regulation of pdh, gs and insulin signalling in skeletal ...20sj%f8rup%20biens%f8.pdf · training...
TRANSCRIPT
![Page 1: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/1.jpg)
F A C U L T Y O F S C I E N C E U N I V E R S I T Y O F C O P E N H A G E N
PhD thesis Rasmus Sjørup Biensø
Regulation of PDH, GS and insulin signalling in skeletal muscle; effect of physical activity level and inflammation
Academic advisor: Henriette Pilegaard
Submitted: 31/01/14
![Page 2: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/2.jpg)
2
Contents
Acknowledgements ......................................................................................................................................................... 5 Summary ............................................................................................................................................................................. 6 Resume (Danish summary) ........................................................................................................................................... 8 List of manuscripts ........................................................................................................................................................ 10 INTRODUCTION ........................................................................................................................................................ 13
Metabolic flexibility during rest and exercise ................................................................................................ 13 Insulin resistance ...................................................................................................................................................... 16 Insulin signaling ........................................................................................................................................................ 17
Protein kinase B/ Akt ......................................................................................................................................... 18 Exercise-induced Akt regulation .................................................................................................................... 18
Glucose uptake and glucose metabolism .......................................................................................................... 19 TBC1D4 .................................................................................................................................................................. 19 Insulin-induced TBC1D4 regulation ............................................................................................................. 19 Exercise-induced TBC1D4 regulation .......................................................................................................... 20 GLUT4 .................................................................................................................................................................... 20 Exercise-induced GLUT4 regulation ............................................................................................................ 21 HKII ......................................................................................................................................................................... 21 Exercise-induced HKII regulation ................................................................................................................. 21 Fate of Glucose-6-phosphate ........................................................................................................................... 21
Glycogen synthase .................................................................................................................................................. 22 GS regulation ....................................................................................................................................................... 22 Insulin-‐mediated GS regulation ................................................................................................................... 22 Exercise-induced GS regulation ..................................................................................................................... 23
Pyruvate dehydrogenase ..................................................................................................................................... 24 PDH structure ....................................................................................................................................................... 24 PDH regulation ..................................................................................................................................................... 25 Diabetes and PDK4 ............................................................................................................................................. 26 Fasting and HFD-induced PDH regulation ................................................................................................. 27 Exercise-induced PDH regulation .................................................................................................................. 28 PDH and inflammation ...................................................................................................................................... 29
Physical activity ........................................................................................................................................................ 30 Physical activity level – physiological adjustments ................................................................................. 30 Physical activity level – and molecular adaptations ........................................................................... 32
![Page 3: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/3.jpg)
3
Akt ............................................................................................................................................................................ 32 TBC1D4 .................................................................................................................................................................. 32 GLUT4 .................................................................................................................................................................... 32 HKII ......................................................................................................................................................................... 32 GS ............................................................................................................................................................................. 32 PDH .......................................................................................................................................................................... 33 Oxidative proteins ............................................................................................................................................... 33
AIMS ................................................................................................................................................................................. 35 METHODS ...................................................................................................................................................................... 36
Human subjects ......................................................................................................................................................... 36 Mice .............................................................................................................................................................................. 36 Experimental protocols ....................................................................................................................................... 36 Bed rest .................................................................................................................................................................. 36 LPS ............................................................................................................................................................................ 36 Catheterization ................................................................................................................................................... 37 Hyperinsulinemic euglycemic clamp ........................................................................................................ 37 Interleukin-‐6 injection .................................................................................................................................... 37
In vivo tests ............................................................................................................................................................... 38 Oral glucose tolerance test ............................................................................................................................ 38 Exercise performance ...................................................................................................................................... 38 VO2max test ............................................................................................................................................................. 38
Laboratory analyses .............................................................................................................................................. 39 Muscle biopsies .................................................................................................................................................. 39 Freeze-‐drying ...................................................................................................................................................... 39 Muscle glycogen ................................................................................................................................................. 39 Muscle creatine ................................................................................................................................................... 40 Muscle G-‐6-‐P and lactate ................................................................................................................................ 40 mRNA isolation and PCR ................................................................................................................................ 41 SDS-‐page and immunoblotting .................................................................................................................... 41 Gels ........................................................................................................................................................................... 42 GS activity .............................................................................................................................................................. 43 PDHa activity ....................................................................................................................................................... 43 Enzyme activity .................................................................................................................................................. 45
Statistics ....................................................................................................................................................................... 45 INTEGRATED DISCUSSION ................................................................................................................................ 47
![Page 4: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/4.jpg)
4
Physical activity level ............................................................................................................................................ 47 Effects of physical activity level on key proteins in insulin signaling and glucose uptake in skeletal muscle .................................................................................................................................................... 47 Effects of physical activity level on GS regulation in skeletal muscle ......................................... 50 Effects of physical activity level on PDH regulation in skeletal muscle ..................................... 53
Regulation of PDH during and after exercise ............................................................................................. 56 IL-‐6 ........................................................................................................................................................................... 56 Inflammation and PDH regulation during exercise ............................................................................ 57
Conclusion ....................................................................................................................................................................... 60 Perspective ....................................................................................................................................................................... 62 Reference List ............................................................................................................................................................... 63 Study I including co-authorship statement Study II including co-authorship statement Study III including co-authorship statement Study IV including co-authorship statement
![Page 5: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/5.jpg)
5
Acknowledgements
The present thesis is based on experimental work conducted at the section for Molecular and
Integrative Physiology, Department of Biology, University of Copenhagen in the period 2011-2013.
The funding was provided by the Lundbeck Foundation, Department of Biology, University of
Copenhagen and Danish Medical Research Council for the PhD scholarship. Additional founding
was obtained from Lundbeck, Danish Medical Research Council, KIF, NOVO and CIM.
First and foremost I would like to thank my supervisor Henriette Pilegaard for the excellent
guidance and support throughout my time as PhD student in her research group, for that I am very
thankful and it would not have been possible without you.
During my time as PhD student I have had the pleasure working with numerous great colleagues in
HP lab, at the Centre of Inflammation and Metabolism (CIM) and colleagues on the 2th floor at
AKB thanks for the scientific discussions and for making science even more fun.
From the HP lab I would like to thank Jesper Olesen, Stine Ringholm Jørgesen, Jakob Grunnet
Knudsen, Maja Munk Nielsen, Anders Gudiksen, Nina Brandt, Caroline Maag Khristensen, Signe
Larsson, Simon Meinertz, Line van Hauen, Mikkel Sillesen Matzen, Jens Frey Halling, Ella
Joensen, Lærke Bernholdt and former members of the HP group Lotte Leick, Kristian Kiilerich.
Furthermore I would like to thank the co-authors for their collaboration and the subjects for their
participation in the studies.
Finally, I owe my girlfriend Karina a great thank for invaluable support and for showing patients
and indulgence especially during the last month of thesis writing
![Page 6: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/6.jpg)
6
Summary The aims of the present thesis were to investigate 1) The impact of physical inactivity on insulin-
stimulated Akt, TBC1D4 and GS regulation in human skeletal muscle, 2) The impact of exercise
training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3) The
impact of inflammation on resting and exercise-induced PDH regulation in human skeletal muscle
and 4) The effect of IL-6 on PDH regulation in mouse skeletal muscle.
Study I demonstrated that bed rest–induced insulin resistance was associated with reduced insulin-
stimulated GS activity and Akt signaling as well as decreased protein level of HKII and GLUT4 in
skeletal muscle. Iαn addition, the ability of acute exercise to increase insulin-stimulated glucose
extraction was maintained after 7 days of bed rest. However, acute exercise after bed rest did not
fully normalize the ability of skeletal muscle to extract glucose to the level seen when exercise was
performed before bed rest.
Study II demonstrated that exercise training-improved glucose regulation in elderly healthy subjects
was associated with increased HKII, GLUT4, Akt2, PDK2, GS and PDH-E1α protein content.
Moreover, exercise training resulted in an enhanced response of TBC1D4 and GS and a reduced
PDHa activity in response to glucose intake relative to before training.
Study III demonstrated that LPS-induced inflammation with elevated plasma TNFα concentration
did not affect resting or exercise-induced AMPK and PDH regulation in human skeletal muscle.
Study IV demonstrated that an IL-6 injection reduced PDHa activity in skeletal muscle from fed
mice and increased the PDHa activity in skeletal muscle from fasted mice without any change in
phosphorylation level. An IL-6 injection increased AMPK and ACC phosphorylation in mouse
skeletal muscle only in the fasted state. In addition, the effects of IL-6 on PDH were rather modest
relative to the changes observed with fasting.
In conclusion, 1) decreased glucose transport/phosphorylation and decreased non-oxidative glucose
metabolism seemed to contribute to the decreased skeletal muscle glucose extraction with physical
inactivity in humans, and physical inactivity did not affect the ability of exercise to enhance insulin-
mediated skeletal muscle glucose extraction. 2) Exercise training-improved glucose handling in
aged human skeletal muscle was associated with increased content of key proteins in glucose
metabolism and acute molecular changes towards improved glucose uptake and storage. 3) Short-
term inflammation did not seem to influence resting or exercise-induced fat and carbohydrate
utilization in human skeletal muscle. 4) IL-6 may regulate the PDHa activity in mouse skeletal
![Page 7: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/7.jpg)
7
muscle, but the effect seems to depend on the energy state of the muscle, and AMPK may be
involved in the fasted state.
![Page 8: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/8.jpg)
8
Resume (Danish summary)
Formålet med denne PhD afhandling var at undersøge 1) effekt af fysisk inaktivitet på den insulin
stimulerede regulering af Akt, TBC1D4 og GS i human skeletmuskulatur, 2) effekt af træning på
glukose-induceret PDH og GS regulering i skeletmuskulaturen hos ældre mænd, 3) effekt af
inflammation på hvile og arbejds-induceret PDH regulering i human skeletmuskulatur og 4) effekt
af en enkelt IL-6 injektion på PDH regulering i skeletmuskulatur hos mus.
Studie 1 viste, at sengeleje-induceret insulinresistent var associeret med reduceret insulin-stimuleret
GS-aktivitet og Akt-signalering, samt reduceret HKII og GLUT4 proteinindhold i
skeletmuskulaturen. Desuden var evnen til at øge den insulin-stimulerede GS aktivitet efter akut
arbejde bibeholdt efter 7 dages sengeleje. Efter 7 dages sengeleje var et enkelt akut arbejdet dog
ikke nok til at normalisere muskulaturens glukoseekstraktion til det samme niveau, som før
sengeleje.
Studie II viste, at trænings-induceret forbedring af glukosereguleringen hos ældre, raske mænd var
associeret med øget proteinindhold af GLUT4, HKII, Akt2, PDK2, GS og PDHH-E1α i
skeletmuskulaturen. Derudover øgede træning det glukose-medierede respons på TBC1D4 i forhold
til før træning, og glukoseindtag øgede GS-aktiviteten samt reducerede PDHa aktiviteten i
skeletmuskulaturen kun i den trænede tilstand.
Studie III viste, at LPS-medieret inflammation, med forhøjet plasmakoncentration af TNFα ikke
ændrede hvile eller arbejds-induceret AMPK og PDH regulering i human skeletmuskulatur.
Studie IV viste, at en IL-6 injektion reducerede PDHa aktiviteten i skeletmuskulaturen hos mus og
øgede PDHa aktiviteten i fastede mus dog uden at ændre på fosforyleringsniveauet. En IL-6
injektion øgede kun AMPK og ACC fosforylerigen i fastede mus. Endvidere var de IL-6-medierede
effekter på PDH kun moderate i forhold til de ændringer, der sås ved faste.
Samlet kan det konkluderes, at 1) reduceret glukosetransport/fosforylering og reduceret non-
oxidativ glukosemetabolisme kan være årsagen til den reducerede glukoseekstraktion i
skeletmuskulaturen, som forekommer ved fysisk inaktivitet. Fysisk inaktivitet synes ikke at ændre
effekten af et forudgående arbejde på skeletmuskulaturens insulinfølsomhed. 2) den forbedrede
glukosehåndtering efter træning hos ældre mænd var associeret med øget proteinindhold af centrale
proteiner i glukosemetabolismen og akutte molekylære ændringer mod forbedret optag og lagring af
glukose. 3) Akut inflammation ændrede tilsyneladende ikke hvile eller arbejds-induceret
![Page 9: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/9.jpg)
9
substratvalg i human skeletmuskulatur. 4) IL-6 synes at regulere PDH i skeletmuskulaturen, men
energitilstanden synes at influere på denne effekt, og AMPK kan muligvis være involveret ved lav
energitilstand i muskulaturen.
![Page 10: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/10.jpg)
10
List of manuscripts
The present thesis is based on the following manuscripts referred to through this thesis as study I-IV
Study
I: Biensø RS, Ringholm S, Kiilerich K, Aachmann-Andersen NJ, Krogh-Madsen
R, Guerra B, Plomgaard P, van Hall G, Treebak JT, Saltin B, Lundby C, Calbet
JA,Pilegaard H, Wojtaszewski JF. GLUT4 and glycogen synthase are key players in
bed rest-induced insulin resistance. Diabetes. 2012 May;61(5):10909.
II: Biensø RS, Olesen J, Gliemann L, Smith JF, Matzen MS, Wojtaszewski JFP,
Hellsten Y, Pilegaard H. Effects of exercise training on regulation of skeletal muscle
glucose metabolism in skeletal muscle of elderly men. Submitted Journal of
Gerontology: Medical Scinces 2014
III: Biensø RS, Olesen J, van Hauen L, Meinertz S, Halling JF, Gliemann L,
Plomgaard P, Pilegaard H.. Exercise-induced AMPK and pyruvate dehydrogenase
regulation is maintained during LPS-induced inflammation. Submitted Pflugers
Archive, European Journal of Physiology 2014
IV: Biensø RS, Knudsen JG, Brandt N, Pedersen PA, Pilegaard H. Effects of IL-6 on
pyruvate dehydrogenase regulation in mouse skeletal muscle. Pflugers Arch. 2013
Nov 14.
![Page 11: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/11.jpg)
11
Work was contributed to the following manuscript not included in the present thesis
Knudsen JG, Murholm M, Carey AL, Biensø RS, Basse AL, Allen TL, Hidalgo J, Kingwell
BA, Febbraio MA, Hansen JB, Pilegaard H. Role of IL-6 in Exercise Training- and Cold-
Induced UCP1 Expression in Subcutaneous White Adipose Tissue. PLoS One. 2014 Jan
8;9(1):e84910
Guerra B, Ponce-González JG, Morales-Alamo D, Guadalupe-Grau A, Kiilerich K, Fuentes
T, Ringholm S, Biensø RS, Santana A, Lundby C, Pilegaard H, Calbet JA. Leptin signaling in
skeletal muscle after bed rest in healthy humans. European Journal of Applied physiology. 2014
Feb;114(2):345-57.
Nellemann B, Vendelbo MH, Nielsen TS, Bak AM, Høgild M, Pedersen SB, Biensø RS,
Pilegaard H, Møller N, Jessen N, Jørgensen JO. Growth hormone-induced insulin resistance in
human subjects involves reduced pyruvate dehydrogenase activity. Acta Physiologia (Oxf). 2013
Oct 21.
Kenneth Allen Dyar, Stefano Ciciliot, Lauren Emily Wright, Rasmus Sjørup
Biensø, Guidantonio Malagoli Tagliazucchi,Vishal Rajesh Patel, Mattia Forcato, Marcia
Ivonne Peña Paz,Anders Gudiksen, Francesca Solagna, Mattia Albiero, Irene Moretti, Kristin
Lynn Eckel-Mahan, Pierre Baldi, Paolo Sassone-Corsi, Rosario Rizzuto, Silvio
Bicciato, Henriette Pilegaard, Bert Blaauw, Stefano Schiaffino. Muscle insulin sensitivity and
glucose metabolism are controlled by the intrinsic muscle clock Molecular Metabolism. 01/2013
Gliemann L, Schmidt JF, Olesen J, Biensø RS, Peronard SL, Grandjean SU, Mortensen SP,
Nyberg M, Bangsbo J, Pilegaard H, Hellsten Y. Resveratrol blunts the positive effects of exercise
training on cardiovascular health in aged men. Journal of Physiology. 2013 Oct 15;591(Pt 20):5047-
59.
![Page 12: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/12.jpg)
12
Bach E, Nielsen RR, Vendelbo MH, Møller AB, Jessen N, Buhl M, K-Hafstrøm T, Holm L,
Pedersen SB, Pilegaard H, Biensø RS, Jørgensen JO, Møller N.Direct effects of TNF-α on local
fuel metabolism and cytokine levels in the placebo-controlled, bilaterally infused human leg:
increased insulin sensitivity, increased net protein breakdown, and increased IL-6 release. Diabetes.
2013 Dec;62(12):4023-9.
Buhl M, Bosnjak E, Vendelbo MH, Gjedsted J, Nielsen RR, K-Hafstrøm T, Vestergaard ET,
Jessen N, Tønnesen E, Møller AB, Pedersen SB, Pilegaard H, Biensø RS, Jørgensen JO,
Møller N. J Direct effects of locally administered lipopolysaccharide on glucose, lipid, and protein
metabolism in the placebo-controlled, bilaterally infused human leg.
Clinical Endocrinol Metababolism. 2013 May;98(5):2090-9.
Haase TN, Ringholm S, Leick L, Biensø RS, Kiilerich K, Johansen S, Nielsen MM,
Wojtaszewski JF, Hidalgo J, Pedersen PA, Pilegaard H Role of PGC-1α in exercise and fasting-
induced adaptations in mouse liver. American Journal of Physiology, Regulatory Integrative
Comparative Physiology. 2011 Nov;301(5):R1501-9.
Ringholm S, Biensø RS, Kiilerich K, Guadalupe-Grau A, Aachmann-Andersen NJ, Saltin B,
Plomgaard P, Lundby C, Wojtaszewski JF, Calbet JA, Pilegaard H. Bed rest reduces metabolic
protein content and abolishes exercise-induced mRNA responses in human skeletal muscle.
American Journal Physiology, Endocrinol Metabolism. 2011 Oct;301(4):E649-58
Kiilerich K, Ringholm S, Biensø RS, Fisher JP, Iversen N, van Hall G, Wojtaszewski JF,
Saltin B, Lundby C, Calbet JA, Pilegaard H. Exercise-induced pyruvate dehydrogenase
activation is not affected by 7 days of bed rest. Journal of Applied Physiology (1985). 2011
Sep;111(3):751-7.
![Page 13: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/13.jpg)
13
INTRODUCTION
The development of lifestyle related metabolic diseases including insulin resistance and type 2
diabetes (T2D) are increasing all over the world. It was estimated that 200 million people were
glucose intolerant (Zimmet et al. 2001) and 171 million people had T2D in 2000 and a prognosis
estimates that this number will increase to 366 million people in the year 2030 (Wild et al. 2004).
The development of glucose intolerance, insulin resistance and T2D is strongly correlated with
aging and the number of elderly people with T2D is predicted to be doubled in the year 2030
(Glumer et al. 2003;Wild et al. 2004). Together this underlines the importance of understanding the
etiology of lifestyle related metabolic diseases in order to be able to cope with the future challenges
and hopefully prevent these predictions.
