Regulation of telomere length and

telomerase during human multistep

hepatocarcinogenesis

Young-Joo Kim

Department of Medical Science

The Graduate School, Yonsei University

Regulation of telomere length and

telomerase during human multistep

hepatocarcinogenesis

Directed by Professor Young Nyun Park

The Master’s Thesis submitted to the Department of Medical Science, the Graduate School of Yonsei

University in partial fulfillment of the requirements for the degree of Master of Medical Science

Young-Joo Kim

December 2004

This certifies that theMaster’s Thesis of

Young-Joo Kim is approved.

The Graduate School

Yonsei University

December 2004

Thesis Supervisor : Young Nyun Park

Bong-Kyeong Oh

Kwang-Hyub Han

Acknowledgements

본 논문이 완성되기까지 부족한 저를 세심한 배려와

깊은 관심으로 이끌어 주신 박영년 교수님과 오봉경

교수님께 진심으로 감사를 드립니다. 좋은 조언으로

논문을 심사해 주신 한광협 교수님께도 감사 드립니다.

그리고 어려운 일이 있을 때마다 물심 양면으로 도와주신

병리학 교실 선생님들께도 감사를 드립니다. 특히 처음

실험실에 들어왔을 때 잘 적응 할 수 있도록 옆에서

지켜봐 주신 광조 형님께도 감사 드립니다. 저희가

필요로 하는 실험 기자재를 흔쾌히 사용하도록 도와주신

안용호 교수님과, 실험에 대한 조언과 격려를 해 주신

김건홍 교수님께도 감사를 드립니다.

언제나 저를 위해 기도해 주시는 할머니와 지금은 하늘

나라에 계신 할아버지께 고개 숙여 감사 드리고, 저의

뒷바라지 때문에 늙어가시는 부모님께도 감사 드립니다.

힘든 학교 생활을 웃을 수 있게 해준 고마운

친구들에게도 감사하고, 이 모든 분들의 은혜에

보답하고자 앞으로도 열심히 노력하겠습니다.

저자 씀

Table of contents

ABSTRACT ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥1

Ⅰ. INTRODUCTION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥3

Ⅱ. MATERIALS AND METHODS ‥‥‥‥‥‥‥‥‥‥‥ 6

1. Tissue samples ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 6

2. Total RNA isolation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 7

3. cDNA synthesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 8

4. Genomic DNA isolation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 9

5. Real-time quantitative PCR ‥‥‥‥‥‥‥‥‥‥‥‥ 9

A. cDNA amplification ‥‥‥‥‥‥‥‥‥‥‥‥‥‥12

B. Gene amplification ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 15

6. Southern hybridization analysis ‥‥‥‥‥‥‥‥‥‥ 17

A. Analysis of telomere length ‥‥‥‥‥‥‥‥‥‥‥17

B. Analysis of hTERT gene copy number ‥‥‥‥‥‥ 18

Ⅲ. RESULTS ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥20

1. Upregulation of TRF1, TRF2 and TIN2 mRNA in human

multistep hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥20

2. Telomere shortening during human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 24

3. TRF1, TRF2 and TIN2 in relation to telomere length

regulation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥26

4. Upregulation of hTERT mRNA in human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥28

5. The number of hTERT gene copies in human multistep

hepatocarcinogenesis‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥28

Ⅳ. DISCUSSION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥33

Ⅴ. CONCLUSION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 36

REFERENCES ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥37

ABSTRACT (in Korean) ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 42

List of Figures

Figure 1. Microscopic feature of human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥ 7

Figure 2. Principle of the TaqMan methodology ‥‥‥‥‥‥ 11

Figure 3. Amplification profiles and standard curves by real-time

quantitative PCR ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 14

Figure 4. Expression of the telomeric repeat binding factor 1

(TRF1), TRF2 and TRF1-interacting nuclear protein 2

(TIN2) mRNA in human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥23

Figure 5. Comparison of each telomere length in human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥ 25

Figure 6. Comparison of the telomeric repeat binding factor 1

(TRF1), TRF2 and TRF1-interacting nuclear protein 2

(TIN2) mRNA levels with telomere length

in human multistep hepatocarcinogenesis ‥‥‥‥ 27

Figure 7. Expression of the human telomerase reverse

transcriptase (hTERT) mRNA in human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥ 30

Figure 8. Status of the human telomerase reverse transcriptase

(hTERT) gene in human multistep hepatocarcinogenesis

‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 31

Figure 9. Southern blot analysis for the status of the human

telomerase reverse transcriptase (hTERT) gene

‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 32

List of Tables

Table 1. Oligonucleotide primer and probe sequences used for

real-time quantitative PCR analysis‥‥‥‥‥‥‥‥16

Table 2. Summary of the telomeric repeat binding factor 1 (TRF1),

TRF2, TRF1-interacting nuclear protein 2 (TIN2) mRNA

levels and telomere length in human multistep

hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥22

Table 3. Comparison between the human telomerase reverse

transcriptase (hTERT) mRNA level and its gene copy

number in hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥29

1

ABSTRACT

Regulation of telomere length and telomerase during human multistep

hepatocarcinogenesis

Young-Joo Kim

Department of Medical Science

The Graduate School, Yonsei University

(Directed by Professor Young Nyun Park)

Aims : There is increasing evidence of human multistep hepatocarcinogenesis and

dysplastic nodules (DNs) are considered to be preneoplastic lesion. Telomere

shortening and telomerase reactivation is an important early event of

hepatocarcinogenesis, however their regulation mechanism is still unknown. The

telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear

protein 2 (TIN2) are involved in telomere maintenance. Here we describe the

regulation of these genes expression along with their relationship to the telomere

length in multistep hepatocarcinogenesis. We also determined mRNA level of

human telomerase reverse transcriptase (hTERT), a catalytic component of

telomerase, and the hTERT gene dosages in multistep hepatocarcinogenesis, and

subsequently analyzed their relationship.

Meterials and Methods : There were 9 normal livers, 14 chronic hepatitis (CH), 24

liver cirrhosis (LC), 5 large regenerative nodules (LRN), 14 low grade dysplastic

nodules (DNs), 7 high grade DNs, 10 DNs with hepatocellular carcinoma (HCC)

foci and 31 HCCs. The transcriptional expressions of TRF1, TRF2, TIN2 and

hTERT were examined by real-time quantitative PCR and the telomere lengths were

2

measured by southern hybridization. The gene copy number of hTERT was

evaluated by real-time quantitative PCR and confirmed by southern hybridization.

Results : A marked increase in TRF1, TRF2 and TIN2 mRNA levels was found in

the high grade DNs and DNs with HCC foci and a further increase was observed in

HCCs. Most lesions (52/67) had shorter telomeres than their adjacent CHs or LCs,

and their telomeres were inversely correlated with the mRNA level of these genes

(p≤0.001). This negative correlation was more evident in the early stages of

hepatocarcinogenesis of low grade DNs, high grade DNs and DNs with HCC foci.

The hTERT mRNA was progressively increased during hepatocarcinogenesis, and a

great induction was found in DNs. In contrast, the hTERT gene, located at 5p15.33,

was not numerically varied. There was no significant correlation between the hTERT

mRNA level and its gene copy number.

Conclusion : Our results suggest that the upregulation of TRF1, TRF2 and TIN2

have a negative regulatory influence over the telomere length during the

hepatocarcinogenesis and increase of the hTERT mRNA occurred in the early stages

of hepatocarcinogenesis, but its induction was unlikely regulated by the genetic

alteration.

