regulation of tissue-specific expression of alternative peripheral

THE JOURNAL OF B I O ~ I C A L CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

VOl. 269, No. 41, Issue of OctobeI ' 14, PP. 25795-25808,1394 Printed in U.S.A.

Regulation of Tissue-specific Expression of Alternative Peripheral Myelin Protein-22 ( P M . 2 2 ) Gene Transcripts by Two Promoters*

(Received for publication, May 4, 1994)

Ueli Suter,qb*c G. Jackson Snipes,""e Raymond Schoener-Scott! Andrew A. Welcher,g Sangeeta Pareek," James R. Lupski,GYk Richard A. Murphy," Eric M. Shooter,d and Pragna I. P a t e W j From the 'Department of Cell Biology, Swiss Federal Znstitute of Zbchnology, ETH-Honggerberg, 8093 Zurich, Switzerland, the Departments of 'Neurobiology, and 'Neuropathology, Stanford University School of Medicine, Stanford, California 94305, the Departments of fNeurology, 'Molecular and Human Genetics, and 'Pediatrics and the JHuman Genome Center, Baylor College of Medicine, Houston, Texas 77030, gAmgen Znc., Thousand Oaks, California 91320, and the hMontreal Neurological Znstitute, McGill University, Montreal H3A 2B4, Canada

Mutations affecting the peripheral myelin protein-22 (PMP22) gene have been shown to be associated with inherited peripheral neuropathies. To provide the molecular basis for the analysis of such mutations, we have cloned and characterized the human PMP22 gene. It spans approximately 40 kilobases and contains four coding exons. Detailed analysis of its 5"flanking region suggested the presence of two alternatively transcribed, but untranslated exons. Mapping of separate PMP22 mRNA transcription initiation sites to each of these exons indicates that PMP22 expression is regulated by two alternatively used promoters. In support of this hypothesis, both putative promoter sequences demonstrated the ability to drive expression of reporter genes in transfection experiments. Furthermore, the structures of the 5'-portions of the PMP22 genes appear to be identical in rat and human, supporting the biological significance of the observed arrangement of regulatory regions. The relative expression of the alternative PMP22 transcripts is tissue-specific, and high levels of the exon 1A-containing transcript are tightly coupled to myelin formation. In contrast, exon 1B-containing transcripts are predominant in non-neural tissues and in growth-arrested primary fibroblasts. Interestingly, although a strong up- regulation of PMP22 mRNA was observed in cultured Schwann cells in the presence of the adenylate cyclase activator forskolin under various culture conditions, the regulation of the different PMP22 mRNA species did not mimic the regulation that occurs during myelin formation in vivo. The observed regulation of the PMP22 gene by a complex molecular mechanism is consistent with the proposed dual role of PMP22 in neural and non-neural tissue.

The 22-kDa peripheral myelin protein PMP22 has recently been characterized as a major protein component of peripheral

* This work was supported by National Institutes of Health Grants NS01559 (to G. J. S.), NS04270 (to E. M. S.), and NS27042 (to J. R. L. and P. I. P.), by grants from the American Paralysis Association (to E. M. S.), the Muscular Dystrophy Association (to E. M. S., P. I. P., and J. R. L.), the March of Dimes (to P. I. P.), and the Swiss National Science Foundation (to U. S.), by Medical Research Council of Canada Program Grant MRC-PG46 (to R. M.), and by a fellowship (to S. P.) from the Canadian Network of Centers on Neural Regeneration and Functional Recovery. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* Contributed equally to this work. e To whom correspondence should be addressed.

nerve myelin (reviewed by Suter et al. (199311, where it com- prises about 2 4 % of the total protein found in isolated myelin preparations (Kitamura et al., 1976; Snipes et al., 1992; Pareek et al., 1993). PMP22 protein is predominantly expressed throughout the full thickness of the compact myelin sheath (Snipes et al., 1992), although expression of PMP22 mRNA has also been found in extra-neural tissues like lung, gut, and heart (Manfioletti et al., 1990; Spreyer et al., 1991; Welcher et al., 1991; Patel et al., 1992). Interestingly, the molecular cloning of PMP22 cDNA by differential hybridization (De Leon et al., 1991; Welcher et al., 1991; Spreyer et al., 1991) revealed that PMP22 is identical to the growth arrest-specific mRNA 3 (gas- 31, a molecule whose expression is negatively correlated with cellular growth in cultured fibroblasts (Manfioletti et al., 1990; Suter et al., 199213). The significance of the identity between PMP22 and gas-3 and its implication for the function of PMP22 in and outside of the peripheral nervous system remain to be determined.

Point mutations in the mouse pmp22 gene are most likely responsible for the severe myelin deficiencies and the excessive proliferation of Schwann cells that underlie the profound peripheral neuropathies in the neurological mouse mutants, trembler and trembler-J (Suter et al., 1992a, 1992b). Based on these findings and its location in a region of conserved synteny, PMP22 has been proposed as a candidate gene for the most common inherited peripheral neuropathy in humans, Charcot- Marie-Tooth disease type 1A (CMTlA),' and the rarely encoun- tered Dejerine-Sottas syndrome (Suter et al., 1992a, 1993; Snipes et al., 1993). In support of this hypothesis, the human PMP22 gene was mapped within a large duplication on chromosome 17 (Patel et al., 1992; Timmerman et al., 1992; Valen- tijn et al., 1992a; Matsunami et al., 1992), a genetic abnormal- ity associated with the majority of familial and spontaneous CMTlA cases (Lupski et al., 1991; Raeymaekers et al., 1991; Hoogendijk et al., 1992; Wise et al., 1993; Ionasescu et al., 1993). Confirmatory evidence for the crucial role of PMP22 in the dysmyelinating neuropathies CMTlA and Dejerine-Sottas syndrome has come from the finding of point mutations within the PMP22 gene in some patients who do not carry the CMTlA duplication (Valentijn et al., 1992b; Roa et al., 1993a, 1993b, 19934. Furthermore, PMP22 has also been implicated in an-

' The abbreviations used are: CMTIA, Charcot-Marie-Tooth disease type 1A HNPP, hereditary neuropathy with liability to pressure palsies; PNS, peripheral nervous system; MBP, myelin basic protein; kb, kilobase(s); RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; bp, base paifis); PIPES, 1,4-piperazinediethanesulfonic acid; GGF, glial growth factor; FCS, fetal calf serum; BrdUrd, bromodeoxyuridine.

25795

25796 7ho Promoters for Alternative PMP22 Transcripts

other peripheral neuropathy, hereditary neuropathy with liability to pressure palsies (HNPP; tomaculous neuropathy), which is associated with a deletion of the same chromosomal region that is duplicated in CMTlA patients (Chance et al., 1993; Nicholson et al., 1994). Thus, a variety of genetic mechanisms involving PMP22, including point mutations, duplica- tions, and deletions, may give rise to distinct hereditary peripheral neuropathies. Based on these results, the copy number of the PMP22 gene has been hypothesized to be a major determining factor in the molecular pathology of hereditary peripheral nerve myelin disorders (reviewed by Snipes et al. (1993), Lupski et al. (1993), Suter and Patel (1994), and Patel and Lupski (1994)). According to this hypothesis, inheritance of only one copy of the PMP22 gene results in HNPP, two copies (the diploid number) results in normally myelinated nerves, three copies (dup(l7p)) leads to CMTlA, and four copies, as seen in homozygous CMTlA patients, results in a very severe CMT1-type peripheral neuropathy. Thus, it seems reasonable to assume that the correct regulation of PMP22 is critically important for myelin function. Furthermore, based on teleolog- ical considerations, one would expect that the regulation of PMP22 expression should be exceptionally tightly controlled.

The myelin genes offer an intriguing experimental system to study coordinate transcriptional regulation since the expression of structural myelin proteins appears to be up-regulated with the onset of myelination during development and regeneration of the peripheral nervous system (PNS) (reviewed by Snipes et al. (1992, 1993)). In that context, it has been suggested that a master regulator might exist in glial cells, com- parable to MyoD and its role in muscle development (Berndt et al., 1992). PMP22 expression is regulated similarly to other structural proteins found in compact myelin-like myelin basic protein (MBP), protein zero (PO) (Spreyer et al., 1991; Snipes et al., 1992; Kuhn et al., 1993). Thus, a detailed comparison of the individual promoters regulating the major PNS myelin protein genes is likely to yield information to support or refute the hypothesis of coordinate gene regulation by common transcription factors in Schwann cells. The molecular mechanism gov- erning the expression of the PMP22 gene appears particularly interesting since PMP22 is also expressed in non-neural tissues. I t is anticipated that some of this PMP22 expression is due to innervation by peripheral nerves. In addition, however, PMP22 may subserve a function that is not restricted to its role in PNS myelin.

In this paper, we describe the detailed characterization of the structure of the human PMP22 gene, providing the basis for a genomic DNA-based test system to identify point mutations in PMP22 that co-segregate with the neurodegenerative phenotype in patients affected with hereditary motor and sensory neuropathies (Roa et al., 1993a, 1993b, 1993~). Our results also indicate that the PMP22 gene is regulated by two alternative promoters that are located immediately upstream of two alternative 5"noncoding exons (exons 1A and 1B). A similar organization is conserved in the rat PMP22 gene, a finding that strongly supports the biological significance of this arrangement of potential regulatory sequences. Using the experimental advantages of the rat system, we have been able to charac- terize the expression of these two alternative transcripts under a variety of conditions in which PMP22 had been shown to be regulated. We demonstrate that, while both transcripts are coexpressed in iissues and cell lines, the transcripts containing exon 1A are preferentially expressed in myelinating Schwann cells, while transcripts containing exon 1B are preferentially expressed in tissues that do not form peripheral myelin. In agreement with these findings, exon 1B expression predominates in cultured rat embryonic fibroblasts, although both exon

1A and 1B expression are up-regulated if the cells are arrested in the Go phase of the cell cycle. Surprisingly, a similar regulation is also observed after forskolin treatment of primary rat Schwann cells under conditions where myelin gene expression is induced.

EXPERIMENTAL PROCEDURES Identification and Characterization of Rat Exons IA and IE--Two

nonoverlapping clones containing rat exons 1A and 1B were isolated by screening a ra t A phage genomic library (Stratagene) with synthetic DNA oligomers. Positive plaques were purified, and the inserts were subcloned into plasmid vectors (pSP72). The presence of exons 1A and 1B has been verified by Southern blotting and characterized by auto- mated dideoxy sequencing.

RNA Isolation--RNA was isolated by the single step guanidine thio- cyanate method (Chomczynski and Sacchi, 1987). Adult human tissues were obtained at post-mortem examination within 6 h of the time of death and were frozen immediately on dry ice. Isolation of total RNA from rat tissues including rat sciatic nerves taken during postnatal development and following focal sciatic nerve injury has been described (Snipes et al., 1992).

