Vol. 174, No. 14JOURNAL OF BACTERIOLOGY, July 1992, p. 4647-46560021-9193/92/144647-10$02.00/0Copyright © 1992, American Society for Microbiology

Regulation of Transcription of the Cell Division Gene ftsAduring Sporulation of Bacillus subtilis

AHMAD GHOLAMHOSEINIAN,t ZHU SHEN, JIUNN-JONG WU,t AND PATRICK PIGGOT*Department of Microbiology and Immunology, Temple University

School of Medicine, Philadelphia, Pennsylvania 19140

Received 13 March 1992/Accepted 5 May 1992

Three distinct 5' ends offtsA mRNA were identified by SI mapping and by primer extension analysis. Theseare thought to represent three transcription start sites. The transcripts from the downstream and upstreamsites were detected throughout growth. The transcript from the middle site was not detected during exponentialgrowth but was detected within 30 min of the start of sporulation, when it was the predominant transcript.Insertion of a cat cassette in the middle promoter,ftsAp2 (p2), did not affect vegetative growth but preventedpostexponential symmetrical division and spore formation. Transcription from p2 was dependent on RNApolymerase containing a", and promoter p2 resembled the consensus &r promoter. Transcription from p2 didnot require expression of the spoOA, spoOB, spoOE, spoOF, or spoOK loci. Northern (RNA) blot analysisindicated thatftsA is cotranscribed with the adjacentftsZ gene. Multiple promoters provide a mechanism bywhich essential vegetative genes can be subjected to sporulation control independent of control duringvegetative growth. In the case offtsA,Z, the promoters provide a mechanism to permit septum formation inconditions of nutrient depletion that might be expected to shut down the vegetative division machinery.

The formation of spores by Bacillus subtilis is a primitivesystem of cellular differentiation (25). It is initiated bynutrient depletion, and there has been intense interest in howthis leads to the carefully orchestrated program of geneexpression during spore formation. As a consequence, thereis now compelling evidence that transcription is activated atthe start of sporulation by a phosphorelay system (11). Thereis also extensive evidence that either depletion of GTP(and/or GDP) or alteration of some metabolite closely asso-ciated with GTP may be a critical signal that initiates sporeformation (18). Despite these and other advances, the deter-minants of the early morphometric events during sporeformation are poorly understood. For example, little isknown about the generation of cellular asymmetry, which isa crucial process in differentiation (31).The formation of an asymmetrically sited division septum

is an early event of sporulation. The asymmetric divisionresults in two distinct cells, the mother cell and the prespore,which have radically different developmental fates. This"sporulation" division (defined as stage II of sporulation)contrasts with division during vegetative growth of B. sub-tilis, in which the septum is symmetrically situated withrespect to the ends of the dividing cell. In addition to theasymmetric division during sporulation, there is likely to bea symmetrical division after sporulation has been triggered inbacteria that were growing in rich medium, where chromo-some replication was dichotomous (24, 31). This final sym-metrical division would facilitate segregation of a singlecompleted chromosome into the prespoie. The postexpo-nential symmetrical and asymmetrical divisions occur instarvation conditions that might be expected to be inimical tothe normal vegetative division process. However, it wouldseem reasonable that much of the machinery required to

* Corresponding author.t Present address: Kerman University of Medical Sciences, Ker-

man, Iran.t Present address: Department of Medical Technology, Medical

College, National Cheng-Kung University, Tainan, Taiwan 70101.

form division septa during spore formation would be thesame as that required for septum formation during vegetativegrowth. It would seem likely that there are, in addition,controls that are unique to spore formation and that arelikely to be critical to spore formation. We explore here theregulation of transcription of genes associated with septumformation.

Several genes thought to be involved in the formation ofthe vegetative septum (27) in B. subtilis have been identified,but their role in spore formation has not been extensivelystudied. The B. subtilis homologs of the Escherichia coli celldivision genesftsA andftsZ have been cloned and sequenced(5). As in E. coli, the genes are adjacent to each other. Theyappear to have roles in vegetative cell division similar tothose of their E. coli counterparts. Expression of the B.subtilisftsA orftsZ gene in E. coli leads to filamentation andcell death (5). The B. subtilis mutation ts-1, which causestemperature-sensitive filament formation during vegetativegrowth, has been shown to map to ftsZ (21). Beall andLutkenhaus (7) have recently shown that in B. subtilis, ftsZhas a role in formation of the sporulation septum as well asof the vegetative septum. As a mutation causing tempera-ture-sensitive spore formation, spoIIN279, maps in ftsA(Leighton; quoted in reference 6), it seems likely that ftsA isalso involved in spore septum formation as well as information of the vegetative septum. We address here thequestion of how the expression of ftsA and ftsZ might becontrolled during spore formation. We show that ftsA andftsZ are transcribed from a distinct promoter during sporu-lation.

MATERIALS AND METHODS

Bacterial strains. The E. coli strain used was DH5a [F-endAl hsdR17 (rK iK) supE44 thi-1 recAl gyrA96 relAlA(lacZYA-argF)U169 480dlacZAM15] except where other-wise indicated. E. coli MM294(pMI1101AP), kindly providedby P. Youngman (University of Georgia), was the source of

4647

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4648 GHOLAMHOSEINIAN ET AL.

TABLE 1. B. subtilis strains used

Straina Relevant characteristics Origin orreference

JH642 trpC2 phe-1 J. A. HochJH646 trpC2phe-1 spoOA12 J. A. HochJH646MS trpC2phe-1 spoOA12 abrB15 J. A. HochJH647 spoOEJJ trpC2 phe-1 J. A. HochJH651 trpC2 phe-l spoOH81 J. A. HochMB24 trpC2 metC3 nf-2 41SL513 spoOH17 trpC2 nf-2 41SL741 spoOK141 trpC2 14SL964 spoOB136 metC3 tal-I 41SL965 spoOF221 metC3 tal-I 41SLA133 spoOH17 trpC2 nf-2 SPPftsAp2-1acZb This studySLA134 trpC2 metC3 nf-2 SBp3ftsAp2-lacZb This studySLA156 trpC2 metC3 nf-2 ftsAp2::cat(+)c This studySLA512 trpC2 metC3 nf-2 ftsAp2::cat(-)c This studyZB307 SPO c2del2::Tn917::pSKlOdel6 46

a The JH series and the MB24 and SL series represent distinct sets ofisogenic strains.

b Derivatives of SPj3 c2del2::Tn917 (46); see text.c +, cat in same orientation as ftsA; -, cat in opposite orientation.

the cat (chloramphenicol acetyltransferase) cassette. The B.subtilis 168 strains used are listed in Table 1.