Key words : Telomere, telomeric repeat binding factor 1, telomeric repeat binding

factor 2, TRF1-interacting nuclear protein 2, human telomerase reverse

transcriptase, hepatocellular carcinoma, dysplastic nodule

3

Regulation of telomere length and telomerase during human multistep

hepatocarcinogenesis

Young-Joo Kim

Department of Medical Science

The Graduate School, Yonsei University

(Directed by Professor Young Nyun Park)

I. Introduction

Telomeres, the specialized nucleoprotein complexes at the ends of linear

chromosomes, consist of multi-kilobase tandem arrays of double-stranded TTAGGG

repeats, a single-stranded overhang of the G rich 3’ strand and associated proteins. 1-4

This complexes distinguish natural chromosome ends from broken DNA, protecting

chromosome ends from end-to-end fusion and preventing the activation of a DNA

damage response. 5-7 In somatic human cells, telomeres shorten during cell division

until they reach a critical length at which they are no longer able to be protective and

enter replicative senescence. In contrast, most transformed cells including tumor

cells maintain short but stable telomeres by activating telomerase. Therefore, the

telomere maintenance along with telomerase activation has been suggested as a

general mechanism of tumorigenesis.8

The 3’ telomeric DNA single stranded overhang is apparently buried in the t-

loop form with telomeric proteins bound to stabilize the t-loop junction.9 The

telomeric repeat binding factor 1 (TRF1) and -2 (TRF2) directly bind to the double-

stranded region of the telomere and play important roles in the t-loop structure.4, 10

Growing evidence has shown that these proteins are involved in telomere

4

maintenance by acting as negative regulators. The expression of TRF1 is considered

to link to telomere length, acts as negative regulator by limiting the access of

telomerase to the telomere and mediates the interaction of the telomere with a

mitotic spindle.11-12 TRF2 is related to karyotypic stability13 and leads to the

progressive shortening of the telomere length.14 TRF1-interacting protein 2 (TIN2)

plays a negative regulator of telomere length in accordance with a previous study of

TIN2 truncation mutant.15

Several reports have described the upregulation of TRF1, TRF2 and TIN2 in

lung cancer,16 gastric cancer,17 and that of TRF2 in lymphomas.18 In contrast,

downregulation of these genes has been reported in breast cancers,19 gastric

cancers20 and malignant hematopoietic cells.21

Telomerase is a ribonucleoprotein enzyme which synthesizes telomeres after

cell division and maintains chromosomal stability.22, 23 The enzyme is active in 70-

90% of malignant tissue and many immortal cell lines. The fundamental components

of telomerase have been identified as the reverse transcriptase (hTERT), the RNA

template (hTR) and the telomerase associated proteins.24 Of these hTR and

telomerase associated proteins are expressed ubiquitously in both normal and

cancerous tissue,25 whereas hTERT is detectable in tumor cells but not in normal

somatic cells. 24 And hTERT is the rate-limiting component of telomerase, because

the level of hTERT expression is correlated to telomerase activity. The hTERT gene

is localized at 5p15.33.26

Hepatocellular carcinoma (HCC) is the seventh most common cancer and

accounts for the highest number of adult malignancies in those areas endemic for the

hepatitis B virus. There is increasing evidence of a multistep process in human

hepatocarcinogenesis, emphasizing the preneoplastic nature of large nodules, which

are referred as dysplastic nodules (DNs) or adenomatous hyperplasia, usually found

in a cirrhotic liver.27 DNs, especially high grade DNs, are believed to be

preneoplastic lesions, although the nature of low grade DNs appears less resolved

than that of high grade DNs.

5

Telomere shortening and telomerase activation, which is important for

carcinogenesis, has been observed in HCCs.28-33 A previous study demonstrated that

telomere shortening and telomerase activation occur in DNs during the early stages

of hepatocarcinogenesis with a significant change in the transition of low grade DNs

to high grade DNs.34 However, the expression levels of telomeric repeat binding

proteins as well as their relationship with the telomere length during multistep

hepatocarcinogenesis have not been examined. In order to address these issues, the

mRNA levels of TRF1, TRF2 and TIN2 were examined using real-time quantitative

PCR in normal livers, livers with chronic hepatitis, cirrhosis, large regenerative

nodules (LRNs), low grade DNs, high grade DNs, DNs with HCC foci and HCCs.

These mRNAs were subsequently compared with the telomere length, which was

measured by southern hybridization, in multistep hepatocarcinogenesis, and then

with the pathological parameters, such as the differentiation, mitotic activity and

tumor size of HCCs. We also determined both hTERT mRNA level correlated to

telomerase activity and hTERT gene copy numbers in above lesions, and then

subsequently analyzed their relationship.

6

Ⅱ. Materials and Methods

1. Tissue samples

Nine normal liver tissues (Nr), 14 chronic hepatitis (CH), 24 liver cirrhosis

(LC), 5 large regenerative nodules (LRN), 14 low grade dysplastic nodules (DNs), 7

high grade DNs, 10 DNs with hepatocellular carcinoma (HCC) foci and 31 HCCs

were obtained from 47 patients undergoing surgery and analyzed for TRF1, TRF2

and TIN2. Among them, 6 Nr, 6 CH, 15 LC, 4 LRN, 11 low grade DN, 7 high grade

DN, 10 DN with HCC foci and 16 HCC samples were analyzed for hTERT. The

tissues were immediately frozen in liquid nitrogen and stored at -80°C until use. The

diagnostic classification of the nodular lesions was subdivided into the following 5

groups: 1) LRN, 2) low grade DN, 3) high grade DN, 4) DN with HCC foci, and 5)

HCC according to the standard criteria of an international working party27 (Figure 1).

In this study, the term ‘others’ denotes the patients who have only two lesions, HCC

and their adjacent CH/ LC.

7

Figure 1. Microscopic features of human multistep hepatocarcinogenesis. Low grade dysplastic nodule (A), high grade dysplastic nodule with small liver cell dysplasia (B), dysplastic nodule with hepatocellular carcinoma foci in right lower part (C), and hepatocellular carcinoma with trabecular pattern (D) (H-E, original magnification ×200).

2.Total RNA isolation

The frozen tissues were stored in RNAlater™ (Ambion, Austin, TX, USA) at -

80°C in order to prevent RNA degradation. The tissues, weighing 30 mg, were

powdered by grinding thoroughly with a pestle and mortar in liquid nitrogen. The

tissue powder was transfered into 2 ml microcentrifuge tube filled with 600 µl buffer

RLT (Qiagen, Gmbh, Germany) containing 10 µl β-mercaptoethanol per 1 ml buffer

RLT, then pipetted the lysate directly onto a Qiashredder spin column (Qiagen)

A

C D

B

8

placed in 2 ml collection tube, and homogenized by centrifugation at 13,000 rpm for

2 min. The total RNA was extracted using the RNeasy mini kit (Qiagen) according

to the manufacturer’s protocol. The quantity of total RNA was determined by UV

spectrophotometry using UV-1601(Simadzu, Kyoto, Japan).

3. cDNA synthesis

The total RNA was pretreated with RNase-free DNase I (Takara, Shiga, Japan)

to remove genomic DNA prior to the cDNA synthesis. The reaction was carried out

at 37°C for 20 min using 2 µg of the total RNA, 1× DNase I buffer (Takara), 10

units of DNase I (Takara) in a 20 µl volume. This was followed by incubation at

80°C for 10 min to inactivate the enzyme. The complete removal of the genomic

DNA was confirmed by a PCR of the total RNA using β-actin primers (forward

primer; 5’-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3’, reverse primer;

5’- CGTCATACTCCTGCTTGCTGATCCACATCTGC-3’), which generated no

product. The reaction mixture contained 100 ng of the total RNA pretreated with

DNase I (Takara), 1× PCR buffer (Promega, Madison, WI, USA), 0.2 mM of dNTP,

1.5 mM of MgCl2, 200 nM of forward and reverse primers, 1.25 units of Taq DNA

polymerase (Promega) in a 50 µl volume. The thermal cycle profile was heated to

94°C for 5 min, followed by 31 cycles of denaturation at 94°C for 45 sec, annealing

at 60°C for 45 sec, elongation at 72°C for 2 min each, and a final extension at 72°C

for 7 min. The cDNA synthesis was performed in a total volume of 20 µl, at 42°C

for 50 min, containing 1 µg of the total RNA, 160 pmol of the random hexamers

(Takara), 200 units of superscript™ RNase H- reverse transcriptase (Invitrogen,

Carlsbad, CA, USA), 20 units of the RNase inhibitor (Ambion), 0.5 mM dNTP, 10

mM DTT and 1× the first strand buffer (Invitrogen). This was followed by

incubation at 70°C for 15 min to stop the reverse transcription reaction. Aliquots of

the first-strand cDNA were stored at -20°C until use. To confirm whether cDNAs

9

were synthesized or not, the PCR for β-actin amplification was performed with the

same as mentioned above. The PCR products including the open-reading frame of

838bp were electrophoresed in 1.8% agarose gel and stained with ethidium bromide

(EtBr), followed by scanning the gel.