Metabolic flexibility during rest and exercise Skeletal muscle is one of the largest organs in the body and skeletal muscle metabolism has
therefore a major impact on whole body metabolism. Skeletal muscle has normally an incredible
ability to adjust the substrate utilization according to the demands. This includes the changes in
substrate utilization from rest to exercise, where the energy turn-over increases and there is a need
for a marked increase in substrate utilization, as well as the ability to shift between fat and
carbohydrates, when substrate availability changes after a meal or during prolonged exercise. This
ability of skeletal muscle to adjust according to demands can be termed metabolic flexibility
(Corpeleijn et al. 2009;Kelley et al. 1999;Kelley, Mandarino 2000;Storlien et al. 2004). Previous
studies have most often used “metabolic flexibility” to describe the ability to switch between fat and
carbohydrate oxidation (Corpeleijn et al. 2009;Kelley et al. 1999;Kelley, Mandarino 2000;Meex et
al. 2010;Storlien et al. 2004), but also the regulation of fat oxidation (Corpeleijn et al. 2009;Kelley,
Mandarino 2000) and the ability to increase glucose utilization in response to enhanced availability
and increased workload (Crewe et al. 2013;Prior et al. 2013). Metabolic flexibility was first
introduced by Kelley and Mandarino in 2000 (Kelley, Mandarino 2000), where they described the
metabolic inflexibility of oxidative fuel selection in skeletal muscle of insulin resistant, obese
subjects and in T2D subjects emphasizing that a key aspect of skeletal muscle metabolic fitness is
the capacity to switch between fuels. They illustrated (Figure 1, left) that insulin resistant, obese
subjects and T2D patients had a diminished or blunted ability to increase respiratory quotient (RQ)
![Page 14: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/14.jpg)
14
during insulin stimulation due to a reduced insulin-mediated suppression of fat oxidation and they
suggested this as part of the observed insulin resistance (Kelley, Mandarino 2000). This point has
Fig 1. Illustration of metabolic flexibility in obese subjects and T2D patients as the ability to increase the respiratory
quotient (RQ) during a hyperinsulinemic euglycemic clamp (left) (Kelley et al. 2000), and metabolic flexibility and
inflexibility after a meal (right) (Corpeleijn et al. 2008).
also schematically been illustrated by the response of lipid and carbohydrate oxidation after a meal
in a metabolic flexible and inflexible subject (Figure 1, right).
Exercise is the most potent physiological enhancer of whole body and muscle metabolism with an
intensity dependent increase in energy expenditure of the working muscle (van Loon et al. 2001).
While carbohydrate utilization dominates the initial phase of exercise (Figure 2, left), a switch
towards fat oxidation takes place as the exercise is prolonged. This was presented already 75 years
ago by Christensen and Hansen showing a decline in RQ during prolonged exercise reflecting
increased fat oxidation (E Christensen, O Hansen 1939;E.Christensen, O.Hansen 1939) (Figure 2,
right).
Fig 2. The respiratory quotient (R.Q) during 30 min (left) and up to 240 min (right) of exercise. The figure to the right
shows the RQ during exercise when on a carbohydrate (K-h) diet, protein rich (N) diet and fat (F) diet (Christensen et
al. 1939).
![Page 15: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/15.jpg)
15
This shift in substrate choice takes place as carbohydrate availability decreases and enables muscle
contractions to continue although potentially at a lower exercise intensity. The mechanisms behind
this shift is not fully understood, but the interplay between fat and carbohydrate utilization is
thought to be a contributing factor (Garland et al. 1962;Randle et al. 1963;Randle et al.
1978;Randle 1986;Randle et al. 1988) as originally described in the glucose fatty-acid cycle for
resting conditions proposed by Randle et al. The original idea was that muscle derives energy
through a tight regulation between glucose and fat metabolism (Randle et al. 1963), where fatty
acids released from muscle or adipose tissue impose restrictions on muscle glucose metabolism, and
where glucose uptake imposes restrictions on fatty acid release from triglycerides (Randle et al.
1963). This idea was later modified with the discovery that lipolysis is independent of glucose
metabolism and regulated by hormones, and the observation that FFA oxidation can inhibit glucose
oxidation (Randle et al. 1988).
Recently, a less marked increase in the respiratory exchange ratio (RER) during exercise was
demonstrated in obese, older glucose intolerant subjects than in normal glucose tolerant subjects
reflecting metabolic inflexibility during submaximal exercise (Prior et al. 2013) (Figure 3). This
suggests a link between insulin-mediated and exercise-induced metabolic inflexibility in glucose
intolerant subjects.
Figure 3. Respiratory exchange ratio (RER) during exercise at 50% and 60% of VO2max in normal glucose tolerant
subjects (NGT) and subjects with impaired glucose tolerance (IGT) (Prior et al. 2013).
Taken together, disturbances in the interaction between fat and carbohydrate may lead to inflexible
skeletal muscle fat and carbohydrate utilization, which may influence skeletal muscle and whole
body metabolism both during exercise and at rest, where it may result in insulin resistance.
![Page 16: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/16.jpg)
16
Insulin resistance Insulin regulates a large number of cellular processes in many tissues including adipose tissue, liver
and skeletal muscle. In adipose tissue insulin stimulates glucose uptake and triglyceride synthesis
and inhibits the release of FFA (Kiens et al. 1989;NOVAK et al. 1965), while insulin inhibits the
release of glucose from the liver by inhibiting hepatic gluconeogenesis and glycogenolysis and
stimulating glycogen storage (DeFronzo et al. 1981;Donkin et al. 1997). In skeletal muscle, insulin
stimulates glucose uptake, storage and oxidation and inhibits glycogenolysis (Bogardus et al.
1984;Cohen 1979;DANFORTH 1965;DeFronzo et al. 1979;DeFronzo et al. 1981), and prior
exercise has been shown to enhance the insulin-mediated effects on glucose uptake and glycogen
storage in skeletal muscle (Wojtaszewski et al. 2000;Bergstrom, Hultman 1966). Insulin resistance
is defined as reduced insulin-mediated cellular responses (Hojlund, Beck-Nielsen 2006;Mandarino
et al. 1987;Mandarino et al. 1996;Perseghin et al. 1996;Schinner et al. 2005) and T2D is most often
characterized by the combined existence of peripheral insulin resistance and β-cell dysfunction
(Donath et al. 2009;Kahn et al. 2006;Stumvoll et al. 2005). The general view is that insulin
resistance is the first step in the development of T2D and that T2D only develops if the beta-cells
are unable to compensate for the reduced insulin sensitivity (Kahn et al. 2006;Stumvoll et al. 2005).
Hence, while a normal glucose tolerant individual will compensate for reduced insulin sensitivity
with increased β-cell insulin release, a person with impaired glucose tolerance will respond with a
reduced insulin secretion and T2D patients will be unable to compensate for reduced insulin
sensitivity due to β-cell dysfunction. A schematic illustration (Figure 4) of this scenario originally
presented by Stumvoll et al (Stumvoll et al. 2005) places insulin resistance as the first step in the
development of T2D and underlines the utmost importance in understanding how to prevent and
potentially reverse the insulin resistant state before β-cell dysfunction sets in.
![Page 17: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/17.jpg)
17
Fig 4 Schematic illustration of the hyperbolic relation between insulin release and insulin sensitivity in a normal
glucose tolerant individual (Normal), while this relationship is abolished in people with impaired glucose tolerance
(IGT) and type 2 diabetes (T2DM) due to an inability to compensate sufficiently for reduced insulin sensitivity.
(adapted from Stumvoll 2005 by Kahn, hull 2006)
Insulin resistance may occur in several insulin-sensitive tissues (Schinner et al. 2005;Tsatsoulis et
al. 2013). Although the insulin regulated processes in adipose tissue and liver may be impaired and
contribute to insulin resistance (DeFronzo et al. 1985;Smith et al. 1999;Tsatsoulis et al. 2013),
skeletal muscle is at least quantitatively by far the most important insulin sensitive tissue (Baron et
al. 1988). Hence, glucose uptake by skeletal muscle constitutes 75-95% of insulin-stimulated
glucose uptake (Baron et al. 1988). Therefore even small changes in skeletal muscle glucose uptake
and glucose metabolism can have a major impact on whole body metabolism. This includes skeletal
muscle insulin resistance characterized by for example reduced insulin-stimulated glucose uptake
and glycogen storage, compared with normal insulin sensitive muscles (DeFronzo et al.
1985;Himsworth 2011;Mandarino et al. 1987). An understanding of insulin signaling in skeletal
muscle in both insulin sensitive and insulin resistant states is therefore important.
Insulin signaling The plasma glucose concentration is regulated to be kept around 5 mM in the post absorptive phase
and during fasting (Hommes et al. 1991). But after a meal, the blood glucose concentration will
increase and glucose will activate secretion of insulin from the pancreas. The increased insulin level
will stimulate signaling pathways in skeletal muscle leading to increased glucose uptake, storage
![Page 18: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/18.jpg)
18
and oxidation. The first step in the insulin signaling pathway is the activation and phosphorylation
of the insulin receptor (IR) at the plasma membrane. This is followed by the docking and
phosphorylation of the Insulin receptor substrate (IRS)1(Yenush, White 1997). Phosphatidylinositol
3-kinase p85 regulatory subunit binds to IRS and activates the p110 catalytic subunit, that becomes
active and phosphorylates phosphatidylinositol (4,5)-biphosphate (PIP2) to phosphatidylinositol
(3,4,5)-triphosphate (PIP3) (Summers, Birnbaum 1997). The increase in PIP3 will phosphorylate and
activate the phosphatidylinositol dependent kinase, which then phosphorylates protein kinase B
(Akt).
Protein kinase B/ Akt
Akt exists as 2 isoforms, Akt1 and Akt2, and it has been suggested that Akt2 plays a larger role in
insulin-stimulated glucose uptake than Akt1 (Vind et al. 2012;Whiteman et al. 2002). Akt is
activated by phosphorylation on two phosphorylation sites termed Akt Thr308 and Akt Ser473
((Alessi et al. 1996;Summers et al. 1999) and concomitantly phosphorylate downstream targets
including TBC1D4 and glycogen synthase kinase (GSK)-3. As TBC1D4 is a key factor in GLUT4
translocation and GSK3 involved in regulating glycogen synthase (GS), Akt is seen as a central
factor in insulin-mediated intracellular signaling towards glucose uptake and glycogen storage
(Figure 4 and 5). While there is no clear line regarding the effect of aging on Akt protein content in
skeletal muscle (Consitt et al. 2013;Leger et al. 2008;Wilkes et al. 2009), lower insulin-stimulated
Akt Ser473 phosphorylation and Akt activity has been observed with aging (Leger et al. 2008;Wilkes
et al. 2009), although Akt phosphorylation has also been reported to be similar in young and elderly
subjects (Consitt et al. 2013). The reduced Akt phosphorylation may be compared with the lower
insulin-stimulated Akt Thr308and Akt Ser473 phosphorylation observed in insulin resistant subjects
(Hojlund, Beck-Nielsen 2006;Hojlund et al. 2009;Karlsson et al. 2005;Meyer et al. 2002;Vind et al.
2011;Vind et al. 2012) indicating that an impaired insulin-stimulated Akt response in aged skeletal
muscle may have similarities with observations in insulin resistant subjects.
Exercise-induced Akt regulation
An increase in Akt Thr308 and Akt Ser473 phosphorylation has been observed in rodent skeletal
muscle immediately after exercise relative to resting skeletal muscle (Howlett et al. 2006;Sakamoto
et al. 2004). However, Akt phosphorylation is similar in a rested and a prior exercised muscle in
both humans and rodents 3-4 h after exercise (Wojtaszewski et al. 1997;Wojtaszewski et al.
2000;Wojtaszewski et al. 2002b;Arias et al. 2007;Hansen et al. 1998).
![Page 19: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/19.jpg)
19
Glucose uptake and glucose metabolism
TBC1D4
The TBC1D4 protein has been shown to be a direct target of Akt, hence the name Akt substrate of
160 kD (zeiger 04). TBC1D4 contains a Rab GTPase activating protein, which has a reduced
activity when phosphorylated leading to an increase in Rab-GTP and the exocytosis of the GLUT4
vesicles to the plasma membrane (Bruss et al. 2005;Cartee, Wojtaszewski 2007;Karlsson et al.
2005;Zeigerer et al. 2004) (Figure 5).
Fig 5 Insulin stimulated and contraction stimulated phosphorylation of TBC1D4 and the following exocytosis of
GLUT4 vesicles (CArtee and wojtaszewski 2007).
Insulin-induced TBC1D4 regulation
The insulin-stimulated GLUT4 translocation is dependent on the RabGAP on TBC1D4 observed in
mice skeletal muscle (Zeigerer et al. 2004;Karlsson et al. 2005). TBC1D4 has been shown to be
phosphorylated on 9 different phosphorylation sites (REF). Furthermore it has been observed in
humans that insulin stimulation further increases the phosphorylation on several specific
phosphorylation sites (Consitt et al. 2013;Treebak et al. 2009;Treebak et al. 2010;Treebak et al.
2014;Vind et al. 2011). The insulin-stimulated phosphorylation of specific sites on TBC1D4 in
skeletal muscle is reduced in type 2 diabetic patients compared with healthy subjects (Consitt et al.
2013;Hojlund et al. 2008;Vind et al. 2011) and this effect has been suggested to contribute to the
![Page 20: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/20.jpg)
20
reduced glucose uptake observed in insulin resistant skeletal muscle (Hojlund et al. 2008;Vind et al.
2011). In addition, insulin-stimulated TBC1D4 phosphorylation has been shown to be reduced in
skeletal muscle of elderly subjects (Consitt et al. 2013)
Exercise-induced TBC1D4 regulation
TDC1D4 was first shown to be phosphorylated by insulin, and shortly after it was observed that
insulin and exercise together increased the overall phosphorylation of TBC1D4 in mouse (Bruss et
al. 2005) and human skeletal muscle (O'Gorman et al. 2006;Treebak et al. 2009).
A single 1 hour exercise bout or longer has been reported to increase TBC1D4 phosphorylation in a
site-specific manner (Howlett et al. 2008;Treebak et al. 2009;Treebak et al. 2014) and with an
elevated phosphorylation level 3 hours into recovery (Howlett et al. 2008;Treebak et al. 2009). The
phosphorylation level in recovery from exercise was further increased with insulin stimulation
(Treebak et al. 2009;Vind et al. 2011), but this seemed to be exercise intensity dependent. In one
study the subjects exercised 60 min at 60% of VO2max (Howlett et al. 2008) and in another study 60
min at 80% of peak work-load and 5 min with 100% peak work load. The more intense workload in
the Treebak et al study resulted in the detection of increased site-specific phosphorylation on
TBC1D4 (Treebak et al. 2009). In addition, the enhanced phosphorylation of TBC1D4 by
combining exercise and insulin could explain some of the increased glucose uptake in the prior
exercised muscle (Treebak et al. 2009).
GLUT4 Because glucose transport across the sarcolemma in part is determined by both the protein content
of GLUT4 and by the translocation of GLUT4 to the membrane (Goodyear, Kahn 1998;Mueckler
1990), improvements in either of these can enhance glucose uptake. In accordance, the insulin
stimulated glucose uptake correlates with the GLUT4 protein content in the muscle (Christ-Roberts
et al. 2004;Dela et al. 1993;Dela et al. 1994b;Frosig et al. 2007).
Aging has often been associated with decreased GLUT4 protein in human (Houmard et al. 1995)
and mouse skeletal muscle (Kern et al. 1992), although no change in GLUT4 protein content has
also been reported with age (Cox et al. 1999). As with aging there is some controversy about
whether or not the GLUT4 protein content in skeletal muscle is changed with insulin resistance and
T2D, because some studies have reported no change (Kahn et al. 1992;Pedersen et al. 1990;Dela et
al. 1994b) and some a decrease in GLUT4 protein content in skeletal muscle with aging and T2D
(Kampmann et al. 2011).
![Page 21: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/21.jpg)
21
Exercise-induced GLUT4 regulation
Even a single exercise bout has been observed to increase the GLUT4 protein content in rat (Ren et
al. 1994) and human skeletal muscle. The contraction-induced translocation of GLUT4 to the
plasma membrane occurring already during exercise is in part mediated by AMPK as shown in
AMPK KO mice (Kramer et al. 2006). Studies suggest that GLUT4 re-locates back to the
cytoplasmic vesicles within 2h after the end of exercise (Goodyear et al. 1990). This indicates that
the increased insulin-stimulated glucose uptake several hours after an exercise session is not due to
an initially elevated number of GLUT4 in the plasma membrane.
HKII When glucose has entered the muscle cell through GLUT4, it is phosphorylated by hexokinase
(HK)II, into glucose-6-phosphate (G-6-P), which is unable to leave the muscle cell. The
phosphorylation of glucose by HKII has been suggested as a limiting step in glucose uptake and
studies in genetically manipulated mice support this possibility (Fueger et al. 2004a;Fueger et al.
2004b;Wasserman et al. 2011;Wasserman, Ayala 2005). In addition, insulin resistant subjects and
T2D patients have reduced HKII activity (Vestergaard et al. 1995) and reduced insulin-stimulated
muscle G-6-P compared with healthy subjects (Cline et al. 1999;Rothman et al. 1995). Furthermore
as aging can be associated with reduced insulin sensitivity (Consitt et al. 2013;Cox et al. 1999;Dela
et al. 1996) and HKII activity also is reduced with age, HKII may be suggested to contribute to the
reduced glucose uptake with aging (Consitt et al. 2013;Cox et al. 1999;Dela et al. 1996).
Exercise-induced HKII regulation
Even a single exercise bout has been shown to increase HKII activity as well as HKII transcription
and mRNA content in human skeletal muscle in recovery from exercise (O'Doherty et al.
1996;Pilegaard et al. 2000). In addition, the exercise-induced HKII mRNA response has been
reported to be similar in T2D patients and control subjects, while the HKII activity has been
reported to be lower in T2D patients (Cusi et al. 2001;Vestergaard et al. 1995) suggesting a less
efficient phosphorylation of glucose in T2D patients than in healthy controls.
Fate of Glucose-6-phosphate
The G-6-P in the muscle cell will either be incorporated into muscle glycogen or through glycolysis
be converted to pyruvate, which either will be converted to acetyl CoA in the mitochondria or
lactate in the cytosol (Randle et al. 1978;Randle 1986;Randle et al. 1988;Randle et al. 1963). GS
catalyzes the incorporation of G-6-P into glycogen in the cytosol (Leloir, CARDINI 1955;Leloir,
![Page 22: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/22.jpg)
22
CARDINI 1957), while the pyruvate dehydrogenase (PDH) complex (PDC) catalyzes the oxidative
decarboxylation of pyruvate to acetyl CoA in the mitochondria (Randle et al. 1978;Randle 1986).
Hence GS and PDC are key enzymes in non-oxidative and oxidative skeletal muscle glucose
metabolism, respectively.
Glycogen synthase
GS regulation Glycogen is a branched polymer and GS incorporates glucose from uridine diphosphate glucose
(UDP-glc) into glycogen (Leloir, CARDINI 1957). GS is a member of the A-type
glycosyltransferase family that catalyzes the formation of the glycosidic linkages of glycogen using
UDP-glucose as the donor (Roach 2002;Roach et al. 2012). GS is regulated by phosphorylation on
at least 9 serine residues (Roach et al. 1977;Roach 1990;Roach 2002;Roach et al. 2012;Roach,
Larner 1977;Skurat et al. 1994;Skurat, Roach 1995;Skurat, Roach 1996) and allosterically by G-6-P
(Leloir, CARDINI 1957;Roach et al. 1976;Roach, Larner 1976;Roach et al. 1977) (Figure 6). When
GS is phosphorylated it becomes inactivated, however the allosteric regulation by G-6-P overrules
the covalent modification (Leloir, CARDINI 1957;Roach et al. 1976;Roach, Larner 1976;Roach et
al. 1977). The main regulatory sites on GS are 2+2a, 3a and 3b (Skurat et al. 1994;Skurat, Roach
1995).
