research article fecal microbiota and diet of...

Research ArticleFecal Microbiota and Diet of Children with ChronicConstipation

Joyce Gomes de Moraes1 Maria Eugecircnia Farias de Almeida Motta2

Monique Ferraz de Saacute Beltratildeo3 Taciana Lima Salviano3 and Giselia Alves Pontes da Silva2

1Federal University of Pernambuco Avenida Professor Moraes Rego 1235 University City 50670-901 Recife PE Brazil2Mother-Child Department Federal University of Pernambuco Avenida Professor Moraes Rego 1235 University City50670-901 Recife PE Brazil3Department of Biotechnology Laboratory of Immunopathology Keizo Asami (LIKA) Avenida Professor Moraes Rego 1235University City 50670-901 Recife PE Brazil

Correspondence should be addressed to Joyce Gomes de Moraes tenjoycehotmailcom

Received 29 November 2015 Accepted 18 May 2016

Academic Editor Samuel Menahem

Copyright copy 2016 Joyce Gomes de Moraes et alThis is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in anymedium provided the originalwork is properly cited

Many factors explain dysbiosis in chronic constipation (CC) such as a low-fiber diet The objective of this study was to comparethe fecal microbiota of constipated and nonconstipated children and their intake frequencies of foodMethods This observationalstudy included 79 children (MF 4336) aged six to 36months divided into two groups cases (39 constipated children) and controls(40 nonconstipated children) We used a structured form to collect demographic variables conducted anthropometric assessmentand collected food intake frequency data The fecal microbiota of the stool samples was analyzed by real-time polymerase chainreaction (PCR) using the fluorophore SYBR Green Results Constipated children had a smaller concentration of Lactobacillusper milligram of stool (119901 = 0015) than nonconstipated children but the concentration of Bifidobacterium per milligram of stool(119901 = 0323) and the intake of fruits vegetables (119901 = 0563) and junk food (119901 = 0093) of the two groups did not differ Constipatedchildren consumed more dairy products (045 plusmn 08 119901 gt 0001) were more frequently delivered via caesarean section (692)were weaned earlier (median 120 60Q

1ndash240Q

3) and had a family history of constipation (718) Conclusions Children with CC

have a smaller concentration of Lactobacillus in their stools and consume more dairy products

1 Introduction

Chronic constipation (CC) is frequent in children andcorresponds to approximately 25 of visits to pediatricgastroenterology offices [1] Most CC cases in small childrencan be explained by functional changes [2] secondary to alow-fiber diet [3] and early weaning [4]

Studies suggest that chronically constipated children havedifferent intestinal microbiota [5 6] and that factors suchas caesarean birth early weaning and low-fiber diets hinderintestinal colonization by healthymicroorganisms [7 8]

Diet is critical among factors capable of modulatingthe intestinal microbiota [9ndash11] because saccharolytic bac-teria such as those from the genera Bifidobacterium and

Lactobacillus ferment fibers into short-chain fatty acids(SCFA) reducing intestinal pH and consequently increasingintestinal motility [12ndash15]

It is possible that there is altered intestinal microbiota inpatients with Functional Gastrointestinal Diseases repercus-sions on intestinal motility [16ndash18] Based on this hypothesisresearchers suggest a beneficial effect of the use of probioticsin the management of constipation especially Lactobacillusand Bifidobacterium [18ndash20] what motivated us to conductthis study and we decided to compare the amount of bacteriafrom the genera Lactobacillus andBifidobacterium in the fecalmicrobiota of constipated and nonconstipated children usingSYBR Green analysis and investigate the childrenrsquos intake offruits vegetables junk food and dairy products

Hindawi Publishing CorporationInternational Journal of PediatricsVolume 2016 Article ID 6787269 8 pageshttpdxdoiorg10115520166787269

2 International Journal of Pediatrics

Table 1 Primers of groups in real-time polymerase chain reaction

Group or species Oligonucleotide sequence (51015840-31015840) Verification media Reference

Eubacteria (total bacteria) UniF340 ACTCCTACGGGAGGCAGCAGT 11 strains of Eubacteria [23 24]UniR514 ATTACCGCGGCTGCTGGC

Lactobacillus sppgLactoF TGGAAACAGRTGCTAATACCG

21 strains of Lactobacillus [25]gLactoR GTCCATTGTGGAAGATTCCCLacAcR GCGGAAACCTCCCAACA

Bifidobacterium sppgBifidF CTCCTGGAAACGGGTGG

11 strains of Bifidobacterium [26]gBifidR GGTGTTCTTCCCGATATCTACABiLonR 2 TACCCGTCGAAGCCAC

2 Methods

This observational study was conducted from March toDecember 2013 in a primary care unit with 79 childrenfrom low-income families The children were divided intotwo groups recruited in consecutive order and diagnosedaccording to the Rome III Diagnostic Criteria [21] cases 39childrenwithCC aged sixmonths to less than three years andcontrols 40 children without CC matched for age

The cases were children who had at least two of thefollowing parameters for at least one month two or fewerdefecations a week at least one episode of incontinence aweek history of excessive stool retention at least one episodeof hard or painful bowel movement a week and history oflarge diameter stools that may obstruct the toilet [22] Thecontrols did not have a history of constipation The controlgroup consisted of healthy children assisted in the primarycare unit who had no previous history of constipation andhad none of the parameters used in Roma III Criteria

All children with a diagnosis of genetic syndromesdelayed neuropsychomotor development chronic encepha-lopathy celiac disease or Hirschsprungrsquos disease evidence ofconstipation secondary to anatomic (anal stenosis) or func-tional (intestinal pseudo-obstruction) abnormalities andevidence of constipation secondary to cow milk allergy wereexcluded The mothers were informed orally of the studyobjectives operationalization and ethical aspects and signedan informed consent form before their childrenwere enrolledin the study

This study was approved by the Research Ethics Commit-tee of the Federal University of Pernambuco under protocolnumber 165098 on December 05 2012 and followed all therules established by Resolution 196 of the National Council ofHealth

The structured form collected the following data sexage history of prematurity family history of constipationtime of weaning and nutritional status A food frequencyquestionnaire (FFQ) with 96 foods collected the childrenrsquosdietary data