Northern Blot Analysis-Northern blot analysis of total cellular RNA was performed as described (Snipes et al., 1992). Either a 1.5-kb rat PMP22 cDNA insert or a 0.6-kb human PMP22 cDNA insert, both containing the entire PMP22 coding region, was used as a probe (Patel et al., 1992).

Reverse Panscriptuse 5'-RACE-PCR"cDNA was prepared from 1 pg of total RNA isolated from human sciatic nerve using the oligonucleotide PMP-8 (5'-GGGAGGCGAAACCGTAG-3') to prime the synthesis (Patel et al., 1992). The 5'-cDNA sequence was amplified using the 5'-RACE kit (Life Technologies, Inc.) according to the manufacturer's conditions. The first round of PCR amplification was performed with the anchor primer included in the kit as well as primer PMP-1.3 (5'- GTGGTGGACATTTCCTGAGGAAG-3'). The second round of amplification used the anchor primer and primer PMP-1.2 (5"CTGAC- GATCGTGGAGAC-3'). DNA fragments of 200-300 bp were isolated, cloned into the pCRlOOO vector (Invitrogen), and sequenced.

been used: 5'-CGGCCAAACAGCGTAACCCC"TCCAAG-3' (exon Primer Extension Analysis-The following oligonucleotides have

lA, positions +171 to +142 in Fig. 4A) and 5'-GCCCAAAGGAACAGCT- GTCCCGATCCTCAG-3' (exon 1B; positions +143 to +114 in Fig. 4E). Oligonucleotides (20 PM) were labeled using the 5"terminal DNA labeling system (Life Technologies, Inc.) according to the manufacturer's instructions. Free nucleotides were removed by two consecutive rounds of ethanol precipitations in the presence of ammonium acetate, and the labeled oligonucleotides were collected in 20 p1 of nuclease-free H,O. 2.5 PM labeled primer was coprecipitated with 20 pg of total femoral nerve RNA or 20 pg of yeast tRNA (as control) using ethanol and sodium acetate. The dried pellet was directly dissolved in hybridization buffer containing 800 pl of formamide, 66 p1 of H,O, and 132 pl of 20 x PIPES (3 M NaCl, 0.1 M PIPES, 0.1 M EDTA, pH 6.8). Hybridization was carried out at 30 "C overnight. After ethanol precipitation, primer extension was performed in a 20-1.11 reaction volume using the Superscript RNase H- reverse transcriptase system (Life Technologies, Inc.) according to the manufacturer's protocol. 16 pl of 0.5 N NaOH was added, and the solution was incubated for 2 min a t 95 "C. The pH of the solution was neutralized by adding 8 pl of 1 M HCl, and the reaction mixture was ethanol-precipitated in the presence of ammonium acetate. The pellet was dissolved in 4 p1 of H,O and 6 pl of DNA loading buffer (Sequenase kit, Stratagene). Samples were heated to 95 "C for 10 min just prior to analysis on a standard 8% sequencing gel. The primer extension products were sized by parallel sequencing reactions using the primer extension primers on plasmids containing appropriate DNA fragments.

Riboprobes-Templates for the preparation of riboprobes were constructed by reverse transcriptase PCR using total RNAisolated from rat or human peripheral nerve. The PCR products were subcloned using the TA cloning system (Invitrogen; pCR2000 vector) according to the manufacturer's instructions. The following PCR primers were synthesized on Applied Biosystems model 391 PCR Mate DNAsynthesizer: lA, human exon 1Atranscript (transcription initiation; Fig. 3E), 5"TTCTC- CATGCCCTGCAG (positions -168 to -152 in Fig. 4A); lB, human exon

AGGCACACATCACCCAG; 2A, human exon 1B transcript (transcrip- 1A transcript, reverse primer (transcription initiation; Fig. 3E), 5'-

tion initiation; Fig. 3E), 5'-CAAACAGGGCGTTGTTC (positions -29 to -13 in Fig. 4E); 2B, human exon 1B transcript, reverse primer (transcription initiation; Fig. 3B), 5'-CCATCTCCTTCACTCTC; 3A, human exon 1A transcript (human riboprobe 1 (Rl)), 5"CCTTGCAT"'G-

lzvo Promoters for Alternative PMP22 Dunscripts 25797

GCTGC (positions +115 to +130 in Fig. 4A); 3B, human exon 1B transcript (human riboprobe 2 (R2)), 5”TGTGTTTGAGGCCACCC (positions +97 to +113 in Fig. 4B); 3C, human reverse primer to primers 3A and 3B, 5”CGACAGGATCATGGTGG (Patel et al., 1992); 4A, rat exon 1A transcript (rat riboprobe 1 (Rl)), 5’-TCCCTGGCTCTCGAlTG; 4B, ra t exon 1B transcript (rat riboprobe 2 (R2)), 5“CGAG”TGTGCCT- GAGG, and 4C, rat reverse primer to primers 4A and 4B, 5“CAGA- CAGGATCATGGTGG. PCRs were performed using the “hot start” method for 2 min at 94 “C, followed by 30 cycles of 30 s at 94 “C, 1 min at 55 “C, and 1 min at 72 “C, with a final 10-min extension a t 72 “C. DNA sequences of all plasmids used were verified by dideoxynucleotide sequencing.

RNase Protection Analysis-RNase protection analysis was performed essentially as described previously (Pareek et al., 19931, except that the protected fragments were resolved on an 8% acrylamide, 19% formamide, 1 x Tris borateiEDTA gel. Briefly, template plasmids were linearized with appropriate restriction endonucleases (BamHI or XbaI) at the 3’-end of the insert and purified on a 1% Tris borateEDTA- agarose gel using Geneclean I1 (BIO 101, Inc.). In vitro transcription was performed in the presence of [a-32PldCTP using T7 or SP6 RNA polymerase (Promega). After treatment with RQ1 DNase (Promega), the samples were extracted with phenolkhloroform and precipitated with ethanol in the presence of sodium acetate after the addition of 20 pg of camer yeast tRNA. Riboprobes were hybridized with 2-5 pg of total RNA overnight at 55 “C. RNA:DNA duplexes were sequentially treated with RNase A and proteinase K, followed by phenolkhloroform extraction. Protected fragments were precipitated with isopropyl alco- hol in the presence of 20 pg of yeast tRNA and resuspended in RNA sample buffer. Finally, the samples were boiled for 2 min just prior to the analysis on 8% acrylamide gels. The protected fragments were sized by comparison to 4x174 DNA standards end-labeled with [y-32PlATP using T4 polynucleotide kinase and RNAmarkers generated by in vitro transcription using a RNA Century marker template set (Ambion Inc.) according to the manufacturer’s instructions.

Construction of Chloramphenicol Acetyltransferase Expression Vectors-In order to generate chloramphenicol acetyltransferase expression constructs, two regions of cosmid c132-G8 (Patel et al., 1992) were first subcloned into pBSKS-: a 4.0-kb PuuII fragment ( ~ 1 3 2 - G8P4a) and a 4.5-kb EcoRI fragment (p132-GSR5a). These fragments were subsequently subcloned into the chloramphenicol acetyltransferase expression vector pBLCAT3 (Luckow and Schutz, 1987) as described below. To test promoter activity of sequences upstream of exon lA, a three-way ligation was performed. A 3.2-kb EcoRV/AuaI fragment from p132-G8P4a was allowed to ligate to a 140-bp PCR fragment (amplified from positions -268 to +170 in Fig. 4A and then digested with AvaI) that terminates within exon 1A and upstream of any ATG sequences that might interfere with the translation of the reporter gene. The resulting 3.34-kb fragment was cloned into the BamHI site of pBLCAT3, after filling in free BamHI ends with Klenow polymerase, to obtain pPMPlCATF and pPMPlCATR with inserts in the forward and reverse orientations, respectively.

To test promoter activity of sequences upstream of exon lB, we en- gineered the plasmid p132-G8R5a such that its insert terminated within exon 1B upstream of any ATG sequences. This was done by ligating a 2.9-kb KpnIISacII fragment from p132-G8R5a to a 320-bp PCR-derived fragment (amplified from positions -224 and +143 in Fig. 4B followed by digestion with SacII). The entire 3.2-kb fragment was cloned into pBSKS- at the EcoRV site. The resulting clone, p12-1, was linearized with HindIII, filled in using Klenow polymerase, and digested with EcoRV to allow for unidirectional deletion using exonucle- ase 111. The insert from one of the resulting deleted derivatives, which included 3 kb of sequence upstream of the 5‘-boundary of exon lB, released by digestion with EcoRI, was ligated into the BamHI site of pBLCAT3, after appropriate repair of the ends, in forward and reverse orientation to yield pPMP2CATF and pPMPBCATR, respectively.

Tissue Culture and Dansfection-The hamster fibroblast cell line FLJK88 (Fuscoe et al., 1983) was used for DNA transfection as a representative fibroblast cell line. Cells were grown in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc.) containing 10% (v/v) fetal calf serum, along with 100 pg of streptomycin and 100 units of penicillidml, under an atmosphere of 5% CO,. Approximately 24 h before transfection, RJK88 cells were plated at a density of 5 x lo5 cells/lOO-mm culture plate. 10 pg of DNA prepared using QIAGEN columns were transfected into cells in 100-mm plates by the calcium phosphate precipitation technique (Graham and van der Eb, 1973).

Primary rat Schwann cells were isolated from sciatic nerves of 2-3- day-old Sprague-Dawley rats and expanded as described previously (Pareek et al., 1993). After three passages, the cells were frozen in

aliquots. For transfections, the frozen cells were regrown and passaged one additional time before use. As judged by SlOO protein immunohis- tochemistry (rabbit anti-cow, Dako Corp.), more than 95% of the cells exhibited a Schwann cell phenotype after this procedure. 60-80% confluent 100-mm culture dishes were fed 6 h before transfection. Since primary cells are often variable in their transfection efficiencies, 10 pg of the PMP22 promoter constructs was cotransfected by the calcium phosphate precipitation method with 500 ng of a CMV-LacZ control construct for normalization purposes (Lemke et al., 1988).

Chloramphenicol Acetyltransferase Assay-For the analysis in fibroblasts, cells were harvested 48 h after transfection and lysed by three cycles of freezing and thawing. Cellular debris was removed by cen- trifugation, and equal amounts of protein, as determined by the Bradford assay (Bio-Rad), were used for standard chloramphenicol acetyltransferase assays (Gorman et al., 1982). The percentage of [‘4C]chloramphenicol converted to acetylated product (percent conver- sion) was determined by quantitating autoradiographic analysis of the TLC plate in a Betascope analyzer, by quantitating the radioactivity on TLC plates with a liquid scintillation counter, or by densitometric analysis ofthe x-ray films. All assays were performed within the linear range of chloramphenicol acetyltransferase activities with respect to incuba- tion time and sample concentration.

Schwann cells were harvested 60 h after transfection, and cellular extracts were prepared by freezing and thawing as described above followed by 10 min of ultrasonification in an ultrasonification water bath. Samples were standardized by determining the protein concentration and cotransfected p-galactosidase activity. Equal amounts of p-galactosidase activity were analyzed in chloramphenicol acetyltransferase assays (Lemke et al., 1988) as described above.

