research article open access development of selectable ...€¦ · most commonly used bio-control...

Bala et al. BMC Biotechnology 2013, 13:88http://www.biomedcentral.com/1472-6750/13/88

RESEARCH ARTICLE Open Access

Development of selectable marker free, insectresistant, transgenic mustard (Brassica juncea)plants using Cre/lox mediated recombinationArpita Bala1, Amit Roy1†, Ayan Das1†, Dipankar Chakraborti2 and Sampa Das1*

Abstract

Background: Antibiotic/ herbicide resistant marker genes have been proven to be very useful in planttransformation for the initial selection of desired transgenic events. However, presence of these genes in thegenetically modified crops may render the crop less acceptable to the consumers. Among several differentapproaches, the effectiveness of Cre/lox mediated recombination strategy for selectable marker gene (SMG)elimination has previously been demonstrated by different groups in several plants including Brassica. In thepresent study exploiting Cre/lox mediated recombination strategy, attempt has been made for selectable markergene elimination from Allium sativum leaf agglutinin (ASAL) expressing Brassica plants with hemipteran insectresistant phenotype.

Results: Allium sativum leaf agglutinin (ASAL) linked with lox flanked hygromycin resistant (hpt) gene wasintroduced in mustard. Cre recombinase gene cassette was also integrated in separate event. A Cre/lox mediatedrecombination using crossing strategy was adopted to remove the hpt gene from the subsequent generation ofselected hybrid events. Reciprocal crosses were made between T1 ASAL-lox-hpt-lox and cre-bar plants. Marker geneelimination was confirmed in the resulting F1 hybrid progenies by PCR analysis, using hpt, cre and ASAL specificprimers followed by Southern hybridization. In marker free plants, expression of ASAL was also confirmed bywestern blotting and ELISA analysis. Retention of functionality of expressed ASAL was investigated by agglutinationassay using rabbit erythrocytes. Expressed ASAL was also found to be thermo-sensitive. In planta insect bioassay onF1 hybrid progenies exhibited detrimental effect on the performance of devastating target pest, Lipaphis erysimi.The F1 hybrid hpt negative, ASAL positive plants were allowed to self- fertilize to obtain F2 progeny plants. In someof these plants cre gene was found to be segregated out of the ASAL gene by genetic segregation yieldingcompletely marker free plants.

Conclusions: The present study establishes the efficient expression of the newly introduced insect resistant ASALgene even after Cre/lox mediated recombination resulting in elimination of selectable marker gene.

Keywords: Agglutination, Allium sativum leaf agglutinin (ASAL), Cre/lox recombination, Lipaphis erysimi, Selectablemarker gene (SMG)

* Correspondence: [email protected]†Equal contributors1Division of Plant Biology, Bose Institute, P1/12, C. I. T Scheme VIIM, Kolkata700054, WB, IndiaFull list of author information is available at the end of the article

© 2013 Bala et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.

mailto:[email protected]

http://creativecommons.org/licenses/by/2.0

Bala et al. BMC Biotechnology 2013, 13:88 of 11http://www.biomedcentral.com/1472-6750/13/88

BackgroundGenetic transformation of Brassica juncea (Indian mus-tard) has been an important area of research since thecrop is one of the most important sources of edible oiland accounts for 12% of the total edible oil throughoutthe world. B. juncea is widely cultivated in many parts ofthe world. Unfortunately, mustard cultivation is seriouslyaffected by sap sucking hemipteran pest- Lipaphis erysimi(mustard aphid). Infestation of the pest at the time offlowering and silique formation causes significant yieldloss [1]. The nutritional constituents (lipid, carbohydrate,nitrogen and protein level) of mustard plant at differentgrowth stages are also reduced due to the aphid attack [2].In India aphid causes 10– 90% yield loss of mustard de-pending upon the severity of infestation and stage of theplant at which aphid attacks [3]. In addition to the nutri-ent loss of plants, aphids also transmit pathogenic viruseswhich contributes to additional yield loss [4,5].Application of chemical insecticides for controlling

these insects leads to evolution of resistant biotypes. Themost commonly used bio-control agent Bt (Bacillusthuringiensis) toxin is useful for chewing insects such aslepidopteran and coleopterans but it is ineffective againsthemipteran group of sucking insect pests [6]. Severalother proteins including α- amylase inhibitor, ribosome–inactivating proteins, enzyme inhibitors, arcelins, chiti-nases, ureases, modified storage proteins and lectinshave been reported to be involved in plant defenceagainst various insects. Among these, plant lectins havebeen found to be potent insecticidal agents which play acrucial role in managing several important pests [7-10].Previous reports from this group demonstrated that ahomodimeric mannose binding Allium sativum leaf ag-glutinin (ASAL) exhibits insecticidal activity against sapsucking hemipterans namely, mustard aphid, rice brownplanthopper, green leafhopper and chickpea aphid. Con-sequently, transgenic expression of ASAL had been ac-complished in mustard, rice, and chickpea [11-13].Generally, in the process of development of transgenic

plants, selectable marker genes (SMGs) are utilised to se-lect transgenic events. SMGs are generally conditionallydominant genes which code for enzymes capable of inacti-vating different toxic agents such as antibiotics, herbicides[14]. In recent days, public concern has developed regard-ing the indiscriminate introduction of SMGs in naturalecosystem [15]. Antibiotic or herbicide resistant genesmay have chances to be transferred by outcrossing intoweeds or rarely, through horizontal gene transfer to otherorganisms [16-20]. Additionally, continuous expression ofthe markers may interfere with normal plant growth anddevelopment [21]. Thus, it is desirable to eliminate theSMG after establishment of transgenic plant [17,22,23].Development of herbicide or antibiotic resistant