Plasmids. All plasmids were maintained in E. coli DH5aunless otherwise stated. The structure of all plasmids wasconfirmed by analysis of appropriate restriction endonucle-ase digests. Plasmid pPP215 was prepared by ligating a1.64-kbp HindIII-EcoRV fragment from the Charon 4Aclone 7.3.2 (5, 32) into pUC18 that had been digested withHindIII and SmaI. It contained the 5' end of the B. subtilisftsA gene and the region extending approximately 900 bpupstream from the ftsA open reading frame (Fig. 1) (6).

PvV H PvI I

Plasmid pPP220 contained a 554-bp PvuII-Sau3A fragmentfrom pPP215 cloned into pUC18 that had been digested withBamHI and SmaI (Fig. 1).

Plasmid pPP221 was derived from pPP220 by exonucleaseIII digestion. pPP220 was digested with PstI and Sail, whichcut in polylinker sites flanking the inserted B. subtilis DNA.The double-digested plasmid was treated with phenol, pre-cipitated with ethanol, washed, dried, dissolved in 10 mMTris-HCl-1 mM EDTA, pH 8.0, and digested with exonucle-ase III at 4°C. Samples were taken at intervals and treatedwith S1 nuclease. The ends were filled in with the Klenowfragment of DNA polymerase, and the resulting DNA frag-ments were ligated. Ligated plasmids were transformed intoE. coli, selecting for resistance to ampicillin. Among thetransformants, one contained a 495-bp B. subtilis insert thatcontained the presumed promotersftsAp2 (p2) and p3 but notthe promoter pl. The structure of the insert was confirmedby DNA sequencing, and the plasmid was designatedpPP221. Plasmid pPP222 was constructed by removing theinsert in pPP221 by digestion in flanking sites with HindIIIand EcoRI and ligating it to the promoterless lacZ transcrip-tional fusion plasmid pGV34 (45) previously cut with thesame enzymes.

Plasmids pPP223 and pPP224 were constructed by ligatinga partial XmnI digest of pPP215 to the SmaI fragment frompMI11O1AP that contained the cat cassette. Restrictionanalysis established that they contained two copies of the catcassette inserted in tandem into the XmnI site inftsAp2. Thecat inserts in pPP223 were in opposite orientation to those inpPP224.

Plasmid pPP306 was constructed by ligating a 1.6-kbEcoRI-HindIII fragment of pPP215 into pDH32 (ptrpBGI[37]) that had been digested with BamHI; in each case, the

H XH H V HHI I/ I II

dds ORF4 ORF5 sbp fts A fts Z bpf

H Pv Ac X S

---I I HIP PP3 Pi2P

PvHc Hc VHc XI/ I / I

fts A 1Hc P

fts Z

A- AT-l

PROBE A 1 I B I

FIG. 1. Restriction map of theftsA region of the B. subtilis chromosome. The top shows the approximate locations of open reading framesin the vicinity offtsA (5, 6, 38, 43). The lower part shows the regions cloned in plasmids used in the study. The regions used to probe Northernblots are indicated as A and B. P3, P2, and P1 indicate the transcription start points for ftsA (see text). Restriction sites: H, HindIII; Hc,HincII; P, PstI; Pv, PvuII; S, Sau3A; V, EcoRV; X, XmnI. Not all Sau3A sites are indicated. CAT indicates the insertion of a cat cassette

(see text).

pPP 215pPP 220

pPP 221

pPP 222pPP 223xpPP 224

pPP 306

pPP 308

pPP 319

I SOObp I

J. BACTERIOL.

I :1II I

I I

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ftsA REGULATION DURING SPORULATION OF B. SUBTILIS

ends were filled in with DNA polymerase I Klenow frag-ment.

Plasmid pPP308 was constructed from pPP295. PlasmidpPP295 was a derivative of plasmid pPP221 obtained byexonuclease III digestion from the AccI site at nucleotide282 (numbering of Beall et al. [5]) so that it containednucleotides 308 to 495 of the ftsA upstream region (con-firmed by DNA sequencing). This region, as part of aHindIII (filled in)-EcoRI fragment, was ligated into pDH32previously digested with BamHI (filled in) and EcoRI inorder to construct pPP308.

Plasmid pPP319 was constructed by ligating a 543-kbMboII fragment from a derivative of pPP215 into pDH32 thathad been digested with BamHI and then treated with Kle-now fragment.

Construction of a bacteriophage SP,3 derivative containinganftsAp2p3-lacZ fusion. Plasmid pPP222 was linearized withBalI and used to transform B. subtilis ZB307, which containsthe heat-inducible prophage SPO C2del2::Tn9l7::pSKlOdel6(46). Transformants showing chloramphenicol resistance(Cmr) were selected, in which the ftsAp2p3-lacZ transcrip-tional fusion had integrated into the prophage. Isolatedtransformant clones were checked for the transposon-deter-mined erythromycin resistance (Emr). A transducing lysatewas prepared by heat induction of a culture that had beengrown from an isolated clone (46). Transductants of targetstrains were obtained by selection for Cmr and Emr.DNA sequencing. DNA sequencing was done by the dide-

oxy chain termination method of Sanger et al. (35). ASequenase kit was used according to the protocol of themanufacturer (United States Biochemical Corp., Cleveland,Ohio).Three oligonucleotide primers designed to be complemen-

tary to ftsA mRNA were synthesized with an AppliedBiosystems model 380B DNA synthesizer and kindly pro-vided to us by J. K. de Riel (Temple University). The firstprimer, 5'-CATFlTCTCCGACGATCAC-3', correspondedto bases 652 to 635 in the numbering of Beall et al. (5), 99to 82 bp downstream from the deduced vegetative transcrip-tion start site pl. The second primer, 5'-GAGCCE'1'1'JFTCAACCC-3', corresponded to nucleotides 717 to 701 (5).The third primer, 5'-GTGGCT'TACAAGTGTG-3', corre-sponded to bases 513 to 497 (5).RNA analysis. RNA was prepared as described previously

(42). Primer extension analysis was done essentially asdescribed by Wu et al. (42). Electrophoresis of RNA inagarose-formaldehyde gels and Northern (RNA blot) hybrid-izations were performed as described by Maniatis et al. (26).S1 mapping was performed essentially as described byAusubel et al. (4); mRNA was hybridized with a reversetranscript of the promoter region that had been generated invitro by using a synthetic oligonucleotide primer.