.

4. Genomic DNA isolation

The genomic DNA was extracted from the tissue samples stored at -80°C. The

tissues (30mg) were powdered by grinding thoroughly with a pestle and mortar in

liquid nitrogen. The tissue powder was scraped into 2 ml microcentrifuge tube filled

with 600 µl of extraction buffer TNES (20 mM Tris-HCl [pH 8], 400 mM NaCl, 5

mM EDTA [pH 8], 1% (v/v) SDS) containing 1 mg/ ml of proteinase K, and 20 µg/

ml of RNase A. The samples were incubated at 55°C overnight with shaking gently

to avoid aggregation. Equal volume (600 µl) of phenol/ chloroform (1:1) was added

to the extract, followed by shaking softly at room temperature for 30 min and

centrifugation at 13,000 rpm for 5 min, and then the upper aqueous phase was

transferred to a clean tube. The process was repeated twice to clear aqueous phase.

One volume (600 µl) of isopropanol was added to the aqueous phase, and mixed

carefully by inversion. The mixture was then centrifuged at 13,000 rpm at 4°C for 5

min. The pellet was rinsed with 70% ethanol and allowed to dry briefly in air. The

DNA was finally resuspended in 300 µl of ddH2O, followed by rocking gently

overnight. The quantity of genomic DNA was determined by UV spectrophotometry

using UV-1601(Simadzu).

5. Real-time quantitative PCR

In this study, the real-time quantitative PCR technique based on the TaqMan

methodology was used. Using 5’ nuclease activity of Taq polymerase, a specific

10

fluorescent signal, generated by cleavage of an oligonucleotide hybridization probe

with a 5’ fluorescent reporter dye and a 3’ quencher dye, is measured at each cycle

during a run (Figure 2). Reactions are characterized by the point during cycling

when amplification of the PCR product is first detected, rather than by the amount of

PCR products accumulated after a fixed number of cycles. The larger starting

quantity of the target molecules, the earlier a significant increase in fluorescence is

observed. The parameter Ct (threshold cycle) is defined as the fractional cycle

number at which the fluorescence generated by cleavage of the probe passes a fixed

threshold above baseline. The fluorescence signal is monitored using the laser

detector of the ABI PRISM 7700 sequence detection system (Perkin-Elmer Applied

Biosystems, Foster City, CA, USA).

11

Figure 2. Principle of the TaqMan methodology. The Taq polymerase extends the primer and hydrolyzes the probe. Release of the 5’-attached reporter dye abolishes the quenching effect of the 3’-attached quencher dye, and then a fluorescence signal is detected. (Abbreviations: F. primer, Forward primer; R. primer, Reverse primer)

5’

5’

3’

3’

Fluorescent

5’

5’

3’

3’

3’

5’

5’

3’

F. primer

R. primer

Reporter Quencher

12

A. cDNA amplification

The TRF1, TRF2, TIN2 and hTERT mRNA expression levels were measured

using the gene-specific fluorescent hybridization probes. Either FAM or VIC was

used as the 5’-fluorescent reporters while TAMRA was added to the 3’ end as a

quencher. The gene-specific primers and fluorescent hybridization probes used in

this study are shown Table 1. The 18S rRNA was used to normalize the sample-to-

sample variation in the amount of the input cDNA, and also to evaluate the quality

of the isolated RNA and RT efficiency. Amplification of the 18S rRNA was

performed using the primers and the internal probe provided by Perkin-Elmer

(Perkin-Elmer Applied Biosystems). The standard curve was constructed with five-

fold serial dilutions of the cDNA from the HT1080 cell line, which corresponded to

the total RNA ranging from 0.32 to 200 ng for TRF1, from 0.16 to 100 ng for TRF2,

from 0.08 to 50 ng for TIN2 and hTERT, and from 0.008 to 5 ng for 18S rRNA. The

PCR for TRF1 amplification was carried out using 0.5 µl of each RT reaction, which

corresponded to 25 ng of the total RNA, 1× TaqMan universal master mix (Perkin-

Elmer Applied Biosystems), 300 nM of primers, and 200 nM of the probe in a 25 µl

volume. The reaction for TRF2 and TIN2 amplification was performed with 0.5 µl

of each RT reaction, which corresponded to 25 ng of the total RNA, 1× TaqMan

universal master mix (Perkin-Elmer Applied Biosystems), 1× each Gene Expression

ProductsTM in a 25 µl volume. The amplification of hTERT was done using 1 µl of

each RT reaction, which corresponded to 50 ng of the total RNA, 1× TaqMan

universal master mix (Perkin-Elmer Applied Biosystems), 300 nM of primers, and

200 nM of the probe in a 25 µl volume. The 18S rRNA reaction was performed with

50 nM of the primers, 200 nM of the probe and 1 µl of the RT reaction, which

corresponded to 0.5 ng of the total RNA. Thermal cycling was initiated with a 2-

minute incubation at 50°C, for the uracil N-glycosylase reaction, which was

followed by a 10-minute reaction at 95°C to activate the AmpliTaq gold, and 40

PCR cycles at 95°C for 15 sec and at 60°C for 1 min. Fluorescence measurements

13

were taken at the end of the annealing/ extension phase at 60°C. The quantity of

target mRNA in unknown samples was determined from the Ct value using the

standard curve (Figure 3). Each experiment included a determination of the

standards and “no-template” as a negative control, where water was substituted for

the cDNA. Non-template controls, standard dilutions and samples were assayed in

duplicate.

14

Figure 3. Amplification profiles and standard curves by real-time quantitative PCR. A. Amplification plots for TRF1. B. Amplification plots for 18S rRNA. C. Standard curve for TRF1. D. Standard curve for 18S rRNA. The ΔRn value reflects the quantity of fluorescent probe degraded for each well. Threshold cycle (Ct) represents the fractional cycle at which the fluorescence passes a fixed threshold above baseline. The quantity of target molecules is obtained by the Ct value and by using a standard curve performed during the same experiment. 18S rRNA was used as an internal control.

D.B.

A.

0 10 20 30 400

0.5

1.0

1.5

2.0

2.5

∆Rn

Number of cycles

TRF1

0 10 20 30 40

7

0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

∆Rn

Number of cycles

18S rRNA

-1 0 1 2 30

10

20

30

40

Thr

esho

ld C

ycle

s

Log[cDNA] (ng)

TRF1

R2=0.994

0 1 2 3 40

5

10

15

20

25

Thr

esho

ld C

ycle

s

Log[cDNA] (ng)

18S rRNA

R2=0.998

C.

HT1080 sample

HT1080 sample

15

B. Gene amplification

The number of hTERT gene copies was determined by real-time PCR analysis.

The quantity of hTERT gene was normalized as a ratio to the amount of insulin-like

growth factor-1 (IGF-1) gene. Each reaction for the hTERT and IGF-1 gene was

carried out in a total volume of 25 µl. The reaction mixture contained 25 ng of the

genomic DNA, 1× TaqMan universal master mix (Perkin-Elmer Applied

Biosystems), 300 nM of primers, and 200 nM of the probe. The standard curve was

made up of five-fold serial dilutions of the genomic DNA from the HEK293 cell line,

which corresponded to the genomic DNA ranging from 0.16 to 100 ng for hTERT

and IGF-1 each. The sequences of the primers and probes used in this experiment

are shown in Table 1.