marker gene free transgenic plants could ease release

and commercialization of transgenic crop [24]. In the lastfew years several strategies have been employed for re-moval of selectable markers [20,23,24] including co-transformation [25,26] transposon mediated repositioningof the gene of interest [27,28], exploitation of multi- auto-transformation system [29] and site – specific recombin-ation system [30-33]. Among several strategies, Cre/lox Pinduced site- specific recombination strategy observed inbacteriophage P1 has been widely used for recombinationmediated elimination of the SMGs [30,31,33-37]. The38 kDa Cre recombinase specifically recognizes and in-duces precise excision of DNA fragment between two dir-ectly repeated asymmetric 34 bp lox P sites [35,38,39].In the present study, Cre/lox mediated recombination

system has been used to produce marker gene free ASALexpressing transgenic insect resistant mustard plants. Tocarry out this study, initially two types of transgenic lineswere generated using two independent vectors, one havingthe antibiotic resistant hpt gene flanked by two lox P sitesand ASAL gene under the control of CaMV 35S promoterand another vector with cre recombinase gene cassettealong with the herbicide resistant gene bar. These T1

plants were reciprocally crossed. A substantial number ofhybrid plants exhibited loss of hpt gene due to Cre/lox re-combination, and were analysed for resistance against thetarget insect Lipaphis erysimi. These plants were allowedto self-fertilize to obtain F2 plants. Elimination of the cregene (and of the associated selectable marker-bar) was ac-complished by genetic segregation, thus obtaining com-pletely marker-free mustard plants expressing ASAL.

MethodsPlant materialBrassica juncea cv. B-85 seeds were obtained fromBerhampur Pulse Research Station, West Bengal, Indiaand used for plant transformation.

Plant transformation vectorDetails of construction of the vector pBKhgASAL (~ 7.0 kb)(Figure 1A) was reported earlier by the present group [33],which contains ASAL gene under the control of CaMV35S promoter and nos terminator within HindIII/ EcoRIsite plus the hygromycin resistance gene (hpt) cassetteflanked by lox sites. The 1.1 kb cre coding sequence wascloned into the multiple cloning site of pCAMBIA3300along with herbicide resistant marker bar and named aspBK16.2 (~10.6 kb) (Figure 1B). The details of this cloningwere previously reported by Chakraborti et al. [30]. Allthese vectors were mobilized into the AGL-1 strain ofAgrobacterium tumefaciens.

Mustard transformationA. tumefaciens mediated transformation and regenerationof mustard were performed according to the method

Figure 1 Schematic representation of the T-DNA region of binary vectors used for mustard transformations. A pBKhgASAL showing ASALgene under CaMV35S promoter and hpt gene cassette flanked by two lox sequences. B pBK16.2 showing the cre gene under CaMV35S promoter,also containing bar gene as selection marker; the respective restriction endonuclease sites are indicated. A1/B1, A2/B2 and A3/B3 indicate theprimer sequences for ASAL, cre and hpt genes, respectively. 5′→ 3′: orientation of lox sequences. LB: T-DNA left border; RB: T-DNA right border.


described by Mehra et al. [40] with some modifications[11]. Selection media containing either 30 mg/l hygro-mycin or 5 mg/l bialaphos were used to select calli andshoots transformed by pBKhgASAL or pBK16.2. Afterroot induction the plants were transferred to soil in glasshouse at 25°C under a 16/8 h light/dark photoperiod re-gime. Identical regeneration steps were also carried outwithout infecting explants with A. tumefaciens. These ex-plants were grown in the absence of antibiotics and usedas control plants.

Screening of transgenic plants by PCRThe analysis of T0, T1, F1 hybrid and F2 plants were car-ried out with the DNA extracted from mature leaf tissueof putative transformed plants as well as control plants[41]. Polymerase Chain Reactions (PCR) were performedin all lines using ASAL, hpt and cre specific forward andreverse primers (Table 1). Multiplex PCR was performedin F1 hybrid and F2 plants using Qiagen Multiplex PCRkit (GmbH, Hilden, Germany). Each 50 μl PCR reactionmixture contained 1x PCR master mix including HotStart Taq DNA polymerase. Primers were used in0.2 μM concentration. The reaction started with incuba-tion for 15 min at 94°C followed by 35 cycles of 30s at94°C, 90 s at 58°C, 90 s at 72°C and final extension with

Table 1 Sets of forward and reverse primers used in the expe

Primers Sequences

A1 (ASAL forward) 5′ATGGCCAGGAACCTACTGACGA 3′

B1 (ASAL reverse) 5′CTATCTTCTCTAGGTACCAGTA 3′

A2 (cre forward) 5′ ATGTCCAATTTACTGACC 3′

B2 (cre reverse) 5′ CTAATCGCCATCTTCCAGC 3′

A3 (hpt forward) 5′ GCTTTCCACTATCGGCGA 3′

B3 (hpt reverse) 5′ AAAGCCTGAACTCACCGC 3′

10 min at 72°C in My Cycler (Bio Rad, Hercules, CA,USA). In all PCR experiments pBKhgASAL plasmid wastaken as positive control for ASAL, hpt genes andpBK16.2 plasmid was taken as positive control for cregene. The amplification products of ASAL, cre and hptgenes were checked in 0.8% agarose gel.

Crossing of T1 transgenic linesT0 plants were self pollinated to obtain T1 seeds. FourT1 [ASAL-lox-hpt-lox] lines were crossed with four T1

[cre-bar] lines reciprocally. Eight independent crosses oftransgenic plants were performed. F1 hybrid seeds wereharvested, surface- sterilized and germinated on halfstrength MS basal medium in the dark at 25°C. Germi-nated seedlings were transferred to greenhouse andmaintained for further analysis.