Sporulation. Bacteria were induced to sporulate in modi-fied Schaeffer's sporulation medium (MSSM) essentially asdescribed previously (34). B. subtilis strains are prone togrow as chains in rich medium, particularly during earlyexponential growth. To reduce chain formation, cultures inlate exponential growth were diluted 10-fold in warm MSSMand reincubated. This procedure was repeated two to threetimes before the cultures were permitted to grow beyond theexponential phase and so, by definition, to start sporulating.The procedure did not affect the growth rate but waseffective in reducing chain formation. The start of sporula-tion was defined as the end of exponential growth. Inexperiments involving Spo- mutants, control cultures ofSpo+ strains were included to ensure that the particular

GATCabcdefT

TT* A

AT4A

AA

AA

C

FIG. 2. Determination of the 5' end of ftsA mRNA by primerextension analysis. Primer extension analysis was carried out onmRNA preparations as described in Materials and Methods. RNAwas extracted from MB24 during vegetative growth (sample a), andat intervals during sporulation (0.5, 1.5, 2.5, 3.5, and 4.5 h after thestart of sporulation; samples b, c, d, e, and f, respectively). Eachsample contained 50 ng of RNA. A sequencing ladder with the sameprimer is also shown. The letters above the lanes indicate whichdideoxynucleotide was used to terminate the sequencing reaction.The sequence indicated is that of the nontranscribed strand and isthe complement of the sequence that can be read from the sequenc-ing ladder. The 5' ends of the mRNA are indicated with arrows; the5' end corresponding to p1 was apparent as a faint band on theoriginal autoradiograph but is difficult to see here.

batch of medium used permitted good (i.e., greater than 60%of all organisms are phase-bright spores) sporulation.Growth was followed by measuring theA60i and convertingthis to milligrams of bacteria (dry weight) per milliliter witha standard calibration curve.

Microscopy. Cultures were fixed in 1% Formalin, washedin water, and attached to polylysine-coated coverslips. Theywere visualized and photographed by differential interfer-ence contrast microscopy.

All other methods have been described previously (33,42).

RESULTS

Analysis of the jtsA transcript. The 5' end of the mRNAtranscribed from ftsA4 was investigated by primer extensionanalysis. RNA was extracted from exponentially growingstrain MB24 and from MB24 at hourly intervals during sporeformation. Reverse transcripts were obtained with an 18-merprimer designed to hybridize toftsA4 mRNA and correspond-ing to bases 635 to 652 of the published sequence (5). Thereverse transcripts were characterized by electrophoresiswith the products of a dideoxy sequencing reaction obtainedwith the same primer and pPP21S (Fig. 2). A faint bandcorresponding to nucleotide 554 of Beall et al. (5) wasdiscernible in all samples on the original autoradiograph(promoter designated p1). A strong band corresponding tonucleotide 444 (Fig. 2; band identification based on analysisof a series of gels; promoter p2) was present in samples fromsporulating cultures but not in samples from vegetative

VOL. 174, 1992 4649

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4650 GHOLAMHOSEINIAN ET AL.

250

TAAGTTTAGCTTTTCTGGGAGTCCATCTTGGTGTAGACTTGTATTTAGCAGGTATATTCG

310

CATTTGGAGTCAGATTATTTCAGAATATAGCCGTTATCAGAAGAAATCTACTAACAAAGT

370

GGACTCTTTCTAAAAAAAATAAAAAAAATGTGATATAAAAGAGGATATACATAGGATATA

430

ACGAATATTITCAATAAXmnl

490

550

AAATGATCGAA-4TGTGAGGAGGTGCCATAGAATGAACAACAATGAACTTTACGTCAGSau3A RBS MetAsnAsnAsnGlu....

FIG. 3. DNA sequence of the nontranscribed strand of the ftsApromoter region. The sequence is numbered according to Beall et al.(5). The deduced transcription start points are indicated by aster-isks. The likely -10 and -35 regions of pl, p2, and p3 are

underlined. The putative ribosome-binding site (RBS) for ftsA andthe putative N-terminal sequence of the FtsA protein are shown (5).The XmnI and Sau3A sites used in the study are indicated under theappropriate sequences. The 3' end of the promoter region inplasmids pPP221, pPP222, and pPP308 is indicated with an arrow-

head.

cultures. The same two transcript endpoints were obtainedby using a 17-mer primer corresponding to nucleotides 701 to717 of the published sequence; again, the downstream bandwas very faint and the upstream band was only present inextracts from sporulating cultures (data not shown). Thesame results were obtained with several sets of RNA prep-arations. The positions of the endpoints relative to the ftsAcoding sequence are indicated in Fig. 3.With a third primer corresponding to nucleotides 497 to

513, a faint band suggestive of a third transcript end at aboutnucleotide 296 of Beall et al. (5) was detected. To examinethis further, the 5' ends offtsA mRNA were also determinedby Si mapping. The DNA fragment to be protected from Sinuclease digestion by the mRNA was generated by reversetranscription of denatured pPP215 DNA, using the oligonu-cleotide primer corresponding to bases 635 to 652; followingreverse transcription, the newly synthesized DNA wascleaved by PvuII (nucleotide 0 of Beall et al. [5]), generatinga 652-nucleotide fragment for hybridization to mRNA. TheDNA protected from Si digestion was fractionated by elec-trophoresis, and its mobility was compared with that of asequencing ladder obtained with the same oligonucleotideprimer. A band is clearly visible at about nucleotide 296 (Fig.4). It is most abundant in extracts from exponentially grow-ing bacteria. The band at nucleotide 444 was again predom-inant in post-exponential-phase samples. A band corre-

sponding to pl is just detectable at the bottom of the gel (Fig.4).