16

Table 1. Oligonucleotide primer and probe sequences used for real-time quantitative

PCR analysis

Target Sequence (5’→3’) TRF1 Forward primer TCTCTCTTTGCCGAGCTTTCC cDNA

amplification Reverse primer ACTGGCAAGCTGTTAGACTGGAT Probe (FAM)-

CCCGCAACAGCGCAGAGGCTA-(TAMRA)

hTERT Forward primer CACGCGAAAACCTTCCTCA Reverse primer CAAGTTCACCACGCAGCC Probe (FAM)-

TCAGGGACACCTCGGACCAGGGT-(TAMRA)

hTERT Forward primer CCACGAGCACCGTCTGATTAG Gene amplification Reverse primer GGAGGCCGTGTCAGAGATGA

Probe (FAM)-CCTTTCCTCTGACGCTGTCCGCC-(TAMRA)

IGF-1 Forward primer TTGCCTCATCGCAGGAGAA Reverse primer TGTGATCTCATTTCCTAGAACCTATGG Probe (FAM)-

AGGGACCAATCCAATGCTGCCTG-(TAMRA)

For the amplification of TRF2 and TIN2, Gene Expression Products™ (Perkin-Elmer Applied Biosystems) was used. The sequence of the TRF2 and TIN2 primers and probes are under the copyright of Perkin-Elmer Applied Biosystems.

17

6. Southern hybridization analysis

A. Analysis of telomere length

Genomic DNA (6 µg) was digested with 60 units of HinfⅠ(New England

BioLabs, Beverly, MA, USA) at 37°C in 100 µl of restriction buffer (New England

BioLabs), which generate terminal restriction fragments consisting of telomeric and

subtelomeric regions. The digested DNA was extracted with equal volume (100 µl)

of phenol/ chloroform (1:1), repeatedly, followed by precipitation using 3 volume

(300 µl) of absolute ethanol, 0.1 volume (10 µl) of 3M sodium acetate and 20 µg of

glycogen (Roche Molecular Biochemicals, Mannheim, Germany), and

centrifugation at 13,000 rpm at 4°C for 30 min. After rinsed with 70% ethanol, the

pellet was allowed to dry briefly in air and dissolved in 25 µl of ddH2O. The HinfⅠ-

digested DNA along with 500 ng of λ DNA/ HindⅢ marker (Promega) was

fractionated on 0.7% agarose gel in 0.5× Tris-borate-EDTA(TBE) at 24 V for 16 hr.

The gel was stained with EtBr, and depurinated in 0.125 M HCl for 15 min,

denatured twice in 1.5 M NaCl, 0.5 M NaOH for 30 min and neutralized in 1.5 M

NaCl, 0.5 M Tris [pH 7.5] for 30 min. The digested DNA was immediately

transferred overnight to a Hybond-N+ membrane (Amersham Pharmacia Biotech,

Piscataway, NJ, USA) in 10× SSC (1.5 M NaCl, 0.15 M sodium citrate, [pH 8])

using an upward capillary transfer, and immobilized by UV cross-linking. The

hybridization was carried out with a 3’-end digoxigenin-labeled d(TTAGGG)4

(Roche Molecular Biochemicals) created by terminal transferase, overnight at 37°C.

The hybrids were detected according to the manufacturer’s recommendation (Roche

Molecular Biochemicals). The mean telomere length was calculated by a previously

described method.35 The hybridization signals, telomeres, were scanned with LAS-

1000 (Fujifilm, Tokyo, Japan) and quantified using the Image Gauge Version 3.12

(Fujifilm). In the software, a grid object was defined as a single column with 25

rows. This 1×25 grid was placed over the size marker lane, and the row, 1-25, in

which each ladder of the marker fell was recorded. And then the 1×25 grid was

18

reproduced and placed over the telomere signals. The measurements corresponding

to the average optical density for each row were transferred to EXCEL for Microsoft

Windows XP software. The mean telomere length was calculated as Σ(MWi × ODi)/

Σ(ODi)35, where ODi is the densitometer output and MWi, determined by the

calibration curve obtained by plotting log (molecular size) for the size marker vs

row number and given in the form y = ax + b, is the length of the DNA at row

number i. A mean length of the sample was obtained from 2-3 replicate experiments.

B. Analysis of hTERT gene copy number The isolated genomic DNA (20-25 µg) was digested by incubation overnight

at 37°C in 100 µl of restriction buffer (Promega) and 100 units of BamHⅠ

(Promega). The BamHⅠ-digested DNA was requantified by UV spectrophotometry

using UV-1601(Simadzu) for an exact quantity. Eighteen micrograms of the

digested and quantified DNA were extracted, precipitated and electrophoresed by

the same methods as described above. After denatured by soaking in a alkaline

solution (0.4 N NaOH, 1 M NaCl), the digested DNAs were blotted overnight to a

Hybond-N+ membrane (Amersham Pharmacia Biotech) in alkaline transfer buffer

(0.4 N NaOH, 1 M NaCl) using an upward capillary transfer. For the hTERT

hybridization, the probe was amplified using the pcDNA3 (Invitrogen) cloned

hTERT cDNA as a template and primers (forward; 5’-

CACGCGAAAACCTTCCTCA-3’, reverse; 5’-CTGTGACACTTCAGCCGCA-3’)

in exon 10 and exon 12, denaturated and labeled with α-32P-dCTP (3000 Ci/ mmol)

using random prime labeling system (Amersham Pharmacia Biotech) following the

manufacturer’s protocol. Southern blots were hybridized overnight at 60°C, using

ExpressHybTM Hybridization Solution (BD Biosciences, Palo Alto, CA, USA) and

washed twice for 30 min at low stringency (2× SSC, 0.05% SDS, at RT) and twice

for 30 min at high stringency (0.1× SSC, 0.1% SDS, at 55°C) in order. The blot was

exposed on a phosphorimager screen for 1 hr and to X-ray film for 18 hr. The image

19

quantification was performed using Image Gauge Version 3.12 (Fujifilm).

20

Ⅲ. Results

1. Upregulation of TRF1, TRF2 and TIN2 in human multistep

hepatocarcinogenesis

The expression levels of TRF1, TRF2 and TIN2 mRNA were gradually

increased according to the progression of multistep hepatocarcinogenesis and it was

also evident in the patients with multiple synchronous nodules of DNs and/ or HCCs.

The results are summarized in Table 2 and Figure 4.

The TRF1 mRNA levels remained low in chronic hepatitis, cirrhosis and

LRNs, which was comparable to those of the normal liver (Table 2 and Figure 4A).

The low- and high grade DNs expressed a higher TRF1 mRNA level than chronic

hepatitis, cirrhosis and LRNs (p=0.002) and the mean TRF1 mRNA level of the DNs

was 1.3 times higher than that of the normal livers. The TRF1 mRNA level was

further increased in the DNs with HCC foci compared to the DNs, where the mean

value was 1.7 times higher than that of the normal livers. A marked increase was

observed in the HCCs (p= 0.005), where the mean value was 3.2 times higher than

that of the normal livers. The HCCs showed a wide range of the TRF1 mRNA levels

from 20 to 261, and 29 HCCs (94%) had higher TRF1 mRNA levels than the

adjacent non-HCCs. According to the differentiation of HCC, those with poorer

differentiation showed significantly higher levels of the TRF1 mRNA (p=0.004).

However, the mitotic activity and tumor size of HCCs had no correlation with it.

Increase of the TRF2 mRNA level also appeared according to the progression

of multistep hepatocarcinogenesis, particularly from DNs to HCCs (Table 2 and

Figure 4B). The TRF2 mRNA levels of chronic hepatitis and cirrhosis were higher

than that of the normal liver (p=0.019), however, they were still low. Low grade

DNs showed a TRF2 mRNA level similar to chronic hepatitis, cirrhosis and LRNs. A

significant increase was observed in the transition of the low grade DNs to high

grade DNs (p=0.016) and the mean TRF2 mRNA level of the high grade DNs was

2.5 times higher than that of the normal livers. The DNs with HCC foci had the

21

TRF2 mRNA level similar to high grade DNs. A further marked increase was

observed in the HCCs (p=0.036), where the mean value was 3.4 times higher than

that of the normal livers. The range of the TRF2 mRNA level in HCCs was a rather

wide from 9 to 92 and 29 HCCs (94%) had a higher TRF2 mRNA level than the

adjacent non-HCCs. The TRF2 mRNA levels were significantly higher in HCCs

with poorer differentiation (p=0.028) and it was positively correlated with the

mitotic activity of HCCs (p<0.001, R2=0.347), but had no correlation with the size

of HCCs.

The TIN2 mRNA level showed a similar pattern of upregulation during

multistep hepatocarcinogenesis to the TRF2 mRNA level (Table 2 and Figure 4C).