Cultured Schwann Cells-Rat primary Schwann cells were isolated from neonatal rat sciatic nerves using the method of Brockes et al. (1979) with modifications and culture conditions as previously described (Pareek et al., 1993). Schwann cells were grown on poly-L-lysine (20 pg/ml) and laminin (8.33 pg/ml) in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum, 20 pg/ml crude glial growth factor (GGF), 5 p~ forskolin, and 50 pg/ml gentamicin for 5 days. Subsequently, the cells were divided into three groups. Group 1 was continued in the same supplemented medium for 3 more days; group 2 was grown in Dulbecco’s modified Eagle’s medium, 10% FCS, and 50 pg/ml gentamicin, but deprived of GGF and forskolin for 3 days; and group 3 was treated identically to group 2, but at the end of 3 days without GGF and forskolin, the cells were stimulated with 20 PM forskolin for an additional 36 h. Parallel experiments were also performed in defined medium (serum-free) consisting of 1 : l Dulbecco’s modified Eagle’dHam’s F-12 medium supplemented with insulin (5 pg/ml), transferrin (100 pg/ml), progesterone (60 ng/ml), putrescine (16 pg/ml), selenium (160 ng/ml), 3,3‘-triido-~-thyroxine (10.1 ng/ml), L-thyroxine (400 ng/ml), bovine serum albumin (0.035%), glutamine (1 mM), dexa- methasone (38 ng/ml), and gentamicin (50 pg/ml).

Growth-arrested Fibroblasts-Primary rat embryonic fibroblasts (Woods and Couchman, 1992) (used at passages 11-14; kindly provided by Dr. Gerald Fuller, University of Alabama a t Birmingham) were growth-arrested essentially as described for NIH 3T3 cells (Manfioletti et al., 1990). Briefly, fully growing fibroblasts were cultured in a-mini- mal essential medium (Life Technologies, Inc.) supplemented with 10% bovine calf serum (Hyclone Laboratories) to approximately 70% confluency (full growth) before harvesting for the isolation of total cellular RNA. Parallel cultures were allowed to become confluent (density growth arrest) and were fed every 2 days for a total of 8 days. RNAfrom these cells were harvested every 48 h. A second set of cultures were plated a t a density of 2 x lo5 celld100-mm2 plate and grown overnight and harvested (full growth) or switched to medium without serum (serum-deprived) before RNAwas isolated at 0,3,12,24,48, and 72 h after addition of serum-free medium. RNA was prepared as described above and quantitated by optical density (260 nm) and ethidium bromide staining on formaldehyde, 1.2% agarose gels. Growth kinetics were determined by bromodeoxyuridine (BrdUrd) incorporation (see below). Samples were analyzed by Northern blot analysis for the induction of PMP22 mRNA and by RNase protection using the rat R2 riboprobe to determine the relative amount of the two major PMP22 transcripts.

Bromodeoxyuridine Incorporation in Fibroblasts-At the time of har- vest of fibroblasts for RNA, parallel cultures were treated with BrdUrd (50 final concentration) for 2 h a t 37 “C. The cells were then rinsed in phosphate-buffered saline and fixed in cold (-20 “C) 50 mM glycine, pH 2.0, in 70% ethanol overnight. The futed cultures were rinsed with ethanol and air-dried. The cultures were then blocked with 10% normal goat serum in phosphate-buffered saline, reacted for 1 h with undiluted monoclonal anti-BrdUrd (Amersham Corp.), and detected with biotin-

25798 %o Promoters for Alternative PMP22 Transcripts

cDNA-A : . . GCTGTTTGGCCGG/GCAGAAACTCCGCTGAGCAGAACTTGCCGCCAGAAi (Hayasaka et al., 1992)

c D N A - B : . . GTTCCTTTGGGCT/GCAGAAACTCCGCTGAGCAGAACTTGCCGCCAGmX (Edomi et al., 1993) I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I CDNA-C : . . GCTCTCCTCGCAG/GCAGAAACTCCGCTGAGCAGAACTTGCCGCCAGmX (Patel et al., 1992)

FIG. 1. Comparison of the 5’-ends of human PMP22 cDNAs. Identical nucleotides are marked by vertical bars. The putative position of an intron is indicated with a slash. The translation start is underlined. References are given on the right.

conjugated goat anti-rabbit IgG (1:400; Jackson ImmunoResearch Laboratories, Inc.). Streptavidin-conjugated horseradish peroxidase (1:400; Jackson ImmunoResearch Laboratories, Inc.) was added, and diaminobenzidine was used as substrate for visualization. Unlabeled nuclei were counterstained with 0.05% methylene blue.

RESULTS

Identification of Human PMP22 cDNAs with Different 5’- Sequences-We have identified several PMP22 cDNA clones by a combination of reverse transcriptase PCR and 5”RACE-PCR using RNA derived from human sciatic nerve as a template (data not shown). The alignment of the resulting DNA sequences with published human PMP22 cDNAs (Patel et al., 1992; Hayasaka et al., 1992; Edomi et al., 1993) revealed the presence of three different 5”flanking sequences that diverge from the common sequence at the same nucleotide position (Fig. 1). The sequence of cDNA-C displays the classical features of an aberrantly spliced mRNA that has retained the 3‘-border of an intron (conserved splice acceptor site adjacent to a poly- pyrimidine stretch). This suspicion was confirmed by DNA sequence analysis of appropriate genomic clones (Table I), and RACE-PCR and primer extension analyses gave no indication that cDNA-C represents a frequent PMP22 mRNA species (data not shown). Consequently, cDNA-C was not analyzed further. Based on the different sequences of cDNA-A and cDNA-B, we hypothesized that these cDNAs represent alternatively spliced 5’-untranslated exons in the PMP22 gene that have been joined to a shared exon 2 to generate the observed mRNA (cDNA) diversity.

Structure of the Human PMP22 Gene-In order to study the genomic organization of the human PMP22 gene and to confirm the presence of alternatively spliced exons in its 5”flanking region, we have isolated genomic cosmid clones spanning the PMP22 locus from a cosmid library constructed from flow- sorted human chromosome 17 (Patel et al., 1992). We previously reported two overlapping cosmid clones, c132-G8 and c103-Bl1, which encompass the PMP22 gene. In the present study, cosmid c49-E4 (which is similar to c132-G8) was used for detailed characterization. The overlapping cosmids c103-Bll and c49-E4 were found to contain the entire PMP22 gene, which spans about 40 kilobases (Fig. 2). Restriction enzyme and Southern blot analyses revealed that the human PMP22 gene contains four coding exons (exons 2-5). Exon 2 (putative first transmembrane region) and exon 3 (extracellular loop including the N-linked glycosylation site) appear to encode specific domains of the PMP22 protein. In contrast, exon 4 covers the second putative transmembrane domain as well as half of the third, and exon 5 contains the information that determines the second half of the third transmembrane region, the putative fourth transmembrane region, and the 3”untranslated region. Furthermore, as predicted by the variable cDNAs, two alternative exons 1A and 1B are located in the 5”untranslated region of the gene (Fig. 2), corresponding to cDNA-A and cDNA-B (Fig. 1). All exodintron boundaries are in good agreement with known consensus sequences (Table I) (Mount, 1982).

Mapping of the 5I-End.s of Human PMP22 mRNAs- Extensive reverse transcriptase 5“RACE-PCR analysis suggested that the presence of exons 1A and 1B in human PMP22 RNAs is mutually exclusive, and no evidence for an additional

exon in the human PMP22 gene upstream of exon 1A was observed (data not shown). Thus, we hypothesized that PMP22 expression is regulated by two different promoters that are located upstream of each of the alternative exons 1A and 1B (Fig. 2).

Based on the genomic human PMP22 DNA sequence and appropriate cDNA sequences, oligonucleotide primers specific for either exon 1A or 1B were synthesized and used in separate primer extension experiments to determine the transcription initiation sites of the two observed mRNA species. In both experiments, several extended cDNA products were obtained (Fig. 3, A and C ) . In order to eliminate signals due to premature terminations of the reverse transcriptase reactions and potential nonspecific priming of the oligonucleotides used, the results of the primer extension experiments were confirmed by appropriate RNase protection analysis (Fig. 3B). Specific 32P-labeled cRNA probes were synthesized in vitro from template plasmids that contained PCR-amplified DNA fragments spanning the different putative mRNA ends as tentatively determined by results of the primer extension analysis and DNA sequencing of the putative promoter regions (see “Experimental Procedures” for description of probes). The combined results of both types of analyses suggest the usage of one major transcription initiation site for each mRNA species (Fig. 4).

According to the mapping results of exon lA, the longest isolated human PMP22 cDNA-A clone is missing 19 nucleotides at its 5‘-end (Fig. 5 A ) (Hayasaka et al., 1992). Interestingly, a sequence comparison of the longest corresponding rat PMP22 cDNA-A (Spreyer et al., 1991) with the appropriate genomic human PMP22 sequence reveals a nucleotide identity of 92% in the 50 nucleotides immediately following the transcription initiation site and 63% within the entire exon lA(Fig. 5 A ) . The 19 nucleotides putatively missing in the human cDNA-A clone can be found with only one nucleotide mismatch in the corresponding rat clone whose 5’-end coincides with the experimentally determined human mRNA-A start site. Since the arrangement of two alternative exons in the 5’-untranslated region is conserved between PMP22 genes in human and rat (see below), these results further support the correct mapping of the cap site of the human mRNA-A and make the presence of additional untranslated exons upstream of exon 1A unlikely.

The longest human PMP22 cDNA-B clone is 42 nucleotides short of being full-length (Fig. 5B). A comparison of the latter sequence with the longest mouse PMP22 clone reveals that the 5”sequence of exon 1B is highly conserved between human and mouse (Fig. 5B). The mouse clone stops 5 nucleotides short of the corresponding human transcription initiation site, and its first 37 nucleotides are 95% identical to the human genomic sequence (nucleotide identity over the entire exon 1B is 70%). Although these findings indirectly support our mapping results of human exon lB, the significance of this observation remains elusive due to the current lack of information on the genomic organization of the mouse pmp22 gene.

Sequence of the Putative Human PMP22 Promoters-We have previously shown that a cloned 4.5-kb EcoRI fragment derived from the cosmid c132-G8 (p132-G8R5) contained a portion of the CpG island associated with the PMP22 gene (Patel et al., 1992). Restriction mapping and Southern blot analysis

Tzu0 Promoters for Alternative PMP22 Dunscripts 25799

TABLE I DNA sequences of the exon /intron boundaries of the PMP22 gene

Exon sequences are shown in upper-case letters, and intron sequences in lower-case letters. The numbers directly below the sequence refer to 5'- and 3'-nucleotide positions in the PMP22 cDNA flanking each intron (Pate1 et al., 1992). Below these numbers, amino acids at the exodintron junctions are indicated.