It is thought likely that these 5' ends indicate transcriptionstart points, although we have not excluded the possibility ofRNA processing. With this reservation, it is tentativelyconcluded that there are vegetative transcription start pointsat about nucleotides 554 and 296 and a sporulation-associ-ated start point at 444 (Fig. 3). The corresponding promotersare designated pl (position 554), p2 (position 444), and p3

A

TT

A..

A\G

T

AAA

T 4

FIG. 4. Determination of the 5' end of ftsA mRNA by Simapping. Si mapping was carried out as described in Materials andMethods. RNA was extracted from MB24 during vegetative growth(sample a) and at intervals during sporulation (0, 0.5, 1, and 2 h afterthe start of sporulation; samples b, c, d, and e, respectively). Eachsample contained 50 ng of RNA. A sequencing ladder is shown thatwas obtained with the same primer as was used to synthesize theDNA for RNA hybridization and Si protection. The letters abovethe lanes indicate which dideoxynucleotide was used to terminatethe sequencing reaction. The sequences indicated are of the non-transcribed strand and are the complement of the sequences readfrom the sequencing ladder. The 5' ends of the mRNA are indicatedwith arrows.

(position 296). The vegetative transcripts were detectable atreduced levels in sporulating cultures of the parent strain.Therefore, it is possible that they were still being synthe-sized in sporulating bacteria after sporulation-specific tran-scription had started. However, it is also possible that thevegetative transcripts were only present in those cells in thecultures that were not sporulating.Northern blot analysis was used to estimate the size of the

ftsA transcript. RNA samples were fractionated by electro-phoresis in agarose containing formaldehyde and transferredto a nylon membrane. The blot shown (Fig. 5) was probedwith an 870-bp EcoRI-XmnI fragment from pPP215 thatincludes most offtsA (probe A, Fig. 1). A band of approxi-mately 2.5 kb was detected in all samples from both vegeta-tive and sporulating bacteria. The size of the band is that ofa transcript containing both ftsZ andftsA (5). The band wasalso detected by using a probe (probe B, Fig. 1) for the 5' endof ftsZ (data not shown). This would indicate that ftsZ aswell as ftsA is transcribed from the promoters immediatelyupstream offtssA; Beall and Lutkenhaus (7) have reached thesame conclusion through studies with integrative plasmids.A second RNA band was present to variable extents in someextracts of both vegetative and sporulating bacteria. Its sizewas substantially less than the 1.5-kb (16S mRNA) marker,so that it could not code for the entirety of both ftsA andftsZ. Its role is unclear; it is thought to be a breakdownproduct of the 2.5-kb transcript, but it was not investigatedfurther.

J. BACTERIOL.

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ftsA REGULATION DURING SPORULATION OF B. SUBTILIS

A B C D E250

2001-

23S

16S

FIG. 5. Northern blot analysis of ftsA mRNA. RNA was ex-tracted from MB24 during vegetative growth (sample A) and atintervals during sporulation (0.5, 1.5, 2.5, and 3.5 h after the start ofsporulation; samples B, C, D, and E, respectively). The probe usedwas probe A of Fig. 1. Arrows indicate the positions of 23S and 16SRNA on the same gel.

Fusion of JisA promoters to lacZ. To analyze further thesporulation-associated induction of transcription of ftsA, aseries of transcriptional lacZ fusions were constructed(pPP306 [pl, p2, and p3], pPP319 [pl and p2], and pPP308[p2]) and inserted into the amyE locus by the back-to-frontamy system of Shimotsu and Henner (37); for each insert,integration by double crossover was confirmed by Southernblots. Transcriptional fusions to lacZ of the various pro-moter combinations and p2 alone all showed the sameinduction of postexponential expression (Fig. 6). This con-firmed the findings by primer extension analysis and by Simapping that there is a burst of transcription from p2beginning within 30 min of the start of sporulation. Thepresence of pl or of pl and p3 did not substantially affect theextent of postexponential expression. The postexponentialburst of expression from p2 was not observed in strains thathave mutations, spoOH81 or spoOHl7, in the structural genefor e (Fig. 6). A low level of spoOH-dependent expressionfrom the p2-lacZ fusion detected during exponential growthwas not observed by primer extension analysis. Neither thisdifference nor the differences between fusions in the lowlevels of vegetative expression were investigated further.The postexponential burst of ftsA transcription was also

observed with the SPP system of Zuber and Losick (46),using anftsAp3p2-lacZ fusion in strain SL4134 (Fig. 7). Theburst of expression was not observed in a strain (SL4133)harboring a spoOH17 mutation (Fig. 7). To check that thespoOHi 7 effect was not a consequence of a mutation of thephage upon lysogeny, phage was induced from SL4133 andused to lysogenize the spo+ strain MB24. The resultingstrain gave the same pattern of 0-galactosidase induction asdid SL4134 (Fig. 7). It should be noted that the absolute levelof 3-galactosidase obtained for the fusion in SP,B was sub-stantially higher than for fusions in amy (Fig. 6); this mayrepresent a position effect, as has been described previously(40). The pattern of postexponential induction was similarfor fusions at SPf and at amy.No other spoO mutation tested (spoOA12, spoOB136,

e15 0I-

ox

CU

uJ

(f 150

CL

a

I-

CL

50

- . .0 1 2 3 4 5

TIME IhoursiFIG. 6. Formation of p-galactosidase by strains containingftsA-

lacZ transcriptional fusions inserted into the amy locus (37). SpecificP-galactosidase activity is expressed as nanomoles of o-nitrophenyl-P-D-galactopyranoside hydrolyzed per minute per milligram of bac-teria (dry weight). The time is the time after the start of sporulation.The plasmids used for insertion at the amy locus were pPP306(plp2p3), pPP308 (p2), and pPP319 (plp2) (see Fig. 1). Symbols: 0,JH642 amyE::ftsAp1p2p3-lacZ; A, JH642 amyE::ftsAp2-lacZ; *,JH642 amyE::ftsAp1p2-lacZ; K, JH642; A, JH651 (spoOH81) amyE::ftsAp2-1acZ; 0, SL513 (spoOH17) amyE::ftsAp2-lacZ.

spoOEII, spoOF221, or spoOK141) prevented the postexpo-nential induction offtsA transcription. Results for spoOA12,as assayed with an ftsAp2pj-lacZ fusion in amyE, are illus-trated in Fig. 8 for strain JH646. The pattern was notsignificantly affected by the presence of an abrB mutation(Fig. 8). Strain JH646 amyE::ftsAp2pj-lacZ was checked bycolony morphology, by competence, and by protease pro-duction to confirm that it had not inadvertently acquired anabrB mutation. In contrast, the spoOH81 mutation largelyprevented the postexponential induction of ,B-galactosidasefrom ftsAp2p, (Fig. 8); the basal level in the spoOH mutantwas higher than for p2 alone (Fig. 6), presumably indicatingsome spoOH-independent postexponential expression frompl. Postexponential expression from pl (or p3) was notapparent when p2, p1p2, and plp2p3 fusions in a spo+ strainwere compared (Fig. 6). Studies of pl (and p3) separatedfrom the other promoters are required to clarify their regu-lation.