Insulin-‐mediated GS regulation Insulin is a very potent activator of GS activity both through the increase in cellular G-6-P and
through reduced GSK-3 activity by Akt-mediated phosphorylation, leading to dephosphorylation of
sites 3a, 3b, 3c and 4 (Roach et al. 1977;Skurat, Roach 1995;Skurat et al. 2000) (Figure 6). GS is
dephosphorylated by protein phosphorylase (PP)1 (Cohen 1989), the activity of which is regulated
by its subunit GM. When GM is bound to PP1, the PP1-GM complex is active and dephosphorylates
GS (Cohen 1989;Nielsen, Wojtaszewski 2004;Roach 2002). Insulin resistant subjects and T2D
patients have reduced GS activity and a reduced insulin-mediated effect on GS regulation (Christ-
Roberts et al. 2004;Hojlund, Beck-Nielsen 2006;Hojlund et al. 2008;Hojlund et al. 2009;Perseghin
et al. 1996;Vind et al. 2011;Cline et al. 1999). One of the molecular changes observed in skeletal
muscle of insulin resistant subjects is a defect in insulin-mediated dephosphorylation of GS site
2+2a (Hojlund et al. 2003;Hojlund et al. 2009;Glintborg et al. 2008;Vind et al. 2011) resulting in a
hyper-phosphorylation of GS site 2+2a (Hojlund et al. 2003;Vind et al. 2011), although not
observed in all studies (Hojlund et al. 2006).
![Page 23: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/23.jpg)
23
Fig 6. The regulation of glycogen synthase (GS) by insulin (left) and exercise (right). Insulin stimulated the Akt/PKB-
GSK-3 pathway (modified from Roach 2002 and Nielsen et al 2004)
In addition the insulin-stimulated GS activity in elderly subjects has been reported to be reduced
despite a reduced phosphorylation level on GS site 2 and site 3a compared with young subjects
(Poulsen et al. 2005). Furthermore, the GS protein content has also been shown to be reduced in
aged subjects (Poulsen et al. 2005). Indicating a discrepancy between GS activity and
phosphorylation level in elderly subjects
Exercise-induced GS regulation
During exercise glycogen is a key substrate for supplying the muscle with energy and restoring
glycogen after use has high priority for the muscle (E Christensen, O Hansen 1939;Green 1991). GS
activity has been shown to increase in human skeletal muscle after a single bout of exercise in part
due to dephosphorylation of GS site 2+2a, 3a and 3a+3b (Jensen et al. 2012;Prats et al. 2009),
while several studies have reported that GS activity is not increased during exercise, but
immediately after exercise (Chasiotis et al. 1983;Katz, Raz 1995;Kida et al. 1989). As
phosphorylation on site 2+2a is regulated by AMPK (Huang, Krebs 1977;Jorgensen et al.
2004;Wojtaszewski et al. 2002a), adrenaline (Hiraga, Cohen 1986) and the glycogen content in the
muscle (DANFORTH 1965;Nielsen, Wojtaszewski 2004;Wojtaszewski et al. 2002a) (Figure 6,7),
these factors are thought to mediate the observed changes at 2+2a in response to exercise. GS
remains dephosphorylated and GS activity elevated for several hours after a single bout of exercise
(Prats et al. 2005;Wojtaszewski et al. 1997;Wojtaszewski et al. 2000;Wojtaszewski et al. 2003).
This increased GS activity after exercise is related to lower glycogen content in skeletal muscle as
![Page 24: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/24.jpg)
24
both observed in rats (DANFORTH 1965) and humans (Nielsen et al. 2001;Wojtaszewski et al.
2001).
Figure 7. Relationship between GS activity and glycogen content in skeletal muscle in fed and 16h fasted mice as well
as after treatment with epinephrine (DANFORTH 1965).
The elevated GS activity in recovery from exercise can be further increased with insulin stimulation
(Christ-Roberts, Mandarino 2004;Frosig et al. 2007;Prats et al. 2009;Wojtaszewski et al.
1997;Wojtaszewski et al. 2000;Wojtaszewski et al. 2003), which is associated with a further
dephosphorylation of GS site 2+2a and 3a (Prats et al. 2009) This elevated GS activity is thought to
be a key factor in the effect of prior exercise on insulin-stimulated glucose uptake (Wojtaszewski et
al. 1997;Wojtaszewski et al. 2000;Wojtaszewski et al. 2003).
Pyruvate dehydrogenase The PDC is the only entry for carbohydrate-derived substrate into the mitochondria for oxidation
and is therefore central in the switching between carbohydrates and fat oxidation. PDC ensures
carbohydrate oxidation when carbohydrates are abundant and inhibition of carbohydrate oxidation
when carbohydrates are scarce (Peters et al. 1998;Putman et al. 1993;Randle et al. 1978;Randle et
al. 1988;St Amand et al. 2000).
PDH structure
PDC is a multi-enzyme complex composed of several copies of the heterotetramer (α2β2) pyruvate
dehydrogenase (PDH) (E1), dihydrolipoamide acetyltransferase (E2), dihydrolipoamide
![Page 25: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/25.jpg)
25
dehydrogenase (E3) and dihydrolipoamide dehydrogenase-binding protein (E3BP) (Holness,
Sugden 2003;Patel, Korotchkina 2001;Sugden, Holness 1994).
PDH regulation
The activity of PDH in the active form (PDHa) is tightly regulated when energy demand and
substrate availability changes during exercise and when availability of glucose changes during
glucose intake, fasting and high fat diet (HFD). Although the activity of PDC to some extend is
regulated by product inhibition and stimulated by the substrates (Garland et al. 1963;Kanzaki
1969;Kelley et al. 1993), the main regulation is thought to be by phosphorylation of at least 4 serine
residues in PDH-E1α located at 232 (site 3), 293 (site 1), 300 (site 2) and 295 (site 4) (Gnad et al.
2011;Kiilerich et al. 2010a;Sugden et al. 1978;Linn et al. 1969). More recently, PDH has also been
reported to be regulated by acetylation, but with the effects exerted on the phosphorylation level of
PDH-E1α (Gnad et al. 2011;Jing et al. 2013).
The phosphorylation level of these sites is regulated by 4 isoforms of PDH kinase (PDK) (Jing et al.
2013;Korotchkina et al. 1995;Korotchkina, Patel 2001;Patel, Korotchkina 2001), which
phosphorylate and inactivate the complex, and 2 isoforms of PDH phosphatase (PDP) (Patel,
Korotchkina 2006;Roche et al. 2001) (Fig 7), which dephosphorylate and activate the complex
(Figure 8). The distribution of the 4 PDK’s is tissue specific. While PDK1 is primarily expressed in
heart and pancreas islets (Bowker-Kinley et al. 1998;Sugden, Holness 2003), PDK2 is expressed in
most tissues (Bowker-Kinley et al. 1998), and PDK3 is expressed in testis, kidney and brain
(Bowker-Kinley et al. 1998;Huang et al. 1998). PDK4 is primarily expressed in heart, skeletal
muscle, liver, kidney and pancreatic islets (Bowker-Kinley et al. 1998;Holness et al. 2000). PDP1 is
primarily expressed in heart, brain and skeletal muscle (Huang et al. 1998;Huang et al. 2003), while
PDP2 is expressed in liver, adipose tissue and kidney (Huang et al. 1998;Huang et al. 2003).
Furthermore both PDP isoforms have been detected at the mRNA level in human skeletal muscle by
using real time PCR (Pilegaard et al. 2006). The phosphorylation level of PDH-E1α will therefore
at any given time depend on the balance between the activities of the PDK’s and PDP’s, In addition,
the different PDK isoforms have different affinities for the various phosphorylation sites on the
PDH-E1α subunit (Korotchkina, Patel 2001), which can further play a role in the regulation of the
phosphorylation state.
The activities of the PDK’s and PDP’s can be modified both by changes in expression,
phosphorylation and/or allosteric regulation of the proteins (Patel, Korotchkina 2006). The activity
of the PDK’s is regulated by the acetylation and reduction state of PDH-E2 with PDK activated by
![Page 26: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/26.jpg)
26
an increase in mitochondrial acetyl CoA/CoA and NADH/NAD+ concentration ratios, which may
occur during high rates of β-oxidation as well as PDH activity (Cate, Roche 1978;Randle et al.
1988;Roche et al. 1989). Furthermore, PDK activity is reduced by pyruvate (Cooper et al.
1974;Cooper et al. 1975;Priestman et al. 1996). PDP1 is stimulated by Ca2+ (Huang et al. 1998) and
PDP2 activity has previously been reported to be regulated by insulin in skeletal muscle (Caruso et
al. 2001) through phosphorylation-induced translocation to the mitochondria (Caruso et al. 2001)
(Figure 8).
Fig 8. Illustration of the regulation of the pyruvate dehydrogenase complex (PDC) by PDP and PDK, and the interaction
between the different factors involved in PDK and PDP regulation (Holness et al. 2003).
Diabetes and PDK4
An increased protein content of PDK4 has been observed in a rat model for diabetes and the authors
suggest that the higher PDK4 protein content was induced by elevated FFA plasma levels (Bajotto
et al. 2004). In a human study, PDH activity during a hyperinsulinemic euglycemic clamp was
reduced in T2D patients relative to healthy subjects (Mandarino et al. 1990;Mandarino et al. 1996).
The lower PDH activity indicates a reduced glucose oxidation and this could be a possible
mechanism behind insulin resistance. This is in line with the observed reduced glucose oxidation
and increased lipid oxidation in skeletal muscle during insulin stimulation in diabetic rats (Wu et al.
1998) and in T2D patients (Kelley, Mandarino 2000). In addition is has been reported that T2D
patients have elevated PDK4 mRNA content in skeletal muscle compared with glucose tolerant
subjects (Kulkarni et al. 2012).
![Page 27: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/27.jpg)
27
Fasting and HFD-induced PDH regulation
Fasting has been shown to increase PDK4 transcription and mRNA content in human skeletal
muscle (Pilegaard et al. 2003a) and PDK4 mRNA and protein content in rat (Wu et al. 1998;Wu et
al. 2000) and mouse (Kiilerich et al. 2010a) skeletal muscle with no change in skeletal muscle
PDK2 protein content (Wu et al. 1998;Wu et al. 2000). Similarly skeletal muscle PDK activity has
been reported to increase in human and rat skeletal muscle with fasting (Fuller, Randle 1984;Peters
et al. 1998;Sale, Randle 1980). In accordance with the observed PDK regulation, the two PDP
isoforms have been shown to be down regulated in rat skeletal muscle at both the mRNA and
protein level by 48 hours of fasting (Huang et al. 2003). Hence, the hyper-phosphorylation of PDH-
E1α during fasting shown in mouse skeletal muscle (Kiilerich et al. 2010a) seems to be due to a
combination of increased PDK4 (Kiilerich et al. 2010a;Wu et al. 1998;Wu et al. 2000) and
decreased PDP protein content. Furthermore, in agreement with an the increased PDH-E1α
phosphorylation, skeletal muscle PDHa activity has been shown to be reduced in mice after 24
hours of fasting (Kiilerich et al. 2010a) suggesting that inhibition of PDHa activity contributes to
reducing carbohydrate oxidation and increasing fat oxidation in skeletal muscle during fasting.
Another model used to investigate the regulation of PDH during changes in substrate availability
and use is high fat diet (HFD). Intake of saturated fat has been shown to increase PDK activity in
rat oxidative skeletal muscle (Peters et al. 2001a) and a human study has shown that decreased RER
after 3 days on low carbohydrate diet/rich in saturated fat was associated with increased PDK
activity and reduced PDHa activity in skeletal muscle (Peters et al. 2001b). This suggests that PDK-
mediated inhibition of PDH contributes to an increased fat oxidation during HFD (Jansson, Kaijser
1982;Peters et al. 1998;Peters et al. 2001b;Putman et al. 1993). Furthermore, intake of a
carbohydrate rich breakfast meal after an overnight HFD has been shown to reduce PDK4 protein
content in human skeletal muscle relative to a high fat rich breakfast after an o/n HFD
demonstrating very rapid regulation of PDK4 protein in humans by changes in carbohydrate
availability (Kiilerich et al. 2010b). A tendency for an increase in PDK4 mRNA content in human
skeletal muscle after only 4h of intralipid infusion (Pilegaard et al. 2006) supports that fatty acids
play a role in this regulation of PDH during fasting and HFD.
Only limited information exists on PDK4 regulation with aging, but there are indications that PDK4
at least in rat muscle is increased with aged (Bajotto et al. 2004).
![Page 28: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/28.jpg)
28
Exercise-induced PDH regulation
The first study to show an exercise-induced increase in PDHa activity in human skeletal muscle
used cycling exercise with 1 min exercise and 3 min rest until exhaustion (Ward et al. 1982). Later
it has been demonstrated that PDHa activity increases in human skeletal muscle already after just 1
min (Howlett et al. 1998) and that the PDHa activity is increased in an exercise intensity dependent
manner (Howlett et al. 1998). A proposed contributing mechanism for the increase in PDHa activity
during exercise is a combination of increased accumulation of Ca+ and pyruvate (Constantin-
Teodosiu et al. 2004;Huang et al. 2003) with concomitant effects on the activity of PDP1 and
PDK’s. In accordance, a single exercise bout has been shown to result in marked dephosphorylation
of PDH-E1α in human skeletal muscle (Kiilerich et al. 2008;Pilegaard et al. 2006;Kiilerich et al.
2010b;Kiilerich et al. 2011) supporting a key role of phosphorylation status in PDHa activity also
during exercise. The impact of plasma FFA concentration on exercise-induced PDH regulation has
been examined by modulating the FFA concentration through HFD, nicotinic acid and intralipid
infusion (Kiilerich et al. 2010b;Pilegaard et al. 2006;Stellingwerff et al. 2003). Reduction in plasma
free fatty acid (FFA) concentration by ingestion of the antilipolytic dryg nicotinic acid resulted in a
higher level of PDHa activity and higher RER value in response to exercise (Stellingwerff et al.
2003). In accordance, enhanced plasma FFA concentration by o/n HFD has been shown to reduce
the exercise-induced increase in PDHa activity and reduced the decrease in PDH phosphorylation at
Ser300 (Kiilerich et al. 2010b).
Further studies have shown that the PDHa activity in human skeletal muscle remains elevated at a
rather constant level up for to about 2 hours of low intensity exercise followed by a decrease
towards the resting level as exercise proceeds above 2 hours (Mourtzakis et al. 2006;Pilegaard et al.
2006;Watt et al. 2004). Although a single exercise bout has been shown to increase PDK4
transcription and mRNA content in human skeletal muscle in response to exercise (Pilegaard et al.
2002;Pilegaard et al. 2003a), the increase is first pronounced some hours into recovery (Pilegaard et
al. 2000;Pilegaard et al. 2002). In accordance, the decrease in PDHa activity during prolonged
exercise, as the duration exceeds 2 hours of exercise, does not seem to be explained by an increase
in PDK4 protein content, but may be due to an increase in PDK activity (Watt et al. 2004). Opposite
of expected, intralipid infusion resulting in elevated plasma FFA level, maintained the level of
PDHa activity and of PDH dephosphorylation after 3 hours of two-legged knee extensor exercise
relative to a decrease observed at 3 hours of exercise in the control trial. (Pilegaard et al. 2006).
![Page 29: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/29.jpg)
29
This suggests that elevated circulating FFA are not sufficient to obtain the down-regulation of
PDHa activity late during prolonged exercise and that additional factors also play a role.
Previous findings in gene modified mice showing that AMPK KO mice exhibited a more marked
exercise-induced increase in PDHa activity and PDH dephosphorylation than wildtype mice
indicated that AMPK may exert an inhibitory effect on exercise-induced PDH regulation. The
concomitant observation that in vitro muscle incubation with AICAR had no effect on PDH
phosphorylation did however not support such a link between AMKP and PDH (Klein et al. 2007).
On the other hand, the observations in AMPK KO mice (Klein et al. 2007) combined with the
observations that plasma interleukin (IL)-6 increased during prolonged exercise (Keller et al.
2001;Steensberg et al. 2002), IL-6 infusion increased fat oxidation in human skeletal muscle (van et
al. 2003;Wolsk et al. 2010) and IL-6 injections increased AMPK phosphorylation in rat skeletal
muscle (Kelly et al. 2009;Ruderman et al. 2006) may suggest that an IL-6-AMPK-PDH mediated
regulation is involved in regulating the shift towards fat oxidation in skeletal muscle during
prolonged exercise. However, the potential role of IL-6 in regulating skeletal muscle PDH
regulation is unresolved.
PDH and inflammation
One of the factors suggested to play a role in lifestyle related metabolic diseases is low-grade
inflammation characterized by 2-3 fold elevated level of circulating cytokines (Dandona et al.
2004). One of these cytokines is the pro-inflammatory cytokine, tumor necrosis factor (TNF)α,
which has been observed to be elevated in the plasma of obese individuals and T2D patients as well
as in elderly subjects (Bruunsgaard et al. 2001;Bruunsgaard, Pedersen 2003;Hotamisligil
1999;Plomgaard et al. 2005;Stephens et al. 1997). Furthermore TNFα has been reported to induce
insulin resistance in cell culture as well as in mouse and human skeletal muscle (Hotamisligil
1999;Hotamisligil 1999;Plomgaard et al. 2005;Stephens et al. 1997). Hence, 2 hours of TNFα
infusion has been shown to reduce glucose uptake during a hyperinsulinemic euglycemic clamp in
humans (Plomgaard et al. 2005) suggesting that elevated circulating TNFα plays a role in the
development of insulin resistance. Although very little information exists on this, results from a few
studies do indicate an inhibitory effect of inflammation on PDHa activity. Hence, incubation of
cardio myocytes with TNF-α for 24 hours has been shown to reduce the PDH activity (Zell et al.
1997). Furthermore, 24 hour of LPS infusion increased PDK4 mRNA and protein content, reduced
PDP1 mRNA content and reduced the PDHa activity in rat skeletal muscle (Crossland et al. 2008).
Similarly, sepsis in rats induced by E. coli has been shown to decrease PDH activity (vary 1999,
![Page 30: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/30.jpg)
30
vary martin 1993) and increase PDK activity in isolated mitochondria from skeletal muscle (Vary,
Martin 1993;Vary et al. 1998;Vary, Hazen 1999). However the impact of inflammation on PDH
regulation in human skeletal muscle at rest and during exercise is unknown.
Physical activity Several factors contribute to the development of metabolic inflexibility including insulin resistance
in skeletal muscle including genetics, microbiota and lifestyle related factors like obesity and
physical inactivity (Fletcher et al. 2002;Meng et al. 2013;Morine et al. 2010). The major impact of a
physical active lifestyle in reducing the risk of developing lifestyle related diseases and in
improving health in general underlines, however, the special importance of physical activity in this
(Pedersen, Saltin 2006).
The effects of endurance exercise training in preventing lifestyle related metabolic diseases involve
numerous types of adaptations in several tissues of the body including skeletal muscle. These
adaptations are initiated in response to each single exercise bout and are thought to arise from
cumulative effects of each exercise bout (Pilegaard et al. 2000). However, the metabolic challenges
during exercise with enhanced fat and carbohydrate utilization in skeletal muscle may also provide
beneficial effects through the increased removal of fatty acids and/or glucose from the blood. In
addition, the molecular changes in skeletal muscle induced by endurance exercise training improve
both metabolic capacity and flexibility (Meex et al. 2010), which together will improve metabolic
regulation and exercise endurance performance. Hence, an understanding of the impact of physical
activity in the prevention of lifestyle related metabolic diseases requires both an examination of
metabolic regulation during exercise as well as the adaptations to exercise training.
Physical activity level – physiological adjustments
It is well established that the physical activity level has a major impact on both cardiovascular and
metabolic parameters with effects on maximal oxygen uptake, exercise endurance and metabolic
flexibility. Previous studies have used both decreased and increased level of physical activity to
examine the impact of physical activity on skeletal muscle metabolism.
Several studies have reported that exercise training improved insulin sensitivity and/or insulin
responsiveness in skeletal muscle (Dela et al. 1994a;Mikines et al. 1988;Consitt et al. 2013;Frosig
et al. 2007), which is related to the improved capacity for glucose handling. Similarly, many studies
have demonstrated increased exercise endurance using for example an ergometer bike or one-
legged knee extensor exercise (Meex et al. 2010;Perry et al. 2008;Yeo et al. 2008;Pilegaard et al.