Chronic hepatitis and cirrhosis expressed TIN2 mRNAs at a similarly low level,

although their expression level was higher than that of the normal liver (p=0.043).

Low grade DNs showed a similar TIN2 mRNA level to that observed in the livers

with chronic hepatitis and cirrhosis. A significant increase was noted in the transition

from the low grade DNs to high grade DNs (p=0.007) and the mean value of the

high grade DNs was about 2.7 times higher than the normal livers. A further increase

was observed in the DNs with HCC foci, where the mean value was 3.2 times higher

than that of the normal livers. The HCCs showed a marked increase in the TIN2

mRNA level (p=0.026), where the mean value was 4.3 times higher than that of the

normal livers. All the HCCs expressed a higher amount of TIN2 than the adjacent

non-HCC, and their TIN2 mRNA level ranged from 11 to 155. TIN2 mRNA level

showed a positive correlation with mitotic activity of HCCs (p<0.001, R2=0.424),

however it showed no significant difference according to the differentiation and size

of HCCs.

The TRF1, TRF2 and TIN2 mRNA levels appeared to positively correlate with

each other. The TRF1 mRNA levels were higher in the lesions with higher TRF2

(p<0.001, R2=0.377) and TIN2 levels (p<0.001, R2=0.323), and a similar feature was

found between TRF2 and TIN2 (p<0.001, R2=0.547).

22

Table 2. Summary of the telomeric repeat binding factor 1 (TRF1), TRF2, TRF1-

interacting nuclear protein 2 (TIN2) mRNA levels and telomere length in human

multistep hepatocarcinogenesis

TRF1 TRF2 TIN2 Telomere Length (kb)

Range Mean±SD Range Mean±SD Range Mean±SD Range Mean±SD Normal (n=9) 13-42 26±8.5 4-24 10±7.3 3-25 12±8.2 8.1-9.8 8.7±0.57

CH (n=14) 14-48 27±8.8 7-29 17±6.7 7-36 20±9.5 6.8-9.6 8.3±0.94 LC (n=24) 15-39 28±6.4 4-56 17±10.8 5-49 22±10.4 5.6-11.0 7.8±1.19 LRN (n=5) 23-37 30±6.0 7-22 13±5.5 7-15 10±3.0 5.2-9.1 7.8±1.63

LGDN (n=14) 28-47 34±5.9 6-29 14±6.4 7-48 15±11.5 3.9-9.8 7.4±1.77 HGDN (n=7) 25-38 34±4.9 14-41 25±9.4 19-61 32±15.6 4.5-8.1 5.3±1.25

DN with HCC (n=10) 16-74 44±17.2 9-58 22±14.7 12-65 38±20.2 4.4-8.5 6.4±1.31 HCC (n=31) 20-261 82±47.4 9-92 34±20.2 11-155 51±29.6 4.7-14.3 7.3±2.26

Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma. The TRF1, TRF2 and TIN2 mRNA levels = [target gene mRNA copies of sample/18S rRNA copies of sample] х 105. Telomere length of each tissue was obtained from 2-3 replicate experiments.

23

20

40 60

80 100

120 140 160 260 280

Normal (n=9)

CH (n=14)

LC (n=24)

LRN (n=5)

LG DN

(n=14)

HG DN

(n=7)

DN with HCC

(n=10)

HCC (n=31)

TR

F1 m

RN

A le

vel

0

20

40

60

80

100

Normal (n=9)

CH (n=14)

LC (n=24)

LRN (n=5)

LG DN

(n=14)

HG DN

(n=7)

DN with HCC

(n=10)

HCC (n=31)

TR

F2 m

RN

A le

vel

0

30

60

90 130

150

Normal (n=9)

CH (n=14)

LC (n=24)

LRN (n=5)

LG DN

(n=14)

HG DN

(n=7)

DN with HCC

(n=10)

HCC (n=31)

TIN

2 m

RN

A le

vel

0

patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others

A.

B.

C.

Figure 4. Expression of the telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear protein 2 (TIN2) mRNA levels in human multistep hepatocarcinogenesis. The TRF1 (A), TRF2 (B) and TIN2 (C) mRNA levels are increased according to the progression of multistep hepatocarcinogenesis. (Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma)

24

2. Telomere shortening during human multistep hepatocarcinogenesis

The normal liver tissues showed telomere lengths ranging from 8.1 to 9.8 kb,

which did not significantly correlate with the patient ages. A gradual reduction in the

telomere length was observed from the livers with chronic hepatitis, to cirrhosis and

to LRNs (Table 2 and Figure 5). The low grade DNs had a wide range of telomere

lengths, most of which showed similar telomere length to those with chronic

hepatitis, cirrhosis and LRNs, and 2 (14%) of the low grade DNs had short

telomeres, which overlapped with those of the high grade DNs. Significant telomere

shortening occurred in the transition of the low grade DNs to high grade DNs

(p=0.020). The high grade DNs showed telomere lengths ranging from 4.5 to 8.1 kb,

and 6 (86%) of those had a telomere length < 5.4 kb. DNs with HCC foci had

telomere length in the similar range to those of high grade DNs. The HCCs had a

telomere length with a wide range from 4.7 to 14.3 kb and showed no significant

reduction of the telomere length compared to those of DNs with HCC foci, but most

HCCs (24/31, 77%) had shorter telomeres than their adjacent non-HCCs.

Most nodular lesions (52/67, 78%) including 4 LRNs, 11 low grade DNs, 7

high grade DNs, 6 DNs with HCC foci and 24 HCCs had shorter telomeres than

their adjacent chronic hepatitis/cirrhosis, while some lesions (15/67, 22%) including

a LRN, 3 low grade DNs, 4 DNs with HCC foci and 7 HCCs had longer telomeres.

Three of the HCCs had telomeres > 10 kb. A case of HCC with a telomere length of

14.3 kb is believed to be an alternative lengthening of the telomere because it

possessed neither telomerase activity nor hTERT mRNA (data not shown).

25

23kb

9.4kb

6.5kb

4.3kb

2.3kb 2.0kb

DN

w

ith H

CC

LR

N

LC

HC

C

HC

C

CH

CH

Nor

mal

patient 11 others B

2

4

6

8

10

12

14

16 Te

lom

ere

leng

th (k

b)

Normal (n=9)

CH (n=14)

LC (n=24)

LRN (n=5)

LG DN

(n=14)

HG DN

(n=7)

DN with HCC

(n=10)

HCC (n=31)

A

0

patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others

Figure 5. Comparison of each telomere length in human multistep hepatocarcinogenesis. A. The telomere length is shown in normal livers, chronic hepatitis (CH), liver cirrhosis (LC), large regenerative nodules (LRNs), low grade dysplastic nodules (LGDNs), high grade dysplastic nodules (HGDNs), DNs with hepatocellular carcinoma (HCC) foci and HCCs. The lesions are denoted by different symbols according to the patient numbers. B. A representative result of southern blot analysis in various lesions. The genomic DNA, digested with Hinf I, was hybridized with a digoxigenin-labeled d(TTAGGG)4. The mean telomere restriction fragment length was calculated as previously described method,35 using the IMAGE GAUGE software (Fujifilm, Tokyo, Japan). The λ-DNA digested with HindⅢ was used as the size marker and indicated on the right.

26

3. TRF1, TRF2 and TIN2 in relation to telomere length regulation

In order to evaluate whether TRF1, TRF2 and TIN2 are involved in the

telomere length regulation, the mRNA levels of these genes were compared with the

telomere length in each lesion. All of these genes showed significant negative

correlations with the telomere length, when the analysis was done with the lesions

with shortened telomeres compared to their respective adjacent chronic hepatitis and

cirrhosis, (Note: This analysis included 4 LRNs, 11 low grade DNs, 7 high grade

DNs, 6 DNs with HCC foci, 24 HCCs and their respective adjacent chronic hepatitis

and cirrhosis) (Figure 6). The inverse correlation was more evident in the early

stages of hepatocarcinogenesis including low grade DNs, high grade DNs and DNs

with HCC foci (p=0.036, R2 =0.184; p=0.002, R2 =0.352; p=0.005, R2 =0.308,

respectively). Meanwhile, there was no statistically significant relationship between

those genes and the telomere length in the HCCs, which showed a rather wide range

of mRNA levels of these genes.