Disruption of the promoter ftsAp2. The -10 region offtsAp2 contains anXmnI site (GAANNNNTTC; Fig. 3). Thissite was used to insert a cat cassette, so as to disrupt p2 (andalso transcription from p3). To achieve this, a 1.4-kb catcassette from SmaI-digested pMI11O1AP was ligated topPP215 that had been partially digested withXmnI. From the

VOL. 174, 1992 4651

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4652 GHOLAMHOSEINIAN ET AL.

600i-250

200500o-

I--

Ic

0OCO)

IL01-JC.)

2a-

C,

4001-

nI-

c-w

ot0

0

c--J

C6LL

(A

w

300+-

2001-

100o-

O 1 2 3 4

TIMEC(hours)FIG. 7. Formation of 1-galactosidase by spo' an

containing an ftsAp?p2-lacZ transcriptional fusionSpecific 3-galactosidase activity is expressed as

o-nitrophenyl-3-D-galactopyranoside hydrolyzed rmilligram of bacteria (dry weight). The time is the tinof sporulation. Symbols: 0, SL4134 (Spo+); A, Sbf0, MB24; O, MB24 lysogenized with phage from S

ligation, pPP223 and pPP224 were isolated;contain two copies of the cat cassette insertedthe appropriate XmnI site. In pPP223, the cdtranscribed in the opposite direction from ftsthey were transcribed in the same direction asj

pPP223 and pPP224 were linearized with Ssttransform strain MB24 to chloramphenicol re

particular transformant clones, SLA156 fronSL4512 from pPP223, were chosen for furtheysis of appropriately restricted DNA by Southtion indicated that these clones contained tanthe cat cassette inserted intoftsAp2 by the exycrossover event.

Strains SL4512, SL4156, and MB24 hadgrowth rates, with doubling times of about 30In different experiments, SL4512 gave no det4(less than 102 per ml). Strain SL4156 gave 104per ml, and MB24 gave 3 x 108 spores per ml.

150F

1001-

501_

0 1 2 3TIME Ihoursl

4 5

FIG. 8. P-Galactosidase formation by spoO mutants containingan ftsAp1p2-4acZ fusion inserted into the amy locus (37). SpecificP-galactosidase activity is expressed as nanomoles of o-nitrophenyl-3-D-galactopyranoside hydrolyzed per minute per milligram of bac-

teria (dry weight). The time is the time after the start of sporulation.The plasmid used for insertion at the amy locus was pPP319 (see

5 6 Fig. 1). Symbols: 0, JH642 (spo+) amyE::ftsAp1p2-lacZ; A, JH646(spoOA12) amyE::ftsApLp2-lacZ; A, JH646MS (spoOA12 abrB15)

id spoOH strains amyE::ftsAp1p2-lacZ; 0, JH651 (spoOH81) amyE::ftsAp1p2-lacZ.in phage SP,.nanomoles ofe mnutomlespr a spoOH17 derivative of MB24, also had the same growthpe afterthe start rate and formed no detectable spores. The transition from4133 (spoOH17); growth in a rich medium to sporulation involves reduction inIL4133. cell length, as illustrated for the Spo+ strain MB24 (Fig. 9a,

exponential growth in MSSM; Fig. 9b, 2.5 h after the end ofexponential growth in MSSM). This is presumably a conse-quence of a symmetrical division(s) that reduces cell length.

and shown to Strains with transcription from ftsAp2 and ftsAp3 disruptedin tandem into appear similar to MB24 during exponential growth (illustrat-

at genes were ed with SL4156, Fig. 9c); however, by 2.5 h after the end ofLA; i pPP224, exponential growth, the smallest cells were twice the lengthtsAn Plasmids of those obtained with MB24 (SL4156, Fig. 9d; MB24, Fig.

tI and used to 9b). No further divisions were apparent in samples taken 1.5sistance. Two h later. Strain SL513 (spoOH17) appeared similar to MB24a pPP224 and during vegetative growth (Fig. 9e) and also 2.5 h after ther study. Anal- start of sporulation (Fig. 9f).iem hybridiza-dem copies of)ected double- DISCUSSION

Three 5' ends for ftsA mRNA were detected by S1very similar mapping and primer extension analysis. We consider that

min in MSSM. these represent transcription start points, although the pos-ectable spores sibilities of 5' processing and degradation have not beent to 105 spores ruled out. The downstream and upstream transcripts wereStrain SL513, faint and were present throughout growth; the likely promot-

I R-P I-P I-P I-P

J. BACTERIOL.

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ftsA REGULATION DURING SPORULATION OF B. SUBTILIS 4653

FIG. 9. Effects of disruption offtsAP2 on cell morphology. Bacteria were fixed in 5% Formalin and attached to polylysine-coated coverslips.They were viewed and photographed by differential interference contrast microscopy. Samples were taken 30 min before (a, c, and e) and 150min after (b, d, and f) the end of exponential growth in MSSM. (a and b) MB24; (c and d) SIA156; (e and F) SL513. Bars, 5 ,um.

