregnancy. We will do this by examining samples of blood.
The procedure and method of blood collection would be the normal routine protocol and not
experimental. About 4 millilitres of venous blood will be collected and about 50uL of blood
is blotted on a filter paper. You may feel a little pain as a result of the prick of the needle but
this is sure to end as soon as the blood is collected. The plasma will be used to measure
specific cells and immunoglobulin in your body that fight against malaria parasites while the
genetic material of the parasite will be extracted from the blood spotted filter paper. This
genetic material will be subjected to analysis so that we can understand the genomics of the
parasite. All samples would be properly stored and used periodically during the research
Page | 19
![Page 20: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/20.jpg)
(August 2009 – August 2010), after which any remnants would be appropriately disposed off.
Sterile techniques and disposable (single use) materials will be used at all times. If you have
any questions please feel free to ask any member of the team.
Yours sincerely
DR. JOHNSON N. BOAMPONG ( U. C. C.)
DR. ALEXANDER EGYIR-YAWSON ( GAEC)
DR. MICHEAL OFORI (NMIMR)
MR. EKENE K. NWAEFUNA (UCC)
CONSENT FORM (II) (FOR PARTICIPANTS)
I ................................................................................................have read/have had the study explained to me in English/Twi/Fante and have been given the opportunity to discuss it and to ask questions, and any question I have asked has been answered to my satisfaction. I hereby consent voluntarily to take part in the study and I understand that I have the right to withdraw from the study anytime without affecting my further medical care.
.......................................................... ..................................
Signature/Thumbprint of volunteer Date
............................................................ .................................
Signature of Principal Investigator Date
Page | 20
![Page 21: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/21.jpg)
For further information please contact any of the following people:
Dr. Johnson Boampong ( U. C. C.) Tel: 0208154078
Dr. Alexander Egyir-Yawson (GAEC) Tel: 0242966341
Mr. Ekene Nwaefuna (UCC) Tel: 0245698616
……………………………………………………………………………………………………………………………………………………………
CONSENT FORM (II) (FOR PARTICIPANTS)
I ................................................................................................have read/have had the study explained to me in English/Twi/Fante and have been given the opportunity to discuss it and to ask questions, and any question IS have asked has been answered to my satisfaction. I hereby consent voluntarily to take part in the study and I understand that I have the right to withdraw from the study anytime without affecting my further medical care.
.......................................................... ..................................
Signature/Thumbprint of volunteer Date
............................................................ .................................
Signature of Principal Investigator Date
For further information please contact any of the following people:
Dr. Johnson Boampong ( U. C. C.) Tel: 0208154078
Dr. Alexander Egyir-Yawson (GAEC) Tel: 0242966341
Mr. Ekene Nwaefuna (UCC) Tel: 0245698616
CONSENT FORM III(FOR PARTICIPANT’S PARENT/REPRESENTATIVE)
On behalf of .................................................., I.......................................................... have read or have had the study explained to me in my local language. I have also been given the opportunity to discuss it and to ask questions and all my questions have been answered satisfactorily. I hereby voluntarily give my consent for ...................................................... to take part in the study as a subject and I understand that I have the right to withdraw him/her from the study at any time without any consequences to me or him/her.
Relationship of representative to participant .............................................................................
.............................................................. ........................................Signature/Thumbprint of Participant’s representative Date
............................................................. ........................................Signature of Principal Investigator Date
Page | 21
![Page 22: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/22.jpg)
For further information please contact anyone of the following peopleDr. Johnson Nyarko Boampong (UCC) 020 -8154078Dr. Alex Egyir Yawson (GAEC) 024 -2966341Mr. Ekene Nwaefuna (UCC) 024 -5698616
CONSENT FORM III(FOR PARTICIPANT’S PARENT/REPRESENTATIVE)
On behalf of .................................................., I.......................................................... have read or have had the study explained to me in my local language. I have also been given the opportunity to discuss it and to ask questions and all my questions have been answered satisfactorily. I hereby voluntarily give my consent for ...................................................... to take part in the study as a subject and I understand that I have the right to withdraw him/her from the study at any time without any consequences to me or him/her.
Relationship of representative to participant .............................................................................
.............................................................. ........................................Signature/Thumbprint of Participant’s representative Date
............................................................. ........................................Signature of Principal Investigator Date
For further information please contact anyone of the following peopleDr. Johnson Nyarko Boampong (UCC) 020 -8154078Dr. Alex Egyir Yawson (GAEC) 024 -2966341Mr. Ekene Nwaefuna (UCC) 024 -5698616
SP STUDY QUESTIONNAIRE
FACILITY……………………………………………………………………………….
CODE…..…..…………..SOCIO-DEMOGRAPHICS
1. Folder No.:…………………..
2. Age:………………………..
3. Occupation :
(Trader) (Farmer) (Para – profession) (White collar) Other, Specify………………
4. Level of Education:
(Basic) (JSS) (SSS) (Tertiary) Other, specify………………………………………
Page | 22
![Page 23: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/23.jpg)
5. Area of Residence:……………………………………………………………………..
6. Ethnic Origin:…………………………………………………………………………...
7. Occupation of Husband:
(Trader) (Farmer) (Para – profession) (White collar) Other, specify…,,,,………….
GENERAL EXCLUSION CRITERIA
8. No. of visits to antenatal clinic {1} {2} {more}
9. Age of present pregnancy…………………………………………………………..…
10. No. of present pregnancy……………………………………………………...………
11. No. of Deliveries………………………………………………………………...……
12. No. of Children………………………………………………………………………..
13. No. of Abortions……………………………………………………………………...……….
14. History of Blood Transfusion…………………………………………………………..
15. Any recent severe bleeding………………………………………..……………………
16. Any hospital admission during pregnancy……………………………………………..
17. Any history of fever within 2 weeks…{yes} {no} Body temperature ………..
18. If yes, specify condition……………………………………………….………………
19. Use of mosquito net ……………………………………………………………………
20. Use of mosquito coils…………………………………………………………………
21. Use of repellants……………………………………………………………………….
22. Use of insecticides………….………………………………………………………….
NUTRITIONAL HISTORY
23. How many times do you eat in a day…………………………………………………
24. what kind of food…………………………………………………………..………….
25. Do you have any food type you forbid eating during pregnancy……….………………
26. Have you had any episode of vomiting in this pregnancy…………………………….
DRUG HISTORY
Page | 23
![Page 24: Research Proposal](https://reader035.vdocuments.mx/reader035/viewer/2022081413/5470ebe2b4af9fa12e8b458f/html5/thumbnails/24.jpg)
27. Have you taken SP……………………………………………………………………
28. How many times………………………………………………………...………………
29. History of dewormer taken……………………………………………………………
30. Do you take herbal mixtures……………………………………..……………………..
31. Are you on any drug? yes no
Specify……………………………………………………………………..…………….
LAB USE ONLY
MPs:…………………………………………………………………………………………
PARASITE DENSITY:……………………………PARASITEAMIA………………………
HB:…………………………………………………………………………………………….
G6PD:…………………………………………………………………………………………
SICKLING:…………………………… ELECTROPHORESIS:……………………………
BLOOD GROUP:…………………………………RH. FACTOR……………………………
Page | 24