The childrenrsquos nutritional status was classified accordingto their body mass index- (BMI-) for-age 119911-scores using thecurve provided by theWorldHealthOrganization (WHO) forchildren aged 0 to 5 years The following cut-off points wereused extreme underweight when 119911-score lt minus3 underweight

when minus3 le 119911-score lt minus2 normal weight when minus2 le 119911-scorele +1 risk of overweight when +1 lt 119911-score le +2 overweightwhen +2 lt 119911-score le +3 and obesity when 119911-score gt +3 [27]BMI-for-age was calculated by the software WHO AnthroPlus of WHO

After nutritional status assessment a stool sample wascollected from each child and placed in a sterile polypropy-lene container The stool samples were transported in ice-filled coolers and stored in a freezer at minus18∘C until molecularanalysis

The FFQ was assessed as recommended by de Fornes etal [28] with adaptations where the general intake frequencyis converted into scores Six food groups were constitutedgrains tubers and roots (group I) beans and high-proteinplant foods (group II) fruits and vegetables (group III) milkand dairy products (group IV)meats and eggs (groupV) andjunk food (group VI)

The answers (never daily weekly monthly and annually)were transformed into monthly intake frequencies Foodswere consumed daily and never received maximum (119878 = 1)and minimum (119878 = 0) scores respectively Intermediatescores were given by the formula 119878 = 11989930 where 119899 is thenumber of days in a month that the child consumed a givenfood [28 29]

The Laboratory of Immunopathology Keizo Asami of theFederal University of Pernambuco (LIKAUFPE) analyzedthe stool samples by real-time polymerase chain reaction(PCR) using the fluorophore SYBR Green The commercialkit QIAampDNAStool (QIAGENVenloNetherlands)wasused for extracting DNA from the samples as instructed bythe manufacturer The amplification reactions used reagentsstandardized for real-time PCR (Universal PCRMaster Mix)and a set of primers specific for the genera Lactobacillus andBifidobacterium and total bacteriaTheprimerswere acquiredfrom studies on fecal microbiota analysis by real-time PCR(SYBR Green) (Table 1)

The statistical analyses were performed by the softwareStatistical Package for Social Sciences (SPSS) for Windowsversion 130 (SPSS Inc Chicago IL USA) The numericvariables were represented by measures of central tendencyand dispersion The chi-square test and Fisherrsquos exact testmeasured associations between the categorical variables TheKolmogorov-Smirnov test determined whether the quanti-tative variables had a normal distribution Studentrsquos 119905-test

International Journal of Pediatrics 3

Table 2 General characteristics of the sample

Variables Constipated children(39) 119899 ()

Nonconstipatedchildren (40) 119899 ()

Total119899 () 119901 value

Sex 119899 () 0305z

Female 15 (385) 21 (525) 36 (456)Male 24 (615) 19 (475) 43 (544)

Age (months)lozsect 167 plusmn 83 156 plusmn 67 0532z

Nutritional status 119899 () 0597dagger

Underweightnormal 31 (795) 28 (718) 59 (756)Overweightobese 8 (205) 11 (282) 19 (244)

Delivery 119899 () 0084z

Vaginal 12 (308) 21 (525) 33 (418)Caesarean 27 (692) 19 (475) 46 (582)

Premature 119899 () 100dagger

Yes 3 (77) 3 (75) 6 (76)No 36 (923) 37 (925) 73 (924)

Family history of constipation 119899 () 0016z

Yes 28 (718) 17 (425) 45 (57)No 11 (282) 23 (575) 34 (43)

Breastfeeding duration (days)lowast 120 (60 240) 270 (180 360) 0006zsectMean plusmn standard deviation zPearsonrsquos chi-square test daggerFisherrsquos exact test lozStudentrsquos 119905-test lowastMedian and percentiles (25th and 75th) Mann-Whitney test

Table 3 Median and interquartile ranges of the food intake frequency scores of constipated and nonconstipated children

Variables Constipatedchildren (39)

Nonconstipatedchildren (40) 119901 value

Group 1 (grains tubers and roots)lowast 024 (017 030) 022 (015 028) 0220Group 2 (beans and other high-protein plant foods)lowast 020 (008 020) 020 (008 020) 0858Group 3 (fruits and vegetables)lowast 021 (012 031) 020 (012 028) 0563Group 4 (milk and dairy products)sect 045 plusmn 018 027 plusmn 017 lt0001Group 6 (junk food)sect 015 plusmn 011 011 plusmn 009 0093lowastMedian and percentiles (25th and 75th) Mann-Whitney testsectMean plusmn standard deviation

and the Mann-Whitney test compared the variables with andwithout normal distribution respectively especially variablesrelated to the microbiota Statistical analysis of microbiota-related data was performed by the software Graphpad Prismusing the same criteria cited above Since food intake fre-quencies are ordinal measurements they were expressed asmedians and interquartile ranges The significance level wasset at 5 (119901 le 005)

3 Results

A total of 79 children participated in the study 39 cases and40 controls Thirty case and 29 control stools were analyzedTotal bacteria could not be amplified in one case The otherstudy variables of the children did not differ regardless of fecalmicrobiota analysis

Table 2 shows the general characteristics of the sampleMost constipated children had a positive family history

of constipation (718 119901 = 0016) a higher frequency of

cesarean delivery (692 119901 = 0084) and a shorter durationof breastfeeding (median 120 60Q

1ndash240Q

3 119901 = 0006)

The groups had similar intakes of fruits and vegetables(119901 = 0563) However constipated children consumed moredairy products (119901 lt 0001) and junk food (119901 = 0093)(Table 3) combined with a significantly smaller amount ofLactobacillus genus per milligram of stools (119901 = 0022) whencompared to children not constipated (119901 = 0015) (Figure 3)

The two groups had similar total bacteria counts permilligramof stool (119901 = 0325) (Figure 1) and similar counts ofthe genus Bifidobacterium per milligram of stool (119901 = 0323)(Figure 2)

4 Discussion

Constipated children had a smaller number of Lactobacillusper milligram of feces and the same number of Bifidobac-terium as nonconstipated children which may be charac-terized as dysbiosis [30] Conceptually both qualitative and


4 times 1008

3 times 1008

2 times 1008

1 times 1008

0

16

S rR

NA

copi

es p

er g

ram

p = 03256

Control Case

Figure 1 Total bacterial 16S rRNA gene copies detected per gram ofhealthy (control) and constipated (case) children stools (119899 = 29 foreach population) Box plots show the 10th to 90th percentile rangeof the data within the box with outliers indicated as dots 119901 valuewith 95 CI was calculated by 119905-test