VOL. 174, 1992

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4654 GHOLAMHOSEINIAN ET AL.

ers (pl and p3) have potential -35 and -10 regions thatresemble promoters recognized by RNA polymerase holo-enzyme containing the major vegetative factor &a (5, 23)(Fig. 3). The middle transcript was not detected duringvegetative growth but appeared within about 30 min of thestart of sporulation (defined by the end of exponentialgrowth), when it was the predominant transcript (Fig. 2 and4). The sporulation-associated induction of expression fromthis promoter (p2) was also observed by measuring 0-galac-tosidase activity in a strain that contained p2 fused to lacZ(Fig. 6). Gonzy-Treboul et al. (20) and Stragier and Losick(39) have independently found sporulation-associated tran-scription offtsA by testing variousftsA::lacZ transcriptionalfusions and have identified the same three transcription startpoints.The -35 and -10 regions of the promoterftsAp2 resemble

those of promoters recognized by RNA polymerase holoen-zyme containing eH (41). eH is the product of the spoOHlocus (17), and mutations in spoOH prevented transcriptionfrom p2, as detected by lacZ transcriptional fusions (and byprimer extension analysis; data not shown). Furthermore,M. Amjad (3) has found that induction of spoOH from thespac promoter activates transcription fromftsAp2. We con-sider the circumstantial evidence strong that E-er tran-scribesftsA from p2 in vivo, although we have not ruled outthe possibility that the role of o-1 is indirect. e is presentand is transcriptionally active during vegetative growth (41).There is a substantial increase in e activity at the end ofexponential growth (22). This increase could explain thetiming of induction from ftsAp2. However, we consider itlikely that there is one or more additional control forinduction from ftsAp2 at or soon after the start of sporula-tion, as transcription from ftsAp2 was not activated duringcompetence development (36), when eH is known to beactive (1). Expression from ftsAp2 was not prevented bymutations in the spoOA, spoOB, spoOE, spoOF, or spoOK loci.Thus, the transcription determinant is distinct from otherknown sporulation controls.The nature of the additional factor(s) required for tran-

scription fromftsAp2 remains to be established. Presumablythis factor relays information about sporulation-inducingconditions so as to trigger division under conditions ofnutrient depletion that shut down the normal vegetativeseptum formation machinery. An attractive possibility is thatit could relay the information by modifying the mechanism(s)that ordinarily couples cell division to vegetative growthrate. Several such mechanisms have been suggested. Anyone could potentially be modified in some way so as to allowthe sporulation division(s). Four possibilities might be con-sidered. (i) ppGpp has been thought to be a possible media-tor of growth rate control and is closely related metabolicallyto GTP. However, Ochi et al. (29) have shown that a B.subtilis mutant unable to make ppGpp in response to nutrientstarvation sporulated efficiently, provided there was a fall inthe GTP/GDP pool. Moreover, it has recently been shownthat an E. coli mutant lacking ppGpp shows normal growthrate control (19), so that, at least in E. coli, ppGpp cannot bethe (sole?) mediator of growth rate control. (ii) The lov geneof E. coli is a plausible link between ribosome biosynthesis(and hence growth rate) and cell division (10, 15); a homologin B. subtilis could play the same role and also mediate thesporulation divisions. (iii) Termination of chromosome rep-lication must take place in a sporulation medium for sporu-lation to take place (30). Termination is clearly necessary forsubsequent division, and the sporulation medium require-ment makes termination an attractive candidate for a causal

role here. A similar causal role for chromosome terminationin vegetative division has long been considered but has yet tobe established (8, 28). (iv) In E. coli, ftsA and ftsZ are in agene cluster which shows a complex pattern of gene regula-tion when analyzed with transcriptional lacZ fusions (44).Aldea et al. (2) have recently identified a series of promotersin the region. Most interestingly, one of these appears tobelong to a class of promoters for E. coli morphogenes thatthey name "gearbox." These promoters are sensitive togrowth rate, so that expression from them increases asgrowth rate decreases. In this respect, they resemble the B.subtilis ftsAp2 promoter. However, ftsAp2 shows no homol-ogy in the -10 and -35 regions to the E. coli gearboxpromoters. At present, our conclusion must be cautious:some mechanism may link division to sporulation viaftsAp2transcription; this may or may not be related to the mecha-nism linking vegetative growth rate to vegetative division.

Insertion of the cat cassette into the -10 region offtsAp2had no effect on vegetative growth but blocked spore forma-tion. Promoter pl (but not p3) was still functioning in strainswith p2 inactivated and is thought to be essential for cellviability, at least when p2 and p3 are inactive, although thiswas not tested directly. We consider it unlikely that theeffect of the cat insert in ftsAp2 results from altered tran-scription of a gene downstream from ftsZ, as (i) Northernblot analysis indicated that no transcript that could extendfrom ftsAp2 (or pl) to downstream of ftsZ, (ii) the geneimmediately downstream offtsZ is bpf (43) and disruption ofbpf has no effect on spore formation (38), and (iii) there is aplausible transcription terminator betweenftsZ and bpf (43).We consider that transcription of ftsA and/or ftsZ from p2(and/or p3) is necessary for a final symmetrical division andfor spore formation; we presume that it is also necessary forthe asymmetric division. We think that the effect on sporeformation is a consequence of the effect on division, but acausal relationship has not been established. The low level ofsporulation that is obtained with strain SL4156 is presumedto be a consequence of readthrough from the promoter in thecat cassette, which somehow permits a small portion of cellsto form spores; no sporulation was detected when the catcassette was inserted in the opposite orientation in strainSL4512.

Disruption of the sporulation promoterftsAp2 by insertionof the cat cassette prevented a final symmetrical division(Fig. 9). The division occurs after the time (the end ofexponential growth) ordinarily defined as the start of sporu-lation. This would suggest that a final symmetrical divisionis, or can be, an early stage of spore formation. Such a stagehas been suggested previously (24, 31), although it is notordinarily considered a stage of spore formation. At leastone such division seems necessary if bacteria growing in arich medium, in which DNA replication is dichotomous, areinduced to form spores (24, 31) which contain single com-plete copies of the chromosome (12). In this context, it isvery interesting that Dawes et al. (16) had previously de-duced that certain sporulation signals occur prior to the finalsymmetrical division. They had observed a highly significantcorrelation in the stages of sporulation which sister cells hadreached in chemostat populations that were heterogeneouswith respect to the stages of sporulation observed.The morphology of strain SL513, in which aH is inactive,

is the same as that of the parent strain MB24 2.5 h after thestart of sporulation (Fig. 9). However, the morphology ofstrains in which the ftsAP2 promoter, which is apparentlyutilized by eH, is disrupted differs from that of SL513 andMB24. We are unsure of the reason for the difference

J. BACTERIOL.

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

ftsA REGULATION DURING SPORULATION OF B. SUBTILIS 4655

between the morphology ofSL513 and that of strains with p2disrupted. One possible explanation is that the insert alsodisrupts expression from p3 and that expression from p3, orp2 plus p3, rather than p2 alone is required for the finalsymmetrical division; this possibility remains to be tested. Asecond possibility is that a balance is required between FtsAand FtsZ and some other moiety that is also dependent,directly or indirectly, on e. A third possibility is that loss ofeH but not of ftsAp2Ip3 transcription is compensated for insome way so as to increase ftsA/Z transcription from pl.This last possibility is consistent with the observation thatpostexponential expression from pl is apparent in a spoOHmutant (Fig. 8), although not in a spo+ strain (compare Fig.6, p2-lacZ and plp2-lacZ).