Exon Exon Sequence of exodintron junction no. size 5"Border 3"Border

Intron size

bP hlA" 173 GGCCGG gtgagt. . . .gcgctCtCCtCgCag hlB 143 TGGGCT gtaagt. . . .gcgctCtCCtCgCag rlA ND GGTCTG gtgagt. . . . ttCCtCtCCCgCag rlB ND CTGAAA gtaagt. . . . ttcctctcccgcag h2 112 GTC AGC gtgagt. . . .tctgattctctctag

127 Ser-26

227 Glu-60

368

h3 100 CA AAC G gtgagg. . . .gtctctttccccCag

h4 141 TT GCT G gtaagt. . . .cctctCCttcccCag

h5

h and r represent human and rat, respectively. ND, not determined.

Gly-107 -1300

GCAGAA 16 GCAGAA 16 GCACCG GCACCG CAA TGG 128 Gln-27 AA TGG 228 GlU-60 GT CTG 369 Gly-107

kb 2.5

1.5

ND ND 1.5

20

8.3

Kb I I I I I I I I 0 10 20 30 40 50 60 70

Hindu1 I I I I I I I I I I I I

- p132-GgP4a p132-GER5a

T3 c49-E4

n c103-Bll

5' 1A 1B 2 3 4 5 I 1 1 1 I I

I 3' / ' ' I ' -

/ "

/

- " "

/ " -

/ " - -

/ - -

/

- " " -"

FIG. 2. Genomic organization of the human PMP22 gene. Overlapping cosmids c49-E4 and c103-Bll were mapped with respect to EcoRI, BamHI, and Hind111 sites. T3 and T7 refer to T3 and T7 promoter sites and indicate the orientation of the inserts in the vector sCosl. Exons are identified by numbers above filled boxes. The proposed alternate splicing that results in two different PMP22 transcripts is schematically indicated at the bottom. P1 and P2 refer to the location of promoter 1 and promoter 2 sequences. The line adjacent to the asterisk denotes the region of the rat gene that has been analyzed.

with probes specific for exons 1A and 1B confirmed that the regulatory regions of the PMP22 gene were likely located within this fragment (data not shown). The results of the combined efforts of DNA sequencing, primer extension, and RNase protection assays used to map exons 1A and lB, as well as their respective 5"flanking regions, are shown in Fig. 4. The putative promoter P1 contains a TATA box-like sequence 30 bp upstream of the corresponding mRNA cap site, a typical feature for most eukaryotic genes. In addition, an inverted CCAAT box, an element that is often found in RNA polymerase I1 promoters (McKnight and Kingsbury, 19821, is also present at positions -43 to -47. In contrast, neither TATA-like nor CCAAT sequences can be found in the putative promoter P2.

Agents that increase the level of cellular CAMP are known inducers of PMP22 expression in cultured Schwann cells (Spreyer et al., 1991; Pareek et al., 1993). Thus, we analyzed both promoters for putative consensus sequences for the binding of specific transcription factors that have been implicated in gene regulation by CAMP. Two potential binding sites for the transcription factor NF1 at positions -217 to -221 and -241 to -245 in promoter P1 (Zhang and Miskimins, 1993) and overlapping consensus sequences for the binding of the transcription factors AP-2 and Sp-1 at positions -67 to -79 in promoter P2 (Imagawa et al., 1987) might be significant in this context (Fig. 4).

Homologies to Myelin Gene Promoters-A computer search aimed at the identification of shared sequence elements be-

25800 lluo Promoters for Alternative PMP22 Dantscripts

A A C G T B ” exon l b exon la A C G T C

1 2 3 4 5 6 7 8

500- 400- 300-

200-

100 -

-31 1

-200

-151 -140 - -118

*-

-1 00

I

..

FIG. 3. Mapping of the 5’-ends of human PMP22 mR.NAs. Primer extension analysis was carried out using primers specific for the exon 1B-containing transcript (A) or the exon la-containing transcript (C). Lanes 1,20 pg of total peripheral nerve RNA; lunes 2,20 pg of yeast tRNA. Standard DNA sequencing reactions using the same primers as in the primer extension reactions are shown as size markers on the right in each panel. The extension products confirmed by RNase protection assay ( B ) are indicated by an asterisk. A prominent longer primer extension product in A could not be confirmed by RNase protection analysis and might be due to primer cross-hybridization. RNase protection analysis was camed out using probes specific for exons 1A and 1B (B). Lune 1, RNA size markers; lunes 2 and 5, undigested exon lB/exon 1A-specific probes; Lanes 3 and 6, 5 pg of total peripheral nerve RNA analyzed with exon lB/exon 1A-specific probes, RNase-digested; lanes 4 and 7, 20 pg of yeast tRNA analyzed with exon lB/exon 1A-specific probes, RNase-digested; lune 8, DNA size markers.

A Exon 1A / Promoter 1:

-298AATTCACTGGGAGGGGAGGGGAGCCAGTGGGACCTCTTGGCTATTACACA -248 GGTTGGCACTTCCAGAGAGAACAGTCTTGGC%TCACACAGGCTTCAGGCATA -198 CTCAAAGCTCTTCTCCCTTCTGATTCCAGTTTCTCCATGCCCTGCAGGGC -148 CTCTTGGGATTATTGTATTCTGGAAAGCAAACAAAGTTGGACACTGTCTC -9 8 TTTAAATAATAGAGGCTGAGAACCTCTCAGGCCACCATGACATATCCCAG

-48 CATTGGACCAGCCCCTGAATAAACTGGAAAGACGCCTGGTCTGGCTTCAG *

FIG. 4. Sequences of the alternative + 2 TTACAGGGAGCACCACCAGGGAACATCTCTCGGGGAGCCTGGTTGGAAGCTG exons 1A and 1B and their respective +52 CAGGCTTAGTCTGTCGGCTGCGGGTCTCTGACTGCCCTGTGGGGAGGGTC 5”flanking regions. Mapped transcrip- +io2 TTGCCTTAACATCCCTTGCATTTGGCTGCAAAGAAATCTGCTTGGAAGAA tion initiation sites are marked with an +is2 GGGGTTACGCTGTTTGGCCGG g tgag t t t t a t tggcaaac tg tgcc tc t asterisk and represent nucleotide +l. A, a (T)ATA-like sequence and an inverted CCAAT-box are indicated in boldface letters. In promoter 1, TGGCA (underlined) B is a perfect match for NF1. B, in promoter 2, an AP2-like site is underlined. Exon 1B / Promoter 2:

-352 GTCGGCGGGCCCAGAAGCCCAGCCCTGGGCATCCGCTGAGCTACATTTGG -302 CTGGGTCTTCCCAGAGTGGGCTGAGGAGCCAGTTTCTCGGTCAACACTAG -252 GTCTCCACGGGGCCAGGGGAGAAGGGAGGTGGGAGGTGAGAAAGCTCAGC -202 CGCCTCTGGTTTCGAGTAGTCGCCGCGGTTTTGCAGGGACCGACTTT -152 TTCTTGAGGCGCATTTAAGGCCAAGTGACTGTCTCCTGCCCTCCCTCTCT -102 CCTGCCCCCTCTCCTCCCTGAGT~CCGCCCTCCCGCACACGCTGACCCAG -52 GGACACACCCTACTGCAGCGACGCAAACAGGGCGTTGTTCCCGTTAAAGG

* - 2 GGAACGCCAGGAGCCTCCCACTGCCCCCTTGCTTCGCGCGCGCGCAGCCC +48 CGCAGCGCAGCTTTGGCGGCGCCAGCAGCGGAGCCAACGCACCCGAGTTT + 9 8 GTGTTTGAGGCCACCCTGAGGATCGGGACAGCTGTTCCTTTGGGCT gta +148 agtaatttggtggggagagtgaaggagatgga

tween the two putative PMP22 promoters and the 5”flanking regions of other myelin genes was performed. Since no foot- printing data of the PMP22 promoter sequences are available at this time, we concentrated our efforts on a comparative analysis of sequence elements that have been previously identified by functional assays in the proteolipid protein and MBP gene promoters. Using this approach, several potentially important sequence motifs in the two putative PMP22 promoters

were identified. First, a striking similarity was observed between the mouse MBP enhancer (Fors et al., 1993) and a sequence motif in the putative PMP22 promoter P1 just down- stream of the TATA-like sequence (Fig. 6A). In the mouse MBP gene, this sequence element is involved in binding of the NF1 transcription factor as determined by band shift and footprint- ing experiments (Tamura et al., 1988; Aoyama et al., 1990). Second, Aoyama et al. (1990) identified the binding site of a

lluo Promoters for Alternative PMP22 Transcripts 25801

A

the exon 1A (A) and exon 1B ( B ) DNA FIG. 5. Interspecies comparisons of

sequences. Conserved nucleotides are represented by asterisks. Dots indicate that the corresponding sequence has not been determined in that particular species. Dashes indicate nucleotide gaps in- troduced for optimal alignments. Vertical bars indicate the 5'-ends of the longest human PMP22 cDNA clones yet identi- tied.

B Exon 1B

HUMAN MOUSE RAT

MOUSE HUMAN

RAT

HUMAN MOUSE RAT

A

Mouse MBP Enhancer: -127 AACTGGCAAGGCGCCCACCCAG -106

Human PMPZ2 Promoter 1: -27AACTGGAAAGACGCCTGGTCTG -6 I I I I I I I l l I I I I I I

I N F 1 I

B

Mouse M 1 Binding Si te :

Human PMP22 Promoter 2 :

C

Human PMP22 Promoter 1:

Rat PO Promoter:

Mouse PO Promoter:

Mouse MBP Promoter:

Human PO Promoter:

Human PLP Promoter:

-111 CCCAGCTGACCCAG -98 I I I I I I I I I I I

-66 ACACGCTGACCCAG -53

-78 AACCTCTCAGGC -67

-367 GGGCTCTCAGGC -356 I I I I I I I I I

I I I I I I I I I GGGCTCTCAGGC

I I I I I I I I I -455 GGGCTCTCAGGC -444

GGGCTGTGAGGC I I I I I I I

I 1 \ 1 \ 1 -341 GGGCTCTCACTT -330

otide positions in PMP22 promoter sequences are as described in the FIG. 6. Conserved motifs in promoters of myelin genes. Nucle-

legend of Fig. 4. References to other sequences are given by Nave and Lemke (1991) and Fors et al. (1993). PLP, proteolipid protein.

putative general transcription factor, M1, in the mouse MBP promoter; a similar sequence motif is also found in the putative P2 promoter (Fig. 6B). Finally, the P1 promoter contains a sequence element that is similar to a footprinted sequence (FP330; Fig. 6C) in the proteolipid protein promoter, which is also present in the PO promoter of various species (rat, mouse, human), as well as in the mouse MBP promoter (MOTIF B) (Nave and Lemke, 1991). This finding is of particular interest since the transacting regulator(s) binding at FP330 are poten-

I AACGCCAGGAGCCTCCCACTGCCCCCTTGCTTCGCGCGCGCGCAGCCC--

*C**********************"**T***T*********TGA***GC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

AGCACAGCTGT******G*A********A*CC**TGG*******G***** **G*AA*******A*CT**AGG****C********

-CGCAGCGCAGCTTTGGCGGCGCCAGCAGCGGAGCCAACGCACCCGAGTT

. . . . . . . . . . . . . . . TGTGTTTGAGGCCACCCTGAGGATCGGGACAGCTG~TCCTTTGGGCT ****CC******T*AT**--*CTCT*A**T******C******AA** ****CC******T**T*C--*CTCT*A*C*G*****C*G*****C******AA**

tial candidates for common transcriptional regulators of myelin genes (Nave and Lemke, 1991).