6 times 1007

4 times 1007

2 times 1007

3 times 1006

2 times 1006

1 times 1006

0

p = 03230

Control Case

Bifid

obacteriu

msp

p re

lativ

e exp

ress

ion

per g

ram

Figure 2 Relative expression of Bifidobacterium spp analyzedby RT-qPCR in stools of healthy (control) and constipated (case)children (119899 = 29 for each population) (Bifidobacterium genus permg of stool of the two study groups)

quantitative changes in intestinal microbiota as bacterialovergrowth are classified as dysbiosis [31] Constipated chil-dren consumed dairy products and sweets more frequently

Diet modulates the intestinal microbiota significantly [1132 33] Some nutrients in excess such as simple sugarsproteins [34 35] and some types of lipids are capable ofreducing bacterial genera that promote intestinal motility

4 times 1005

3 times 1005

2 times 1005

1 times 1005

0

p = 00223

Control Case

Lactobacillus

spp

relat

ive e

xpre

ssio

n pe

r gra

m

Figure 3 Relative expression of Lactobacillus spp analyzed by RT-qPCR in stools of healthy (control) and constipated (case) children(119899 = 29-30 for each population)

[10 35] On the other hand it is described that some fibersimprove intestinal motility by stimulating bacterial generawith fermentative and saccharolytic activities [11 15 35ndash37]

High intakes of simple sugars fatty acids and proteinschange the composition of the intestinal microbiota [9 3839] and have been associated with intestinal constipation inchildren Crowley et al found that cow milk protein waspositively associated with intestinal constipation in childrenaged three to twelve years but the mechanisms had notbeen fully elucidated [40] Kocaay et al verified a positiveassociation between intestinal constipation and cow milkintake in excess of 250mL per day which the authorsbelieved was caused by the saponification of fatty acids withcalcium [41] Other authors consider that excess proteinintake changes the intestinal microbiota [9 38 39]

It is noteworthy that constipated children consumedsweets more frequently and dairy products significantlymorefrequently It is possible that the high intake frequency ofthese foods by constipated children led them to consumefewer foods with higher fiber content such as fruits andvegetables for example

On the other hand foods with high simple sugar fattyacid and protein contents such as dairy products and sweetsare associated with fewer Lactobacillus [9 10] genera in chil-drenrsquos intestinal microbiota because they promote the growthof other bacterial genera [10] Hence these mechanisms mayjustify the low Lactobacillus count per milligram of feces insamples of children with high intake of sweets and dairyproducts

In agreement with the study results other observationalstudies did not detect a smaller number of bacteria from thegenera Bifidobacterium in the fecal microbiota of constipatedchildren and children with low fiber intake [6 42] Usingthe table of the Association of Official Analytical Chemists


to determine dietary fiber intake Aguirre et al did not finda significant difference in the fiber intake of constipated andnonconstipated children [42]

However studies that related fiber intake to intestinalconstipation are controversial possibly because of the dif-ferent methods and tables used for determining fiber intake[43 44] Based on the fiber intake recommended by theAcademy of Pediatrics Ip et al found that constipatedchildren consume less fiber than nonconstipated children[45] The methods used by Aguirre et al and Ip et al tocalculate fiber intake differed from the method used by thepresent study [42 45]

De Filippo et al reported that children with high-fiberdiets have more bifidobacteria in their intestinal microbiotathan children with low-fiber diets [11] Bernal et al obtainedsimilar results [46]

Therefore fruit and vegetable intake seems to increasethe number of Bifidobacterium in fecal microbiota [47] andchildren who consume fewer fruits and vegetables have moreconstipation than children who consume adequate amountsof these foods [48ndash50] The number of Bifidobacterium bymilligram of feces was not associated with fruit and vegetableintake frequency in either study group

Conceptually the role played by fibers on intestinalmotil-ity is associated with its action on the intestinal microbiotaPeople are incapable of hydrolyzing this nutrient so theintestinal microbiota synthesizes hydrolases that break downfibers As the intestinal microbiota ferments fiber it producesshort-chain fatty acids (SCFA) which reduce intestinal pHLow intestinal pH reduces intestinal transit time [51 52] andstimulates smooth muscles actions that promote peristalsisLow intestinal pH also promotes the growth of beneficialintestinal microbiota [10 53] especially bacteria from thegenera Bifidobacterium [10 15] and Lactobacillus [13 14] andinhibits the growth of pathogens [10 35 37 54]

Bacteria from the genera Bifidobacterium and Lactobacil-lus are important constituents of childrenrsquos microbiota [5556] Constipation during childhood promotes qualitative andquantitative changes in the intestinal microbiota especiallywith respect to these genera [56ndash58] which influences peri-stalsis However the exact mechanisms have not yet beenfully elucidated [59ndash61]

Most study children with constipation had a familyhistory of constipation along with a higher frequency ofcaesarian delivery and shorter breastfeeding duration Thisfact may be justified by shared food habits and intestinalmicrobiota between family members [62] This frequency ishigh and above the frequency found in other European stud-ies which found frequencies ranging from 13 to roughly54 [41 45 63ndash65]

However the study frequency was very close to that foundby a Brazilian study which attributed the high frequencyof constipation among family members (816) to theircommon food habits [62] This difference between studiesmay stem from the method used since family memberswith constipation were presently identified by ROMA IIIwhile other studies used a questionnaire or retrospectiveassessment of the medical records

Vaginal delivery and breastfeeding are thought to bekey players in the colonization and succession of healthymicroorganisms in childrenrsquos digestive tract [41 42 66ndash68]In agreement with our findings Mitsou et al found thatchanges in childrenrsquos intestinalmicrobiota are associated witha higher frequency of caesarian delivery and characterizedby a smaller number of Lactobacillus in their intestinalmicrobiota [67]

Breast milk contains not only Lactobacillus in its compo-sition [69ndash71] but also prebiotics that favor their prolifera-tion in childrenrsquos intestines [72ndash74] The motherrsquos intestinalmicrobiota influences the microbiota present in breast milkBreast milk bacteria differ from skin bacteria During preg-nancy high intestinal permeability allows the translocationof intestinal bacteria to Peyerrsquos patches and lamina propriaand mononuclear cells then transfer them to the mammaryglands [75 76]