Southern blot analysisTotal genomic DNA was extracted from the mature leavesof one month old control and transgenic plants of T0

(both ASAL and cre plant types) and F1 hybrid lines. TheSouthern blot hybridization was carried out according toSambrook et al. [42] with modifications [11]. A total of10 μg of genomic DNA per line was digested with HindIII(Roche, Mannheim, Germany) followed by separation in

riments

Annealing temperature (°C) Amplicon size (bp)

56 362

58 1100

58 980


0.8% (w/v) agarose gel. The gels were blotted ontopositively charged nylon membranes (Hybond-N+;Amersham™ Biosciences, Buckinghamshire, UK). InSouthern blot experiment the following probes wereused: 362 bp amplicon from the ASAL gene prepared byusing primer pairs A1 and B1; 1.1 kb amplicon from thecre gene produced by using primer pairs A2 and B2;980 bp amplicon from the hpt gene generated by usingprimer pairs A3 and B3 (Table 1). Each probe was radiolabeled with [α-32P] dCTP separately using RediprimeII™ Random Prime Labeling System, (Amersham™ Bio-sciences, Buckinghamshire, UK). After hybridizationfollowed by extensive washing the membranes were ex-posed to Kodak X-ray film for seven days at −80°C andfinally developed.

Western blottingTotal soluble protein from the leaves of one month oldcontrol and transgenic plants were extracted as de-scribed by Dutta et al. [11] and quantified. Garlic leaflectin (ASAL, 1 μg) purified from fresh garlic leaves [43]was used as positive control. Western blotting wasperformed with 10 μg of total soluble protein of four T0

ASAL positive lines and nine F1 hybrid lines using themethod as reported earlier [11].

ELISAELISA was done as per the method described by Duttaet al. [11]. Microtiter (Immunomaxi, Switzerland) wellswere coated with 50 μg of crude protein extracted fromthe leaves of F1 hybrid plants or purified native ASALserially diluted from 5 μg to 500 ng overnight at 4°Cin coating buffer. After addition of substrate O-phenylenediaminehydrochloride (OPD, Gibco BRL,Gaithersburg, MD) dissolved in citrate buffer colourreaction was developed and the reading of the microti-ter plate was recorded at 415 nm in a microtiter platereader (Biorad).

Hemagglutination and thermal stability assayThe hemagglutination assay was carried out with the totalsoluble protein extracted from the F1 hybrid lines con-taining ASAL gene. Blood was collected from the rabbit bya syringe pre- filled with 500 μl 0.9% NaCl solution andimmediately transferred to a culture tube pre- filled with0.9% saline [44] and subsequently dispensed into the wellsof the plate. Hemagglutination activity of expressed ASALin selected F1 hybrid lines was assayed in a 96-well mic-rotiter U-plate. Protein was dispensed to each well at a2-fold serial dilution starting from 250 μg to 15.6 μg/ well.The U-plate was kept for 1 hour at 37°C and then hemag-glutination was assessed visually.The stability of the protein was assessed by its ability

to agglutinate rabbit erythrocytes upon incubation at

different temperatures [45]. Rabbit blood was diluted in0.9% NaCl to a final concentration of 5% erythrocytes(v/v). The amount of total soluble protein from each ofthe selected ASAL expressing plant lines causing comp-lete agglutination of rabbit erythrocytes was measuredprior to assessing the stability of expressed ASAL. Thus,125 μg of the total soluble protein from all the selectedASAL expressing F1 hybrid plants were dissolved inphosphate buffered saline (PBS) and incubated separ-ately at 4, 25, 37, 55, 75 and 95°C for 30 mins. Upon in-cubation, each sample was subjected to rapid cooling onice and agglutination activity was monitored.

In planta insect bioassayF1 hybrid plants bearing ASAL gene and control plantswere subjected to bioassay with nymphs of L. erysimi.Cages with one end open were used for insect bioassay.About twenty nymphs of L. erysimi of 3rd instar stagewere collected from the culture stock and transferred ontothe leaf surface of the plants which were already placed inthe glass cages. The open end of the cage was sealed withadhesive tape. Three such cages were used per individualtransgenic and control plant. Three replications wereperformed for each individual line. The survival of insectswithin the cages was monitored at an interval of every24 hrs for 9 days. The mean data per plant was expressedas the percentage of the total aphids surviving on the re-spective days. Effect of ASAL on fecundity of the insectwas monitored by counting the total number of nymphsproduced per individual transgenic plants at the end ofthe bioassay period. ANOVA followed by Duncun’s mul-tiple range tests were conducted to compare the signifi-cance of differences among all the transgenic and controlplants for the insect bioassay experiment.

ResultsDevelopment of ASAL and cre linesSouthern blot analysis was carried out to check success-ful integration of transgene in putatively transformed T0

ASAL-lox-hpt-lox and cre - bar containing plants devel-oped by Agrobacterium mediated transformation. Plantno. LA, LB, LD, LF showed single copy insertion ofASAL gene, LC was a double copy insertion event andLE was found to be Southern negative (Figure 2A). Incase of cre plants, plant no. CA, CC, CD, CE were singlecopy insertion events and CB was found to be Southernnegative (Figure 2B). Single copy insertion lines of ASALand cre were used for further analysis. Expression ofASAL was also confirmed by western blotting in the sin-gle copy ASAL insertion lines (Figure 2C). Eight recipro-cal crosses were made between four T1 ASAL positiveplants of ASAL-lox-hpt-lox lines: LA2, LB9, LD3, LF5and four T1 cre positive plants of cre-bar lines: CA2,CC3, CD1, CE5 (Table 2).