Functional Analysis of the Putative Human PMP22 Promot- ers 1 and 2-In order to analyze putative promoter activity within sequences upstream of exons 1A and lB, reporter plasmids were constructed in the vector pBLCAT3, which contains the gene encoding bacterial chloramphenicol acetyltransferase. The resulting plasmids, pPMPlCATF and pPMPlCATR, contain approximately 3.3 kb of sequence upstream of exon 1A in the forward and reverse orientations, respectively, and the plasmids pPMP2CATF and pPMP2CATR contain approximately 3.2 kb of sequence upstream of exon 1B in the forward and reverse orientations, respectively. These plasmids along with a positive and negative control were transfected into the hamster fibroblast line RJK88 (Fig. 7A) and primary rat Schwann cells (Fig. 7B with virtually identical assay results. Overall, the sequences upstream of exon 1A as well as exon 1B display significant promoter activity, with the sequence upstream of exon 1B being a more potent promoter in both cell types than the sequence upstream of exon 1A. The construct containing the putative promoter 1 sequence in the forward orientation (pPMP1CATF) consistently yielded at least 10-fold higher chloramphenicol acetyltransferase expression compared with the construct containing the promoter 1 sequence in the reverse orientation (pPMP1CATR). The promoterless vector pBLCAT3 showed a variable background, often approaching that of the construct pPMP1CATF. Nevertheless, the apparent differences in activities between the constructs containing the promoter 1 sequences in the forward versus reverse orientation, the position of promoter 1 upstream of the highly active promoter 2, the perfectly positioned (T)ATA box, and the mRNA mapping results strongly suggest that the sequences upstream of exon 1A function as a PMP22 gene promoter.

Conservation of the 5'-Regulatory Regions in the Rat and Human PMP22 Genes-In order to establish the rat as an experimental system in which to study the regulation of the two alternative PMP22 transcripts in detail, we cloned and

25802 %o Promoters for Alternative PMP22 Banscripts

FIG. 7. Functional analysis of promoters 1 and 2 in -88 fibroblast cells (A) and mitogen-expanded primary Schwann cells (B) . The relative chloramphenicol acetyltransferase activity obtained after transfection is shown for each reporter construct, pBLCAT3,

pBLCAT2, thymidine kinase core promoter; pPMPICATF, promoter 1 promoterless chloramphenicol acetyltransferase expression vector;

pPMP2CATF, promoter 2 in forward orientation; pPMP2CATR, pro- in forward orientation; pPMPICATR, promoter 1 in reverse orientation;

moter 2 in reverse orientation; pSV-CAT, simian virus-derived chloramphenicol acetyltransferase expression vector. Three independent transfections have been performed, and the results of a representative experiment are shown.

analyzed the putative regulatory region of the rat PMPZZ gene. The results demonstrate that, as anticipated from rat PMP22 cDNA comparisons (Fig. 11, the genomic structure of the PMPZZ gene with regard to exons 1A and 1B is, indeed, evolutionarily conserved in rat and human (see schematic in Fig. 2 for the region analyzed). Table I provides the sequence of the exodintron boundaries between exons 1 N l B and 2 of the rat PMP22 gene and details the sites of RNA splicing, which gives rise to the two alternative rat PMP22 mRNA transcripts. These combined findings support an important role for the observed use of alternative exons in the regulation of the PMP22 gene and prompted an examination of the quantitative expression of alternative PMP22 transcripts in various experimental paradigms.

The Expression of Alternative PMPZZ Danscripts Displays Marked Tissue Specificity-To determine the presence and relative abundance of both transcripts simultaneously, we designed human- and rat-specific riboprobes for RNase protection analysis (Fig. €24). Two riboprobes were designed for each species. Riboprobe R1 was designed to be fully complementary for -300 bp to all transcripts containing exon 1A contiguous to exon 2 and, in addition, to be complementary over -250 bp to all other PMP22 transcripts that carry exon 2 but not exon 1A (Fig. 8B). A reciprocal riboprobe, designated R2, was designed

A riboprobe R1 exon 1 ai exon 2

50 bp ' 250 bp

riboprobe R2 exon lb; exon 50bp 250 bp

AAAA

C probe R1 probe R2 n n

exon l a - 300 bp - exon 1 b

exon 1 b - 250 bp - exon 1 a u u FIG. 8. Schematic of riboprobe design. Shown is a diagram of

idealized riboprobes used in RNase protection assays to detect and quantitate the two alternatively spliced forms of PMP22 mRNA, the actual riboprobes used vary slightly with regard to the size of the fragments that they protect from RNase digestion. A shows that the differences between riboprobes R1 and R2 reside in the specificity of the

tively. B shows how each riboprobe individually (in this case, probe R1) approximately 50-bp 5"extension specific for exons la and lb, respec-

can detect and quantitate both exon la- and lb-containing transcripts that can be identified on a polyacrylamide gel as shown in C.

to be fully complementary for -300 bp to exon 1B-containing transcripts contiguous to exon 2 and complementary for -250 bp to all other PMP22 transcripts that carry exon 2 (schema- tized in Fig. 8C). RNase protection analysis for the expression of human and rat alternative PMP22 transcripts in various tissues is shown in Fig. 9. This experiment was designed to detect the ratios of the two PMP22 transcripts in tissues, no effort was made to control for tissue-specific autolysis rates in the human post-mortem samples. All tissues expressed detect- able amounts of both transcripts (Fig. 9 and data not shown). The high levels of PMP22 mRNA in rodent heart, lung, and gut have been reported previously (Manfioletti et al., 1990; Welcher et al., 1991). Differences between human and rat lung and gut PMP22 mRNA levels may reflect species differences, age differences, sampling differences, or autolysis artifact. Signifi- cantly, however, the point is that transcripts containing exon 1B are preferentially expressed in all human and rat tissues examined, except for peripheral nerve. In the rat sciatic nerve, the levels of both PMP22 transcripts are much higher than in any other tissue examined, and in contrast to non-neural tissues, the exon 1A-containing transcript is predominant, com- prising approximately 80% of total PMP22 mRNA (see quanti- fication in Figs. 1OB and 11B).

Based on the observed reciprocal pattern of expression using riboprobes R1 and R2, we inferred that alternative transcripts containing exon 1A or 1B account for most, if not all, of the PMP22 mRNA species in human and rat. To test this hypothesis more directly, we performed a quantitative analysis of five independent mRNA samples from the sciatic nerves of 60-day- old rats by RNase protection using both rat riboprobes R1 and R2 separately. Taking into account the differences in radiolabel incorporated as a function of probe length, we calculated the absolute value of the maximum contribution of exon 2-contain-

l t vo Promoters for Alternative PMP22 Tkanscripts 25803

404 bp - 297 bp - 250 bp -

432 bp-

310 bp-

255 bp -

- 416 bp

- 309 bp

-250 bp

- 437 bp

-31 4 bp

-255 bp

tissues using riboprobes R2 (A, human (hR2); and C, rat (rR2)) and R1 (B , human (hRI); and D, rat (rRI 1). 5 pg of total RNA from each tissue FIG. 9. Tissue survey of alternative PMP22 transcripts. Shown is the RNase protection of a variety of human (A and B ) and rat (C and D )

was subjected to RNase protection analysis with the indicated "P-labeled riboprobe. Yeast tRNA was used as a negative control for hybridization specificity. The various tissues examined in each species are indicated. SCG, superior cervical ganglion.

ing transcripts that were not detected as -300-bp fragments by either of the riboprobes to be 0.5 2 2%, indicating that the vast majority of PMP22 transcripts detected contain either exon 1A or 1B. These findings validate the capability of each probe alone to identify the relative proportion of each transcript. Fur- thermore, the identical tissue specificity of the expression of alternative PMP22 transcripts in rat and human as shown in Fig. 9 reiterates the similarity of the two species in the regulation of PMP22 gene expression as suggested by the similar structures of the rat and human PMP22 regulatory regions.

Regulation of the Exon 1A-containing PMP22 Dunscript Is llghtly Associated with Myelin Formation during Sciatic Nerve Development-To further investigate the regulation of alternative PMP22 transcripts, we performed an RNase protection analysis on peripheral nerve samples taken from the period of myelination that occurs during early postnatal development in the rat. These studies are complementary to Northern and Western blot studies performed previously in our laboratory (Snipes et al., 1992). We have repeated those Northern blots in this study since it is the method of choice for the quantitation of changes in total PMP22 mRNA, while the RNase protection analysis allows accurate determination of the relative amounts of the two alternative transcripts. By combining the results of both types of analyses, the total expression of each transcript at each stage of development could be determined.

Fig. 1OA (middle panel) demonstrates the dramatic increase in the expression of total PMP22 mRNA during postnatal PNS development of the rat, and Fig. 1OA (lower panel) shows that both the exon 1A-containing transcript and the exon 1B-containing transcript are regulated, at first approximation, in a time course that parallels myelination. For quantitation, the relative expression of the two transcripts was determined by two-dimensional scintillation scanning using an AMBIS gas- phase detection scintillation scanner and is shown graphically along with the autoradiographs from the RNase protections in Fig. 1OB. The results demonstrate that the exon 1A-containing transcript converts from being the minor mRNA species, accounting for approximately 30% of the total PMP22 mRNA at birth, to the major transcript, accounting for approximately

80% of the PMP22 mRNA in adult rat sciatic nerves. Further- more, from the combined quantitative analysis of the Northern blot and RNase protection data, we can estimate that the exon 1A-containing transcript is induced approximately 25-fold, while the exon 1B-containing transcript is induced only approximately 7-fold during the postnatal myelination period. Detailed analysis reveals also that the expression of the exon 1A-containing transcript seems to be more closely correlated with the process of myelination since the highest levels of the exon 1A-containing transcript are detected several weeks post- natally, while the expression of the exon 1B-containing transcript peaks at postnatal day 7.