During vaginal delivery the motherrsquos microbiota is trans-ferred to the child by a process called verticalization In otherwords the child is inoculated orally by the motherrsquos vaginaland intestinalmicrobiota as the child passes through the birthcanal Thus children born by vaginal delivery have morediverse intestinal microbiota which is very similar to themotherrsquos intestinal microbiota On the other hand childrenborn by caesarian delivery are colonized later by the bacteriapresent in the environment [30 76ndash80]

Studies have used cultures to analyze fecal microbiota [658] even though only a small percentage of the species thatcompose fecal microbiota can be analyzed by this techniqueThe present study used molecular techniques to analyze fecalmicrobiota

The present results corroborate those of Zoppi et alwho used cultures to analyze the intestinal microbiota ofchildren and also found that constipated children have asmaller number of Lactobacillus and the same number ofBifidobacterium as nonconstipated children which has beencharacterized by the authors as dysbiosis [6]

Despite the scarcity of studies on the fecal microbiotaof constipated individuals there is a reasonable number ofstudies on the use of probiotics to revert this condition [18ndash20 81ndash85] Intervention studies have shown that the use ofprobiotics in constipated children improves the symptoms[20 85] suggesting that their use is capable ofmodulating thefecal microbiota which is associated with an improvement inchildhood constipation [86 87] It may be indirectly inferredthat changes in the intestinal microbiota are a major factor inthe pathophysiology of constipation in children

5 Conclusion

Thus our results showed that constipated children had a posi-tivematernal history for constipation associatedwith a higherrate of cesarean delivery a shorter time of breastfeeding andincreased consumption of junk foods and dairy productscombined with dysbiosis No empirical basis for inferringthe dysbiosis is causative factor or a result of constipationwhich in its complex and multifactorial character needs tohave these and more other factors involved most be studied


Competing Interests

The authors declare no conflict of interests

Authorsrsquo Contributions

Joyce Gomes de Moraes conceived and designed the studyconducted data collection analyzed the data and drafted thepaper Maria Eugenia Farias de Almeida Motta conceivedand designed the study Monique Ferraz de Sa Beltrao andTaciana Lima Salviano analyzed and interpreted the dataprovided advice and critically revised the paperGiseliaAlvesPontes da Silva conceived and designed the study interpretedthe data provided advice and critically revised the paper Allauthors approved the final version of the paper

Acknowledgments

The authors thank Jose Luiz de Lima Filho Director ofLIKA for letting them use LIKA facilities for fecal microbiotaanalysis and CNPq for the scholarship and the support ofGiselia A P da Silva

References

[1] L Ambartsumyan and L Rodriguez ldquoGastrointestinal motilitydisorders in childrenrdquoGastroenterology and Hepatology vol 10no 1 pp 16ndash26 2014

[2] I Xinias and A Mavroudi ldquoConstipation in childhood Anupdate on evaluation andmanagementrdquoHippokratia vol 19 no1 pp 11ndash19 2015

[3] M M Tabbers N Boluyt M Y Berger and M A BenningaldquoNonpharmacologic treatments for childhood constipationsystematic reviewrdquo Pediatrics vol 128 no 4 pp 753ndash761 2011

[4] A D Camurdan U Beyazova S Ozkan and V T TuncldquoDefecation patterns of the infants mainly breastfed from birthtill the 12th month prospective cohort studyrdquo The TurkishJournal of Gastroenterology vol 25 supplement 1 pp 1ndash5 2014

[5] L Zhu W Liu R Alkhouri et al ldquoStructural changes in the gutmicrobiome of constipated patientsrdquo Physiological Genomicsvol 46 no 18 pp 679ndash686 2014

[6] G Zoppi M Cinquetti A Luciano A Benini AMuner and EB Minelli ldquoThe intestinal ecosystem in chronic functional con-stipationrdquo Acta Paediatrica International Journal of Paediatricsvol 87 no 8 pp 836ndash841 1998

[7] P M Munyaka E Khafipour and J Ghia ldquoExternal influenceof early childhood establishment of gut microbiota and subse-quent health implicationsrdquo Frontiers in Pediatrics vol 2 article109 pp 1ndash9 2014

[8] M-C Arrieta L T Stiemsma N Amenyogbe E Brown andB Finlay ldquoThe intestinal microbiome in early life health anddiseaserdquo Frontiers in Immunology vol 5 article 427 2014

[9] S N Heinritz E Weiss M Eklund et al ldquoIntestinal microbiotaand microbial metabolites are changed in a pig model fed ahigh-fatlow-fiber or a low-fathigh-fiber dietrdquo PLoS ONE vol11 no 4 Article ID e0154329 2016

[10] K Brown D DeCoffe E Molcan and D L Gibson ldquoDiet-induced dysbiosis of the intestinal microbiota and the effectson immunity and diseaserdquoNutrients vol 4 no 8 pp 1095ndash11192012

[11] C De Filippo D Cavalieri M Di Paola et al ldquoImpact of dietin shaping gut microbiota revealed by a comparative studyin children from Europe and rural Africardquo Proceedings of theNational Academy of Sciences of the United States of Americavol 107 no 33 pp 14691ndash14696 2010

[12] T-H Jung W-M Jeon and K-S Han ldquoIn vitro effects ofdietary inulin on human fecal microbiota and butyrate produc-tionrdquo Journal of Microbiology and Biotechnology vol 25 no 9pp 1555ndash1558 2015

[13] A L Kau P P Ahern N W Griffin A L Goodman andJ I Gordon ldquoHuman nutrition the gut microbiome and theimmune systemrdquo Nature vol 474 no 7351 pp 327ndash336 2011

[14] Q Shen L Zhao and K M Tuohy ldquoHigh-level dietary fibreup-regulates colonic fermentation and relative abundance ofsaccharolytic bacteria within the human faecal microbiota invitrordquo European Journal of Nutrition vol 51 no 6 pp 693ndash7052012

[15] K Pokusaeva G F Fitzgerald and D Van Sinderen ldquoCarbohy-dratemetabolism in BifidobacteriardquoGenes andNutrition vol 6no 3 pp 285ndash306 2011

[16] E M Quigley ldquoProbiotics in irritable bowel syndrome thescience and the evidencerdquo Journal of Clinical Gastroenterologyvol 49 supplement 1 pp S60ndashS64 2015

[17] Y Ringel and T Ringel-Kulka ldquoThe intestinal microbiota andirritable bowel syndromerdquo Journal of Clinical Gastroenterologyvol 49 pp S56ndashS59 2015