![Page 31: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/31.jpg)
31
2003b). Lifelong exercise trained subjects have also been shown to have markedly higher exercise
endurance during cycling than age-matched untrained subjects (Iversen et al. 2011). Furthermore
exercise training has been reported to improve glucose regulation both using hyperinsulinemic
euglycemic clamp and an oral glucose tolerance test (REF; REF). This indicates that elderly
subjects have maintained the ability to adapt to exercise training (Consitt et al. 2013;Cox et al.
1999;Iversen et al. 2011). However, the underlying mechanisms behind the improved glucose
regulation with exercise training in elderly subjects are not fully resolved.
The National Space Agency (NASA) was among the first to investigate the effect of physical
inactivity on the human body through the investigations of the effects of weightlessness during
space travel (Carlson 1967;Lipman et al. 1970;Lipman et al. 1972;Lutwak L, Whedon GD
1959;Mikines et al. 1989;Mikines et al. 1991;Saltin et al. 1968). In addition, one of the first studies
investigating the impact of physical inactivity on cardiovascular functions showed that only 20 days
of bed rest elevated the heart rate during submaximal exercise due to reduced stroke volume and
reduced maximal oxygen uptake due to reduced maximal stroke volume and cardiac output (Saltin
et al. 1968).
Mikines et al (Mikines et al. 1989;Mikines et al. 1991) investigated the effect of 7 days of bed rest
on both whole body and skeletal muscle insulin sensitivity using the hyper-insulinemic euglycemic
clamp technique. They observed that insulin-stimulated glucose uptake in the legs was reduced
following 7 days in bed, clearly demonstrating a decreased skeletal muscle insulin sensitivity.
Furthermore, using a glucose clamp, the same study also showed that the glucose-stimulated insulin
secretion was increased after bed rest (Mikines et al. 1989). Even as little as 3 days in bed have later
been shown to increase heart rate during a submaximal exercise bout, decrease glucose tolerance
and increase the plasma insulin level during an oral glucose tolerance test (Smorawinski et al.
2000).
Detraining can be used as another model of physical activity level to study insulin sensitivity. Dela
et al. observed a decrease in insulin sensitivity after only 6 days of detraining, underlining the
impact of the physical activity level on skeletal muscle insulin sensitivity (Dela et al. 1992).
![Page 32: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/32.jpg)
32
Physical activity level – and molecular adaptations
Akt
Several studies have demonstrated that exercise training increases both Akt 1 and Akt 2 protein
content in human skeletal muscle (Consitt et al. 2013;Vind et al. 2011;Yfanti et al. 2011). However,
no studies have reported the impact of physical inactivity on insulin-mediated Akt regulation.
TBC1D4
Exercise training has been reported to increase TBC1D4 protein content in young subjects (Frosig
et al. 2007), but not in aged subjects (Consitt et al. 2013;Vind et al. 2011). Furthermore, exercise
training has been shown to reverse the impaired insulin-stimulated TBC1D4 phosphorylation
observed in T2D patients (Vind et al. 2011) and elderly subjects (Consitt et al. 2013) underlining
the impact of exercise training on key factors in insulin-mediated cellular responses. However, no
studies have examined the effect of physical inactivity on insulin-mediated TBC1D4 regulation.
GLUT4
Skeletal muscle GLUT4 protein content has been reported to be reduced following 10 days of
detraining (McCoy et al. 1994) and in accordance exercise training has in many studies been shown
to increase the GLUT4 protein content in skeletal muscle of both young and aged subjects (Consitt
et al. 2013;Cox et al. 1999;Dela et al. 1994c;Frosig et al. 2007). However, no studies have
investigated the effect of physical inactivity on GLUT4 protein content in skeletal muscle.
(Kraniou et al. 2006)
HKII
Although hexokinase is considered a glycolytic enzyme, numerous studies have shown that HKII
activity (Bernadr R, Peter J. 1969) and HKII protein content can increase in mouse skeletal muscle
and skeletal muscle of young subjects with endurance exercise training (Frosig et al. 2007;Leick et
al. 2008). However, no studies have investigated the effect of physical inactivity on HKII protein
content in skeletal muscle or whether exercise training can also enhance HKII protein in elderly
subjects.
GS
Exercise training increases total GS activity in human skeletal muscle both in healthy subjects
(Frosig et al. 2007;Vind et al. 2011) and in T2D patients (Perseghin et al. 1996;Vind et al. 2011). In
line, skeletal muscle GS protein content has been reported to increase following 10 weeks of
![Page 33: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/33.jpg)
33
endurance exercise training (Vind et al. 2011), but not to change with 3 weeks of one-legged knee
extensor exercise training (Frosig et al. 2007). The improved insulin-stimulated glucose uptake
observed after an exercise training period may thus in part be due to an increased capacity for GS
synthesis if the exercise training period is of sufficient duration (Christ-Roberts et al. 2004;Frosig et
al. 2007;Vind et al. 2011). The GS activity has also been observed in T2D patients indicating that
improved glucose handling in T2D patients with exercise training include increased GS activity
(Perseghin et al. 1996;Vind et al. 2011). However the impact of physical inactivity on prior
exercise enhancement of insulin-stimulated GS regulation and the impact of exercise training on
skeletal muscle GS regulation in elderly subjects are unresolved.
PDH
The protein content of PDH-E1α in skeletal muscle is increased in human skeletal muscle with
exercise training (Burgomaster et al. 2008;LeBlanc et al. 2004b;Sjogaard et al. 2013) and the
oxidative capacity has been shown to correlate with the protein content of PDH-E1α (LeBlanc et al.
2004a;Love et al. 2011). In line with the increased PDH-E1α protein content, PDK2 protein has
also been shown to increase with exercise training, while PDK4 protein has been reported to remain
unchanged with exercise training (LeBlanc et al. 2004b). The exercise-induced PDHa activity has
been shown to depend on the relative exercise intensity (Howlett et al. 1998). In accordance, PDHa
activity during exercise at the same absolute workload was demonstrated to be lower after an
exercise training period than before (LeBlanc et al. 2004a). However, 7 days in bed have been
reported not to affect the exercise-induced PDH regulation in human skeletal muscle (Kiilerich et
al. 2011) indicating that PDH regulation is affected differently by increased and increased physical
activity.
Oxidative proteins
Numerous previous studies have demonstrated that endurance exercise training increases skeletal
muscle oxidative capacity through enhanced activity and/or protein content of oxidative proteins
and increased capillarization (Henriksson, Reitman 1977;Iversen et al. 2011;Klausen et al.
1981;LeBlanc et al. 2004b;Leick et al. 2008). In accordance, RER during submaximal exercise has
repeatedly been shown to be lower after endurance exercise training than before (Henriksson,
Reitman 1976;Kiens et al. 1993) reflecting a change in substrate utilization towards increased fat
oxidation (Kiens 2006). Furthermore, 6 weeks of exercise training followed by detraining
demonstrated that the activity of oxidative enzymes decreased abruptly when the exercise training
![Page 34: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/34.jpg)
34
was terminated (Henriksson, Reitman 1977). In line several studies have later reported reduced
citrate synthase (CS) activity after a period with physical inactivity (Coyle et al. 1985;Jansson et al.
1988;Richter et al. 1989), while 7 days of bed rest only resulted in a visual decrease in skeletal
muscle CS and 3-hydroxyacyl-CoA-dehydrogenase (HAD) activity. Such reduced capacity for
substrate oxidation may reduce the ability of skeletal muscle to remove both glucose and FFA from
the blood (Mikines et al. 1991).
![Page 35: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/35.jpg)
35
AIMS The overall aim of this PhD thesis was to investigate 1) the impact of physical activity level on
glucose/insulin mediated regulation of PDH, GS and insulin signaling in skeletal muscle and 2) the
role of IL-6 and inflammation in exercise-induced PDH regulation in skeletal muscle.
The following questions will be addressed
1) The impact of physical inactivity on insulin-stimulated Akt, TBC1D4 and GS regulation in
human skeletal muscle.
2) The impact of exercise training on gluce-mediated regulation of PDH and GS in skeletal
muscle in elderly men.
3) The impact of inflammation on resting and exercise-induced regulation in human skeletal
muscle.
4) The effect of IL-6 on PDH regulation in mouse skeletal muscle
![Page 36: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/36.jpg)
36
METHODS In the following section a description of the methods used in this thesis will be described.
Human subjects Human subjects participated in study I, II, and III. In study I, 12 normally physically active young
male subjects with an average age 26±3 years. In study II, 13 elderly male subjects with an average
aged of 65±1 years and in study III 9 untrained subjects age with an average age of 20.8±1 years
participated. Ethical approvals study I, H-C-2007-0085, study II H-2-2011-079 and study III, H-1-
2012-108. All the subjects were informed of the risk and discomfort associated with the
participation in all studies and the experimental protocols were explained in details. The subjects all
provided there oral and written consent to participate. All studies were conducted in accordance
with the guidelines of the Declaration of Helsinki.
Mice In study IV, 8 weeks old female C57/B6 mice (Taconic, Lille Skensved, Denmark) were used. The
mice had free access to a normal chow diet (Altromin 1324, Brogaarden, Lynge, Denmark) and
water ad libitum. The mice had a 12:12 light-dark cycle. The mice were housed together until the
day before the experimental day, where they were housed individually. The ethical approval in
study IV, 2009, 561 1607.
Experimental protocols
Bed rest The protocol used in study I, were a 7 days bed rest with performance tests and hyperinsulinemic
euglycemic clamp before and after the. The subjects performed a one-legged knee extensor
endurance exercise test to exhaustion and a VO2max test before and after the 7 days in bed. The
subjects were allowed and encouraged to sit in a wheel chair for up to 5 hours a day, to avoid
cardiovascular complication. The subjects were transported in wheelchairs to the bathroom.
Rigshospitalets kitchen delivered all meals to the subjects during the bed rest period, where the
subjects were allowed to eat ad libitum.
LPS Lipopolysaccharide (LPS) endotoxin is a protein located in the cell wall of gram negative bacteria
and is the compound that our immune system reacts to during a bacterial infection (Elin et al. 1981).
The LPS can create acute inflammation in subjects when injected with a dose of LPS. The LPS will
![Page 37: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/37.jpg)
37
indorse the macrophages to produce TNFα and IL-6 (Andreasen et al. 2008;Frost et al. 2002). In
study III untrained and trained subjects were injected with 0.3 ng/kg LPS based on previous studies
(Andreasen et al. 2008;Andreasen et al. 2011) and pilot trials on 3 subjects. The LPS injection was
given 2 hours before a 10 min one-legged knee extensor exercise bout at 60% of Wattpeak. Biopsies
were obtained before and after the exercise bout.
Catheterization In study I and III, the subjects had catheters placed in the femoral vein (18 Ga. X 8”, Arrow,
Athlone, Ireland) and femoral artery (20 Ga. X 5”, Arrow, Athlone, Ireland). In study I catheters
were placed in the femoral vein of both legs and one femoral artery, in the rested and exercise leg
respectively. The femoral vein and artery was found with a combination of palpation and ultra
sound. The area where the catheter was inserted was shaved free of hair and disinfected with
ethanol. When the area is clean it was covered with a sterile cloth. The vein was localized with ultra
sound punctuated with a needle and the catheter was inserted via a guide wire. A similar procedure
was performed with the artery. The catheters was flushed with sterile saline and taped to the skin to
minimize irritation during the exercise bout.
Hyperinsulinemic euglycemic clamp There are several ways to assess insulin sensitivity. One method is with the hyper insulinemic
euglycemic clamp technic first described by deFronzo in 1979 (DeFronzo et al. 1979). Insulin (Acta
rapid, Novo nordisk, Denmark) was infused into an arm vein in the subject at a given infusion rate
while the blood glucose concentration was kept at approximately 5mM by a continuous infusion of
glucose. The amount of glucose infused to keep glucose 5mM was a reflection of whole body
insulin sensitivity (DeFronzo et al. 1979). The clamp technique was used in study I with an insulin
infusion rate of 50 mU min-1· m-2. This results in plasma concentration between 400-500 pmol/l that
was within the normal physiological range. The blood glucose concentration was measured during
the clamp to make sure that the blood glucose does not drop to a critical low level. The plasma
glucose was measured on a Radiometer ABL 725 series every 5-10 min and the glucose infusion
rate was adjusted accordingly. The muscle tissue will during a hyper insulinemic clamp be affected
by elevated plasma insulin, but the plasma glucose concentration around 5mM.
Interleukin-‐6 injection In study IV, mice were injected with 3 ng/g recombinant mouse (rm) IL-6 or phosphate buffer
saline (PBS) in the fed or fasted state (16-18h). The quadriceps muscles and trunk blood were
obtained 30 min or 60 min after the injection.
![Page 38: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/38.jpg)
38
In vivo tests
Oral glucose tolerance test Another and more simple way to examine potential changed in glucose metabolism was to use an
oral glucose tolerance test (OGTT) that was first described by Boudouin 1908 with a 100 gr.
glucose load. In study II the subjects consumed a glucose drink containing 1 g glucose per kg body
weight. Blood samples were obtained at 15, 30, 45, 60, 90 and 120 min and plasma glucose, insulin
and C-peptide concentrations were measured. This will give an indication of the glucose tolerance
of the subjects. The muscle tissue during a OGTT potentially be affected by the transient elevation
in both plasma glucose and insulin concentrations.
Exercise performance Performance tests were used in study I, II and III to determine fitness and exercise endurance of the
subjects. A one-legged knee extensor exercise was used in study 1, 3 and 4. The one-legged knee
extensor exercise was first described by Andersen el al (Andersen et al. 1985), where they used a
modified Krogh bicycle ergometer. For the studies described in this thesis the test was performed
on a modified Monach Ergometer bicycle ergometer, but with almost the same setup as in 1985.
The bike was mounted with a rod and attached to one side of the crankset, making it possible for the
subject to kick either with the right or left leg. The subject was instructed to continue until
exhaustion, that was when it was no longer possible to keep up a frequency of 60 per min. The
subjects kicked with a frequency of 60 kicks/min. The test begins with a 5 min warm up followed
by the test a graded incremental test with an increase in resistance (6W) every second minute. The
endurance test was started with different load with either untrained (18W) or trained (24W).
VO2max test The subjects maximal oxygen uptake in study I, II and III using a graded bicycle ergometer test.
The test is performed on an electric Monach Ergometer bike (Monark 839E, Sweden), a modified
version of the original first described by August Krogh in 1911-1913 (Krogh 1913). Oxygen uptake
was determined using an online system (COSMED Quark b2). The test was started with a 5 min
warm up, followed by an incremental increase with 30 W every minute. The subjects respiratory
exchange ratio should be ∼1.10-1.15 at exhaustion and the test should optimally last between 5-10
min (Astrand, Rodahl 1977).
![Page 39: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/39.jpg)
39
Laboratory analyses
Muscle biopsies Muscle biopsies were obtained from the vastus lateralis muscle in study I, II and III. Before the
muscle biopsy was obtained, the area on the thigh was wiped with chlorhexidine and the skin area
was anesthetized (lidocain) and an insertion was made in the skin. Muscle biopsies were obtained
using the percutaneous needle biopsy technique (Bergstrom 1962) modified with suction (Evans et
al. 1982) from individual insertions in the skin. The biopsies were quickly dissected free from
connective tissue and visual blood and frozen in liquid nitrogen within 25 sec and stored at -80°C.
Freeze-‐drying In study I, II and III the muscle samples were freeze-dried to make it possible to separate blood and
connective tissue from the muscle tissue. Muscle pieces to measure PDHa activity and mRNA were
cut off while 80-100 mg of the remaining samples were freeze-dried. The samples were placed in -
25°C and 0.1 bar pressure for at least 48 h that allows the frozen water in the muscle samples to
evaporate. After 48 h, the samples were moved to room temperature for 1 h ad 0.1 bar to be ready
for dissection. Before starting the dissection, a water calibration was made to make it possible to
calculate the exact dry weight of the samples. One sample was weighted at 20 s, 30 s, 40 s, 50 s, 60
s, 90 s and 120 s after the release of the vacuum. The muscle samples were dissected free from
blood and connective tissue and weighted out to western blotting analyses, glycogen content,
enzyme activity and perchloric acid (PCA) extract. Due to the very low water content within the
sample <10% the protein phosphorylation and enzyme activity is maintained in the freeze-dried
muscle samples (Essen et al. 1975;Schantz, Henriksson 1987).
Muscle glycogen The muscle glycogen content was determined in ∼0.8 mg dry weight or 225 µg protein in
homogenate samples in study I, III, and IV and in ∼20 mg wet weight in study II as previously
described (Passonneau, Lauderdale 1974) was boiled for 2 hours in 1 M HCl, which hydrolyses the
glycogen into glycosyl units. The samples were quick spun and the solution free of tissue is
transferred to a new tube. The samples were then loaded to a white mikrotiter plate (Whatman,
Frisenette, Ebeltoft, Denamark) and a reaction mix is added. The mix contains Trisbuffer, H2O,
ATP, MgCl, DTT and NADP+. This assay is based on the auto fluorescence properties of NADPH.
By adding the enzyme G-6-PDH, any G-6-P and NADP+ are converted into 6- phosphogluconic
acid and NADPH that was measured spectophotometrically.
Glycogen --->boiling for 2hours ----> Glucose
![Page 40: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/40.jpg)
40
G-6-P + NADP+ ---G-6-PDH ---> 6PG + NADPH + H+
Glucose + ATP ---> HK ---> G-6-P + ADP
The glycogen concentration was based calculated on a standard curve made from standards loaded
together with the samples on the plate.
Muscle creatine The creatine content was determined in the homogenate used for determining PDHa activity. The
creatine content was use to normalized the PDHa activity, to the total muscle content in each
sample. The creatine was extracted with 0.6 M PCA for 1 hour at room temperature. The reaction
was neutralized with KHCO3 and the samples were centrifuges at 10.000 g for 3 min and
supernatant was transferred to new tubes. The creatine content was determined by using the auto
fluorescence of NADPH in the reaction described in fig xx. The samples and a standard with a
known concentration of creatine is loaded to a white microtiter plate a mix containing: Hepes,
MgCl2, phosphoenol pyruvate, NADH, pentaphosphate pentasodium, ATP, pyruvate kinase (PK)
and lactate dehydrogenase (LDH) is added to each well on the plate and incubated for 20 min. The
plate was then analyzed in a Flouroscan (Thermo Sientific, Rockford, IL, USA) and creatine kinase
(CK) was added to start the reaction described below.
Creatine + ATP ----CK----> P-Creatine + ADP
ADP + P-Pyruvate ----PK----> ATP + Pyruvate
Pyruvate + NADH + H ---LDH---> Lactate + ADP
Muscle G-‐6-‐P and lactate For measuring lactate and G-6-P in muscle 0.8 mg of freeze dried muscle was hydrolyzed with 0.6
M PCA to extract the metabolites (Bergmeyer H.U. 1965). The samples were kept on ice and the
PCA was added the samples were then placed 30 min at 5C°. The sample was transferred to new
tubes and neutralized with KHCO3.
The G-6-P content in the muscle samples was determined in the PCA extract. In a similar way
described above in the glycogen and creatine assay. The samples was loaded on a white microtiter
plate and a mix containing Trisbuffer, H2O, ATP MgCl, DTT and NADP was added and analyses in
a flouroscan G-6-PDH enzyme was added to start the reaction described below. The samples was
incubated for 30 min and analyzed again.
G-6-P + NADP+ ---G-6-PDH ---> 6PG + NADPH + H+
![Page 41: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/41.jpg)
41
Glucose + ATP ---> HK ---> G-6-P + ADP
The muscle content of lactate was determined in the PCA extract from the muscle samples. The
samples were loaded on a white microtiter plate and a mix containing Glycylglycine, H2O, NAD+
and Glutamic acid. The plate was analyzed in a floroscan and a enzyme mix containing LDH and
glutamic-pyruvate transaminase was added to start the reaction described below and incubated for
60 min. The plate was then analyzed in a flouroscan and the lactate content was calculated.