Transcription of ftsA/Z appeared to be substantially in-creased at the start of sporulation, as judged by Si mapping,primer extension analysis, and transcriptional lacZ fusions.This might suggest that production of FtsA and FtsZ pro-teins is increased at the start of sporulation. In E. coli, mildoverproduction of FtsZ yields organisms with asymmetri-cally sited septa (9). Thus, in B. subtilis, overproduction ofFtsZ might partly explain the asymmetric location of thesporulation septum, although it would not be a sufficientexplanation, as, in E. coli, the smaller cells produced areanucleate (9). The generation of asymmetry is one of themost intriguing problems about spore formation, so thateven such a partial explanation would be of considerableinterest. Unfortunately for this line of reasoning, Beall andLutkenhaus (7) were unable to detect minicell productionwhen they artificially induced FtsZ overexpression in B.subtilis, and they did not detect an increase in the amount ofFtsZ protein during sporulation. There are various ways toexplain the change in ratio of transcript to protein product atthe start of sporulation that this implies, but no clearconclusion can be drawn about the role of transcript orproduct in the generation of asymmetry. The level of FtsAprotein during sporulation has not been investigated, and itsrole is also unclear.

Regulation from the three promoters pl, p2, and p3provides an interesting case of modification of the regulationof an essential vegetative function so as to have a role insporulation. Carter et al. (13) have reported a e promoter ofrpoD, the structural gene for the major B. subtilis a factor,and this could provide another such case. Separate promot-ers under vegetative and sporulation control could provide ageneral way in which to regulate the expression of essentialgenes, such as those required for septum formation, duringspore formation.

ACKNOWLEDGMENTS

This work was supported in part by grant DMB-8912323 from theNational Science Foundation and by Biomedical Research Supportgrant 7RR0417.We thank M. L. Higgins, R. Losick, I. Smith, and P. Stragier for

helpful discussions. We are particularly grateful to P. Stragier forcommunicating his results before publication.

REFERENCES1. Albano, M., J. Hahn, and D. Dubnau. 1987. Expression of

competence genes in Bacillus subtilis. J. Bacteriol. 169:3110-3117.

2. Aldea, M., T. Garrido, J. Pla, and M. Vicente. 1990. Divisiongenes in Escherichia coli are expressed coordinately to cellseptum requirements by gearbox promoters. EMBO J. 9:3787-3794.

3. Amjad, M. Personal communication.4. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.

Seidman, J. A. Smith, and K. Struhl. 1990. Current protocols inmolecular biology. John Wiley & Sons, Inc., New York.

5. Beall, B., M. Lowe, and J. Lutkenhaus. 1988. Cloning andcharacterization of Bacillus subtilis homologs of Eschenchiacoli cell division genes ftsZ and ftsA. J. Bacteriol. 170:4855-4864.

6. Beall, B., and J. Lutkenhaus. 1989. Nucleotide sequence andinsertional inactivation of a Bacillus subtilis gene that affectscell division, sporulation, and temperature sensitivity. J. Bac-teriol. 171:6821-6834.

7. Beall, B., and J. Lutkenhaus. 1991. FtsZ in Bacillus subtilis isrequired for vegetative septation and for asymmetric septationduring sporulation. Genes Dev. 5:447-455.

8. Bernander, R., and K. Nordstrom. 1990. Chromosome replica-tion does not trigger cell division in E. coli. Cell 60:365-374.

9. Bi, E., and J. Lutkenhaus. 1990. FtsZ regulates frequency of celldivision in Escherichia coli. J. Bacteriol. 172:2765-2768.

10. Bouloc, P., A. Jaffe, and R. D'Ari. 1989. The Escherichia coli lovgene product connects peptidoglycan synthesis, ribosomes andgrowth rate. EMBO J. 8:317-323.

11. Burbulys, D., K. A. Trach, and J. A. Hoch. 1991. The initiationof sporulation in Bacillus subtilis is controlled by a multicom-ponent phosphorelay. Cell 64:545-552.

12. Callister, H., and R. G. Wake. 1976. Homogeneity in Bacillussubtilis spore DNA content. J. Mol. Biol. 102:367-371.

13. Carter, H. L., Ill, L.-F. Wang, R. H. Doi, and C. P. Moran, Jr.1988. rpoD operon promoter used by e-RNA polymerase inBacillus subtilis. J. Bacteriol. 170:1617-1621.

14. Coote, J. G. 1972. Genetic analysis of oligosporogenous mu-tants. J. Gen. Microbiol. 71:17-27.

15. D'Ari, R., E. Maguin, P. Bouloc, A. Jaffe, A. Robin, J.-C.Liebart, and D. Joseleau-Petit. 1990. Aspects of cell cycleregulation. Res. Microbiol. 141:9-16.

16. Dawes, I. W., D. Kay, and J. Mandelstam. 1971. Determiningeffect of growth medium on the shape and positions of daughterchromosomes and on sporulation in Bacillus subtilis. Nature(London) 230:567-569.

17. Dubnau, E., J. Weir, G. Nair, L. Carter III, C. Moran, Jr., andI. Smith. 1988. Bacillus sporulation gene spoOH codes for &30(o). J. Bacteriol. 170:1054-1062.

18. Freese, E. 1981. Initiation of bacterial sporulation, p. 1-12. InH. S. Levinson, A. L. Sonenshein, and D. J. Tipper (ed.),Sporulation and germination. American Society for Microbiol-ogy, Washington, D.C.