Regulation of the Exon 1A-containing PMP22 Dunscript Is Associated with Myelin Formation during Sciatic Nerve Regeneration-In order to confirm the association between the regulation of expression of exon 1A-containing PMP22 transcripts and myelin formation, we exploited the tight regulation of myelin gene expression that occurs in the portion of a nerve distal to the site of focal nerve crush injury as the denervated nerve stump undergoes Wallerian degeneration followed by axon and myelin regeneration. RNase protection analysis of mRNA from the distal sciatic nerve of crush-lesioned rats shows a dramatic repression in the levels of the exon 1A-containing transcript to almost undetectable levels 3 days post- crush, followed by its re-expression to become the major PMP22 transcript by 21 days after injury (Fig. 1lA). This observed time course is compatible with a model in which exon 1A expression is tightly correlated with the formation of myelin and inversely correlated with the breakdown of myelin, as expected for a myelin-specific transcript. The exon 1B-containing transcript also shows a small down-regulation in the first 3-7 days following nerve injury, but not nearly as marked as that observed for the exon 1A-containing transcript. When the percentage of each transcript at each time point is plotted versus days following nerve crush injury, it is apparent that the regulation of the exon 1A-containing transcript more tightly correlates with the profound initial inhibition and later reinduction of myelin synthesis than does the regulation of the exon 1B- containing transcript (Fig. l lB , inset 1.

25804 l h o Promoters for Alternative PMP22 Banscripts

A 1 2 3 4 5 6

B PMP22 - 1.8 kb

exon 1 b.

exon l a -

310 bp

255 bp

B 2oz

I f n

I 4 31 containing exon la

." """_ containing exon 1 b

"-x

O P . , . 1 . , . , . , . 1 . 0 10 20 30 40 50 60 7

days postnatal

FIG. 10. Analysis of alternative PMP22 transcripts during the development of the rat sciatic nerve. A, total RNA was collected from the sciatic nerves of postnatal rats at the day of birth and at postnatal days 3,7,14,21, and 60 (lanes 1-6, respectively). 5 pg of each was analyzed by agarose gel electrophoresis to visualize total RNA loading (top panel), by Northern blot analysis for total PMP22 mRNA (middle panel), and by RNase protection using the rat R2 riboprobe (lower panel) to identify the relative proportion of the two alternative PMP22 transcripts. B, quantitative analysis of the Northern blot and RNase protection experiments were used to calculate the total amount of PMP22 mRNA (O), the relative amount of the exon la-containing transcripts (O), and the relative amount of exon lb-containing transcripts (x).

In summary, we conclude from the studies of PMP22 expression during development and following nerve injury that expression of the exon 1A-containing PMP22 transcript is tightly correlated with the formation of myelin. The exon 1B-containing transcript is also correlated with myelin formation, albeit to a much lesser extent.

Exon 1B-containing Dunscripts Predominate in Forskolin- induced Primary Schwann Cells-PMP22 protein is well established as a component of myelin. In the previous set of experiments, we have shown that the transcripts containing exon 1A are predominantly associated with myelin formation. In primary Schwann cells, myelin gene expression can be induced by the adenylate cyclase activator forskolin (Lemke and Chao,

al CI 3 S .- E L a, n

3 0 0

A 1 2 3 4 5 6 7

rR2 - 310bp-

255 bp-

1250-

1000-

I 0 E N 0 0 0 O Y ) * 0

days

FIG. 11. Analysis of alternative PMP22 transcripts in the distal portion of the adult rat sciatic nerve following focal crush injury. A, the results of the RNase protection of total RNA from the distal nerves at 1, 3, 7, 14,21, and 40 days (lanes 2-7, respectively) following focal sciatic nerve crush at the midthigh level. These studies were performed with the rat R2 riboprobe (rR2). Lane 1 shows the tRNA negative control. B, the results of quantitative analysis on each of the post-crush RNA samples as determined by scintillation scanning of the gel from A. The counts/minute for each transcript (containing exon la or

obtained by adding the individual contributions from the exon la and l b lb) at each time point is provided along with the total countdminute

transcripts. The inset shows the relative percentage of each transcript (as a percentage of total a t each time point) versus the number of days after focal nerve crush.

1988). It has been proposed that forskolin induces myelin gene expression in the absence of axons by acting as a partial sub- stitute for the axon-Schwann cell interactions that are responsible for the initiation of myelin formation (Lemke and Chao, 1988; but see also Morgan et al., 1991). Indeed, we and others have previously shown that PMP22 and PO mRNAs are induced by forskolin in cultured Schwann cells (Spreyer et al., 1991; Pareek et al., 1993). We have reproduced our original Schwann cell growth conditions and have examined the specificity of forskolin action on the expression of the alternative PMP22 transcripts in order to compare the results with the observed PMP22 gene regulation in vivo during the formation of myelin. Surprisingly, in triplicate experiments, both exon 1A and 1B expression appear to be induced by forskolin treatment to the same extent; the exon 1B-containing transcript clearly remains the predominant PMP22 mRNA species (data not shown). Since it has been reported that culturing Schwann cells in defined medium without serum results in both a reduced fraction of dividing cells and an enhanced induction of PO mRNA following the addition of forskolin (Morgan et al., 1991), we have repeated and extended our studies by culturing the Schwann cells in serum-containing or defined medium with and without forskolin. Fig. 12 (lower panel) shows that forskolin addition up-regulated both the exon 1A- and exon 1B-containing transcripts, with the exon 1B transcript predominat- ing. Quantitatively, the addition of forskolin to the Schwann

lluo Promoters for Alternative PMP22 Danscripts 25805

Perioh. nerve Schwann cells I - + - + [forskolin

- - -. .- ~ ~ ~ , - ~ ~ - ~ -,._ ’ ...~..

dorthern blot

FIG. 12. Effects of forskolin stimulation on the expression of alternative PMP22 transcripts in mitogen-expanded primary Schwann cells. Schwann cells were expanded in medium containing GGF, 10% FCS, and 5 PM forskolin (complete medium) and then with- drawn from GGF and forskolin for 3 days and transferred to either defined medium alone or medium supplemented with 10% FCS (indicated at the bottom of the gel; see “Experimental Procedures” for media composition) with (+) or without (-) 5 PM forskolin for a n additional 36 h. The top right panel shows the forskolin induction of PO mRNA by Northern blotting. The middle right panel shows the forskolin induction of PMP22 mRNA. The bottom right panel shows the RNase protection results from these samples using the rat R2 riboprobe. The ethidium bromide gel for total RNA is provided in the left panel. A rat sciatic nerve RNA sample (peripheral nerve (PN)) was run as a positive control for the probes.

PN - * - +

Ethidium bromide Agarose gel

cells grown in defined medium showed the expected enhance- ment in PO and PMP22 mRNA levels by Northern blot analysis when compared with the forskolin-stimulated Schwann cells that had been grown in serum-containing medium (Fig. 12). Since myelination in vivo is associated with an up-regulation of the exon 1A-containing transcript out of proportion to the up- regulation of the exon 1B-containing transcript, we conclude that the induction of PMP22 mRNA by forskolin treatment of primary Schwann cells does not closely resemble the gene regulation observed in in vivo myelination. Additional studies will be necessary to determine if there are any in vitro conditions that mimic the in vivo situation where the exon 1A-containing transcript is up-regulated out of proportion to the exon 1B- containing transcript.

Exon 1B-containing Danscripts Predominate in Growth- arrested Rat Fibroblasts-Steady-state PMP22Igas-3 mRNA levels have been correlated with cellular growth arrest induced by serum deprivation or contact inhibition of NIH 3T3 fibroblasts (Manfioletti et al., 1990). We have isolated RNA from rat embryonic fibroblasts grown under favorable growth conditions (full growth) or following growth inhibition when a greater percentage of cells are arrested in the Go phase because of serum deprivation or contact inhibition. The growth kinetics of the cultures used in this set of experiments were monitored by BrdUrd incorporation (Fig. 13B). Northern blot analysis using the rat PMP22 cDNA probe shows the expected correlation of induction of PMP22 in growth-inhibited as compared with fully growing cells (Fig. 13, A (middle panel) and B). RNase protection analysis reveals that both transcripts are up-regulated in growth-arrested cells; however, the expression of the exon 1B- containing PMP22 transcript continues to dominate in growth- arrested cells (Fig. 13A, lower panel). There is no evidence that the ratio of the two alternative PMP22 transcripts is altered

. Protein zero

U T “€7

I ”9 Northern blot

- PMP22

RNase protection

exon I b

exon l a

significantly by growth arrest under any of the conditions reported here.

DISCUSSION

In this paper, we report the cloning and characterization of the human PMP22 gene. This analysis provides the basis for the analysis of mutations affecting the PMP22 gene in hereditary motor and sensory neuropathies, in particular Charcot- Marie-Tooth disease and Dejerine-Sottas disease. Since the un- derlying anomaly in the majority of hereditary motor and sensory neuropathy and HNPP patients appears to be altered levels of PMP22 due to a gene dosage effect (Lupski et al., 1992; Chance et al., 1993), the identification and preliminary characterization of regulatory regions of the PMP22 gene may also constitute the first step toward potential novel treatment strat- egies for these particular neuromuscular disorders (Roa and Lupski, 1993).

We hypothesized from the isolation of several human and rat PMP22 cDNA species with variable 5’-ends that the PMP22 gene might be regulated by alternative promoters. The characterization of the human PMP22 gene and partial analysis of the rat PMP22 gene provided evidence to support this hypothesis with the identification of two upstream noncoding exons, 1A and lB, which display remarkable interspecies sequence similarity. Primer extension and RNase protection studies allowed mapping of the transcription initiation sites of each of the two hypothesized human PMP22 mRNA species and suggested the presence of the two alternative promoter regions. Functional promoter analysis by transfection into a fibroblast cell line and primary mitogen-expanded Schwann cells demonstrated that DNA sequences upstream of exon 1B (promoter 2) directed high levels of reporter gene expression in both cell culture systems, while only weak activity could be detected for sequences up-

25806 Tiuo Promoters for Alternative PMP22 Dunscripts

A hrs serum days deprivation confluent -

FIG. 13. Regulation of alternative PMP22 transcripts in rat embryonic fibroblasts in vitro during serum deprivation and in confluent cell culture. The details of the experiment are provided under “Experimental Procedures.” Briefly, rat embryonic fibroblast cells were plated a t approximately 30% confluency and grown overnight before chang- ing the medium from 10 to 0% fetal calf serum and were grown for the indicated times (left portions of A and B ) before the cells were either harvested for mRNA or labeled for an additional 2 h with BrdUrd. At the end of the 72 h, the cells were refed with medium containing 10% FCS for an additional 24 h. An experiment in which rat embryonic fibroblast cells were plated at 50% confluency and allowed to grow with media changes every 2 days is shown (right portions ofA and B) . The cells were harvested every 48 h for RNA and also labeled at these times with BrdUrd. In A, the top panel shows the ethidium-stained agarose gel comparing total RNA. The middle panel is a Northern blot showing the induction of PMP22 under the various culture conditions. The lowerpanel shows the results of the RNase protection using the rat R2 riboprobe (rR2). In the lower panel, lane 1 shows the labeled riboprobe, lane 2 is the tRNA negative control, lanes 3-14 correspond to the samples above in ._ 30 the upper panels, and lane 15 is again a tRNA control. In B, the results of the BrdUrd labeling of the rat embryonic fi- .- broblast cells at the t ime points and cul- j 20 ture conditions that correspond to the RNA analyses in A are shown. The 96-h 3 time point in the serum deprivation panel P corresponds to 72 h of exposure to serum-

m

free culture medium followed by refeeding with medium containing 10% FCS for an additional 24 h.