Figure 2 Molecular analysis of gene integration and expression in T0 lines. A Southern blot analysis of genomic DNA from leaves ofputative T0 ASAL- lox- hpt - lox plants probed with [α-32P] dCTP labeled ASAL. Lane 1, 362 bp ASAL coding sequence was used as positive control;lane 2, untransformed genomic DNA as negative control; lanes 3–8, HindIII digested genomic DNA from six ASAL plants LA, LB, LC, LD, LE, LF. BSouthern blot analysis of genomic DNA from leaves of putative T0 cre-bar plants probed with [α-32P] dCTP labeled cre. Lane 9, 1.1 kb cre codingsequence as positive control; lane 10, untransformed genomic DNA as negative control; lanes 11–15, HindIII digested genomic DNA from five creplants CA, CB, CC, CD, CE. Approximate molecular weight markers are indicated in the middle. C Western blots analysis of protein from four T0Southern positive ASAL-lox-hpt-lox mustard plants. ~ 1 μg purified native ASAL used as positive control (lane 1) and crude protein fromuntransformed plant used as negative control (lane 2). Lane 3 – 6 crude protein from four transgenic mustard plants LA, LB, LD, and LF.


Molecular analysis of gene excisionFrom the eight independent crossing events, seeds werecollected separately and multiplex PCR was performed toscreen out the hybrid plants. The results of hybrid lineLA2CC3 is shown here (Figure 3A). Thirty seeds were ran-domly chosen from hybrid line LA2CC3 (Table 2). Multi-plex PCR was performed with ASAL and cre gene specificprimers (Table 1). Among the 30 progeny plants, 16 plantswere found to be positive for both ASAL gene and cregene; 8 for only ASAL gene, 4 plants only for cre gene and2 plants were azygous for both the genes (Figure 3A). Themarker gene excision among the 16 ASAL and cre positivehybrid plants of LA2CC3 2, 3, 6, 7, 9, 12, 13, 14, 16, 18, 21,23, 24, 27, 28, 29 were further verified through PCR(Figure 3B) using hpt gene specific primers. This amplifi-cation identified nine hpt negative plants where cre did

Table 2 Crosses between ASAL and cre lines and estimation o

Crossno.

T1 parent T1 parent Hybridline ID

Topl

♂ ♀

1 LA2 CC3 LA2CC3

2 LB9 CD1 LB9CD1

3 LD3 CA2 LD3CA2

4 LF5 CE5 LF5CE5

5 CA2 LD3 CA2LD3

6 CC3 LA2 CC3LA2

7 CD1 LB9 CD1LB9

8 CE5 LF5 CE5LF5

work efficiently; as a result excision of hpt took placethrough recombination event. Following nine plants:LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27 were found to be hptnegative. Thus, the Cre/lox mediated recombination fre-quency was determined to be 56.25% in case of hybrid lineLA2CC3. The nine hybrid plants were further verifiedthrough Southern blotting experiments using three differ-ent probes for ASAL, cre and hpt (Figure 4A,B,C) whichclearly showed the absence of hpt gene (Figure 4C) but thepresence of ASAL and cre genes (Figure 4A,B) in thosenine hybrid plants. Recombination frequency in anotherseven hybrid lines varied between 22.2 - 50%.

Expression of ASAL in F1 hybrid linesNine hpt negative LA2CC3 F1 hybrid progeny plantswere analyzed to monitor the expression of ASAL.

f the frequency of cre-mediated excision

talants

ASAL andcre positive

plants

hptnegativeplants

Recombinationfrequency (% )

30 16 9 56.25

35 18 9 50

25 15 7 46.67

30 17 5 29.41

40 22 10 45.5

25 16 6 37.5

30 18 4 22.2

40 21 6 28.5

Figure 3 Molecular analysis of marker gene excision. A Multiplex PCR analysis of F1 hybrid line LA2CC3. Lane ‘+’, mix of pBKhgASAL andpBK16.2 plasmids as positive control; lane ‘- ’ genomic DNA of an untransformed plant. Lanes 1–30, 30 F1 hybrid progenies of line LA2CC3. The362 bp and 1.1 kb amplicon derives from the ASAL and cre genes respectively and B PCR with hpt specific primers of 16 ASAL + cre + plants of F1hybrid line LA2CC3. Lanes 1–16, F1 hybrid plants, where plant no. 3, 6, 9, 12, 14, 18, 23, 24 and 27 showed absence of hpt. Lane ‘ + ‘, pBKhgASAL ;lane ‘ – ‘, genomic DNA of an untransformed plant. The 980 bp amplicon derives from the hpt gene. Lane M in A and B, DNA molecular weightmarker (GenerulerTM, MBI Fermentas, UK).


Western blot of total soluble protein extracted from30 days old plants’ leaves of those nine lines showedidentical signals at ~12 kDa region (Figure 5A), corre-sponding to the purified native ASAL protein whenprobed with anti- ASAL antibody. In control plants nosuch band was observed. ELISA was performed to quan-tify the level of expressed ASAL in the selected plants.These nine plants showed level of expression of ASALin the range of 0.2% to 0.48% of the total soluble protein(Figure 5B).

Agglutination and thermal stability assayThe hemagglutination assay was performed with theextracted total soluble protein from five F1 hybrid ASALpositive plants [LA2CC3 3, 9, 14, 18, 23]. A tight buttonof rabbit erythrocytes was formed indicating negative re-action in well no. 1 – no protein control and well no. 2 -containing protein samples of untransformed plants inpanel I-V. Five F1 hybrid lines exhibited agglutination ofRBCs resulting in the formation of a layer over the wells(well no. 3–7; panel I-V) of the microtiter plate

Figure 4 Southern blot analysis of HindIII digested genomic DNA fromhybridized with probe for A 362 bp ASAL sequence B 1.1 kb cre sequenceASAL gene, B PCR amplified cre gene, C PCR amplified hpt gene as positivecontrol plants as negative control. Approximate molecular weight markers

(Figure 6A). This result confirmed the retention of ag-glutination property in the transgenically expressedASAL protein.Thermal stability assay was conducted by monitoring

the agglutination characteristics of ASAL, extracted fromthe above mentioned five F1 hybrid plants. ASAL lost itsagglutination activity when treated at 55-75°C (wells 5–6;panel I-V; Figure 6B).