19. Gaal, T., and R. L. Gourse. 1990. Guanosine 3'-diphosphate5'-diphosphate is not required for growth rate-dependent con-trol of rRNA synthesis in Escherichia coli. Proc. Natl. Acad.Sci. USA 87:5533-5537.

20. Gonzy-Treboul, G., C. Karmazyn-Campelli, and P. Stragier.Developmental regulation of transcription of the Bacillus sub-tilis ftsAZ operon. J. Mol. Biol., in press.

21. Harry, E. J., and R. G. Wake. 1989. Cloning and expression ofa Bacillus subtilis division initiation gene for which a homologhas not been identified in another organism. J. Bacteriol.171:6835-6839.

22. Healy, J., J. Weir, I. Smith, and R. LosicL 1991. Post-transcrip-tional control of a sporulation regulatory gene encoding tran-scription factor e in Bacillus subtilis. Mol. Microbiol. 5:477-487.

23. Helmann, J. D., and M. J. Chamberlin. 1988. Structure andfunction of bacterial sigma factors. Annu. Rev. Biochem. 57:839-872.

24. Leighton, T., G. Khachatourians, and N. Brown. 1975. The roleof semiconservative DNA replication in bacterial cell develop-ment, p. 677-687. In M. Goulian, P. Hanawalt, and C. F. Fox(ed.), ICN-UCLA symposium on molecular and cellular biologyIII: DNA synthesis and its regulation. W. A. Benjamin, MenloPark, Calif.

25. Losick, R., P. Youngman, and P. J. Piggot. 1986. Genetics ofendospore formation in Bacillus subtilis. Annu. Rev. Genet.20:625-669.

26. Maniatis, T., E. F. Fritsch, and J. Sambroolk 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,

VOL. 174, 1992

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

4656 GHOLAMHOSEINIAN ET AL.

Cold Spring Harbor, N.Y.27. Mendelson, N. 1982. Bacterial growth and division: genes,

structures, forms, and clocks. Microbiol. Rev. 46:341-375.28. Nordstrom, K., R. Bernander, and S. Dasgupta. 1991. The

Escherichia coli cell cycle: one cycle or multiple independentprocesses that are co-ordinated? Mol. Microbiol. 5:769-774.

29. Ochi, K., J. C. Kandala, and E. Freese. 1981. Initiation ofBacillus subtilis sporulation by the stringent response to partialamino acid deprivation. J. Biol. Chem. 256:6866-6875.

30. Piggot, P. J. 1985. Sporulation of Bacillus subtilis, p. 73-108. InD. A. Dubnau (ed.), The molecular biology of the bacilli, vol. 2.Academic Press, Inc., New York.

31. Piggot, P. J. 1991. Morphometric events leading to the asym-

metric division during sporulation of Bacillus subtilis. Semin.Dev. Biol. 2:47-53.

32. Piggot, P. J., K.-F. Chak, and U. D. Bugaichuk. 1986. Isolationand characterization of a clone of the spoVE locus of Bacillussubtilis. J. Gen. Microbiol. 132:1875-1881.

33. Piggot, P. J., and C. A. M. Curtis. 1987. Analysis of theregulation of gene expression during Bacillus subtilis sporula-tion by manipulation of the copy number of spo-lacZ fusions. J.Bacteriol. 169:1260-1266.

34. Piggot, P. J., C. A. M. Curtis, and H. de Lencastre. 1984. Use ofintegrational plasmid vectors to demonstrate the polycistronicnature of a transcriptional unit (spoIL4) required for sporulationof Bacillus subtilis. J. Gen. Microbiol. 130:2123-2136.

35. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

36. Shen, Z., and P. J. Piggot. Unpublished observations.37. Shimotsu, H., and D. J. Henner. 1986. Construction of a

single-copy integration vector and its use in analysis of regula-tion of the trp operon of Bacillus subtilis. Gene 43:85-94.

38. Sloma, A., G. A. Rufo, Jr., C. F. Rudolph, B. J. Sullivan, K. A.Theriault, and J. Pero. 1990. Bacillopeptidase F of Bacillussubtilis: purification of the protein and cloning of the gene. J.Bacteriol. 172:1470-1477.

39. Stragier, P., and R. Losick. 1990. Cascades of sigma factorsrevisited. Mol. Microbiol. 4:1801-1806.

40. Sun, D., R. M. Cabrera-Martinez, and P. Setlow. 1991. Controlof transcription of the Bacillus subtilis spoIIIG gene, whichcodes for the forespore-specific transcription factor aG. J.Bacteriol. 173:2977-2984.

41. Tatti, K. M., H. L. Carter III, A. Moir, and C. P. Moran, Jr.1989. Sigma H-directed transcription of citG in Bacillus subtilis.J. Bacteriol. 171:5928-5932.

42. Wu, J.-J., M. G. Howard, and P. J. Piggot. 1989. Regulation oftranscription of the Bacillus subtilis spoIL4 locus. J. Bacteriol.171:692-698.

43. Wu, X.-C., S. Nathoo, A. S.-H. Pang, T. Carne, and S.-L. Wong.1990. Cloning, genetic organization, and characterization of astructural gene encoding bacillopeptidase F from Bacillus sub-tilis. J. Biol. Chem. 265:6845-6850.

44. Yi, Q.-M., S. Rockenbach, J. E. Ward, Jr., and J. Lutkenhaus.1985. Structure and expression of the cell division genes ftsQ,ftsA and ftsZ. J. Mol. Biol. 184:399-412.

45. Youngman, P., H. Poth, B. Green, K. York, G. Olmedo, and K.Smith. 1989. Methods for genetic manipulation, cloning, andfunctional analysis of sporulation genes in Bacillus subtilis, p.65-87. In I. Smith, R. A. Slepecky, and P. Setlow (ed.),Regulation of procaryotic development. American Society forMicrobiology, Washington, D.C.

46. Zuber, P., and R. Losick. 1987. Role of AbrB in SpoOA- andSpoOB-dependent utilization of a sporulation promoter in Bacil-lus subtilis. J. Bacteriol. 169:2223-2230.

J. BACTERIOL.

on Decem

ber 13, 2020 by guesthttp://jb.asm

.org/D

ownloaded from