[18] K Hod and Y Ringel ldquoProbiotics in functional bowel disor-dersrdquo Best Practice amp Research Clinical Gastroenterology vol 30no 1 pp 89ndash97 2016

[19] Y Vandenplas G Huys and G Daube ldquoProbiotics an updaterdquoJornal de Pediatria vol 91 no 1 pp 6ndash21 2015

[20] J J Korterink L Ockeloen M A Benninga MM Tabbers MHilbink and J M Deckers-Kocken ldquoProbiotics for childhoodfunctional gastrointestinal disorders a systematic review andmeta-analysisrdquo Acta Paediatrica vol 103 no 4 pp 365ndash3722014

[21] D Drossman E Corazziari M Delvaux et al Rome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 2006

[22] P E Hyman P J Milla M A Benninga G P Davidson D FFleisher and J Taminiau ldquoChildhood functional gastrointesti-nal disorders neonatetoddlerrdquoGastroenterology vol 130 no 5pp 1519ndash1526 2006

[23] R I Amann B J Binder R J Olson S W ChisholmR Devereux and D A Stahl ldquoCombination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyz-ing mixed microbial populationsrdquo Applied and EnvironmentalMicrobiology vol 56 no 6 pp 1919ndash1925 1990

[24] ACroswell E Amir P TeggatzM Barman andNH SalzmanldquoProlonged impact of antibiotics on intestinalmicrobial ecologyand susceptibility to enteric Salmonella infectionrdquo Infection andImmunity vol 77 no 7 pp 2741ndash2753 2009

[25] R Byun M A Nadkarni K-L Chhour F E Martin NA Jacques and N Hunter ldquoQuantitative analysis of diverseLactobacillus species present in advanced dental cariesrdquo Journalof Clinical Microbiology vol 42 no 7 pp 3128ndash3136 2004

[26] T Matsuki K Watanabe J Fujimoto et al ldquoQuantitativePCR with 16S rRNA-gene-targeted species-specific primersfor analysis of human intestinal bifidobacteriardquo Applied andEnvironmental Microbiology vol 70 no 1 pp 167ndash173 2004


[27] World Health Organization WHO Child Growth StandardsLenghHeight-for-AgeWeight-for-AgeWeight-for-LenghWeight-for-Height and Body Mass Index-for-Age Methods and Develop-ment WHO Geneva Switzerland 2006

[28] N S de Fornes I S Martins G Velasquez-Melendez andM D R Dias de Oliveira Latorre ldquoFood consumption scoresand serum lipids levels in the population of Sao Paulo BrazilrdquoRevista de Saude Publica vol 36 no 1 pp 12ndash18 2002

[29] C Pinho P Israel C D Lira F Cristina and S PastichldquoExcesso de peso em adultos do Estado de Pernambuco Brasilmagnitude e fatores associadosrdquoCadernos de Saude Publica vol27 no 12 pp 2340ndash2350 2011

[30] P D Houghteling and W A Walker ldquoWhy is initial bacterialcolonization of the intestine important to infantsrsquo and childrenrsquoshealthrdquo Journal of Pediatric Gastroenterology andNutrition vol60 no 3 pp 294ndash307 2015

[31] E O Petrof E C Claud G B Gloor and E Allen-Vercoe ldquoMicrobial ecosystems therapeutics a new paradigm inmedicinerdquo Beneficial Microbes vol 4 no 1 pp 53ndash65 2013

[32] G Trinchese G Cavaliere R B Canani et al ldquoHumandonkey and cow milk differently affects energy efficiency andinflammatory state by modulating mitochondrial function andgut microbiotardquo Journal of Nutritional Biochemistry vol 26 no11 pp 1136ndash1146 2015

[33] J Siddharth N Holway and S J Parkinson ldquoA western dietecological module identified from the lsquohumanizedrsquo mousemicrobiota predicts diet in adults and formula feeding inchildrenrdquo PLoS ONE vol 8 no 12 Article ID e83689 2013

[34] E Kim D-B Kim and J-Y Park ldquoChanges of mouse gutmicrobiota diversity and composition by modulating dietaryprotein and carbohydrate contents a pilot studyrdquo PreventiveNutrition and Food Science vol 21 no 1 pp 57ndash61 2016

[35] H L Simpson and B J Campbell ldquoReview article dietary fibre-microbiota interactionsrdquo Alimentary Pharmacology amp Thera-peutics vol 42 no 2 pp 158ndash179 2015

[36] K Aryana F Greenway N Dhurandhar et al ldquoA resistant-starch enriched yogurt fermentability sensory characteristicsand a pilot study in childrenrdquo F1000Res vol 4 article 139 2015

[37] A W Walker S H Duncan E Carol McWilliam Leitch M WChild andH J Flint ldquopH and peptide supply can radically alterbacterial populations and short-chain fatty acid ratios withinmicrobial communities from the human colonrdquo Applied andEnvironmental Microbiology vol 71 no 7 pp 3692ndash3700 2005

[38] E G Zoetendal and W M de Vos ldquoEffect of diet on theintestinal microbiota and its activityrdquo Current Opinion inGastroenterology vol 30 no 2 pp 189ndash195 2014

[39] H Brussow ldquoMicrobiota and healthy ageing observational andnutritional intervention studiesrdquo Microbial Biotechnology vol6 no 4 pp 326ndash334 2013

[40] E T Crowley L T Williams T K Roberts R H Dunstan andP D Jones ldquoDoes milk cause constipation A crossover dietarytrialrdquo Nutrients vol 5 no 1 pp 253ndash266 2013

[41] P Kocaay O Egritas andBDalgic ldquoNormal defecation patternfrequency of constipation and factors related to constipation inTurkish children 0ndash6 years oldrdquo Turkish Journal of Gastroen-terology vol 22 no 4 pp 369ndash375 2011

[42] A N Aguirre M R Vitolo R F Puccini and M B MoraisldquoConstipacao em lactentes influencia do tipo de aleitamento eda ingestao de fibra alimentarrdquo Jornal de Pediatria vol 78 no3 pp 202ndash208 2002

[43] A Torres and M Gonzalez ldquoConstipacion cronicardquo RevistaChilena de Pediatrıa vol 86 no 4 pp 299ndash304 2016

[44] M Vitolo A Aguirre U Fagundes-Neto and M de MoraisldquoEstimativa do consumo de fibra alimentar por criancas deacordo com diferentes tabelas de composicao de alimentosrdquoArchivos Latinoamericanos de Nutricion vol 48 no 2 pp 141ndash145 1998