The analysis was also performed on the nodular lesions with the lengthened

telomeres compared to the respective adjacent chronic hepatitis and cirrhosis, which

were one LRN, 3 low grade DNs, 4 DNs with HCC foci and 7 HCCs. Most of these

lesions also expressed higher levels of TRF1, TRF2 and TIN2 mRNA compared to

the respective adjacent chronic hepatitis and cirrhosis. However, the mRNA levels of

these genes did not show a significant correlation with the telomere length in the

lesions with elongated telomeres.

27

chronic hepatitis cirrhosis LRN

low grade DN high grade DN DN with HCC foci

HCC

Figure 6. Comparison of the telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear protein 2 (TIN2) mRNA levels with telomere length in human multistep hepatocarcinogenesis, shown in A, B and C, respectively. The analysis was performed with the nodular lesions with shortened telomeres compared to the adjacent chronic hepatitis and cirrhosis. This analysis included 4 large regenerative nodules (LRNs), 11 low grade dysplastic nodules (DNs), 7 high grade DNs, 6 DNs with hepatocellular carcinoma (HCC) foci, 24 HCCs and their respective adjacent chronic hepatitis (n=11) and cirrhosis (n=19).

2

4

6

8

10

12

0 50 100 150 200 0

TRF1 mRNA level

Telo

mer

e le

ngth

(kb)

y = -0.022x + 8.074 R2 = 0.133

p=0.001

A.

2

4

6

8

10

12

0 100 20 40 60 80 0

TRF2 mRNA level

Telo

mer

e le

ngth

(kb)

y = -0.050x + 8.145 R2 = 0.146 p<0.001

B.

2

4

6

8

10

12

0 100 80 60 40 20 0

TIN2 mRNA level

Telo

mer

e le

ngth

(kb)

y = -0.038x + 8.161 R2 = 0.206 p<0.001

C.

28

4. Upregulation of hTERT mRNA level in human multistep

hepatocarcinogenesis

The expression of hTERT mRNAs was dramatically increased in

conformity with the progression of multistep hepatocarcinogenesis, especially from

low grade DNs to HCC (Table 3 and Figure 7). A significant increase was detected

in low grade DNs, where the mean hTERT mRNA level was approximately 2,000

times higher than that of the normal livers. A further increase was observed in high

grade DNs and the mean hTERT mRNA level of the high grade DNs was about

25,000 times higher than the normal livers. All HCCs expressed higher hTERT

mRNAs than the adjacent non-HCCs, and their hTERT mRNA level ranged from

123 to 14.1×105 similar to high grade DNs and DNs with HCC foci. Although there

was a slightly increase in chronic hepatitis, cirrhosis and large regenerative nodules,

the hTERT mRNA expression was a little level.

5. The number of hTERT gene copies in human multistep hepatocarcinogenesis

The hTERT gene copy numbers were not varied in multistep

hepatocarcinogenesis (Table 3 and Figure 8). Only one HCC from a patient showed

a significant amplification, where the hTERT gene copies were about 4 times higher

than those of the adjacent non-HCC. But in almost all samples, little amplification

was detected with the mean values varying between 0.8 and 1.2. In this study, we

tested 3 reference genes, IGF-1, γ-actin and glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), for their suitability as internal controls. Among these,

IGF-1 was best suited, so we used that. The hTERT amplification was also assessed

by southern blot analysis to confirm above result. We collected the samples

containing one hTERT-amplified HCC, two non-amplified HCC and their adjacent

non-HCCs, and performed the experiments. Based on the results of real-time PCR

experiments, the anticipated results of southern blot assays were obtained. The

results are shown in Figure 9. The level of the hTERT gene signal was normalized

29

with the intensity of EtBr-stained DNA.

We found that the hTERT mRNA level was not correlated with the hTERT

gene amplification in hepatocarcinogenesis. Even if the mRNA level is high in a

lesion, there is no amplification of the gene copies in the lesion.

Table 3. Comparison between the human telomerase reverse transcriptase (hTERT)

mRNA level and its gene copy number in hepatocarcinogenesis

hTERT mRNA hTERT gene Range Mean Range Mean±SD

Normal (n=6) 0.0-10.0 3.5 0.8-0.9 0.8±0.08 CH/LC (n=21) 0.0-57.9 14.4 0.6-1.3 1.0±0.17

LRN (n=4) 0.0-92.1 32.4 0.7-1.4 0.9±0.31 LGDN (n= 11) 0.0-71.1×103 6504.9 0.5-1.0 0.8±0.14 HGDN (n=7) 53.8×10-44.5×104 86037.9 0.9-1.2 1.0±0.12

DN with HCC (n=10) 25.8-12.9×104 23143.1 0.9-1.5 1.1±0.14 HCC (n=16) 12.3×10-14.1×105 96207.2 0.5-4.1 1.2±0.80

Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma. The hTERT mRNA and the hTERT gene was normalized with 18S rRNA and IGF-1, respectively.

30

Figure 7. Expression of the human telomerase reverse transcriptase (hTERT) mRNA in human multistep hepatocarcinogenesis. The hTERT mRNA was progressively increased during hepatocarcinogenesis, and a great induction was found in dysplastic nodules. Eleven patients with multiple synchronous nodules are denoted by different symbols in accordance with the patient numbers.

HCC (n=16)

0

50

100

150

200

250

5000

10000

15000

20000

250003000050000

1500000hT

ER

T m

RN

A le

vel

Normal(n=6)

CH/ LC

(n=21)

LRN(n=4)

LG DN

(n=11)

HG DN

(n=7)

DN withHCC

(n=11)

patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others

CH : chronic hepatitis LC : liver cirrhosis LRN : large regenerative nodule LGDN : low grade dysplastic nodule HGDN : high grade dysplastic nodule DN : dysplastic nodule HCC : hepatocellular carcinoma

31

Normal (n=6)

CH/ LC

(n=21)

LRN (n=4)

LG DN

(n=11)

HG DN

(n=7)

DN with HCC

(n=11)

HCC (n=16)

0

1

2

3

4

5

hTE

RT

gene

stat

us *

patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others

Figure 8. Status of the human telomerase reverse transcriptase (hTERT) gene in human multistep hepatocarcinogenesis. The copy number of the hTERT gene and the reference gene, insulin-like growth factor-1 (IGF1), was measured in each tissue sample. The ratio of hTERT/IGF-1 indicates the hTERT gene status. There is little variation of the hTERT gene copies during multistep hepatocarcinogenesis. (* : The HCC amplified hTERT gene. This case was confirmed by southern blot analysis shown in Figure 9. Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma)

32

Figure 9. Southern blot analysis for the status of the human telomerase reverse transcriptase (hTERT) gene. Each patient contains both hepatocellular carcinoma (HCC) and adjacent non-HCC (CH, chronic hepatitis; LC, liver cirrhosis). A. The genomic DNA, digested with BamHⅠ, was hybridized with α-32P-dCTP-labeled probe. BamHⅠ-digested DNA from each lesion was detected approximately 2.3kb and 7.0 kb. The second lane, only one case of hTERT-amplified HCC (*) as result of real time PCR, was visualized with more intensity than the others. The λ-DNA digested with HindⅢ was used as the size marker and indicated on the right. B. The signal intensity of each lesion was measured by summing up the measurements of two bands using the IMAGE GAUGE software (Fujifilm), and then normalized with value of EtBr-stained DNA shown in C.

Sign

al in

tens

ity

A.

B.