L-Lactat + NAD+ ---LDH---> Pyruvat + NADH + H+
Pyruvat + Lglutamat ---GPT---> Lalanine + α-Oxoglutarate
mRNA isolation and PCR Total RNA was isolated from ∼25 mg muscle with the guanidinium thiocyanate (GT)-phenol-
chloroform extraction method as previously described (Chomczynski, Sacchi 1987) and modified
by Pilegaard et al (Pilegaard et al. 2000). The muscle samples were weighted of in a sterile tube in a
-20°C freezer. The samples were homogenized in an ice-cold GT and β-mercaptoethanol (BME)
solution using a TissueLyserII (Quiagen, Germany) and placed on ice. The GT and BME denature
proteins including RNases. The RNA was extracted by adding phenol, chloroform:isoamyl (49:1)
and NaOAc and the samples were shaken vigorously and placed on ice for 15 min followed by
centrifugation at 12.000 g for 20 min at 4°C. This results in separation into an upper aqueous phase
and a lower organic phase. The organic phase contains proteins while the aqueous phase contains
the RNA. The aqueous phase was carefully transferred to a new tube. Ice-cold isopropanol (-20°C)
was added and the samples vortexed vigorously followed by incubation at -20°C for at least 15 min.
The samples were centrifuged at 12.000 g for 10 min at 4°C resulting in an RNA pellet. The
supernatant was poured off and 75% EtOH in DEPC H2O was added followed by centrifugation at
12.000 g for 5 min at 4°C. The wash step was repeated followed by vacuum drying of the tubes and
resuspension of the pellet in 1 µl/mg DEPC H2O containing 0.1 mM EDTA. It is important to work
with sterile tubes and tips and to keep the samples on ice at all times to keep RNase inactive.
SDS-‐page and immunoblotting The method was described and presented in 1979 (Towbin et al. 1979) and later modified (Burnette
1981). The method used in our laboratory is further modified from the original description. The
analyses were made with either homogenate or lysate made from the homogenized samples. The
![Page 42: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/42.jpg)
42
muscle samples were homogenized in an ice cold buffer containing 50 mmol/l HEPES, 150 mmol/l
NaCl, 20 mmol/l Na4P2O7, 20 mmol/l β-glycerophosphate, 10 mmol/l Na3VO4, 2 mmol/l EDTA,
1%, NP-40, 10%, glycerol, 2 mmol/l phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 20 µg/ml
aprotinin and 3 mmol/l benzamidine using a TissuLyserII (Quiagen, Germany) for 2 min. Freeze-
dried samples from the human studies (study I, II and III) were diluted 1:80, while wet weight
samples were diluted 1:20 in the mouse study (Study IV). Afterwards the samples were rotated end
over end for 1 hour. A part of the homogenate is transferred to new tubes, while the remaining of
the samples were centrifuged at 17500 g at 4°C for 20 min to obtain lysate (the supernatant), that
were transferred to new tubes. The homogenates and lysates are stored at -80°C
The protein concentration in the homogenates and lysates was determined in microtiter plates using
the bicinchoninic acid method (Pierce Chemical). This method uses that the reaction between Cu2+
and protein under alkali conditions reduced Cu2+ to Cu+ that produces a color shift, detectable at a
wavelength at 550 nm. This value is converted to a protein concentration based on albumin
standards (Thermo Sientific, Rockford, IL, USA) loaded on the plate.
To prepare the samples for SDS-PAGE the homogenate and lysate samples were mixed with
sample buffer, containing Tris Base, Dithiothreitol (DTT), sodium dodecyl sulfate (SDS), glycerol
and bromphenol blue. The samples were heated to 96 °C for 3 min, that denatures the proteins and
SDS coats the proteins with negative charges, according to the size of the protein approximately
one SDS molecule for every two amino acid residues.
Gels The hand casted or pre-made gels (24 well, Bio-Rad, Hercules, CA, USA) were placed into a gel
electrophoresis cell and running buffer solution containing Tris-base, glycine, SDS amd H2O is
added. The samples were loaded onto the gel, together with a protein standard and a protein ladder
in each side of the gel. The protein standards were used to normalize between gels and to evaluate
both the run across each gel and the quality of the blotting process. The ladder helps to identify the
relevant part of the gel for visualizing a specific protein of interest. An electric current was applied
to the electrophoresis cell, 150 V and 40 mA per gel in the cell. The SDS coated proteins is
negatively charged and will know be pulled through the gel according to charge and therefore the
size of the protein. When the samples were running through the gel, a color front was created by the
sample buffer, helping to estimate when the samples have proceeded sufficiently, through the gel.
The proteins in the gel were transferred to a polyvinylidene fluoride (PVDF) membrane
(Immobilon-P membrane, Millipore, Billerica, MA, USA) by using the semi dry blotting. The gel
![Page 43: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/43.jpg)
43
piece of interest was cut out of the gel and placed in a sandwich consisting of 3x2 pieces of filter
paper with the gel in between. The sandwich was stacked on a blotting apparatus (Transblot DF
semi-dry Electrophoretic transfer cell, Bio-Rad, Hercules, CA, USA) and an electric field was
applied at 20 V and 0.8 mA per cm2 to horizontally drawn out the proteins and captured them in the
membrane.
After the protein transfer it is important to block the membrane in either bovine serum albumin
(BSA), skin milk solution or fish gelatin to ensure that the PVDF membrane was blocked with
protein. This improves specific binding of the primary antibody to the protein of interest. The
membrane was then incubated overnight in primary antibodies diluted in BSA.
The following day the membrane was washed in tris buffered saline (TBS) with tween 20 (TBST)
and species specific secondary antibodies (DAKO, Glostrup, Denmark) against the primary
antibody was added. Horse radish peroxidase is attached to the secondary antibody and addition of
ECL (Luminata, Millipore, Billerica, MA, USA) reagent containing luminol reagts a creates a
photon which is detected by a digital photo analyzing system (Image Quant LAS4000, Munich,
Germany and Carestream Health, Rochester, NY, USA). The proteins will in this way be visualized
as band on the PVDF membrane. The bands can then be analyzed and quantified using computer
software (Image Quant TL, Munich, Germany and Carestream MI SE, Rochester, NY, USA). The
intensity of the bands on each gel was divided with the average of the loaded standard on the same
gel, making it possible to compare the intensity of samples loaded on different gels.
GS activity The GS activity was determined in muscle homogenate as previously described (Thomas et al.
1968) but modified to microtiter plates. A total of 125µg protein was used from each sample and
diluted to a concentration of 1 µg/µl in a new tube. The GS activity was calculated as UDP-glucose
incorporated into glycogen per minute per gram tissue in the presence of low concentration of G-6-
P (0.02 mM), a physiological concentration (0.17 mM) of G-6-P and a high concentration (8 mM)
of G-6-P to get the total activity. These values were then used to calculate the percentage of GS G-
6-P independent GS activity (0.02mM / 8 mM) (GS I-form) and the GS fractional velocity (GS
%FV) (0.17mM/ 8 mM).
PDHa activity The activity of PDH in the active form (PDHa) is determined based on the rate of acetyl-CoA
formation and the following determination of acetyl-CoA using a radioisotopic assay.
![Page 44: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/44.jpg)
44
The protocol was modified from the methods described in two original manuscripts (Cederblad et
al. 1990;Constantin-Teodosiu et al. 1991). Approx. ∼10 mg of frozen muscle sample was
homogenized in 225 µl ice-cold homogenizing buffer containing Sucrose, KCl, MgCl2, EGTA, Tris
HCl, NaF, DCA and Triton X-100 in a glass tube on ice for 50 sec using a motor-driven
homogenizer and a glass pluger (Kontest, Vineland, NJ, USA). This process will gently tear apart
the tissue and the without disrupting the PDC in the mitochondria. The homogenate is transferred to
a tube containing the rest of the homogenizing buffer up to a total volume given by 30 x weight of
the sample and the sample is quickly frozen in liquid nitrogen.
The homogenate was transferred to an assay buffer solution containing Tris-base, EDTA and
MgCl2 and kept at 37°C. To start the reaction, pyruvate is added, and after 45 s, 90 s and 135 s
sample was transferred to a new tube containing PCA. Duplicates are made and a reaction with
water added instead of pyruvate is also performed to serve as “black”. The total of 9 samples was
neutralized after 5 min incubation by addition of potassium bicarbonate. The samples were
centrifuged at 10000 g for 3 min. The supernatant contains the acetyl-CoA of which the content was
determined as previously described (Cederblad et al. 1990) the following 2 enzymatic reactions. A) 14C-aspartate+ 2-oxogluterat ⇔14C-Oxaloacetate + L-glutamate catalyzed by aspartate
aminotransferase and B) 14C-Oxaloacetat + acetyl CoA ⇔ 14C-citrate + CoASH catalyzed by citrate
synthase. Reaction A was necessary because 14-C- oxaloacetate is not commercially available. After
incubation the unreacted 14C- oxaloacetate is transaminated back to 14C-aspartate in a reaction
catalyzed by glutamic oxaloacetic transaminase (GOT) followed by separation of 14C-aspartate
from the formed 14C-citrate using DOWEX, which is a cation exchange resin (Figure 9).
Standards with different concentration of acetyl-CoA were running along with the samples and
were used to create a standard curve. 14C-citrate was measured in the scintillation counter. The
count for each of the samples was related to the standard curve and an average of the duplicates was
calculated. After taking dilutions during the assay into account, the PDHa activity was given in
mmol·min-1·kg-1.
The total creatine content in each sample is extracted using the PCA method (Bergmeyer H.U.
1965). The method is described under creatine content.
Each sample was normalized to the total creatine content in the sample, to adjust for the presence of
non-muscle tissue in the samples (St Amand et al. 2000).
![Page 45: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/45.jpg)
45
Fig 9 the reactions in the PDHa assay drawn by Prof. Henriette Pilegaard (Cederblad et al. 1990;Constantin-Teodosiu et
al. 1991)
Enzyme activity The enzyme activity of 3-hydroxyacyl-CoA and citrate synthase in study I were measured in muscle
homogenate as previously described (Lowry, Passonneau 1972).
Statistics In all manuscripts the values were presented as mean±SE. Two way ANOVA tests were used to
evaluate the effects in study I a Two-way ANOVA with repeated measures was applied to evaluate
the effect of exercise and insulin before as well as after bed rest. Also, a two-way ANOVA with
repeated measures was used to evaluate the effect of bed rest and insulin within the rested leg as
well as within the exercised leg. The data were log transformed if normality or equal variance tests
failed. If significant main effects were found, the Student-Newman-Keuls post hoc test was used to
locate differences. Differences were considered significant at P <0.05. A tendency is reported for
0.05 # P , 0.1. Statistical calculations were performed using SigmaStat version 3.1.
In study II a student paired t-test was used to test the effect of exercise training on fasting plasma
insulin and glucose as well as protein content. Two-way ANOVA with repeated measures was used
to test the effect of exercise training and glucose intake on plasma glucose, insulin and c-peptide as
well as skeletal muscle protein and protein phosphorylation levels. When a main effect was
observed, a Student-Newman-Keuls post hoc test was used to locate differences between groups if
the data set was log transformed if the data did not pass equal variance test. The data were
![Page 46: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/46.jpg)
46
considered significant at P<0.05 and a tendency is reported when 0.05≤P<0.1. Statistical
calculations were performed in SigmaPlot 11.0.
In study III A Two Way ANOVA with repeated measures was used to evaluate the effect of LPS
and exercise. The data were log transformed if normality or equal variance test failed. If a
significant main effect was detected, the student Newman-Keuls test was used to locate differences.
Differences are considered significant at p<0.05 and a tendency is reported for 0.05≤p<0.1.
Statistical calculations were performed using SigmaPlot 11.0
In study IV a two-way ANOVA tests were used to evaluate the effect of fasting and IL-6 injection
by testing within each time point and within each condition. The data were log transformed if equal
variance test failed. If a main effect was observed, the Student–Newman–Keuls post hoc test was
used to locate differences. In addition, a Student’s t test was used to evaluate the effect of IL-6
within a given time point and condition. Differences were considered significant when P <0.05 and
a tendency is reported for 0.05≤P<0.1. The statistical tests were performed using SigmaPlot 11.0.
![Page 47: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/47.jpg)
47
INTEGRATED DISCUSSION In the following the data from the 4 manuscripts of the present thesis will be discussed. Additional
data from the 4 studies not included in the manuscripts and unpublished data from a mouse
HFD/exercise training study, a single LPS injection in mice, a single AICAR injection in mice and
a study examining the impact of glucose intake in recovery from exercise in elite athletes will also
be integrated.
Physical activity level
Effects of physical activity level on key proteins in insulin signaling and glucose uptake in skeletal muscle The findings in Study I that 7 days of bed rest reduced whole body and skeletal muscle insulin
sensitivity is in accordance with previous bed rest studies (Mikines et al. 1989;Mikines et al. 1991).
Similarly, in Study I prior exercise enhanced the insulin-induced increase in the arterio-venous
glucose difference as previously demonstrated (Wojtaszewski et al. 1997;Wojtaszewski et al. 2000).
Together this provides the setting for studying the underlying mechanisms behind physical
inactivity induced insulin resistance. Study I shows also for the first time that bed rest did not
abolish the ability of exercise to increase insulin sensitivity of skeletal muscle 3h after exercise,
although the glucose uptake was at a lower level than before bed rest. Furthermore, the
observations that exercise training in elderly men resulted in lower plasma insulin concentration
during an OGGT in the trained state than the untrained together with similar plasma glucose
responses indicate that exercise training induced an increase in insulin sensitivity in aging skeletal
muscle. This is in agreement with previous studies using either an OGTT (Cox et al. 1999) or a
hyperinsulinemic euglycemic clamp (Dela et al. 1996) and provides the background for exploring
the underlining mechanisms behind exercise training-induced improvements in glucose handling in
elderly subjects.
The decrease in HKII and GLUT4 protein content in skeletal muscle of young subjects with bed
rest in Study I is in accordance with many previous studies showing an increase with exercise
training (Christ-Roberts et al. 2004;Cox et al. 1999;Dela et al. 1994c;Frosig et al. 2007). In
addition, the increase in GLUT4 and the tendency for an increase in HKII protein with exercise
training in the elderly subjects in Study II show that this ability was maintained in the elderly
subjects as was also observed for oxidative proteins in the same study (Olesen et al., unpublished
data). Together these findings support that the protein level of both HKII and GLUT4 depends on
the physical activity level in both young and aged individuals. Because HKII and GLUT4 are
![Page 48: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/48.jpg)
48
central in skeletal muscle glucose uptake, these changes have likely contributed to the observed
changes in glucose regulation in Study I and II.
In study I, 7 days of bed rest resulted in lower protein content of Akt1 and Akt2 in skeletal muscle
to about 50-70% of the level before bed rest and reduced the Akt Thr308 and Ser473 phosphorylation
level even after normalization to Akt protein in the resting leg before insulin and in both legs after
insulin infusion. However, the insulin-induced increase in Akt Thr308 and Ser473 phosphorylation
during a hyperinsulinemic euglycemic clamp was unaffected by bed rest. The reduced Akt1 and
Akt2 protein content in Study I is in contrast to the lack of change in Akt protein in a similar bed
rest study in subjects with low birth weight (Mortensen et al. 2013), while the reduced Akt
phosphorylation level with bed rest in Study I is in accordance with the reduced Akt Ser473
phosphorylation in the previous bed rest study (Mortensen et al. 2013). The reduced Akt1 and Akt2
protein levels in Study I are however in line with the observed increase in total Akt protein in
previous exercise training studies in young subjects (Frosig et al. 2007;Vind et al. 2011) and does
suggest that the physical activity level can influence Akt protein and phosphorylation level.
Similarly, the observed almost 2 fold increase in Akt2 protein and the more marked increase in
glucose-stimulated absolute Akt Ser473 phosphorylation in the elderly subjects after exercise
training in Study II are in accordance with the findings in a previous study examining elderly aged
subjects (Vind et al. 2011). These observations support that the Akt protein level is sensitive to the
physical activity level and demonstrates that aging muscle maintains the ability to adapt in insulin
signaling components like Akt to exercise training as for HKII and GLUT4. Of notice is that the
glucose intake-induced increase in Akt phosphorylation in Study II was similar before and after
exercise training, when Akt phosphorylation was normalized to the Akt2 protein level. This
suggests that changes in Akt protein content underlines the changes observed in Akt
phosphorylation with exercise training in the elderly subjects, while physical inactivity in young
subjects influences not only protein content, but also additional mechanisms. Although this
mechanism may be lost with aging it may suggest that the changes induced with physical inactivity
and exercise training are not direct opposites, when it comes to Akt regulation.
Previous studies have reported that the protein content of Akt1 and Akt2 in skeletal muscle was
unaffected in skeletal muscle of T2D patients (Vind et al. 2011), although total Akt protein content
has been found to be reduced in another T2D human study (Christ-Roberts et al. 2004). In addition,
as Akt is central in insulin signaling (Hojlund, Beck-Nielsen 2006;Hojlund et al. 2009;Karlsson et
al. 2005;Meyer et al. 2002;Vind et al. 2012) the observed changes in Akt in T2D patients have been
![Page 49: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/49.jpg)
49
suggested to contribute to insulin resistance (Hojlund, Beck-Nielsen 2006;Hojlund et al.
2009;Karlsson et al. 2005;Meyer et al. 2002;Vind et al. 2012). Therefore, the observed changes in
Akt protein and Akt phosphorylation level in Study I and II may in part explain the reduced insulin
sensitivity with bed rest observed in Study I and the seemingly increased insulin sensitivity with
exercise training in Study II.
In addition, the observations that bed rest in Study I lowered both Akt1 and Akt2 protein content in
skeletal muscle, while exercise training only increased Akt2 protein content in the elderly subjects
in Study II may suggest that Akt1 is sensitive to physical inactivity but not exercise training or that
the exercise training-induced regulation of Akt1 is age-dependent. While the previous exercise
training studies in young subjects did not discriminate between the isoforms (Christ-Roberts et al.
2004;Frosig et al. 2007), a comparison of the Akt1 and Akt2 protein levels in skeletal muscle of the
untrained subjects in Study III and well trained young subjects, shows that both Akt1 and Akt 2
protein are higher in exercise trained than untrained young subjects (Figure 10).
Akt1 Akt2
Akt
pro
tein
(AU
)
0,0
0,2
0,4
0,6
0,8
1,0
1,2
1,4Untrained Trained #
#
Fig 10 Akt1 and Akt2 protein content in untrained and trained subjects. The untrained subjects are from Study III.
#:significantly different from untrained, P<0.05
Although it is possible that an exercise training-induced increase in Akt1 protein requires more than
8 weeks of regular physical activity, the present findings do bring up the possibility that the ability
of exercise training to increase Akt1 protein in skeletal muscle is lost with age. As results from
Akt1 overexpression in mice (Lai et al. 2004) have suggested that especially Akt1 plays a role in
translational regulation and hence potentially hypertrophy, an age-related impairment in Akt1
regulation may be speculated to affect the ability to increase muscle mass rather than to improve
glucose regulation with exercise training at increasing age.
The observations that 7 days of bed rest in Study I did not affect either TBC1D4 protein level or the
insulin-induced TBC1D4 phosphorylation at Ser588, Thr642 or Ser751 are surprising based on the
![Page 50: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/50.jpg)
50
reduced Akt phosphorylation level. However, a similar lack of change in both total TBC1D4
protein and insulin-stimulated TBC1D4 phosphorylation has been observed in normal birth weight
subjects in a previous 10 day bed rest study (Mortensen et al. 2013). Moreover, in accordance with
the unchanged TBC1D4 protein with physical inactivity in Study I, exercise training in Study II did
not affect TBC1D4 protein in skeletal muscle of the elderly subjects. On the other hand, previous
studies have reported that TBC1D4 protein tended to increase with exercise training in young
subjects (Frosig et al. 2007) and increased in aged subjects (Vind et al. 2012), while another study
reported no change (Consitt et al. 2013). This may indicate that physical inactivity and exercise
training do not necessarily impose opposite effects on TBC1D4 protein in young subjects and that
the ability to increase TBC1D4 protein with exercise training depends on the exact exercise training
protocol. Moreover, the previous finding that exercise training enhanced the insulin-stimulated
TBC1D4 phosphorylation in skeletal muscle of young subjects (Consitt et al. 2013;Frosig et al.