[45] K S Ip W T K Lee J S H Chan and B W Y Young ldquoAcommunity-based study of the prevalence of constipation inyoung children and the role of dietary fibrerdquoHong KongMedicalJournal vol 11 no 6 pp 431ndash436 2005

[46] M J Bernal M J Periago R Martınez et al ldquoEffects ofinfant cereals with different carbohydrate profiles on colonicfunctionmdashrandomised and double-blind clinical trial in infantsaged between 6 and 12 monthsmdashpilot studyrdquo European Journalof Pediatrics vol 172 no 11 pp 1535ndash1542 2013

[47] E Iwata H Hotta and M Goto ldquoThe screening method ofa bifidogenic dietary fiber extracted from inedible parts ofvegetablesrdquo Journal of Nutritional Science andVitaminology vol55 no 4 pp 385ndash388 2009

[48] B Sujatha D R Velayutham N Deivamani and S Bavanan-dam ldquoNormal bowel pattern in children and dietary andother precipitating factors in functional constipationrdquo Journalof Clinical and Diagnostic Research vol 9 no 6 pp SC12ndashSC152015

[49] S M Dehghani H Moravej E Rajaei and H JavaherizadehldquoEvaluation of familial aggregation vegetable consumptionlegumes consumption and physical activity on functionalconstipation in families of childrenwith functional constipationversus children without constipationrdquo Przeglad Gastroentero-logiczny vol 10 no 2 pp 89ndash93 2015

[50] A Comas Vives and I Polanco Allue ldquoCase-control study ofrisk factors associated with childhood constipation The FREIstudyrdquo Anales de Pediatria vol 62 no 4 pp 340ndash345 2005

[51] A Pituch J Walkowiak and A Banaszkiewicz ldquoButyric acid infunctional constipationrdquo Przeglad Gastroenterologiczny vol 8no 5 pp 295ndash298 2013

[52] R Holma S-M Hongisto M Saxelin and R Korpela ldquoCon-stipation is relieved more by rye bread than wheat bread orlaxatives without increased adverse gastrointestinal effectsrdquoJournal of Nutrition vol 140 no 3 pp 534ndash541 2010

[53] A G Flesch A K Poziomyck and D D Damin ldquoThetherapeutic use of symbioticsrdquo Arquivos Brasileiros de CirurgiaDigestiva vol 27 no 3 pp 206ndash209 2014

[54] M Haarman and J Knol ldquoQuantitative real-time PCR analysisof fecal Lactobacillus species in infants receiving a prebioticinfant formulardquo Applied and Environmental Microbiology vol72 no 4 pp 2359ndash2365 2006

[55] A Chmielewska and H Szajewska ldquoSystematic review ofrandomised controlled trials probiotics for functional consti-pationrdquoWorld Journal of Gastroenterology vol 16 no 1 pp 69ndash75 2010

[56] K Mikami H Takahashi M Kimura et al ldquoInfluence ofmaternal bifidobacteria on the establishment of bifidobacteriacolonizing the gut in infantsrdquo Pediatric Research vol 65 no 6pp 669ndash674 2009

[57] S Matamoros C Gras-Leguen F Le Vacon G Potel and M-F de La Cochetiere ldquoDevelopment of intestinal microbiota ininfants and its impact on healthrdquo Trends in Microbiology vol21 no 4 pp 167ndash173 2013

[58] I L Khalif E M M Quigley E A Konovitch and I DMaximova ldquoAlterations in the colonic flora and intestinalpermeability and evidence of immune activation in chronic


constipationrdquoDigestive and LiverDisease vol 37 no 11 pp 838ndash849 2005

[59] K Al-Nedawi M F Mian N Hossain et al ldquoGut commen-sal microvesicles reproduce parent bacterial signals to hostimmune and enteric nervous systemsrdquo FASEB Journal vol 29no 2 pp 684ndash695 2015

[60] M Furnari E Savarino L Bruzzone et al ldquoReassessment of therole of methane production between irritable bowel syndromeand functional constipationrdquo Journal of Gastrointestinal andLiver Diseases vol 21 no 2 pp 157ndash163 2012

[61] A Attaluri M Jackson J Valestin and S S C RaoldquoMethanogenic flora is associated with altered colonic transitbut not stool characteristics in constipation without IBSrdquoAmerican Journal of Gastroenterology vol 105 no 6 pp 1407ndash1411 2010

[62] C S Mello K d Freitas S Tahan andM BMorais ldquoConsumode fibra alimentar por criancas e adolescentes com constipacaocronica influencia da mae ou cuidadora e relacao com excessode pesordquoRevista Paulista de Pediatria vol 28 no 2 pp 188ndash1932010

[63] O B Soylu ldquoClinical findings of functional and secondaryconstipation in childrenrdquo Iranian Journal of Pediatrics vol 23no 3 pp 353ndash356 2013

[64] S AydogduM Cakir H A Yuksekkaya C Arikan G Tumgorand M Baran ldquoChronic constipation in Turkish childrenclinical findings and applicability of classification criteriardquoTurkish Journal of Pediatrics vol 51 no 2 pp 146ndash153 2009

[65] S M Borowitz D J Cox A Tam L M Ritterband J LSutphen and J K Penberthy ldquoPrecipitants of constipationduring early childhoodrdquo Journal of the American Board ofFamily Practice vol 16 no 3 pp 213ndash218 2003

[66] J M Rodrıguez K Murphy C Stanton et al ldquoThe compositionof the gutmicrobiota throughout life with an emphasis on earlyliferdquoMicrobial Ecology in Health ampDisease vol 26 no 1 ArticleID 26050 17 pages 2015

[67] E K Mitsou E Kirtzalidou I Oikonomou G Liosis andA Kyriacou ldquoFecal microflora of Greek healthy neonatesrdquoAnaerobe vol 14 no 2 pp 94ndash101 2008

[68] R C Gomes H S Maranhao L d Pedrosa and M BMorais ldquoConsumo de fibra alimentar e de macronutrientespor criancas com constipacao cronica funcionalrdquo Arquivos deGastroenterologia vol 40 no 3 pp 181ndash187 2003

[69] T Hennet A Weiss and L Borsig ldquoDecoding breast milkoligosaccharidesrdquo Swiss Medical Weekly vol 144 Article IDw13927 2014