In planta insect bioassayIn order to investigate the effect of ASAL on survivabilityof L. erysimi, in planta insect bioassay was carried out inbioassay cages (Figure 7A,B) over 9 days time period usingfive ASAL expressing hpt negative F1 hybrid plants ofLA2CC3 line. The survival of aphid was monitored withthird instar nymphs at an interval of 24 h. It was observedthat survival of the nymphs declined from 20 ± 0 (mean ±SE) to 13 ± 0.58 (65%) per control plant over the assayperiod, but the decline of mustard aphid on the ASAL ex-pressing five progenies of LA2CC3 hybrid plant line variedfrom 6 ± 0.57 (30%) to 7 ± 0.57 (35%) at the end of the

nine hpt negative F1 hybrid lines. DNA from Gel blots wereand C 980 bp hpt sequences. Lane ‘+’ represents in A PCR amplifiedcontrol, lane ‘ – ‘ represents HindIII digested genomic DNA fromare indicated.

Figure 5 Expression of ASAL in F1 hybrid plants. A Western blot analysis of protein extracts from leaves of nine hpt –ve F1 hybrid mustardplants. Lane 1, ~ 1 μg purified native ASAL used as positive control; lane 2, crude protein from untransformed plant used as negative control;lanes 3 – 11, show crude protein of LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27. B ELISA analysis for expression of ASAL in total soluble protein of thosementioned F1 hybrid lines respectively.


bioassay period (Figure 7C). The mean number of surviv-ing Lipaphis on control and transgenic plants were foundto be statistically significant (P < 0.05) after 3rd day. It wasobserved that after 9 days of the experiment the ASAL ex-pressing line no. LA2CC3 (9), LA2CC3 (18), and LA2CC3(23) showed maximum decrease in insect survivability.The effect of ASAL on fecundity was determined by

Figure 6 Agglutination and thermal stability assay of expressed ASALwith: Panel I-V; Wells 3 to 7: total soluble protein extracted from ASAL exprtwofold serial dilution started from 250 μg to 15.6 μg/ well; Panel I-V; Wellcontrol plant. B Thermal Stability Assay: Rabbit erythrocytes incubated with[LA2CC3 3, 9, 14, 18, 23 in panel I-V respectively] pre-incubated at differentwells 2–7 respectively. Well 1 (I-V): No protein control (100 μl of 1.5% rabbi

counting the total nymphs produced by the adult insectson transformed and control plants at the end of the bio-assay period. The nymph started developing into non-feeding alate form after 4 days of the initiation of bioassayexperiment. The number of nymphs produced per plantwas reduced by approximately 41% – 59% compared tocontrol plants (Figure 7D).

protein from F1 hybrid plants. A Rabbit erythrocytes incubatedessing F1 hybrid plants namely LA2CC3 3, 9, 14, 18, 23 respectively in a1: No protein control. Panel I-V; Well 2: protein from untransformedtotal soluble protein (125 μg) from ASAL positive F1 hybrid plantstemperatures as- 4°C, 25°C, 37°C, 55°C, 75°C and 95°C in Panel I-V;t erythrocytes incubated without ASAL).

Figure 7 Insect bioassay setup and effect of expressed ASAL on Lipaphis erysimi. A, B In planta insect bioassay setup of Lipaphis erysimi ontransgenic mustard plants. Inset in A shows Lipaphis erysimi culture on control mustard plant. Bar represents 1 mm. C Graph shows thepercentage of survival of mustard aphid on untransformed control plant and five ASAL expressing F1 hybrid plants LA2CC3 3, 9, 14, 18, 23. D Bardiagram showing fecundity pattern (mean number of nymphs produced per plant) of L. erysimi fed on control and five F1 hybrid plants- LA2CC33, 9, 14, 18, 23.


Establishment of marker free F2 plantsSince the F1 hpt negative hybrid plants are cre positive, it isvery likely that they are also bar positive. Therefore, someof the F1 progeny plants were allowed to self- fertilize to ob-tain F2 plants and analyzed for complete marker removalmediated by genetic segregation. Ten F2 progeny plants of

Figure 8 PCR analysis of F2 progeny plants. Ten randomly chosen seedASAL and cre gene specific primer pairs. Lane 1–10 represents plant no. LApBK16.2 plasmids as positive control and lane ‘-’ represents negative controweight marker (GenerulerTM, MBI Fermentas, UK).

the hpt negative line LA2CC3 (3) were analyzed for thepresence of ASAL, hpt and cre genes. Three plants [F2 plantno. LA2CC3 (3) - 3, 6, 9] were found to contain only ASAL,one plant [no. LA2CC3 (3) – 8] showed the presence ofonly cre and six plants contained both ASAL and cre genes[no. LA2CC3 (3) – 1, 2, 4, 5, 7, 10] (Figure 8).

s from LA2CC3(3) line were analysed through multiplex PCR using2CC3(3) 1–10 respectively, lane ‘+’ represents mix of pBKhgASAL andl (genomic DNA of untransformed plant); lane M, DNA molecular


DiscussionThe elimination of the marker gene product is desirable inthe context of environmental safety [16,20,24,46,47]. Inview of this, Cre/loxP site specific recombination systemwas used in the present study for the development of anti-biotic resistant SMG free mustard lines with enhanced in-sect resistance property. The Cre/lox system has beentested for several plants including Arabidopsis thaliana[36], tobacco [30,48], maize [49] and rice [33,35,38] andfound to be highly effective.Cre/lox mediated marker gene elimination in Brassica

juncea was reported for the first time by Arumugam etal. [37] where they cross pollinated the plants after thedevelopment of two homozygous lines with two differentconstructs. Kopertekh et al. [31] has shown marker elim-ination phenomenon in Brassica napus using a binaryvector containing both cre and marker gene within thesame lox sites which was adopted earlier in Arabidopsis[36], maize [49] and tobacco [39].The average frequency of marker gene elimination in