2007) suggests that insulin-stimulated TBC1D4 phosphorylation is not inversely affected by
physical inactivity and exercise training in young subjects as observed for Akt1, Akt2, GLUT4 and
HKII. Furthermore, the observation that glucose intake-induced TBC1D4 phosphorylation was
enhanced after the exercise training period in the elderly subjects in Study II is in accordance with a
previous finding in elderly subjects (Consitt et al. 2013), and suggests that the ability to enhance
insulin-stimulated GLUT4 translocation with exercise training is maintained in aged skeletal
muscle.
The similar regulation of TBC1D4 before and after bed rest in Study I together with the similar
insulin-stimulated increase in the arterio-venous glucose difference before and after bed rest
supports that TBC1D4 is important in glucose uptake. It has been suggested that TBC1D4 in part
can explain the ability of prior exercise to enhance insulin-stimulated skeletal muscle glucose
uptake. However, the observations in Study I, that the insulin-stimulated regulation of TBC1D4
phosphorylation was similar in the rested and prior exercised leg, although the arterio-venous
glucose difference was higher in the prior exercised leg than the rested leg, do not support an
important role of TBC1D4 in this regulation.
Effects of physical activity level on GS regulation in skeletal muscle In study I, bed rest did not affect GS protein content or total GS activity in skeletal muscle of young
healthy subjects, although the latter seemed lower than before bed rest. These observations are in
accordance with previous findings showing that exercise training in young subjects did not change
GS protein content in skeletal muscle (Frosig et al. 2007). On the other hand, GS protein content
![Page 51: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/51.jpg)
51
and total GS activity increased in skeletal muscle with exercise training in the elderly men in study
II, which is in line with previous observations in aged subjects (Vind et al. 2011). The different
effects of exercise training in young (Frosig et al. 2007) and elderly subjects (Study II) with an
increase in both GS protein and GS activity only in the elderly subjects may suggest that an initial
lower level in the elderly subjects than the young has resulted in a more marked effect of exercise
training in the aged subjects. However, the previous findings that GS protein level and total GS
activity in skeletal muscle were similar in T2D patients and healthy controls (Vind et al. 2011) may
suggest that the different observations rather are due to the exercise training protocols. Hence, the
high-intensity bicycling and cross fit performed by the elderly subjects in Study II may have
provided a stronger stimulus for GS regulation than the one-legged knee extensor exercise used in
the previous study (Frosig et al. 2007).
While bed rest in Study I did not influence the insulin-stimulated dephosphorylation of GS site 3a,
and insulin did increase GS activity also after bed rest, the GS activity tended to be lower and the
insulin-induced dephosphorylation of GS site 2+2a was blunted in the rested leg after 7 days in bed
in Study I. This may in part resemble the impaired insulin-stimulated GS activation and GS site
2+2a dephosphorylation reported in skeletal muscle of insulin resistant subjects and T2D patients
(Glintborg et al. 2008;Hojlund et al. 2003;Hojlund et al. 2006;Hojlund et al. 2008;Vind et al. 2011).
Moreover, the elderly subjects in Study II had before exercise training no change in GS activity or
GS site 2+2a phosphorylation after glucose intake, but GS activity increased and GS site 2+2a
phosphorylation decreased in response to glucose intake after the exercise training period. Taken
together, it may therefore be speculated that 7 days in bed resulted in an impaired insulin-induced
regulation of GS activity due to dysregulation of GS site 2+2a and that this modification is similar
to the changes observed in skeletal muscle of T2D patients (Vind et al. 2011) and potentially also
elderly untrained subjects. In addition, as exercise training in young subjects has been shown not to
change insulin-induced GS activity and/or GS site 2+2a phosphorylation in skeletal muscle, the
changes observed in the elderly subjects in Study II may be explained by an initial impairment in
GS regulation in the elderly subjects in Study II and in previous studies (DeFronzo 1981;Dela et al.
1996;Poulsen et al. 2005).
In study I, a single bout of exercise resulted in higher GS activity in the prior exercised leg before
insulin and GS activity appeared higher in the prior exercised leg than the rested after insulin-
stimulation. This may suggest that regulation of GS at least in part contributed to the enhanced
insulin-stimulated arterio-venous glucose difference in the prior exercised leg relative to the rested
![Page 52: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/52.jpg)
52
leg as previously suggested (Wojtaszewski et al. 1997;Wojtaszewski et al. 2000). Furthermore, the
observations that insulin decreased GS site 3a phosphorylation only in the prior exercised leg and
the 2+2a phosphorylation level was lower in the prior exercised leg than in the rested leg before and
after insulin support that modifications of sites 3a and 2+2a likely have played a role in the higher
GS activity in the prior exercised leg than the rested leg in Study I. This is however different from a
previous study showing that prior exercise resulted in a further dephosphorylation of GS site 2+2a
(Prats et al. 2009). In addition, Study I showed for the first time that 7 days in bed did not abolish
the ability of prior exercise to enhance insulin-stimulated skeletal muscle glucose removal, although
the arterio-venous glucose difference was at a lower level after bed rest than before. This ability
may in part be explained by the maintained effect of prior exercise on basal GS activity, although
GS activity only tended to be higher in the prior exercised leg than the rested leg after bed rest.
Furthermore, the exercise bout seemed to prevent the bed rest-induced GS site 2+2
hyperphosphorylation, but the insulin-mediated regulation of GS site 2+2a was not restored.
Together these findings support that GS site 2+2a regulation is important in the observed GS
dysregulation in Study I and II.
As muscle glycogen is one of the factors thought to regulate GS site 2+2a phosphorylation (Nielsen,
Wojtaszewski 2004), the observed changes in muscle glycogen may have played a role in the
modifications in GS site 2+2a phosphorylation in Study I and II. Hence, the lower muscle glycogen
in the prior exercise leg both before and after bed rest in Study I likely contributed to the higher GS
activity in that muscle as previously suggested (Wojtaszewski et al. 1997;Wojtaszewski et al.
2000;Wojtaszewski et al. 2002b). Similarly, the elevated muscle glycogen levels in both legs after
bed rest relative to before in Study I and the elevated muscle glycogen after exercise training
relative to before in Study II may have contributed to the observed elevated GS site 2+2a
phosphorylation, although other factors most likely also have been in play. The link between
muscle glycogen levels and GS site 2+2a phosphorylation during recovery from exercise was
further investigated in an additional study, where elite athletes exercised for 4h at 73% of HRmax
and received either glucose or water for the initial 4h of recovery (Figure 10). During the 24h of
recovery the energy intake was similar in the two groups. Muscle glycogen was markedly reduced
after exercise in both groups, and while glucose intake resulted in an increase in muscle glycogen at
4h of recovery, no change was observed with H2O intake. However, muscle glycogen was similar at
24 h of recovery. These changes in muscle glycogen were associated with lower GS site 2+2a
phosphorylation in the H2O group than the glucose group at 4h and seemingly less than half in the
![Page 53: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/53.jpg)
53
H2O group than in glucose group at 24h of recovery. As reduced GS site 2+2a phosphorylation
reflects increased GS activity (Jensen et al. 2012;Prats et al. 2009), a higher GS activity may be
assumed in the H2O group than in the glucose group at 4h of recovery, which is in accordance with
the expected effect of reduced muscle glycogen on GS activity (Nielsen et al. 2001;Wojtaszewski et
al. 1997;Wojtaszewski et al. 2000). However, these findings may also suggest that suppression of
muscle glycogen resynthesis by H2O intake after exercise results in elevated GS activity even 24h
after exercise although muscle glycogen has been restored (Figure 11 left, 11 right).
Fig 11 Muscle glycogen (Left) and GS site 2+2a phosphorylation (Right) in elite athletes before (Pre) and after 4h of
exercise (Post) as well as at 4h of recovery with either H2O (black) or glucose (grey) intake from Post to 4h (4h) and at
24h of recovery (24h). GS phosphorylation is normalized to GS protein content and given in arbitrary units (AU).
Values are mean±SE. *: significantly different from Pre within given group, P<0.05; #: significantly different from
H2O group at given time point, P<0.05; §: significantly different from post exercise, P<0.05 and £: significantly
different from 4h after exercise, P<0.05 and † significantly different from H2O group located with t-test. Parentheses
indicate tendency(Bogardus et al. 1984;Frosig et al. 2007;Perseghin et al. 1996).
Effects of physical activity level on PDH regulation in skeletal muscle Previous published results from the same experiment as Study I showed that 7 days of bed rest did
not affect resting PDH-E1α protein, PDH phosphorylation levels or exercise-induced PDH
regulation in human skeletal muscle (Kiilerich et al. 2011). This is in contrast to previous studies
demonstrating that PDH-E1α protein content increases with exercise training in skeletal muscle of
young subjects (LeBlanc et al. 2004a) and unpublished results showing that the PDH-E1α protein
content and the PDH phosphorylation level are higher in well trained young subjects than in the
untrained young subjects from Study III (FIGUR 12). The different sensitivity of PDH-E1α protein
Tri11 Glycogen concentration
Pre Post 4h 24h
Gly
coge
n (m
mol
/kg
dw)
0
200
400
600
800
H2O Glucose
*
#*
* *
£
£ß
ß
GS site 2+2a phosphorylation
Pre Post 4h 24h
GS
site
2+2
a ph
osph
oryl
atio
n/ G
S to
tal (
AU
)
0.0
0.2
0.4
0.6
0.8
1.0
H2O Glucose
(*)*
(#) Ü
ߣ
![Page 54: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/54.jpg)
54
to decreased and increased physical activity indicates that basal PDH-E1α maintenance does not
require regular muscle contractions, while increased muscle activity will elicit an increased capacity
for glucose oxidation in accordance with an increased demand from the working muscle.
Fig 12 PDH-E1α, PDHSer295 phosphorylation/PDH-E1α, PDK2 and PDK4 protein content in untrained and trained
subjects additional data from study II, #:significantly different from untrained, P<0.05
The observation that PDH-E1α protein content and PDH phosphorylation increased with exercise
training in the elderly subjects in Study II as observed in young subjects (LeBlanc et al. 2004a)
shows that aged skeletal muscle maintains the ability to increase the capacity for glucose oxidation
with exercise training. The similar increase in PDH-E1α and PDK2, but no change in PDK4 protein
content, in study II suggests that PDK2 may have mediated the increased phosphorylation of PDH
in the trained state in Study II. This is in accordance with unpublished results showing higher PDK2
protein in well trained young subjects than the untrained young subjects in Study III (Figure 11).
The observations that PDK4 protein did not follow the increase in PDH-E1α protein with exercise
training in Study II and the similar level of PDK4 protein in untrained and trained young subjects
(unpublished results; Figure 11) may suggest that a trained muscle independent of age possesses
less capacity for PDK4-mediated PDH inactivation per PDH-E1α molecule. Unpublished results
from a mouse study demonstrated a similar parallel increase in PDK2 and PDH-E1α in skeletal
muscle with exercise training of mice on HFD, but also a parallel increase in PDK4 protein
matching the increase in PDH-E1α. On the other hand, while HFD did not affect PDK2 and PDH-
E1α protein, PDK4 protein content increased providing a likely mechanism for a reduced PDHa
activity as observed in untrained HFD mice (also relative to PDH-E1α protein) reflecting an
enhanced fatty acid oxidation during the HFD. Although the increase in PDK4 protein with exercise
![Page 55: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/55.jpg)
55
training in the mouse study (Figure 13) may be species specific, it seems likely that it is due to the
exercise training being combined with HFD intake. Hence, taken together these findings support
previous studies (LeBlanc et al. 2004b;LeBlanc et al. 2004a) and show that endurance exercise
training increases PDH-E1α protein content in skeletal muscle and that physical activity level
regulates PDK2 protein, while PDK4 protein mainly is regulated by substrate availability (Peters et
al. 1998;Peters et al. 2001b).
Fig 13 Protein content of PDH-E1α, PDK2 and PDK4 (left) and PDK4/PDH-E1α (right) after 16 weeks on chow, high
fat diet (HFD) or HFD and exercise training (Ex). Values are mean±SE. #:significantly different from chow, P<0.05; *:
significantly different from HDF, P<0.05.
In accordance with previous studies (Peters et al. 1998;Peters et al. 2001b;Peters et al. 2001a). The
above mentioned HFD mouse study demonstrated that 4 month of HFD resulted in decreased
resting PDHa activity in mouse skeletal muscle (unpublished data). In addition, 4 month of HFD
combined with exercise training in mice increased resting PDHa activity relative to sedentary HDF
mice. This may suggest that the exercise trained muscle maintained the ability to oxidize
carbohydrates to the same extend as chow fed mice. Still, no difference was observed in the RER
during submaximal treadmill exercise. However, it may be speculated that the effect of the
enhanced resting PDHa activity, which was matched by a similar increase in PDH-E1α protein, first
becomes evident during more intense exercise, where carbohydrate oxidation is dominant and
required (unpublished data). This remains to be determined.
Previous unpublished results from our group has shown that PDH phosphorylation and PDHa
activity were unaffected during the 3h hyperinsulinemic euglycemic clamp in the same experiment
as used in Study I (Kiilerich, Biensø, Ringholm, Wojtaszewski, Calbet, Pilegaard) both before and
![Page 56: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/56.jpg)
56
after bed rest. However, while insulin was elevated, the plasma glucose concentration was kept
constant and relatively low (5 mM) in Study I, and the use of an OGGT in Study II aimed at
providing a more physiological condition with a transient increase in plasma glucose and plasma
insulin. The findings in Study II that glucose intake did not affect PDHa activity in skeletal muscle
of the elderly subjects in the untrained state and even reduced PDHa activity after the exercise
training period were therefore unexpected. Because a previous study has reported increased PDHa
activity in human skeletal muscle with glucose intake (Pehleman et al. 2005), the lack of change in
Study II may indicate that age or training status has played a role. However, the observation that
glucose intake reduced the PDHa activity in the elderly subjects only after the exercise training
period may suggest that exercise training prevented an otherwise impaired regulation in the elderly
untrained subjects in Study II. In addition, the observed combined regulation of PDH and GS after
the exercise training period may suggest that glucose oxidation is inhibited to prioritize glycogen
storage after the glucose intake, although this suggestion remains to be examined.
Regulation of PDH during and after exercise
IL-‐6 The previous finding that PDHa activity after an initial increase decreases towards resting level as
the exercise duration proceeds above 2h has led to the suggestion that PDH is involved in regulating
the switch from carbohydrate to fat oxidation during prolonged exercise, although PDH does not
seem to be the only factor (Mourtzakis et al. 2006;Pilegaard et al. 2006;Watt et al. 2004). Study IV
aimed at elucidating the potential role of IL-6 in this regulation. A single injection of recombinant
IL-6 was given to fed and fasted mice to mimic the transient IL-6 increase in response to exercise
during different metabolic states. The injection increased the plasma IL-6 9.5 fold, which is rather
similar to what has previously been reported in mice running on a treadmill (Nedachi et al. 2008).
The observation that IL-6 reduced PDHa activity in the fed state was in line with the hypothesis that
IL-6 reduced glucose oxidation in skeletal muscle through an inhibition of PDH. The finding, that
IL-6 did not affect AMPK and ACC phosphorylation in the fed state, indicated however that this
IL-6-mediated effect on PDH was not through AMPK, which is not in agreement with a previous
study in rats reporting that IL-6 increased the AMPK phosphorylation in skeletal muscle (Kelly et
al. 2009). However, the observation that AMPK and ACC phosphorylation was increased in the
fasted mice 1h after the injection together with an IL-6-induced increase in PDHa activity may
suggest that an IL-6-AMPK-PDH pathway does exist in fasting conditions although the effect is
opposite of expected based on a previous study in AMPK KO mice (Klein et al. 2007). The idea
![Page 57: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/57.jpg)
57
that PDH should be a direct target for AMPK was also investigated in a pilot study. Fed mice were
injected with the AMPK activator AICAR. AMPK phosphorylation increased but no change was
observed in PDHa activity or PDH phosphorylation (data not shown). Furthermore, IL-6 was also
injected at a higher dose resulting in 10 fold higher IL-6 plasma concentration than in Study IV
(data not shown), but this did not affect PDHa activity or PDH phosphorylation in skeletal muscle.
Taken together, it seems that IL-6 can regulate PDH in mouse skeletal muscle, but that the level of
IL-6 and the metabolic condition of the muscle influence this regulation. In addition, whether such
an IL-6-mediated regulation of PDH takes place during prolonged exercise remains to be
determined.
Inflammation and PDH regulation during exercise Several studies have found that insulin resistant subjects have an impaired ability to switch to
glucose oxidation during an hyperinsulinemic euglycemic clamp (Kelley, Mandarino
2000;Mandarino et al. 1996). The aim of Study III was to investigate whether inflammation is
associated with a similar metabolic inflexibility in exercise-induced PDH and AMPK regulation in
human skeletal muscle reflecting the ability to enhance substrate oxidation. The observation in
Study III that PDH and AMPK regulation in human skeletal muscle was not changed at rest or
during exercise after LPS injection resulting in a 17 fold increase in plasma TNFα indicates that low
grade inflammation does not affect substrate oxidation at rest and in the initial phase of exercise.
These findings are in line with the observation that local infusion of TNFα or LPS did not change
PDH phosphorylation in human skeletal muscle (Bach et al. 2013;Buhl et al. 2013), but different
from studies in rats and another study in humans reporting that PDH or AMPK regulation was
changed during sepsis or LPS infusion (Andreasen et al. 2008;Andreasen et al. 2011;Crossland et
al. 2008;Vary, Martin 1993;Vary et al. 1998;Vary, Hazen 1999). Additional observations in a pilot
study that PDH Ser300 phosphorylation increased in mouse skeletal muscle 2h after a single LPS
injection compared with saline (unpublished results; FIGURE 14) do support the latter findings in
rats and humans. Although species differences may explain the different effects of LPS on PDH
regulation in Study III and the previous studies (Crossland et al. 2008;Vary, Martin 1993;Vary et al.
1998;Vary, Hazen 1999), it is also possible that the level of cytokines like TNFα is important for
the effects on PDH. Hence, the pilot study in mice resulted in 23 fold increase in plasma TNFα,
while plasma TNFα increased 17 fold in Study III. But this remains to be clarified.
![Page 58: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/58.jpg)
58
Saline LPS
PD
H S
er30
0 pho
spho
ryla
tion
(AU
)
0
1
2
3
4
5
6
7
(*)
Fig 14 PDH Ser300 phosphorylation 2h after saline or LPS injection. Values are mean±SE. (*): tendency to be
significantly different from saline, 0.05≤p<0.1.
As mentioned previous published results (Kiilerich et al. 2011) from the same experiment as Study
I have shown that the exercise-induced regulation of PDHa activity and PDH phosphorylation was
similar before and after bed rest, even though Study I shows that muscle insulin sensitivity was
reduced. However, the exercise-induced AMPK phosphorylation was abolished after the bed rest
(Ringholm et al. 2011). In accordance with the observations in Study III, this effect did not seem to
be caused by inflammation, because systemic inflammation was not detected after bed rest (Olesen
et al, unpublished data). Taken together, these observations suggest that the exercise-induced
regulation of PDH is rather robust, although previous studies have observed effects of intralipid and
high fat diet (Kiilerich et al. 2011;Pilegaard et al. 2006). In addition, the maintained exercise-
induced PDH and AMPK regulation in Study III together with previous studies reporting that
inflammation induces insulin resistance (Bach et al. 2013;Buhl et al. 2013;Plomgaard et al. 2005)
suggests that insulin sensitivity and exercise-induced substrate regulation are affected differently
during inflammation, although it cannot be ruled out that more prolonged inflammation also will
affect exercise-induced metabolic flexibility.