6 40

W u 3

W

-

- Q

8 10

PMP22 -1.8 kb

1 2 3 4 5 6 7 8 9 10 11 12131415 . . r R2

- 432 bp

-310 bp

- 255 bp

Confluent growth arrest Serum deprivation

T 1 7- 1

T

1 T

:I 2 s Hours

T

t 6 1 0 1 N t. D 00 d 0 2 4 W m

Days

stream of exon 1A (promoter 1). Several reasons can be envisaged for the weak activity of

promoter 1 in transfection assays. A trivial explanation would be that regulatory regions important for the expression of promoter 1 are missing in the transfection constructs. Alterna- tively, the presence of a (T)ATA-like sequence located at position -30 indicates a well defined and probably tightly regulated, tissue-specific promoter that might not be efficiently activated in cultured fibroblasts or Schwann cells. To address this question, we examined the activity of the two PMP22 gene promoters in different cell types by characterizing the endoge- nous expression patterns of the two PMP22 transcripts in vitro and in vivo. I t should be emphasized that our approach was focused on the measurement of steady-state mRNA levels and does not exclude the contribution of differential mRNA stability, potentially conferred by differences in the evolutionarily conserved 5’4eader sequences of the two alternative PMP22 transcripts. Our results show that the alternative PMP22 transcripts are expressed in a tissue and cell type-specific manner and that they are regulated during the development and regeneration of the sciatic nerve. Schwann cells that elaborate PNS myelin express high levels of the exon lbcontaining

PMP22 transcript, while exon 1B-containing mRNA is predominant in other cell types. During postnatal PNS development, the expression of the exon 1A-carrying transcript is induced approximately 25-fold and correlates tightly with the formation of myelin, while the exon 1B-carrying transcript is induced to a much lesser extent during the same time period.

Numerous studies have established that myelin gene expression by Schwann cells is critically dependent on the presence of axons (Politis et al., 1982; Lemke and Chao, 1988). In pure Schwann cell cultures, forskolin has been shown to up-regulate the expression of the PO gene that encodes for the major protein component of peripheral nerve myelin (Lemke and Chao, 1988). These and similar findings have led to the hypothesis that forskolin can replace the requirement of axonal contact for myelin gene expression in Schwann cells and indirectly implicated the CAMP pathway in the signal transduction cascade leading to myelin gene expression (Sobue et al., 1986; Lemke and Chao, 1988). Our results indicate, however, that the regulation of the PMP22 gene during myelin formation in vivo occurs by preferential induction of the exon 1A-containing transcripts compared with the exon 1B-containing transcripts. In contrast, forskolin stimulation of primary Schwann cells el-

‘Ituo Promoters for Alternative PMP22 nanscripts 25807

evates the levels of both transcripts essentially equally. Al- though we have found potential CAMP-responsive elements in the promoter regions of PMP22, consistent with a model of transcriptional regulation of PMP22 by CAMP, it is also possible that forskolin up-regulates PMP22 mRNA in Schwann cells by selectively stabilizing PMP22 mRNA in a fashion analogous to the CAMP-dependent regulation of renin mRNA stability (Chen et al., 1993). In either case, our finding suggests that forskolin can only partially mimic the effects of axonal contact on PMP22 induction, although extensive comparative studies on the regulation of the expression of alternative PMP22 exons and other myelin proteins (e.g. PO) under various culture conditions will be required to gain further insights into the significance of myelin gene regulation by forskolin in vitro.

The exon 1B-containing transcript is expressed at higher levels in cultured Schwann cells than the exon 1A-containing transcript, consistent with the much stronger activity of promoter 2 compared with promoter 1 in transfected forskolin- treated Schwann cells. It may be possible to increase the activity of PMP22 promoter 1 in vitro by optimizing Schwann cell culture conditions for the expression of the major PNS myelin protein PO (Morgan et al., 1991) or by developing myelinating co-cultures of Schwann cells and appropriate neurons (Owens et al., 1990). However, due to the relatively poor efficiency of myelination in vitro and the complex mechanisms involved in myelin gene regulation, it appears likely that in vivo models using appropriate reporter constructs in transgenic mice will ultimately be required to define the regulatory elements of promoter 1 and to resolve the relative contributions of the two promoters during myelin formation.

Mouse PMP22 has been shown to be identical to the growth- arrest specific gene, gas-3 (Suter et al., 1992131, whose mRNA is up-regulated in quiescent NIH 3T3 cells by contact inhibition and serum deprivation (Schneider et al., 1988). Our results indicate that this regulation of PMP22 mRNA in rat embryonic fibroblasts is not as striking as has been reported in NIH 3T3 cells. Comparison of the growth kinetics of the two cell types reveals two differences. First, more NIH 3T3 cells are labeled in the fully growing phase, and second, a greater degree of growth arrest is observed in the NIH 3T3 cells. We believe that the induction reported here is still significant because it correlates with the labeling index of the rat embryonic fibroblasts, it is qualitatively similar to that reported for the NIH 3T3 cells, and we have observed similar changes in a variety of cell types including C6 glioma cells, human and rat dermal fibroblasts, and rat 2 cells.’ Thus, this type of PMP22 regulation appears to be a widespread phenomenon, although its specificity and significance remain uncertain. When we examined the induction of PMP22 mRNA in the rat embryonic fibroblasts by RNase protection, we were unable to detect a major shift in the ratio of the alternative 5’-exons that might indicate transcriptional regulation. This is consistent with the previous findings of Manfioletti et al. (19901, who examined the induction of gas-3 (PMP22) in fibroblasts by nuclear run-off assays and observed no change in the rate of transcription of PMP22 in growth- arrested cells. It appears that up-regulation of the steady-state levels of PMP22/gas-3 mRNA in cultured NIH 3T3 cells by cellular growth arrest is mainly due to alterations in total PMP22 mRNA stability, which agrees with our finding that the ratio of the two transcripts is apparently not altered during cellular growth arrest. Thus, there seems to be post-transcriptional regulation of PMP22 mRNA in fibroblasts in vitro in addition to the apparent transcriptional regulation of PMP22 mRNA in myelinating Schwann cells in vivo.

U. Suter and G. J. Snipes, unpublished observations.

The validity of the two-promoter model for the human PMPZZ gene is strongly supported by the complete conservation of this genomic arrangement between the human and rat PMP22 genes, but the exact biological importance of this specific gene organization remains to be determined. Gene regulation by multiple promoters is commonly associated with tissue-specific, or inducible, or ubiquitous gene expression. The regulation of the PMPZZ gene may reflect several of these mechanisms since PMP22 expression is inducible and develop- mentally regulated, but also quite widespread. Curiously, these different regulatory modes of gene regulation seem to parallel a previously hypothesized dual function of PMP22. On one hand, a major function for PMP22 in the formation and main- tenance of the myelin sheath is inferred from studies of the phenotypes of the various mutated forms of PMP22. The Schwann cell-specific function in vivo is generally associated with the regulation of both exon 1A- and 1B-containing transcripts, with a much more pronounced regulation of the exon 1A-containing transcript during myelination. On the other hand, PMP22 mRNA can also be found in many tissues outside of the peripheral nerve. We originally hypothesized that PMP22 transcripts detected in these non-neural tissues might be due to contamination by peripheral nerve innervation. The findings presented in this report do not support this view since the exon 1B-containing transcript is predominantly expressed in non-neural PMP22-expressing tissues. Thus, our results have uncoupled the regulation of PMP22 in myelin-forming Schwann cells and in other cell types. We hypothesize that the differential regulation of the PMP22 gene by different promoters might directly correlate with potential multiple functions of the PMP22 protein, one in myelinating Schwann cells and the other in non-myelin-forming cells, as suggested by indirect evidence for other myelin proteins (Schneider et al., 1992).

The extremely high sequence conservation observed between the respective exons 1A and 1B of the human and rat genes suggests that the 5’-untranslated regions might subserve an important function besides their role in facilitating alternative promoter regulation. It has been demonstrated that the use of alternate 5’-untranslated regions can dictate the translational discrimination of mRNAs coding for human insulin-like growth factor I1 (Nielsen et al., 1990) and can also lead to differential regulation at the translational level of the complement protein C2 (Horiuchi et al., 1990). Although differential translatability remains a formal possibility, so far we have observed that the total level of PMP22 mRNA, irrespective of which transcript predominates, correlates with protein expression in all circum- stances examined, which include during myelin formation during development and during Wallerian degeneration (Snipes et al., 19921, in forskolin-stimulated Schwann cells (Pareek et al., 1993), and in growth-arrested fibroblast^.^ So far, it has not been possible to detect or quantitate PMP22 protein in non- neural tissues. Alternatively, these conserved sequences could be involved in the regulation of PMP22 mRNA stability given the finding that PMP22/gas-3 mRNA expression in growth- arrested NIH 3T3 fibroblasts is strongly regulated at the post- transcriptional level. Again, however, there is no evidence that either transcript is stabilized over the other during growth inhibition.

The analysis of the primary sequence of the two alternative PMP22 promoters provides some hints toward their specific regulation. The promoter 1 structure is similar to tissue-specific promoters with a non-canonical (T)ATA box at the optimal distance of 30 bp upstream of the major transcription initiation site. In addition, an inverted CCAAT box is found upstream of the (TIATA box. Interestingly, the sequence around the tran-

s. Pareek et al., unpublished observations.

25808 l b o Promoters for Alternative PMP22 Dunscripts

scription initiation site, TCAG is also found at the same or a similar position in several other myelin protein genes including the PO gene (Lemke et al., 1988), the myelin basic protein gene (Gow et al., 1992), and the proteolipid protein gene (MacMin et al., 1987). It is tantalizing to speculate that coordinate myelin gene transcription might involve a regulatory step using a common “initiator site” (Cherbas and Cherbas, 1993). Promoter 2 displays several features of a “housekeeping” gene promoter. No TATA-like sequence is obvious, and a generally high GIC content (62% compared to 50% in promoter 1) can be found in the first 352 bp upstream of the transcription initiation site. In addition, there is a consensus sequence for an Sp-1-binding site, a transcription factor that is often involved in the regulation of housekeeping genes.

One of the goals of this study was to begin to dissect the regulation of the PMP22 gene in order to gain a better appre- ciation for the hypothesized dosage effect of PMP22 in CMTl and HNPP. Toward this end we have determined that the regulation of the exon Id-containing transcript is the major site of control for PMP22 mRNA expression in peripheral nerves, the tissue most affected by known mutations of the PMP.22 gene. If altered dosage of PMP22 mRNA truly leads to both CMTl and HNPP, the findings presented here lead to the prediction that there might be a subset of patients who, clinically, will have CMTl by virtue of mutations in the regulatory regions govern- ing the expression of exon 1A. Further studies will be necessary to identify such regulatory factors in order to confirm this hypothesis.