the present study was 39.5% which was significantlyhigher than the recombination frequency of 26.0% and29.1% observed earlier by Hoa et al. [35] and Sreekalaet al. [38] respectively. The recombination frequencyobtained herein was also higher than the frequency of19.1% obtained by Chakraborti et al. [30] and 27.4% bySengupta et al. [33] in case of marker gene free transgeniclines of tobacco and rice, respectively. The efficiency of re-combination was also comparable to that reported in theFLP/frt hybrids of tobacco [50]. Incidentally, Arumugamet al. [37] got higher marker excision frequency of 53% byusing Cre/lox system in quiescent, differentiated somatictissues of F1 plants. Previous studies by Stuurman et al. intomato [51], Bar et al. in tobacco [50], Onouchi et al. inArabidopsis [52] and Sreekala et al. in rice [38] haveshown that recombination efficiency varied among andwithin crosses. The cause of such variation might be dueto chromosomal localization of the transgene or variationsin the Cre recombinase activity in different events. Toovercome this problem Bayley et al. [53] proposed to se-lect parents with strong expression of Cre recombinase.The sexual crossing between two different lines led to theprecise and complete elimination of the lox flanked mar-ker gene in the subsequent generation indicating the ad-vantage of the crossing strategy over others. In the presentstudy, the cre gene was found to be segregated out in F2progeny plants of hpt negative ASAL expressing lineLA2CC3(3) as it was observed in ASAL expressinghygromycin resistance marker gene free transgenic ricelines developed earlier by this group [33,54]. Finally, ASALpositive and both hpt and cre negative F2 mustard plantswere established.The transgenically expressed ASAL protein was found

to be stable up to 37°C, but loses its functionality when

heated at 55- 75°C which is comparable to the datashown by Mondal et al. [45] which eliminated all thepossibility of native ASAL protein to be an allergen.Extensive in planta insect bioassay was performed on

ASAL expressing marker gene free F1 hybrid plants withL. erysimi. Effect of ASAL on the mortality of mustardaphid was comparable to the results shown by Duttaet al. [11]. Insect mortality in the present ASAL express-ing transgenic plants was 70% which is comparable to89% observed by Dutta et al. [11] while in control plantsthe insect mortality was 35%. However, insect mortalityobserved in the present study was either comparable orhigher than most of the results of earlier work whereconstitutive expression of GNA led to mortality of BPHup to 48 -62% [55] and 45-50% [56] and in case of GLHup to 51-54% [56]. But Sengupta et al. [33] documentedinsect mortality in ASAL expressing rice plants as highas 72% in GLH and 71% in BPH bioassay. The level ofASAL expression observed in the transgenic mustardplants was fairly comparable to the data of Dutta et al.[11]. The level of ASAL expression was also correlatedwith the fecundity of the insects. The number of nymphsproduced per plant was reduced compared to controlplants. Usually L. erysimi propagates parthenogenetically,resulting in formation of huge population in a shortperiod of time. Thus, reduction in number of nymphsproduced due to the effect of ASAL is of considerablesignificance in controlling aphid infestation.

ConclusionsThe present study significantly establishes the efficient ex-pression of the insect resistant ASAL gene in transgenicBrassica juncea plants following Cre/lox mediated re-combination which resulted in the elimination of the select-able marker gene. This important achievement has a greatimpact on development of insect-resistant, environment-friendly mustard crop which could be important compo-nents of integrated pest management programme.

AbbreviationsANOVA: Analysis of variance; ASAL: Allium sativum leaf agglutinin;ELISA: Enzyme-linked immunosorbent assay; SMG: Selectable marker gene;PBS: Phosphate buffered saline; hpt: Hygromycin phosphotransferase.

Competing interestsThe authors declare that they have no competing interests.

Authors’ contributionsAB, AR and AD conceived the experiments: AB and AR performed westernblotting, hemagglutination and thermal stability assay. AB and AD carriedout Southern analysis, ELISA and in planta insect bioassay experiments. Allthe other experiments were done by AB. AB, AR, AD, DC and SD preparedthe manuscript. SD supervised the research. All authors have read andapproved the final manuscript.

AcknowledgementsThe authors are thankful to Department of Biotechnology, Government ofIndia for financial support. AR and AD are thankful to Council of Scientificand Industrial Research for providing fellowship. The technical assistance of


Mr. Arup Kumar Dey, Mr. Swarnava Das and Mr. Sudipta Basu are sincerelyacknowledged.

Author details1Division of Plant Biology, Bose Institute, P1/12, C. I. T Scheme VIIM, Kolkata700054, WB, India. 2Post Graduate Department of Biotechnology, St. Xavier’sCollege (Autonomous), 30 Park Street, Kolkata 700016, India.

Received: 16 July 2013 Accepted: 8 October 2013Published: 21 October 2013

References1. Amjad M, Islam N, Kakakhel SA: Turnip aphid Lipaphis erysimi Kalt.

(Homoptera: Aphididae) biology, intrinsic rate of increase and developmentthreshold temperature on oilseed Brassica. Pakistan J of Bio Sci 1999, 2:599–602.

2. Singh P, Sinhal VK: Effect of aphid infestation on the biochemicalconstituents of mustard (Brassica juncea) plant. J Phytology 2011, 3:28–33.

3. Rana JS: Performance of Lipaphis erysimi (Homoptera: Aphididae) on differentBrassica species in a tropical environment. J Pest Sci 2005, 78:155–160.

4. Sharma S, Gill CK: Comparative efficiency of Myzus persicae (Sulzer) andLipaphis erysimi (Kaltenbach) in transmitting radish mosaic virus. J Res2004, 41:239–245.

5. Dombrovsky A, Huet H, Chejanovsky N, Raccah B: Aphid transmission of apotyvirus depends on suitability of the helper component and the Nterminus of the coat protein. Arch Virol 2005, 150:287–298.