23kb

9.4kb

6.5kb

4.3kb

2.3kb 2.0kb

CH LC CH HCC HCC HCC

patients

1

2

3

4

5

*

0

C. Loadingcontrol

33

Ⅳ. Discussion

In this study, upregulation of the TRF1, TRF2 and TIN2 mRNA levels was

observed according to the progression of human multistep hepatocarcinogenesis,

particularly from DNs to HCCs, and progressive telomere shortening was

demonstrated according to the progression of hepatocarcinogenesis. Most (78%,

52/67) of the nodular lesions including LRNs, DNs and HCCs had shorter telomeres

than their adjacent chronic hepatitis/ cirrhosis, and the lesions with shorter telomeres

had a higher mRNA expression level of the TRF1, TRF2 and TIN2. This inverse

correlation suggested that these telomere-binding proteins play important roles in

telomere shortening during multistep hepatocarcinogenesis. Moreover, the positive

correlations among the expression levels of these genes suggest their collaboration

in telomere shortening. It was proposed that these telomere-binding proteins act as

negative length regulators at the telomeres.12, 15, 36-39 During hepatocarcinogenesis,

telomere shortening occurred despite telomerase activation.34 This might be, in part,

explained as follows: the upregulation of the TRF1, TRF2 and TIN2 might be

involved in the stabilization of the telomeres by promoting t-loop folding. The

stabilization of the t-loop structures, which limits the access of telomerase to the

telomeres,38, 39 would eventually result in telomere shortening in

hepatocarcinogenesis. In other words, the telomeric length might be not increased

but maintained with short length as above results, even though telomerase is

excessively active in hepatocarcinogenesis.

There is growing evidences that DNs are precancerous lesions.40 Previous

studies as well as this study have demonstrated that many of high grade DNs has a

short telomere length and a high telomerase activity, which is similar to those of

HCCs. Moreover, some low grade DNs also have similar features.34 Considering that

telomere shortening and telomerase activation play a key role in tumorigenesis,

these results suggest that low and high grade DNs are important early lesions in

34

multistep hepatocarcinogenesis.

In this study, a significant increase of the TRF1, TRF2 and TIN2 expression

and an inverse correlation between mRNA levels of these genes and the telomere

length were first noted in DNs during multistep hepatocarcinogenesis. These results

suggest that these telomere-binding proteins involve in telomere shortening in the

early stages of hepatocarcinogenesis. Upregulation of these genes, therefore, is

likely to be crucial for hepatocarcinogenesis by inducing “telomere crisis”, a driving

force in tumor development.41

HCCs showed no further significant telomere shortening, compared to the

high grade DNs and DNs with HCC foci. One of the possible explanations for this

would be the expression of strong telomerase in the HCCs. 28, 29, 34 HCCs expressed a

high TRF1, TRF2 and TIN2 mRNA level, and their mean value was more than 3-4

times that of the normal livers. The mRNA levels of these genes showed no

significant correlation with telomeres in HCCs, indicating that the induction of these

genes is unlikely to directly influence telomere shortening in the HCCs. Their roles

on telomere shortening might be screened by the strong telomerase activity, which

involves in telomere elongation. Therefore, the balance between the telomere

binding protein expression and telomerase activation might be crucial for the

telomere maintenance in HCCs. Interestingly, the HCCs with poorer differentiation

or higher mitotic activity expressed higher mRNA levels of these telomere-binding

protein genes. This suggests that an excess of these genes is likely to be involved in

HCC progression.

Telomere lengthening was also found during hepatocarcinogenesis. Seven

HCCs and 8 other nodular lesions showed an elongated telomere length. It suggests

that the mechanism of telomere lengthening is also involved in hepatocarcinogenesis,

even though it is minor pathway. Our data on higher levels of the TRF1, TRF2 and

TIN2 mRNA in those lesions but no correlation with telomere length suggest that an

excess of these genes might be required for the association with the lengthen

telomeres rather directly involve in telomere length regulation.

35

hTERT is a key component of telomerase and important in tumorigenesis. The

expression of the hTERT mRNA was increased according to the progression of

multistep hepatocarcinogenesis, and significant increase was found in the transition

from DNs to HCCs. But amplification of the hTERT gene was not found during

multistep hepatocarcinogenesis except a case of HCC. This result indicates that there

is no correlation between the hTERT mRNA level and its gene dosage in

hepatocarcinogenesis. In other words, the hTERT overexpression is not influenced

by the hTERT gene copy numbers. Gene amplification frequently occurs during

tumorigenesis and is one of the most common mechanisms for oncogene activation.

The amplification of the hTERT gene was reported in several tumors including

cervical cancer42 and embryonal brain tumors.43 However, there was little alteration

of the hTERT gene in hepatocarcinogenesis according to our results.

36

Ⅴ. Conclusion

In conclusion, an upregulation of TRF1, TRF2, and TIN2 was observed during

multistep hepatocarcinogenesis and the mRNA levels of these genes inversely

correlated with the telomere length. The negative correlation was more evident in

the DNs and DNs with HCC foci of early stages of hepatocarcinogenesis in which

the telomere was significantly shortened. These findings suggest that TRF1, TRF2,

and TIN2 are involved in hepatocarcinogenesis, particularly in the early stages of

hepatocarcinogenesis by playing crucial roles in the telomere shortening. And the

expression of the hTERT mRNA was significantly increased according to the

progression of multistep hepatocarcinogenesis, but an amplification of the hTERT

gene was not found. This result indicates that there is no correlation between the

hTERT mRNA level and its gene copy numbers in multistep hepatocarcinogenesis.

37

References

1. Wright JH, Gottschling DE, Zakian VA. Saccharomyces telomeres assume

a non-nucleosomal chromatin structure. Genes Dev 1992;6:197-210.

2. Tommerup H, Dousmanis A, de Lange T. Unusual chromatin in human

telomeres. Mol Cell Biol 1994;14:5777-5785.

3. Nugent CI, Hughes TR, Lue NF, Lundblad V. Cdc13p: a single-strand

telomeric DNA-binding protein with a dual role in yeast telomere

maintenance. Science 1996;274:249-252.

4. Karlseder J. Telomere repeat binding factors: keeping the ends in check.

Cancer Lett 2003;194:189-197.

5. Collins K. Mammalian telomeres and telomerase. Curr Opin Cell Biol

2000;12:378-383.

6. Kim SH, Kaminker P, Campisi J. Telomeres, aging and cancer: in search of

a happy ending. Oncogene 2002;21:503-511.

7. de Lange T. Protection of mammalian telomeres. Oncogene 2002;21:532-

540.

8. Hackett JA, Greider CW. Balancing instability: dual roles for telomerase

and telomere dysfunction in tumorigenesis. Oncogene 2002;21:619-626.

9. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, et al.

Mammalian telomeres end in a large duplex loop. Cell 1999;97:503-514.

10. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involves

binding of TRF2 near the 3' telomeric overhang. EMBO J 2001;20:5532-

5540.

11. van Steensel B, de Lange T. Control of telomere length by the human

telomeric protein TRF1. Nature 1997;385:740-743.

12. Smogorzewska A, van Steensel B, Bianchi A, Oelmann S, Schaefer MR,

Schnapp G, et al. Control of human telomere length by TRF1 and TRF2.

Mol Cell Biol 2000;20:1659-1668.

38

13. de Lange T, Shiue L, Myers RM, Cox DR, Nayor SL, Killery AM, et al.

Structure and variability of human chromosome ends. Mol Cell Biol

1990;10:518-527.

14. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human

telomeres from end-to-end fusions. Cell 1998;92:401-413.

15. Kim SH, Kaminker P, Campisi J. TIN2, a new regulator of telomere length

in human cells. Nat Genet 1999;23:405-412.

16. Nakanishi K, Kawai T, Kumaki F, Hiroi S, Mukai M, Ikeda E, et al.

Expression of mRNAs for Telomeric Repeat Binding Factor (TRF)-1 and

TRF2 in Atypical Adenomatous Hyperplasia and Adenocarcinoma of the

Lung. Clin Cancer Res 2003;9:1105-1111.

17. Miyachi K, Fujita M, Tanaka N, Sasaki K, Sunagawa M. Correlation

between telomerase activity and telomeric-repeat binding factors in gastric

cancer. J Exp Clin Cancer Res 2002;21:269-275.

18. Klapper W, Krams M, Qian W, Janssen D, Parwaresch R. Telomerase

activity in B-cell non-Hodgkin lymphomas is regulated by hTERT

transcription and correlated with telomere-binding protein expression but

uncoupled from proliferation. Br J Cancer 2003;89:713-719.