[70] W Fan G Huo X Li L Yang and C Duan ldquoImpact ofdiet in shaping gut microbiota revealed by a comparativestudy in infants during the first six months of liferdquo Journal ofMicrobiology and Biotechnology vol 24 no 2 pp 133ndash143 2014

[71] D Garrido S Ruiz-Moyano R Jimenez-Espinoza H-J EomD E Block and D A Mills ldquoUtilization of galactooligosaccha-rides by Bifidobacterium longum subsp infantis isolatesrdquo FoodMicrobiology vol 33 no 2 pp 262ndash270 2013

[72] L Fernandez S Langa V Martın et al ldquoThe human milkmicrobiota origin and potential roles in health and diseaserdquoPharmacological Research vol 69 no 1 pp 1ndash10 2013

[73] E Bezirtzoglou V Maipa N Chotoura et al ldquoOccurrence ofBifidobacterium in the intestine of newborns by fluorescence insitu hybridizationrdquoComparative Immunology Microbiology andInfectious Diseases vol 29 no 5-6 pp 345ndash352 2006

[74] F Lara-Villoslada S SierraM P Dıaz-RoperoMOlivares andJ Xaus ldquoSafety assessment of the humanmilk-isolated probioticLactobacillus salivarius CECT5713rdquo Journal of Dairy Sciencevol 90 no 8 pp 3583ndash3589 2007

[75] A Donnet-Hughes P F Perez J Dore et al ldquoPotential role ofthe intestinal microbiota of the mother in neonatal immuneeducationrdquo Proceedings of the Nutrition Society vol 69 no 3pp 407ndash415 2010

[76] R Albesharat M A Ehrmann M Korakli S Yazaji and RF Vogel ldquoPhenotypic and genotypic analyses of lactic acidbacteria in local fermented food breast milk and faeces ofmothers and their babiesrdquo Systematic and AppliedMicrobiologyvol 34 no 2 pp 148ndash155 2011

[77] M B Azad T Konya H Maughan et al ldquoGut microbiotaof healthy Canadian infants profiles by mode of delivery andinfant diet at 4 monthsrdquo Canadian Medical Association Journalvol 185 no 5 pp 385ndash394 2013

[78] H Takahashi K Mikami R Nishino T Matsuoka M Kimuraand Y Koga ldquoComparative analysis of the properties of bifi-dobacterial isolates from fecal samples of mother-infant pairsrdquoJournal of Pediatric Gastroenterology and Nutrition vol 51 no5 pp 653ndash660 2010

[79] M G Dominguez-Bello E K Costello M Contreras et alldquoDelivery mode shapes the acquisition and structure of theinitial microbiota across multiple body habitats in newbornsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 107 no 26 pp 11971ndash11975 2010

[80] P A Vaishampayan J V Kuehl J L Froula J L MorganH Ochman and M P Francino ldquoComparative metagenomicsand population dynamics of the gut microbiota in mother andinfantrdquo Genome Biology and Evolution vol 2 no 1 pp 53ndash662010

[81] A Horvath A Chmielewska and H Szajewska ldquoFunctionalconstipation in children a follow-up of two randomized con-trolled trialsrdquo Pediatria Polska vol 88 no 3 pp 219ndash223 2013

[82] A Khodadad and M Sabbaghian ldquoRole of synbiotics in thetreatment of childhood constipation a double-blind random-ized placebo controlled trialrdquo Iranian Journal of Pediatrics vol20 no 4 pp 387ndash392 2010

[83] P Coccorullo C Strisciuglio M Martinelli E Miele L Grecoand A Staiano ldquoLactobacillus reuteri (DSM 17938) in infantswith functional chronic constipation a double-blind random-ized placebo-controlled studyrdquo Journal of Pediatrics vol 157 no4 pp 598ndash602 2010

[84] M M Tabbers A Chmielewska M G Roseboom et alldquoEffect of the consumption of a fermented dairy productcontaining Bifidobacterium lactis DN-173 010 on constipationin childhood a multicentre randomised controlled trialrdquo BMCPediatrics vol 9 no 1 article 22 2009

[85] N-L Bekkali M E J Bongers M M Van Den Berg O Liemand M A Benninga ldquoThe role of a probiotics mixture in thetreatment of childhood constipation A Pilot Studyrdquo NutritionJournal vol 6 article 17 2007

[86] L-N BuM-H Chang Y-H Ni H-L Chen and C-C ChengldquoLactobacillus casei rhamnosus Lcr35 in children with chronicconstipationrdquo Pediatrics International vol 49 no 4 pp 485ndash490 2007

[87] T Nakamura S Nishida M Mizutani and H Iino ldquoEffectsof yogurt supplemented and with intestinal brewerrsquos microflorayeast on constipation in ratsrdquo Journal of Nutritional Science andVitaminology vol 47 no 6 pp 367ndash372 2001

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Table 1 Primers of groups in real-time polymerase chain reaction

Group or species Oligonucleotide sequence (51015840-31015840) Verification media Reference

Eubacteria (total bacteria) UniF340 ACTCCTACGGGAGGCAGCAGT 11 strains of Eubacteria [23 24]UniR514 ATTACCGCGGCTGCTGGC

Lactobacillus sppgLactoF TGGAAACAGRTGCTAATACCG

21 strains of Lactobacillus [25]gLactoR GTCCATTGTGGAAGATTCCCLacAcR GCGGAAACCTCCCAACA

Bifidobacterium sppgBifidF CTCCTGGAAACGGGTGG

11 strains of Bifidobacterium [26]gBifidR GGTGTTCTTCCCGATATCTACABiLonR 2 TACCCGTCGAAGCCAC

2 Methods

This observational study was conducted from March toDecember 2013 in a primary care unit with 79 childrenfrom low-income families The children were divided intotwo groups recruited in consecutive order and diagnosedaccording to the Rome III Diagnostic Criteria [21] cases 39childrenwithCC aged sixmonths to less than three years andcontrols 40 children without CC matched for age

The cases were children who had at least two of thefollowing parameters for at least one month two or fewerdefecations a week at least one episode of incontinence aweek history of excessive stool retention at least one episodeof hard or painful bowel movement a week and history oflarge diameter stools that may obstruct the toilet [22] Thecontrols did not have a history of constipation The controlgroup consisted of healthy children assisted in the primarycare unit who had no previous history of constipation andhad none of the parameters used in Roma III Criteria