Acknowledgments-We thank Jacynthe Lalibert6 and Corinne Zgraggen for excellent technical assistance and Dr. Helen Stewart (Uni- versity College, London) for advice on Schwann cell cultures.

REFERENCES

Aoyama, A,, Tamura, T., and Mikoshiba, K. (1990) Biochem. Biophys. Res. Com-

Berndt, J. A., Kim, J. G., and Hudson, L. D. (1992) J. Biol. Chem. 267,14730-14737

Chance, P. F., Alderson, M. K., Leppig, K. A,, Lensch, M. W., Matsunami, N., Smith, Brockes, J. P., Fields, K. L., and RaR, M. C. (1979) Brain Res. 165, 105-118

B., Swanson, P. D., Odelberg, S. J., Disteche, C. M., and Bird, T. D. (1993) Cell

Chen, M., Schnermann, J., Smart, A. M., Brosius, F. C., Killen, P. D., and Briggs, 72,143-151

Cherbas, L., and Cherbas, P. (1993) Insect Biochem. Mol. Biol. 23, 81-90 J. P. (1993) J. Biol. Chem. 268,24138-24144

Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159 De Leon, M., Welcher, A. A,, Suter, U., and Shooter, E. M. (1991) J. Neurosci. Res.

Edomi, P., Martinotti, A,, Colombo, M. P., and Schneider, C. (1993) Gene (Amst.

Fors, L., Hood, L., and Saavedra, R. A. (1993) J. Neurochem. 60,513-521 Fuscoe, J. C., Fenwick, R. G., Ledbetter, D. H., and Caskey, C. T. (1983) Mol. Cell.

Gorman, C. L.. Moffat, L., and Howard, B. (1982) Mol. Cell. Biol. 2, 104P1050

Graham, F. L., and van der Erb, A. J. (1973) Virology 52,45&467 Gow, A,, Friedrich, V. L., Jr. and Lazzarini, R. A. (1992) J. Cell Biol. 119,605416

Hayasaka, K., Himoro, M., Nanao, K., Sato, W., Miura, M., Uyemura, K., Taka-

Hoogendijk, J. E., Hensels, G. W., Gabreels-Festen, A. A. W. M., Gabreels, F. J. M., hashi, E., and Takada, G. (1992) Biochem. Biophys. Res. Commun. 186,827-831

Janssen, E. A. M., De Jonghe, P., Martin, J. J., van Broeckhoven, C., Valentijn, L. J., Baas, F., De Vlsser, M., and Bolhuis, P. A. (1992) Lancet 339, 1081-1082

Horiuchi. T.. Macon. K. J., Kidd, V. J., and Volanakis, J. E. (1990) J. Biol. Chem.

mun. 167,648-653

29,437448

126,289-290

Biol. 3, 1086-1096

285, 652i-6524 Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 61,251-260 Ionasescu, V. V., Ionasescu, R., and Searby, C. (1993) Muscle & Nerue 16, 1232-

1238 Kitamura, K., Suzuki, M., and Uyemura, K. (1976) Biochim. Biophys. Acta 455,

Kuhn, G., Lie, A,, Wilms, S., and Muller, H. W. (1993) Glia 8, 256-264 Lemke, G., and Chao, M. (1988) Development (Caomb.) 102,499-504

806-816

Lemke, G., Lamar, E., and Patterson, J. (1988) Neuron 1, 73-83

Lupski, J. R., de Oca Luna, R. M., Slaugenhaupt, S., Pentao, L., Guzzetta, V., Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 16, 5490

Trask, B. J., Saucedocardenas, O., Barker, D. F., Killian, J. M., Garcia, C. A,,

Lupski, J. R., Wise, C. A,, Kuwano, A., Pentau, L., Parke, J. T., Glace, D. G., Chakravarti, A,, and Patel, P. I. (1991) Cell 66, 219-232

Ledbetter, D. H., Greenberg, F., and Patel, P. I. (1992) Nature Genet. 1, 29-33 Lupski, J. R., Chance, P. F., and Garcia, C. A. (1993) JAMA 270,2326-2330 Macklin, W. B., Campagnoni, C. W., Deininger, P. L., and Gardinier, M. V. (1987) J.

Neurosci. Res. 18, 383-394 Manfioletti, G., Ruaro, M. E., Del Sal, G., Philipson, L., and Schneider, C. (1990)

Mol. Cell. Biol. 10, 2924-2930 Matsunami, N., Smith, B., Ballard, L., Lensch, M. W., Robertson, M., Albertsen, H.,

Hanemann, C. O., Muller, H. W., Bird, T. D., White, R., and Chance, P. F. (1992) Nature Genet. 1, 176-179

McKnight, S. L., and KingbuIy, R. (1982) Science 217,316-324 Morgan, L., Jessen, K. R., and Mirsky, R. (1991) J. Cell Biol. 112,457-467 Mount, S. M. (1982) Nucleic Acids Res. 10,459471 Nave, K-A,, and Lemke, G. (1991) J. Neurosci. 11,30603069 Nicholson, G. A,, Valentijn, L. J., Cherryson, A. K., Kennerson, M. L., Bragg, T. L.,

DeKroon, R. M., Ross, D. A,, Pollard, J. D., Mcleod, J. G., Bolhuis, P. A,, and Bass, F. (1994) Nature Genet. 6,263-266

Nielson, F. C., Gammeltoft, S., and Christiansen, J. (1990) J. Biol. Chem. 268, 13431-13434

Owens, G. C., Boyd, C. J., Bunge, R. P., and Salzer, J. L. (1990) J. Cell Biol. 111, 1171-1182

Pareek, S., Suter, U., Snipes, G. J., Welcher, A. A,, Shooter, E. M., and Murphy, R. A. (1993) J. Biol. Chem. 268,10372-10379

Patel, P. I., and Lupski, J. R. (1994) fiends Genet. 10,128-133 Patel, P. I., Roa, B. B., Welcher, A. A., Schoener-Scott, R., Trask, B. J., Pentao, L.,

Snipes, G. J., Garcia, C. A,, Francke, U., Shooter, E. M., Lupski, J. R., and Suter, U. (1992) Nature Genet. 1,159-165

Politis, M. J., Stemberger, N., Ederle, K., and Spencer, P. S. (1982) J. Neurosci. 2,

Raeymaekers, P., Timmerman, V., Nelis, E., De Jonghe, P., Hoogendijk, J. E., Baas, 1252-1266

F., Barker, D. F., Martin, J. J., De Visser, M., Bolhuis, P. A,, and van Broeck- hoven, C . (1991) Neuromuscular Disorders 1, 93-97

Roa, B. B., and Lupski, J. R. (1993)Am. J. Med. Sci. 306,177-184 Roa, B. B., Dyck, P. J., Marks, H. G., Chance, P. F., and Lupski, J. R. (1993a)Nature

Roa, B. B., Garcia, C. A,, Pentao, L., Killian, J. M., Trask, B. J., Suter, U., Snipes, Genet. 6, 269-273

Nature Genet. 6,189-194 G. J., Ortiz-Lopez, R., Shooter, E. M., Patel, P. I., and Lupski, J. R. (1993b)

Roa, B. B., Garcia, C. A,, Suter, U., Kulpa, D. A,, Wise, C . A,, Mueller, J., Welcher, A. A,, Snipes, G. J., Shooter, E. M., Patel, P. I., and Lupski, J. R. (1993~) N. Engl. J. Med. 329,96-101

Schneider, C., King, R. M., and Philipson, L. (1988) Cell 54,787-792 Schneider, A,, Montague, P., Griffiths, I., Fanarranga, M., Kennedy, P., Bmphy, P.,

Snipes, G. J., Suter, U., Welcher, A. A., and Shooter, E. M. (1992) J. Cell Biol. 117,

Snipes, G. J., Suter, U., and Shooter, E. M. (1993) Cum Opin. Neurobiol. 3,694-702 Sobue, G., Shuman, S., and Pleasure, D. (1986) Brain Res. 362,23-32 Spreyer, P., Kuhn, G., Hanemann, C. O., Gillen, C., Schaal, H., Kuhn, R., Lemke,

G., and Muller, H. W. (1991) EMBO J. 10,366143668 Suter, U., and Patel, P. I. (1994) Hum. Mutat. 3,95-102 Suter, U., Moskow, J. J., Welcher, A. A,, Snipes, G. J., Kosaras, B., Sidman, R. L.,

Buchberg, A. M., and Shooter, E. M. (1992a) Proc. Natl. Acad. Sci. U. S . A. 89, 43824386

Suter, U., Welcher, A. A., Ozcelik, T., Snipes, G. J., Kosaras, B., Francke, U., Billings, G. S., Sidman, R. L., and Shooter, E. M. (1992b) Nature 356, 241-244

Suter, U., Welcher, A. A., and Snipes, G. J. (1993) fiends Neurosci. 16,50-56 Tamura. T.. Miura. M.. Ikenaka. K.. and Mikoshiba, K. (1988) Nucleic Acids Res.

and Nave, K.-A. (1992) Nature 358,758-761

225-238

Timmerman, V., Nelis, E., Van Hul, W., Nieuwenhuijsen, B. W., Chen, K. L., Wang, 16, 11441-11459 ’

S., Ben Othman, K., Cullen, B., Leach, R. J., Hanemann, C. O., De Jonghe, P., Raeymaekers, P., van Ommen, G.J. B., Martin, J.J., Muller, H. W., Vance, J. M., Fischbeck, K. H., andVan Broeckhoven, C . (1992) Nature Genet. 1,171-175

Valentiin. L. J.. Bass. F.. Wolteman. R. A,, Hooeendiik, J. E., van den Bosch, N. H. A., io,, I.,’ Gabreels-Festen, A: A. W . M.,-de Gisser, hi., and Bolhuis, P. A.

Valentijn, L. J., Bolhuis, P. A,, Zom, I., Hoogendijk, J. E., van den Bosch, N., (1992a) Nature Genet. 2,288-291

Hensels, G. W., Stanton, V. P., Jr., Housman, D. E., Fischbeck, K. H., Ross, D. A,, Nicholson, G. A,, Meershock, E. J., Dauwerse, H. G., van Ommen, G.-J. B.,

Welcher, A. A,, Suter, U., De Leon, M., Snipes, G. J., and Shooter, E. M. (1991) Proc. and Bass, F. (199213) Nature Genet. 1,16&170

Wise, C. A,, Garcia, C. A,, Davis, S. N., Heju, Z., Pentao, L., Patel, P. I., and Lupski, Natl. Acad. Sci. U. S. A. 88,7195-7199

Woods, A. C., and Couchman, J. R. (1992) J. Cell Sci. 101,277-290 J. R. (1993)Am. J. Hum. Genet. 53,853-863

Zhang, X., and Miskimins, R. (1993) J. Neurochem. 60,2010-2017

regulation of tissue-specific expression of alternative peripheral

Documents