6. Rao KV, Rathore KS, Hodges TK, Fu X, Stoger E, Sudhakar S, Williams P,Christou P, Bharathi M, Brown DP, Powell KS, Spence J, Gatehouse A,Gatehouse JA: Expression of snpwdrop lectin (GNA) in transgenic plantsconfers resistance to rice brown plant hopper. Plant J 1998, 15:469–477.

7. Hilder VA, Powell KS, Gatehouse AMR, Gatehouse J, Gatehouse LN, Shi Y,Halminton W, Merryweather A, Newell CA, Timans JC: Expression ofsnowdrop lectin in transgenic tobacco plants results in added protectionagainst aphids. Transgenic Res 1995, 4:18–25.

8. Powell KS, Gatehouse AMR VAH, Gatehouse AJ: Antifeedant effects ofplant lectins and an enzyme on the adult stage of the rice brownplanthopper, Nilaparvata legens. Entomol Exp Appl 1995, 75:51–59.

9. Fitches E, Gatehouse AMR, Gatehouse JA: Effects of snowdrop lectin (GNA)delivered via artificial diet and transgenic plants on the development oftomato moth (Lacanobia oleracea) larvae in laboratory and glasshousetrials. J Insect Physiol 1997, 43:727–739.

10. Gatehouse A, Gatehouse J: Identifying proteins with insecticidal activity:use of encoding genes to produce insect resistant transgenic crops.Pestic Sci 1998, 52:165–175.

11. Dutta I, Majumder P, Saha P, Ray K, Das S: Constitutive and phloemspecific expression of Allium sativum leaf agglutinin (ASAL) to engineeraphid (Lipaphis erysimi) resistance in transgenic Indian mustard(Brassica juncea). Plant Sci 2005, 169:996–1007.

12. Saha P, Dasgupta I, Das S: A novel approach for developing resistance inrice against phloem limited viruses by antagonizing the phloem feedinghemipteran vectors. Plant Mol Biol 2006, 62:735–752.

13. Chakraborti D, Sarkar A, Mondal H, Das S: Tissue specific expression ofpotent insecticidal Allium sativum leaf agglutinn (ASAL) in importantpulse crop, chickpea (Cicer arietinum L.) to resist the phloem feedingAphis craccivora. Transgenic Res 2009, 18:529–544.

14. Aragao FJL, Brasileiro ACM: Positive, negative and marker-free strategiesfor transgenic plant selection. Braz J of Plant Physiol 2002, 14:1–10.

15. Daniell H: Molecular strategies for gene containment in transgenic crops.Nat Biotechnol 2002, 20:581–586.

16. Dale PJ, Clarke B, Fontes EMG: Potential for the environmental impact oftransgenic crops. Nat Biotechnol 2002, 20:567–574.

17. Puchta H: Marker-free transgenic plants. Plant Cell Tissue Org Cult 2003,74:123–134.

18. Warwick SI, Simard MJ, Légère A, Beckie HJ, Braun L, Zhu B, Mason P,Séguin-Swartz G, Stewart CN Jr: Hybridization between transgenic Brassicanapus L. and its wild relatives: Brassica rapa L., Raphanus raphanistrum L.,Sinapis arvensis L., and Erucastrum gallicum (Willd.) O.E. Schulz. Theor ApplGenet 2003, 107:528–539.

19. Londo JP, Bautista NS, Sagers CL, Lee EH, Watrud LS: Glyphosate driftpromotes changes in fitness and transgene gene flow in canola (Brassicanapus) and hybrids. Ann Bot 2010, 106:957–965.

20. Yau Y, Stewart Jr CN: Less is more: strategies to remove marker genesfrom transgenic plants. BMC Biotechnol 2013, 13:36.

21. Ebinuma H, Sugita K, Matsunaga E, Yamakado M: Selection of marker-freetransgenic plants using the iso-pentenyl transferase gene. Proc Natl AcadSci 1997, 94:2117–2121.

22. Ow DW: The right chemistry for marker gene removal? Nat Biotechnol2001, 19:115–116.

23. Darbani B, Eimanifar A, Stewart CN, Camargo WN: Methods to producemarker-free transgenic plants. Biotechnol J 2007, 2:83–90.

24. Tuteja N, Verma S, Sahoo RK, Raveendar S, Reddy IBL: Recent advances indevelopment of marker-free transgenic plants: regulation and biosafetyconcern. J Biosci 2012, 37:167–197.

25. Lu HJ, Zhou XR, Gong ZX, Upadhyaya NM: Generation of selectablemarker-free transgenic rice using double right-border (DRB) binaryvectors. Aust J Plant Physiol 2001, 28:241–248.

26. Sripriya R, Sangeetha M, Parameswari C, Veluthambi B, Veluthambi K:Improved Agrobacterium-mediated co-transformation and selectablemarker elimination in transgenic rice by using a high copy numberpBin19-derived binary vector. Plant Sci 2011, 180:766–774.

27. Cotsaftis O, Sallaud C, Breitler JC, Meynard D, Greco R, Pereira A, Guiderdoni E:Transposon-mediated generation of T-DNA and marker free rice plantsexpressing a Bt endotoxin gene. Mol Breed 2002, 10:165–180.

28. Charng YC, Li KT, Tai HK, Lin NS, Tu J: An inducible transposon system toterminate the function of a selectable marker in transgenic plants.Mol Breed 2008, 21:359–368.

29. Khan RS, Nakamura I, Mii M: Development of disease resistant marker-freetomato by R/RS site-specific recombination. Plant Cell Rep 2011, 30:1041–1053.

30. Chakraborti D, Sarkar A, Mondal H, Schuermann D, Hohn B, Sarman B, Das S:Cre/lox system to develop selectable marker free transgenic tobaccoplants conferring resistance against sap sucking homopteran insect.Plant Cell Rep 2008, 27:1623–1633.

31. Kopertekh L, Broer I, Schiemann J: Developmentally regulated site-specificmarker gene excision in transgenic B. napus plants. Plant Cell Rep 2009,28:1075–1083.