19. Saito K, Yagihashi A, Nasu S, Izawa Y, Nakamura M, Kobayashi D, et al.

Gene expression for suppressors of telomerase activity (telomeric-repeat

binding factors) in breast cancer. Jpn J Cancer Res 2002;93:253-258.

20. Yamada M, Tsuji N, Nakamura M, Moriai R, Kobayashi D, Yagihashi A, et

al. Down-regulation of TRF1, TRF2 and TIN2 genes is important to

maintain telomeric DNA for gastric cancers. Anticancer Res 2002;22:3303-

3307.

21. Yamada K, Yagihashi A, Yamada M, Asanuma K, Moriai R, Kobayashi D,

et al. Decreased gene expression for telomeric-repeat binding factors and

TIN2 in malignant hematopoietic cells. Anticancer Res 2002;22:1315-1320.

39

22. Stewart SA, Weinberg RA. Telomerase and human tumorigenesis. Semin

Cancer Biol 2000;10:399-406.

23. Mokbel K. The role of telomerase in breast cancer. Eur J Surg Oncol

2000;26:509-514.

24. Meyerson M, Counter CM, Eaton EN, Ellisen LW, Steiner P, Caddle SD, et

al. hEST2, the putative human telomerase catalytic subunit gene, is up-

regulated in tumor cells and during immortalization. Cell 1997;90:785-795.

25. Wu A, Ichihashi M, Ueda M. Correlation of the expression of human

telomerase subunits with telomerase activity in normal skin and skin

tumors. Cancer 1999;86:2038-2044.

26. Zhang A, Zheng C, Lindvall C, Hou M, Ekedahl J, Lewensohn R, et al.

Frequent amplification of the telomerase reverse transcriptase gene in

human tumors. Cancer Res 2000;60:6230-6235.

27. University of Toronto. Terminology of nodular hepatocellular lesions.

International Working Party. Hepatology 1995;22:983-993.

28. Miura N, Horikawa I, Nishimoto A, Ohmura H, Ito H, Hirohashi S, et al.

Progressive telomere shortening and telomerase reactivation during

hepatocellular carcinogenesis. Cancer Genet Cytogenet 1997;93:56-62.

29. Huang GT, Lee HS, Chen CH, Chiou LL, Lin YW, Lee CZ, et al.

Telomerase activity and telomere length in human hepatocellular carcinoma.

Eur J Cancer 1998;34:1946-1949.

30. Hytiroglou P, Kotoula V, Thung SN, Tsokos M, Fiel MI, Papadimitriou CS.

Telomerase activity in precancerous hepatic nodules. Cancer 1998;82:1831-

1838.

31. Kitamoto M, Ide T. Telomerase activity in precancerous hepatic nodules.

Cancer 1999;85:245-248.

40

32. Isokawa O, Suda T, Aoyagi Y, Kawai H, Yokota T, Takahashi T, et al.

Reduction of telomeric repeats as a possible predictor for development of

hepatocellular carcinoma: convenient evaluation by slot-blot analysis.

Hepatology 1999;30:408-412.

33. Youssef N, Paradis V, Ferlicot S, Bedossa P. In situ detection of telomerase

enzymatic activity in human hepatocellular carcinogenesis. J Pathol

2001;194:459-465.

34. Oh BK, Chae KJ, Park C, Kim K, Lee WJ, Han KH, et al. Telomere

shortening and telomerase reactivation in dysplastic nodules of human

hepatocarcinogenesis. J Hepatol 2003;39:786-792.

35. Kruk PA, Rampino NJ, Bohr VA. DNA damage and repair in telomeres:

relation to aging. Proc Natl Acad Sci USA 1995;92:258-262.

36. Ancelin K, Brunori M, Bauwens S, Koering CE, Brun C, Ricoul M, et al.

Targeting assay to study the cis functions of human telomeric proteins:

evidence for inhibition of telomerase by TRF1 and for activation of

telomere degradation by TRF2. Mol Cell Biol 2002;22:3474-3487.

37. Kim SH, Han S, You YH, Chen DJ, Campisi J. The human telomere-

associated protein TIN2 stimulates interactions between telomeric DNA

tracts in vitro. EMBO Rep 2003;4:685-691.

38. Ancelin K, Brun C, Gilson E. Role of the telomeric DNA-binding protein

TRF2 in the stability of human chromosome ends. Bioessays 1998;20:879-

883.

39. Karlseder J, Smogorzewska A, de Lange T. Senescence induced by altered

telomere state, not telomere loss. Science 2002;295:2446-2449.

40. Theise ND, Park YN, Kojiro M: Dysplastic nodules and

hepatocarcinogenesis. Clin Liver Dis 2002;6:497-512.

41. Ishikawa F. Breakthrough and views. Telomere crisis, the driving force in

cancer cell evolution. Biochem Biophys Res Commun 1997;230:1-6.

41

42. Zhang A, Zheng C, Hou M, Lindvall C, Wallin KL, Angstrom T, et al.

Amplification of the telomerase reverse transcriptase (hTERT) gene in

cervical carcinomas. Genes Chromosomes Cancer 2002;34:269-275.

43. Fan X, Wang Y, Kratz J, Brat DJ, Robitaille Y, Moghrabi A, et al. hTERT

gene amplification and increased mRNA expression in central nervous

system embryonal tumors. Am J Pathol 2003;162:1763-1769.

42

ABSTRACT (in Korean)

인간의 다단계 간암발생과정에서 텔로미어 길이와 텔로머레이즈

조절 기전

<지도교수 박영년>

연세대학교 대학원 의과학과

김 영 주

연구 목적 : 인간의 다단계 간암발생과정에 대한 연구가 최근 활발히 진

행되면서, 형성이상 결절이 전암병변이라는 증거가 축적되고 있다. 그리

고 텔로미어 길이 감소와 텔로머레이즈 재활성화는 초기 간암발생과정에

서 나타나는 현상으로, 아직 그 기작은 정확히 알려지지 않았다. 따라서

본 연구에서는 텔로미어 결합 단백질들 가운데 telomeric repeat binding

factor 1 (TRF1), TRF2 및 TRF1-interacting nuclear protein 2 (TIN2)가 텔로미

어 길이 유지에 관련되어 있다는 사실을 토대로, 인간의 다단계 간암발생

과정에서 각 유전자의 발현양상과 텔로미어 길이와의 관계에 대하여 조사

하였다. 또 텔로머레이즈 활성화에 중요한 역할을 하는 human telomerase

reverse transcriptase (hTERT) 유전자에 대해, mRNA 발현 정도와 유전자 수

를 측정한 후, 그 둘의 관계에 대해서도 조사하였다.

연구재료 및 방법 : 본 실험에서는 간암발생과정의 각 단계별 조직에서

real-time PCR을 이용하여 TRF1, TRF2, TIN2, hTERT mRNA 발현량 및

hTERT 유전자 수를 측정하였으며, 텔로미어의 길이와 앞서 측정된

43

hTERT 유전자 수의 확인을 위해 southern blot을 시행하였다.

결과 : TRF1, TRF2 및 TIN2의 mRNA 발현양상은 형성이상 결절 고등도

조직과 형성이상 결절 유래 간세포암종 조직에서 증가함을 보였으며, 특

히 간세포암종에서 매우 증가함을 확인할 수 있었다. 텔로미어의 길이는

이들 유전자의 발현 양상과는 반대로 간세포암종으로 진행될수록 주위 비

종양 간조직에 비해 감소함을 보였다. hTERT의 mRNA 발현량은 간세포

암종으로 진행될수록 매우 증가함을 보인 반면, 5p15.33에 위치한 hTERT

유전자 수는 변화가 없었다.

결론 : 간암발생과정에서 증가된 TRF1, TRF2 및 TIN2에 의하여 텔로미어

의 길이 감소가 유발되며, hTERT mRNA 발현량의 증가는 간암발생 초기

단계의 중요한 소견이나, 그 유전자 수의 변화에 의한 것이 아닌 것으로

생각한다.

핵심 되는 말 : 텔로미어, telomeric repeat binding factor 1, telomeric repeat

binding factor 2, TRF1-interacting nuclear protein 2,

텔로머레이즈, human telomerase reverse transcriptase,

간세포암종, 형성이상 결절