PDH regulation during recovery from exercise
PDH has also been suggested to play a role in substrate regulation in recovery from exercise. To
investigate this further, PDH regulation was examined in the elite athletes described above after
prolonged exercise with either glucose or only water during the initial 4h of recovery (Figure 15).
PDH phosphorylation was at 4h lower in the glucose group than the water group indicating a higher
![Page 59: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/59.jpg)
59
glucose oxidation when glucose was available. However, the PDH phosphorylation level was still
higher, reflecting reduced PDHa activity, 4h after glucose intake than before exercise, which
suggests that the muscle prioritizes glycogen resynthesis rather than glucose oxidation in recovery
from prolonged endurance exercise, when glucose is available during recovery, as also suggested
above after glucose intake without acute exercise in Study II
Fig 15. Phosphorylation of PDH Ser300 (site p2) in elite athletes before (Pre) and after 4h of exercise at 73% HRmax
(Post), 4h after exercise with H2O (black) or glucose intake (grey) fra Post to 4h (4h) and at 24h of recovery (24h).
Values are mean±SE. *: significantly different from Pre within given group, P<0.05; #: significantly different from H2O
group at given time point, P<0.05; §: significantly different from post exercise, P<0.05. Parentheses indicate a
tendency.
PDH site p2 phosphorylation
Pre Post 4h 24h
PDH
site
p2
phos
phor
ylat
ion
/ PD
H to
tal
0.0
0.5
1.0
1.5
2.0
2.5
H2O Glucose
*
*
**
*(*)
(#)(ß)
![Page 60: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/60.jpg)
60
Conclusion • Study I demonstrated that bed rest–induced insulin resistance was associated with reduced insulin-
stimulated GS activity and Akt signaling as well as decreased protein level of HKII and GLUT4 in
skeletal muscle. This suggests that decreased glucose transport/phosphorylation and decreased non-
oxidative glucose metabolism contributed to the decreased skeletal muscle glucose extraction with
physical inactivity in humans. In addition, the ability of acute exercise to increase insulin-stimulated
glucose extraction was maintained after 7 days of bed rest. However, acute exercise after bed rest
did not fully normalize the ability of skeletal muscle to extract glucose to the level seen, when
exercise was performed before bed rest.
• Study II demonstrated that exercise training-improved glucose regulation in elderly healthy
subjects was associated with increased HKII, GLUT4, Akt2, PDK2, GS and PDH-E1α protein
content. Moreover, exercise training resulted in an enhanced glucose-stimulated TBC1D4 response
relative to before training and GS activity increased while PDHa activity decreased after glucose
intake only in the trained state. This shows that aged human skeletal muscle can adapt to exercise
training. In addition, these results suggest that increased content of key proteins in glucose
metabolism and acute molecular changes towards improved glucose uptake and storage contributed
to the observed exercise training-improved glucose handling in aged human skeletal muscle.
• Study III demonstrated that LPS-induced inflammation with elevated plasma TNFα concentration
did not affect resting or exercise-induced AMPK and PDH regulation in human skeletal muscle.
This suggests that short-term inflammation did not influence resting or exercise-induced fat and
carbohydrate utilization in human skeletal muscle.
• Study IV demonstrated that IL-6 reduced PDHa activity in skeletal muscle form fed mice, and
increased the PDHa activity in skeletal muscle from fasted mice without any change in
phosphorylation level. IL-6 injection increased AMPK and ACC phosphorylation in mouse skeletal
muscle only in the fasted state. This suggests that IL-6 regulates PDHa activity in mouse skeletal
muscle, but that the effect depends on the energy state of the muscle. In addition, AMPK may be
involved in the fasted state.
Taken together the present findings suggest that modifications in key factors in skeletal muscle
glucose uptake and storage contribute to the altered insulin-stimulated glucose handling with
changes in physical activity level. Furthermore, the maintained exercise-induced metabolic
regulation in skeletal muscle during acute inflammation suggests that exercise-induced metabolic
![Page 61: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/61.jpg)
61
flexibility is unaffected during low grade inflammation. In addition, IL-6 may regulate substrate
utilization in skeletal muscle through effects on PDH.
![Page 62: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/62.jpg)
62
Perspective
Several questions have already been answered with this thesis, but there were several interesting
findings that could be further pursued.
In study II the unchanged PDHa activity with glucose stimulation before the training intervention in
the elderly subjects was unexpected and the decreased PDHa activity after the 8 weeks of training
was also unexpected. Because a previous study observed increased PDHa activity with glucose
stimulation (Pehlemand), it may be speculated that aging caused this. Hence, it would be interesting
to conduct the same experiment in untrained and trained young subjects. In line with this a similar
experiment would be interesting to perform in T2D patients.
Most of the previous studies investigating the effect of insulin on PDH regulation have used a
hyperinsulinemic euglycemic clamp and observed no effect of insulin. It may be speculated that the
lack of an elevation in plasma glucose concentration is the reason for the absent PDH regulation.
Therefore it would be interesting to perform a hyperglycemic clamp in both healthy subjects and
insulin resistant subjects.
The current study did not observe any effects of acute inflammation on PDH and AMPK regulation.
However, it may be due to the relatively short period of inflammation. Therefore, it would be
interesting to investigate the effect of more prolonged inflammation on PDH regulation in skeletal
muscle both in humans and rodents, with both healthy and diseased individuals.
The present findings indicated that IL-6 may regulate PDH in skeletal muscle. However this was
based on injection of recombinant IL-6. Therefore it would be interesting to further examine the
potential role of IL-6 in PDH regulation during prolonged exercise for example by using IL-6
knockout mice.
Three phosphorylation sites in PDH-E1α have been analyzed in the current PhD studies. However,
a fourth site is known (Ser232). This site was previously thought not to play a role in skeletal muscle,
but recent studies do indicate that this may not be a correct conclusion. Therefore, it would be
interesting to supplement the present analyses with phosphorylation status of this site, Ser232.
![Page 63: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/63.jpg)
63
Reference List
Alessi,D.R., Andjelkovic,M., Caudwell,B., Cron,P., Morrice,N., Cohen,P., and Hemmings,B.A. 1996. Mechanism of activation of protein kinase B by insulin and IGF-‐1. EMBO J. 15:6541-‐6551.
Andersen,P., Adams,R.P., Sjogaard,G., Thorboe,A., and Saltin,B. 1985. Dynamic knee extension as model for study of isolated exercising muscle in humans. J. Appl. Physiol (1985. ) 59:1647-‐1653.
Andreasen,A.S., Kelly,M., Berg,R.M., Moller,K., and Pedersen,B.K. 2011. Type 2 diabetes is associated with altered NF-‐kappaB DNA binding activity, JNK phosphorylation, and AMPK phosphorylation in skeletal muscle after LPS. PLoS. One. 6:e23999.
Andreasen,A.S., Krabbe,K.S., Krogh-‐Madsen,R., Taudorf,S., Pedersen,B.K., and Moller,K. 2008. Human endotoxemia as a model of systemic inflammation. Curr. Med. Chem. 15:1697-‐1705.
Arias,E.B., Kim,J., Funai,K., and Cartee,G.D. 2007. Prior exercise increases phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle. Am. J. Physiol Endocrinol. Metab 292:E1191-‐E1200.
Astrand,P.O. and Rodahl,K. 1977. Textbook of Work Physiology. McGraw Hill: New York.
Bach,E., Nielsen,R.R., Vendelbo,M.H., Moller,A.B., Jessen,N., Buhl,M., Hafstrom,T., Holm,L., Pedersen,S.B., Pilegaard,H., Bienso,R.S., Jorgensen,J.O., and Moller,N. 2013. Direct effects of TNF-‐alpha on local fuel metabolism and cytokine levels in the placebo-‐controlled, bilaterally infused human leg: increased insulin sensitivity, increased net protein breakdown, and increased IL-‐6 release. Diabetes 62:4023-‐4029.
Bajotto,G., Murakami,T., Nagasaki,M., Tamura,T., Tamura,N., Harris,R.A., Shimomura,Y., and Sato,Y. 2004. Downregulation of the skeletal muscle pyruvate dehydrogenase complex in the Otsuka Long-‐Evans Tokushima Fatty rat both before and after the onset of diabetes mellitus. Life Sci. 75:2117-‐2130.
Baron,A.D., Brechtel,G., Wallace,P., and Edelman,S.V. 1988. Rates and tissue sites of non-‐insulin-‐ and insulin-‐mediated glucose uptake in humans. Am. J. Physiol 255:E769-‐E774.
Bergmeyer H.U. 1965. Methods of Enzymatic Analysis.
Bergstrom,J. 1962. Muscle Electrolytes in Man -‐ Determined by Neutron Activation Analysis on Needle Biopsy Specimens -‐ Study on Normal Subjects, Kidney Patients, and Patients with Chronic Diarrhoea. Scandinavian Journal of Clinical & Laboratory Investigation 14:1-‐&.
Bergstrom,J. and Hultman,E. 1966. Muscle glycogen synthesis after exercise: an enhancing factor localized to the muscle cells in man. Nature 210:309-‐310.
Bernadr R and Peter J. 1969. Effect of training and exhaustion on hexokinase activity of skeletal muscle. Journal of Applied Physiology691-‐695.
![Page 64: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/64.jpg)
64
Bogardus,C., Lillioja,S., Stone,K., and Mott,D. 1984. Correlation between muscle glycogen synthase activity and in vivo insulin action in man. J. Clin. Invest 73:1185-‐1190.
Bowker-‐Kinley,M.M., Davis,W.I., Wu,P., Harris,R.A., and Popov,K.M. 1998. Evidence for existence of tissue-‐specific regulation of the mammalian pyruvate dehydrogenase complex. Biochem. J. 329 ( Pt 1):191-‐196.
Bruss,M.D., Arias,E.B., Lienhard,G.E., and Cartee,G.D. 2005. Increased phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle in response to insulin or contractile activity. Diabetes 54:41-‐50.
Bruunsgaard,H. and Pedersen,B.K. 2003. Age-‐related inflammatory cytokines and disease. Immunol. Allergy Clin. North Am. 23:15-‐39.
Bruunsgaard,H., Pedersen,M., and Pedersen,B.K. 2001. Aging and proinflammatory cytokines. Curr. Opin. Hematol. 8:131-‐136.
Buhl,M., Bosnjak,E., Vendelbo,M.H., Gjedsted,J., Nielsen,R.R., Hafstrom,T., Vestergaard,E.T., Jessen,N., Tonnesen,E., Moller,A.B., Pedersen,S.B., Pilegaard,H., Bienso,R.S., Jorgensen,J.O., and Moller,N. 2013. Direct effects of locally administered lipopolysaccharide on glucose, lipid, and protein metabolism in the placebo-‐controlled, bilaterally infused human leg. J. Clin. Endocrinol. Metab 98:2090-‐2099.
Burgomaster,K.A., Howarth,K.R., Phillips,S.M., Rakobowchuk,M., MacDonald,M.J., McGee,S.L., and Gibala,M.J. 2008. Similar metabolic adaptations during exercise after low volume sprint interval and traditional endurance training in humans. J. Physiol 586:151-‐160.
Burnette,W.N. 1981. "Western blotting": electrophoretic transfer of proteins from sodium dodecyl sulfate-‐-‐polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112:195-‐203.
Carlson,L.D. 1967. Cardiovascular studies during and following simulation and weightlessness. Life Sci. Space Res. 5:51-‐54.
Cartee,G.D. and Wojtaszewski,J.F. 2007. Role of Akt substrate of 160 kDa in insulin-‐stimulated and contraction-‐stimulated glucose transport. Appl. Physiol Nutr. Metab 32:557-‐566.
Caruso,M., Maitan,M.A., Bifulco,G., Miele,C., Vigliotta,G., Oriente,F., Formisano,P., and Beguinot,F. 2001. Activation and mitochondrial translocation of protein kinase Cdelta are necessary for insulin stimulation of pyruvate dehydrogenase complex activity in muscle and liver cells. J. Biol. Chem. 276:45088-‐45097.
Cate,R.L. and Roche,T.E. 1978. A unifying mechanism for stimulation of mammalian pyruvate dehydrogenase(a) kinase by reduced nicotinamide adenine dinucleotide, dihydrolipoamide, acetyl coenzyme A, or pyruvate. J. Biol. Chem. 253:496-‐503.
Cederblad,G., Carlin,J.I., Constantin-‐Teodosiu,D., Harper,P., and Hultman,E. 1990. Radioisotopic assays of CoASH and carnitine and their acetylated forms in human skeletal muscle. Anal. Biochem. 185:274-‐278.
![Page 65: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/65.jpg)
65
Chasiotis,D., Sahlin,K., and Hultman,E. 1983. Regulation of glycogenolysis in human muscle in response to epinephrine infusion. J. Appl. Physiol Respir. Environ. Exerc. Physiol 54:45-‐50.
Chomczynski,P. and Sacchi,N. 1987. Single-‐step method of RNA isolation by acid guanidinium thiocyanate-‐phenol-‐chloroform extraction. Anal. Biochem. 162:156-‐159.
Christ-‐Roberts,C.Y. and Mandarino,L.J. 2004. Glycogen synthase: key effect of exercise on insulin action. Exerc. Sport Sci. Rev. 32:90-‐94.
Christ-‐Roberts,C.Y., Pratipanawatr,T., Pratipanawatr,W., Berria,R., Belfort,R., Kashyap,S., and Mandarino,L.J. 2004. Exercise training increases glycogen synthase activity and GLUT4 expression but not insulin signaling in overweight nondiabetic and type 2 diabetic subjects. Metabolism 53:1233-‐1242.
Cline,G.W., Petersen,K.F., Krssak,M., Shen,J., Hundal,R.S., Trajanoski,Z., Inzucchi,S., Dresner,A., Rothman,D.L., and Shulman,G.I. 1999. Impaired glucose transport as a cause of decreased insulin-‐stimulated muscle glycogen synthesis in type 2 diabetes. N. Engl. J. Med 341:240-‐246.
Cohen,P. 1979. The hormonal control of glycogen metabolism in mammalian muscle by multivalent phosphorylation. Biochem. Soc. Trans. 7:459-‐480.
Cohen,P. 1989. The structure and regulation of protein phosphatases. Annu. Rev. Biochem. 58:453-‐508.
Consitt,L.A., Van,M.J., Newton,C.A., Collier,D.N., Dar,M.S., Wojtaszewski,J.F., Treebak,J.T., Tanner,C.J., and Houmard,J.A. 2013. Impairments in site-‐specific AS160 phosphorylation and effects of exercise training. Diabetes 62:3437-‐3447.
Constantin-‐Teodosiu,D., Cederblad,G., and Hultman,E. 1991. A sensitive radioisotopic assay of pyruvate dehydrogenase complex in human muscle tissue. Anal. Biochem. 198:347-‐351.
Constantin-‐Teodosiu,D., Peirce,N.S., Fox,J., and Greenhaff,P.L. 2004. Muscle pyruvate availability can limit the flux, but not activation, of the pyruvate dehydrogenase complex during submaximal exercise in humans. J. Physiol 561:647-‐655.
Cooper,R.H., Randle,P.J., and Denton,R.M. 1974. Regulation of heart muscle pyruvate dehydrogenase kinase. Biochem. J. 143:625-‐641.
Cooper,R.H., Randle,P.J., and Denton,R.M. 1975. Stimulation of phosphorylation and inactivation of pyruvate dehydrogenase by physiological inhibitors of the pyruvate dehydrogenase reaction. Nature 257:808-‐809.
Corpeleijn,E., Saris,W.H., and Blaak,E.E. 2009. Metabolic flexibility in the development of insulin resistance and type 2 diabetes: effects of lifestyle. Obes. Rev. 10:178-‐193.
Cox,J.H., Cortright,R.N., Dohm,G.L., and Houmard,J.A. 1999. Effect of aging on response to exercise training in humans: skeletal muscle GLUT-‐4 and insulin sensitivity. J. Appl. Physiol (1985. ) 86:2019-‐2025.
![Page 66: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/66.jpg)
66
Coyle,E.F., Martin,W.H., III, Bloomfield,S.A., Lowry,O.H., and Holloszy,J.O. 1985. Effects of detraining on responses to submaximal exercise. J. Appl. Physiol (1985. ) 59:853-‐859.
Crewe,C., Kinter,M., and Szweda,L.I. 2013. Rapid inhibition of pyruvate dehydrogenase: an initiating event in high dietary fat-‐induced loss of metabolic flexibility in the heart. PLoS. One. 8:e77280.
Crossland,H., Constantin-‐Teodosiu,D., Gardiner,S.M., Constantin,D., and Greenhaff,P.L. 2008. A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J. Physiol 586:5589-‐5600.
Cusi,K.J., Pratipanawatr,T., Koval,J., Printz,R., Ardehali,H., Granner,D.K., DeFronzo,R.A., and Mandarino,L.J. 2001. Exercise increases hexokinase II mRNA, but not activity in obesity and type 2 diabetes. Metabolism 50:602-‐606.
Dandona,P., Aljada,A., and Bandyopadhyay,A. 2004. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol. 25:4-‐7.
DANFORTH,W.H. 1965. Glycogen synthetase activity in skeletal muscle. Interconversion of two froms and control of glycogen synthesis. J. Biol. Chem. 240:588-‐593.
DeFronzo,R.A. 1981. Glucose intolerance and aging. Diabetes Care 4:493-‐501.
DeFronzo,R.A., Gunnarsson,R., Bjorkman,O., Olsson,M., and Wahren,J. 1985. Effects of insulin on peripheral and splanchnic glucose metabolism in noninsulin-‐dependent (type II) diabetes mellitus. J. Clin. Invest 76:149-‐155.
DeFronzo,R.A., Jacot,E., Jequier,E., Maeder,E., Wahren,J., and Felber,J.P. 1981. The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes 30:1000-‐1007.
DeFronzo,R.A., Tobin,J.D., and Andres,R. 1979. Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am. J. Physiol 237:E214-‐E223.
Dela,F., Handberg,A., Mikines,K.J., Vinten,J., and Galbo,H. 1993. GLUT 4 and insulin receptor binding and kinase activity in trained human muscle. J. Physiol 469:615-‐624.
Dela,F., Mikines,K.J., Larsen,J.J., and Galbo,H. 1996. Training-‐induced enhancement of insulin action in human skeletal muscle: the influence of aging. J. Gerontol. A Biol. Sci. Med Sci. 51:B247-‐B252.
Dela,F., Mikines,K.J., Sonne,B., and Galbo,H. 1994a. Effect of training on interaction between insulin and exercise in human muscle. J. Appl. Physiol (1985. ) 76:2386-‐2393.
Dela,F., Mikines,K.J., von,L.M., Secher,N.H., and Galbo,H. 1992. Effect of training on insulin-‐mediated glucose uptake in human muscle. Am. J. Physiol 263:E1134-‐E1143.
![Page 67: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/67.jpg)
67
Dela,F., Ploug,T., Handberg,A., Petersen,L.N., Larsen,J.J., Mikines,K.J., and Galbo,H. 1994b. Physical training increases muscle GLUT4 protein and mRNA in patients with NIDDM. Diabetes 43:862-‐865.
Dela,F., Ploug,T., Handberg,A., Petersen,L.N., Larsen,J.J., Mikines,K.J., and Galbo,H. 1994c. Physical training increases muscle GLUT4 protein and mRNA in patients with NIDDM. Diabetes 43:862-‐865.
Donath,M.Y., Boni-‐Schnetzler,M., Ellingsgaard,H., and Ehses,J.A. 2009. Islet inflammation impairs the pancreatic beta-‐cell in type 2 diabetes. Physiology. (Bethesda. ) 24:325-‐331.
Donkin,S.S., Bertics,S.J., and Armentano,L.E. 1997. Chronic and transitional regulation of gluconeogenesis and glyconeogenesis by insulin and glucagon in neonatal calf hepatocytes. J. Anim Sci. 75:3082-‐3087.