32. Li B, Li N, Duan X, Wei A, Yang A, Zhang J: Generation of marker-freetransgenic maize with improved salt tolerance using the FLP/FRTrecombination system. J Biotechnol 2010, 145:206–213.

33. Sengupta S, Chakraborti D, Mondal HA, Das S: Selectable antibioticresistance marker gene-free transgenic rice harbouring the garlic leaflectin gene exhibits resistance to sap-sucking planthoppers. Plant CellRep 2010, 29:261–271.

34. Ghosh K, Duyne GDV: Cre-loxP Biochemistry. Methods 2002, 28:374–383.35. Hoa TTC, Bong BB, Hug E, Hodge TK: Cre/lox site-specific recombination

controls the excision of a transgene from the rice genome. Theor ApplGenet 2002, 104:518–525.

36. Zuo J, Niu QW, Møller SG, Chua NH: Chemical-regulated, site-specific DNAexcision in transgenic plants. Nat Biotechnol 2001, 19:157–161.

37. Arumugam N, Gupta V, Jagannath A, Mukhopadhyay A, Pradhan A, Pental D: Apassage through in vitro culture leads to efficient production ofmarker-free transgenic plants in Brassica juncea using the Cre/loxPsystem. Transgenic Res 2007, 16:703–712.

38. Sreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z: Excision of selectablemarker in transgenic rice (Oryza sativa L.) using a chemically regulatedCre/loxP system. Plant Cell Rep 2005, 24:86–94.

39. Wang Y, Chen B, Hu Y, Li J, Lin Z: Inducible excision of selectable markergene from transgenic plants by the Cre/lox site-specific recombinationsystem. Transgenic Res 2005, 14:605–614.

40. Mehra S, Pareek A, Bandyopadhyay P, Sharma P, Burma PK, Pental D:Development of transgenics in Indian oilseed mustard (Brassicajuncea) resistant to herbicide phosphinothricin. Curr Sci 2000,78:1358–1364.

41. Dellaporta SJ, Wood J, Hicks JB: A Plant DNA minipreparation: version II.Plant Mol Biol Rep 1983, 4:19–21.

42. Sambrook J, Fritsch E, Maniatis T: Molecular clonning: a laboratory manual,2nd edn. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989.

43. Bandyopadhyay S, Roy A, Das S: Binding of garlic (Allium sativum) leaflectin to the gut receptors of homopteran pests is correlated to itsinsecticidal activity. Plant Sci 2001, 161:1025–1033.

44. Banerjee N, Sengupta S, Roy A, Ghosh P, Das K, Das S: Functional alterationof a dimeric insecticidal lectin to a monomeric antifungal proteincorrelated to its oligomeric status. Plos One 2011, 6:18593.


45. Mondal HA, Chakraborti D, Majumder P, Roy P, Roy A, Bhattacharya SG, Das S:Allergenicity assessment of Allium sativum leaf agglutinin, a potentialcandidate protein for developing sap sucking insect resistant food crops.Plos One 2011, 6:e27716.

46. Bryant J, Leather S: Removal of selectable marker genes from transgenicplants: needless sophistication or social necessity. Trends Biotechnol 1992,10:274–275.

47. Gressel J: Indiscriminate use of selectable markers - sowing wild oats?Trends Biotechnol 1992, 10:382.

48. Gleave AP, Mitra DS, Mudge SR, Morris BA: Selectable marker-freetransgenic plants without sexual crossing: transient expression of crerecombinase and use of a conditional lethal dominant gene. Plant MolBiol 1999, 40:223–235.

49. Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L:Cre/lox-mediated marker gene excision in transgenic maize (Zea mays L.)plants. Theor Appl Genet 2003, 107:1157–1168.

50. Bar M, Lesham B, Gilboa N, Gidoni D: Visual characterization ofrecombination at FRT-gusA loci in transgenic tobacco mediated byconstitutive expression of the native FLP recombinase. Theor Appl Genet1996, 43:407–413.

51. Stuurman J, de Vroomen MJ, Nijkamp HJJ, M.J.J H: Single-site manipulationof tomato chromosomes in vitro and in vivo using Cre-lox site-specificrecombination. Plant Mol Biol 1996, 32:901–903.

52. Onouchi H, Nishimana R, Kudo M, Machida Y, Machida C: Visualization ofsite-specific recombination catalyzed by a recombinase fromZygosaccharomyces rouxii in Arabidopsis thaliana. Mol Gen Genet 1995,247:653–660.

53. Bayley CC, Morgan M, Dale EC, Ow DW: Exchange of gene activity intransgenic plants catalyzed by the Cre- lox site-specific recombinationsystem. Plant Mol Biol 1992, 18:353–362.

54. Bala A, Roy A, Behura N, Hess D, Das S: Insight to the mode of action ofAllium sativum leaf agglutinin (ASAL) expressing in T3 rice lines onbrown planthopper. Am J of Plant Sci 2013, 4:400–4007.

55. Loc NT, Tinjuangjun P, Gatehouse AMR, Christou P, Gatehouse JA: Lineartransgene constructs lacking vector backbone sequences generatetransgenic rice plants which accumulate higher levels of proteinsconferring insect resistance. Mol Breed 2002, 9:231–244.

56. Ramesh S, Nagadhara D, Reddy VD, Rao KV: Production of transgenicindica rice resistant to yellow stem borer and sap-sucking insects usingsuper- binary vectors of Agrobacterium tumefaciens. Plant Sci 2004,166:1077–1085.

doi:10.1186/1472-6750-13-88Cite this article as: Bala et al.: Development of selectable marker free,insect resistant, transgenic mustard (Brassica juncea) plants using Cre/loxmediated recombination. BMC Biotechnology 2013 13:88.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

research article open access development of selectable ...€¦ · most commonly used bio-control...

Documents