All children with a diagnosis of genetic syndromesdelayed neuropsychomotor development chronic encepha-lopathy celiac disease or Hirschsprungrsquos disease evidence ofconstipation secondary to anatomic (anal stenosis) or func-tional (intestinal pseudo-obstruction) abnormalities andevidence of constipation secondary to cow milk allergy wereexcluded The mothers were informed orally of the studyobjectives operationalization and ethical aspects and signedan informed consent form before their childrenwere enrolledin the study

This study was approved by the Research Ethics Commit-tee of the Federal University of Pernambuco under protocolnumber 165098 on December 05 2012 and followed all therules established by Resolution 196 of the National Council ofHealth

The structured form collected the following data sexage history of prematurity family history of constipationtime of weaning and nutritional status A food frequencyquestionnaire (FFQ) with 96 foods collected the childrenrsquosdietary data

The childrenrsquos nutritional status was classified accordingto their body mass index- (BMI-) for-age 119911-scores using thecurve provided by theWorldHealthOrganization (WHO) forchildren aged 0 to 5 years The following cut-off points wereused extreme underweight when 119911-score lt minus3 underweight

when minus3 le 119911-score lt minus2 normal weight when minus2 le 119911-scorele +1 risk of overweight when +1 lt 119911-score le +2 overweightwhen +2 lt 119911-score le +3 and obesity when 119911-score gt +3 [27]BMI-for-age was calculated by the software WHO AnthroPlus of WHO

After nutritional status assessment a stool sample wascollected from each child and placed in a sterile polypropy-lene container The stool samples were transported in ice-filled coolers and stored in a freezer at minus18∘C until molecularanalysis

The FFQ was assessed as recommended by de Fornes etal [28] with adaptations where the general intake frequencyis converted into scores Six food groups were constitutedgrains tubers and roots (group I) beans and high-proteinplant foods (group II) fruits and vegetables (group III) milkand dairy products (group IV)meats and eggs (groupV) andjunk food (group VI)

The answers (never daily weekly monthly and annually)were transformed into monthly intake frequencies Foodswere consumed daily and never received maximum (119878 = 1)and minimum (119878 = 0) scores respectively Intermediatescores were given by the formula 119878 = 11989930 where 119899 is thenumber of days in a month that the child consumed a givenfood [28 29]

The Laboratory of Immunopathology Keizo Asami of theFederal University of Pernambuco (LIKAUFPE) analyzedthe stool samples by real-time polymerase chain reaction(PCR) using the fluorophore SYBR Green The commercialkit QIAampDNAStool (QIAGENVenloNetherlands)wasused for extracting DNA from the samples as instructed bythe manufacturer The amplification reactions used reagentsstandardized for real-time PCR (Universal PCRMaster Mix)and a set of primers specific for the genera Lactobacillus andBifidobacterium and total bacteriaTheprimerswere acquiredfrom studies on fecal microbiota analysis by real-time PCR(SYBR Green) (Table 1)

The statistical analyses were performed by the softwareStatistical Package for Social Sciences (SPSS) for Windowsversion 130 (SPSS Inc Chicago IL USA) The numericvariables were represented by measures of central tendencyand dispersion The chi-square test and Fisherrsquos exact testmeasured associations between the categorical variables TheKolmogorov-Smirnov test determined whether the quanti-tative variables had a normal distribution Studentrsquos 119905-test





Total119899 () 119901 value

Sex 119899 () 0305z

Female 15 (385) 21 (525) 36 (456)Male 24 (615) 19 (475) 43 (544)




Delivery 119899 () 0084z



Yes 3 (77) 3 (75) 6 (76)No 36 (923) 37 (925) 73 (924)


Yes 28 (718) 17 (425) 45 (57)No 11 (282) 23 (575) 34 (43)







3 Results





1ndash240Q

3 119901 = 0006)



4 Discussion



4 times 1008

3 times 1008

2 times 1008

1 times 1008

0

16

S rR

NA

copi

es p

er g

ram

p = 03256

Control Case


6 times 1007

4 times 1007

2 times 1007

3 times 1006

2 times 1006

1 times 1006

0

p = 03230

Control Case

Bifid

obacteriu

msp

p re

lativ

e exp

ress

ion

per g

ram




4 times 1005

3 times 1005

2 times 1005

1 times 1005

0

p = 00223

Control Case

Lactobacillus

spp

relat

ive e

xpre

ssio

n pe

r gra

m






















5 Conclusion



Competing Interests




Acknowledgments


References
































































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















Total119899 () 119901 value

Sex 119899 () 0305z

Female 15 (385) 21 (525) 36 (456)Male 24 (615) 19 (475) 43 (544)




Delivery 119899 () 0084z



Yes 3 (77) 3 (75) 6 (76)No 36 (923) 37 (925) 73 (924)


Yes 28 (718) 17 (425) 45 (57)No 11 (282) 23 (575) 34 (43)







3 Results





1ndash240Q

3 119901 = 0006)



4 Discussion



4 times 1008

3 times 1008

2 times 1008

1 times 1008

0

16

S rR

NA

copi

es p

er g

ram

p = 03256

Control Case


6 times 1007

4 times 1007

2 times 1007

3 times 1006

2 times 1006

1 times 1006

0

p = 03230

Control Case

Bifid

obacteriu

msp

p re

lativ

e exp

ress

ion

per g

ram




4 times 1005

3 times 1005

2 times 1005

1 times 1005

0

p = 00223

Control Case

Lactobacillus

spp

relat

ive e

xpre

ssio

n pe

r gra

m






















5 Conclusion



Competing Interests




Acknowledgments


References
































































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















4 times 1008

3 times 1008

2 times 1008

1 times 1008

0

16

S rR

NA

copi

es p

er g

ram

p = 03256

Control Case


6 times 1007

4 times 1007

2 times 1007

3 times 1006

2 times 1006

1 times 1006

0

p = 03230

Control Case

Bifid

obacteriu

msp

p re

lativ

e exp

ress

ion

per g

ram




4 times 1005

3 times 1005

2 times 1005

1 times 1005

0

p = 00223

Control Case

Lactobacillus

spp

relat

ive e

xpre

ssio

n pe

r gra

m






















5 Conclusion



Competing Interests




Acknowledgments


References
































































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of































5 Conclusion



Competing Interests




Acknowledgments


References
































































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















Competing Interests




Acknowledgments


References
































































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















































































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















research article fecal microbiota and diet of...

Documents