E Christensen and O Hansen 1939. Zur Methodik der Respiratorischen Quotient-‐Bestimmungen in Ruhe und bei Arbeit I. Skandinavisches Archiv Für Physiologie 81:137-‐151.
E.Christensen and O.Hansen 1939. Zur Methodik der Respiratorischen Quotient-‐Bestimmungen in Ruhe und bei Arbeit III. Skandinavisches Archiv Für Physiologie 81:160-‐171.
Elin,R.J., Wolff,S.M., McAdam,K.P., Chedid,L., Audibert,F., Bernard,C., and Oberling,F. 1981. Properties of reference Escherichia coli endotoxin and its phthalylated derivative in humans. J. Infect. Dis. 144:329-‐336.
Essen,B., Jansson,E., Henriksson,J., Taylor,A.W., and Saltin,B. 1975. Metabolic characteristics of fibre types in human skeletal muscle. Acta Physiol Scand. 95:153-‐165.
Evans,W.J., Phinney,S.D., and Young,V.R. 1982. Suction applied to a muscle biopsy maximizes sample size. Med. Sci. Sports Exerc. 14:101-‐102.
Fletcher,B., Gulanick,M., and Lamendola,C. 2002. Risk factors for type 2 diabetes mellitus. J. Cardiovasc. Nurs. 16:17-‐23.
Frosig,C., Rose,A.J., Treebak,J.T., Kiens,B., Richter,E.A., and Wojtaszewski,J.F. 2007. Effects of endurance exercise training on insulin signaling in human skeletal muscle: interactions at the level of phosphatidylinositol 3-‐kinase, Akt, and AS160. Diabetes 56:2093-‐2102.
Frost,R.A., Nystrom,G.J., and Lang,C.H. 2002. Lipopolysaccharide regulates proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am. J. Physiol Regul. Integr. Comp Physiol 283:R698-‐R709.
Fueger,P.T., Bracy,D.P., Malabanan,C.M., Pencek,R.R., Granner,D.K., and Wasserman,D.H. 2004a. Hexokinase II overexpression improves exercise-‐stimulated but not insulin-‐stimulated muscle glucose uptake in high-‐fat-‐fed C57BL/6J mice. Diabetes 53:306-‐314.
Fueger,P.T., Hess,H.S., Bracy,D.P., Pencek,R.R., Posey,K.A., Charron,M.J., and Wasserman,D.H. 2004b. Regulation of insulin-‐stimulated muscle glucose uptake in the conscious mouse: role of
![Page 68: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/68.jpg)
68
glucose transport is dependent on glucose phosphorylation capacity. Endocrinology 145:4912-‐4916.
Fuller,S.J. and Randle,P.J. 1984. Reversible phosphorylation of pyruvate dehydrogenase in rat skeletal-‐muscle mitochondria. Effects of starvation and diabetes. Biochem. J. 219:635-‐646.
Garland,P.B., Newsholme,E.A., and Randle,P.J. 1962. Effect of fatty acids, ketone bodies, diabetes and starvation on pyruvate metabolism in rat heart and diaphragm muscle. Nature 195:381-‐383.
Garland,P.B., Randle,P.J., and Newsholme,E.A. 1963. CITRATE AS AN INTERMEDIARY IN THE INHIBITION OF PHOSPHOFRUCTOKINASE IN RAT HEART MUSCLE BY FATTY ACIDS, KETONE BODIES, PYRUVATE, DIABETES, AND STARVATION. Nature 200:169-‐170.
Glintborg,D., Hojlund,K., Andersen,N.R., Hansen,B.F., Beck-‐Nielsen,H., and Wojtaszewski,J.F. 2008. Impaired insulin activation and dephosphorylation of glycogen synthase in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment. J. Clin. Endocrinol. Metab 93:3618-‐3626.
Glumer,C., Jorgensen,T., and Borch-‐Johnsen,K. 2003. Prevalences of diabetes and impaired glucose regulation in a Danish population: the Inter99 study. Diabetes Care 26:2335-‐2340.
Gnad,F., Gunawardena,J., and Mann,M. 2011. PHOSIDA 2011: the posttranslational modification database. Nucleic Acids Res. 39:D253-‐D260.
Goodyear,L.J., Hirshman,M.F., King,P.A., Horton,E.D., Thompson,C.M., and Horton,E.S. 1990. Skeletal muscle plasma membrane glucose transport and glucose transporters after exercise. J. Appl. Physiol (1985. ) 68:193-‐198.
Goodyear,L.J. and Kahn,B.B. 1998. Exercise, glucose transport, and insulin sensitivity. Annu. Rev. Med 49:235-‐261.
Green,H.J. 1991. How important is endogenous muscle glycogen to fatigue in prolonged exercise? Can. J. Physiol Pharmacol. 69:290-‐297.
Hansen,P.A., Nolte,L.A., Chen,M.M., and Holloszy,J.O. 1998. Increased GLUT-‐4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise. J. Appl. Physiol (1985. ) 85:1218-‐1222.
Henriksson,J. and Reitman,J.S. 1976. Quantitative measures of enzyme activities in type I and type II muscle fibres of man after training. Acta Physiol Scand. 97:392-‐397.
Henriksson,J. and Reitman,J.S. 1977. Time course of changes in human skeletal muscle succinate dehydrogenase and cytochrome oxidase activities and maximal oxygen uptake with physical activity and inactivity. Acta Physiol Scand. 99:91-‐97.
Himsworth,H.P. 2011. Diabetes mellitus: its differentiation into insulin-‐sensitive and insulin-‐insensitive types. Diabet. Med 28:1440-‐1444.
![Page 69: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/69.jpg)
69
Hiraga,A. and Cohen,P. 1986. Phosphorylation of the glycogen-‐binding subunit of protein phosphatase-‐1G by cyclic-‐AMP-‐dependent protein kinase promotes translocation of the phosphatase from glycogen to cytosol in rabbit skeletal muscle. Eur. J. Biochem. 161:763-‐769.
Hojlund,K. and Beck-‐Nielsen,H. 2006. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle: markers or mediators of insulin resistance in type 2 diabetes? Curr. Diabetes Rev. 2:375-‐395.
Hojlund,K., Birk,J.B., Klein,D.K., Levin,K., Rose,A.J., Hansen,B.F., Nielsen,J.N., Beck-‐Nielsen,H., and Wojtaszewski,J.F. 2009. Dysregulation of glycogen synthase. J. Clin. Endocrinol. Metab 94:4547-‐4556.
Hojlund,K., Glintborg,D., Andersen,N.R., Birk,J.B., Treebak,J.T., Frosig,C., Beck-‐Nielsen,H., and Wojtaszewski,J.F. 2008. Impaired insulin-‐stimulated phosphorylation of Akt and AS160 in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment. Diabetes 57:357-‐366.
Hojlund,K., Staehr,P., Hansen,B.F., Green,K.A., Hardie,D.G., Richter,E.A., Beck-‐Nielsen,H., and Wojtaszewski,J.F. 2003. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-‐terminal sites during physiological hyperinsulinemia in type 2 diabetes. Diabetes 52:1393-‐1402.
Hojlund,K., Wojtaszewski,J.F., Birk,J., Hansen,B.F., Vestergaard,H., and Beck-‐Nielsen,H. 2006. Partial rescue of in vivo insulin signalling in skeletal muscle by impaired insulin clearance in heterozygous carriers of a mutation in the insulin receptor gene. Diabetologia 49:1827-‐1837.
Holness,M.J., Kraus,A., Harris,R.A., and Sugden,M.C. 2000. Targeted upregulation of pyruvate dehydrogenase kinase (PDK)-‐4 in slow-‐twitch skeletal muscle underlies the stable modification of the regulatory characteristics of PDK induced by high-‐fat feeding. Diabetes 49:775-‐781.
Holness,M.J. and Sugden,M.C. 2003. Regulation of pyruvate dehydrogenase complex activity by reversible phosphorylation. Biochem. Soc. Trans. 31:1143-‐1151.
Hommes,M.J., Romijn,J.A., Endert,E., Eeftinck Schattenkerk,J.K., and Sauerwein,H.P. 1991. Basal fuel homoeostasis in symptomatic human immunodeficiency virus infection. Clin. Sci. (Lond) 80:359-‐365.
Hotamisligil,G.S. 1999. Mechanisms of TNF-‐alpha-‐induced insulin resistance. Exp. Clin. Endocrinol. Diabetes 107:119-‐125.
Houmard,J.A., Weidner,M.D., Dolan,P.L., Leggett-‐Frazier,N., Gavigan,K.E., Hickey,M.S., Tyndall,G.L., Zheng,D., Alshami,A., and Dohm,G.L. 1995. Skeletal muscle GLUT4 protein concentration and aging in humans. Diabetes 44:555-‐560.
Howlett,K.F., Mathews,A., Garnham,A., and Sakamoto,K. 2008. The effect of exercise and insulin on AS160 phosphorylation and 14-‐3-‐3 binding capacity in human skeletal muscle. Am. J. Physiol Endocrinol. Metab 294:E401-‐E407.
![Page 70: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/70.jpg)
70
Howlett,K.F., Sakamoto,K., Yu,H., Goodyear,L.J., and Hargreaves,M. 2006. Insulin-‐stimulated insulin receptor substrate-‐2-‐associated phosphatidylinositol 3-‐kinase activity is enhanced in human skeletal muscle after exercise. Metabolism 55:1046-‐1052.
Howlett,R.A., Parolin,M.L., Dyck,D.J., Hultman,E., Jones,N.L., Heigenhauser,G.J., and Spriet,L.L. 1998. Regulation of skeletal muscle glycogen phosphorylase and PDH at varying exercise power outputs. Am. J. Physiol 275:R418-‐R425.
Huang,B., Gudi,R., Wu,P., Harris,R.A., Hamilton,J., and Popov,K.M. 1998. Isoenzymes of pyruvate dehydrogenase phosphatase. DNA-‐derived amino acid sequences, expression, and regulation. J. Biol. Chem. 273:17680-‐17688.
Huang,B., Wu,P., Popov,K.M., and Harris,R.A. 2003. Starvation and diabetes reduce the amount of pyruvate dehydrogenase phosphatase in rat heart and kidney. Diabetes 52:1371-‐1376.
Huang,T.S. and Krebs,E.G. 1977. Amino acid sequence of a phosphorylation site in skeletal muscle glycogen synthetase. Biochem. Biophys. Res. Commun. 75:643-‐650.
Iversen,N., Krustrup,P., Rasmussen,H.N., Rasmussen,U.F., Saltin,B., and Pilegaard,H. 2011. Mitochondrial biogenesis and angiogenesis in skeletal muscle of the elderly. Exp. Gerontol. 46:670-‐678.
Jansson,E. and Kaijser,L. 1982. Effect of diet on the utilization of blood-‐borne and intramuscular substrates during exercise in man. Acta Physiol Scand. 115:19-‐30.
Jansson,E., Sylven,C., Arvidsson,I., and Eriksson,E. 1988. Increase in myoglobin content and decrease in oxidative enzyme activities by leg muscle immobilization in man. Acta Physiol Scand. 132:515-‐517.
Jensen,J., Tantiwong,P., Stuenaes,J.T., Molina-‐Carrion,M., DeFronzo,R.A., Sakamoto,K., and Musi,N. 2012. Effect of acute exercise on glycogen synthase in muscle from obese and diabetic subjects. Am. J. Physiol Endocrinol. Metab 303:E82-‐E89.
Jing,E., O'Neill,B.T., Rardin,M.J., Kleinridders,A., Ilkeyeva,O.R., Ussar,S., Bain,J.R., Lee,K.Y., Verdin,E.M., Newgard,C.B., Gibson,B.W., and Kahn,C.R. 2013. Sirt3 regulates metabolic flexibility of skeletal muscle through reversible enzymatic deacetylation. Diabetes 62:3404-‐3417.
Jorgensen,S.B., Nielsen,J.N., Birk,J.B., Olsen,G.S., Viollet,B., Andreelli,F., Schjerling,P., Vaulont,S., Hardie,D.G., Hansen,B.F., Richter,E.A., and Wojtaszewski,J.F. 2004. The alpha2-‐5'AMP-‐activated protein kinase is a site 2 glycogen synthase kinase in skeletal muscle and is responsive to glucose loading. Diabetes 53:3074-‐3081.
Kahn,B.B., Rosen,A.S., Bak,J.F., Andersen,P.H., Damsbo,P., Lund,S., and Pedersen,O. 1992. Expression of GLUT1 and GLUT4 glucose transporters in skeletal muscle of humans with insulin-‐dependent diabetes mellitus: regulatory effects of metabolic factors. J. Clin. Endocrinol. Metab 74:1101-‐1109.
![Page 71: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/71.jpg)
71
Kahn,S.E., Hull,R.L., and Utzschneider,K.M. 2006. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 444:840-‐846.
Kampmann,U., Christensen,B., Nielsen,T.S., Pedersen,S.B., Orskov,L., Lund,S., Moller,N., and Jessen,N. 2011. GLUT4 and UBC9 protein expression is reduced in muscle from type 2 diabetic patients with severe insulin resistance. PLoS. One. 6:e27854.
Kanzaki,T. 1969. [Substrate specificity and kinetic properties of the pig heart pyruvate and 2-‐oxo-‐glutarate dehydrogenase complexes]. Seikagaku 41:657-‐662.
Karlsson,H.K., Zierath,J.R., Kane,S., Krook,A., Lienhard,G.E., and Wallberg-‐Henriksson,H. 2005. Insulin-‐stimulated phosphorylation of the Akt substrate AS160 is impaired in skeletal muscle of type 2 diabetic subjects. Diabetes 54:1692-‐1697.
Katz,A. and Raz,I. 1995. Rapid activation of glycogen synthase and protein phosphatase in human skeletal muscle after isometric contraction requires an intact circulation. Pflugers Arch. 431:259-‐265.
Keller,C., Steensberg,A., Pilegaard,H., Osada,T., Saltin,B., Pedersen,B.K., and Neufer,P.D. 2001. Transcriptional activation of the IL-‐6 gene in human contracting skeletal muscle: influence of muscle glycogen content. FASEB J. 15:2748-‐2750.
Kelley,D.E., Goodpaster,B., Wing,R.R., and Simoneau,J.A. 1999. Skeletal muscle fatty acid metabolism in association with insulin resistance, obesity, and weight loss. Am. J. Physiol 277:E1130-‐E1141.
Kelley,D.E. and Mandarino,L.J. 2000. Fuel selection in human skeletal muscle in insulin resistance: a reexamination. Diabetes 49:677-‐683.
Kelley,D.E., Mokan,M., Simoneau,J.A., and Mandarino,L.J. 1993. Interaction between glucose and free fatty acid metabolism in human skeletal muscle. J. Clin. Invest 92:91-‐98.
Kelly,M., Gauthier,M.S., Saha,A.K., and Ruderman,N.B. 2009. Activation of AMP-‐activated protein kinase by interleukin-‐6 in rat skeletal muscle: association with changes in cAMP, energy state, and endogenous fuel mobilization. Diabetes 58:1953-‐1960.
Kern,M., Dolan,P.L., Mazzeo,R.S., Wells,J.A., and Dohm,G.L. 1992. Effect of aging and exercise on GLUT-‐4 glucose transporters in muscle. Am. J. Physiol 263:E362-‐E367.
Kida,Y., Katz,A., Lee,A.D., and Mott,D.M. 1989. Contraction-‐mediated inactivation of glycogen synthase is accompanied by inactivation of glycogen synthase phosphatase in human skeletal muscle. Biochem. J. 259:901-‐904.
Kiens,B. 2006. Skeletal muscle lipid metabolism in exercise and insulin resistance. Physiol Rev. 86:205-‐243.
Kiens,B., Essen-‐Gustavsson,B., Christensen,N.J., and Saltin,B. 1993. Skeletal muscle substrate utilization during submaximal exercise in man: effect of endurance training. J. Physiol 469:459-‐478.
![Page 72: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/72.jpg)
72
Kiens,B., Lithell,H., Mikines,K.J., and Richter,E.A. 1989. Effects of insulin and exercise on muscle lipoprotein lipase activity in man and its relation to insulin action. J. Clin. Invest 84:1124-‐1129.
Kiilerich,K., Adser,H., Jakobsen,A.H., Pedersen,P.A., Hardie,D.G., Wojtaszewski,J.F., and Pilegaard,H. 2010a. PGC-‐1alpha increases PDH content but does not change acute PDH regulation in mouse skeletal muscle. Am. J. Physiol Regul. Integr. Comp Physiol 299:R1350-‐R1359.
Kiilerich,K., Birk,J.B., Damsgaard,R., Wojtaszewski,J.F., and Pilegaard,H. 2008. Regulation of PDH in human arm and leg muscles at rest and during intense exercise. Am. J. Physiol Endocrinol. Metab 294:E36-‐E42.
Kiilerich,K., Gudmundsson,M., Birk,J.B., Lundby,C., Taudorf,S., Plomgaard,P., Saltin,B., Pedersen,P.A., Wojtaszewski,J.F., and Pilegaard,H. 2010b. Low muscle glycogen and elevated plasma free fatty acid modify but do not prevent exercise-‐induced PDH activation in human skeletal muscle. Diabetes 59:26-‐32.
Kiilerich,K., Ringholm,S., Bienso,R.S., Fisher,J.P., Iversen,N., van,H.G., Wojtaszewski,J.F., Saltin,B., Lundby,C., Calbet,J.A., and Pilegaard,H. 2011. Exercise-‐induced pyruvate dehydrogenase activation is not affected by 7 days of bed rest. J. Appl. Physiol (1985. ) 111:751-‐757.
Klausen,K., Andersen,L.B., and Pelle,I. 1981. Adaptive changes in work capacity, skeletal muscle capillarization and enzyme levels during training and detraining. Acta Physiol Scand. 113:9-‐16.
Klein,D.K., Pilegaard,H., Treebak,J.T., Jensen,T.E., Viollet,B., Schjerling,P., and Wojtaszewski,J.F. 2007. Lack of AMPKalpha2 enhances pyruvate dehydrogenase activity during exercise. Am. J. Physiol Endocrinol. Metab 293:E1242-‐E1249.
Korotchkina,L.G., Khailova,L.S., and Severin,S.E. 1995. The effect of phosphorylation on pyruvate dehydrogenase. FEBS Lett. 364:185-‐188.
Korotchkina,L.G. and Patel,M.S. 2001. Probing the mechanism of inactivation of human pyruvate dehydrogenase by phosphorylation of three sites. J. Biol. Chem. 276:5731-‐5738.
Kramer,H.F., Witczak,C.A., Fujii,N., Jessen,N., Taylor,E.B., Arnolds,D.E., Sakamoto,K., Hirshman,M.F., and Goodyear,L.J. 2006. Distinct signals regulate AS160 phosphorylation in response to insulin, AICAR, and contraction in mouse skeletal muscle. Diabetes 55:2067-‐2076.
Kraniou,G.N., Cameron-‐Smith,D., and Hargreaves,M. 2006. Acute exercise and GLUT4 expression in human skeletal muscle: influence of exercise intensity. J. Appl. Physiol (1985. ) 101:934-‐937.
Krogh,A. 1913. A bicycle ergometer and respiration apparatus for the experimental study of muscular work. Skandinavisches Archiv fur Physiologie 30:375-‐394.
![Page 73: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/73.jpg)
73
Kulkarni,S.S., Salehzadeh,F., Fritz,T., Zierath,J.R., Krook,A., and Osler,M.E. 2012. Mitochondrial regulators of fatty acid metabolism reflect metabolic dysfunction in type 2 diabetes mellitus. Metabolism 61:175-‐185.
Lai,K.M., Gonzalez,M., Poueymirou,W.T., Kline,W.O., Na,E., Zlotchenko,E., Stitt,T.N., Economides,A.N., Yancopoulos,G.D., and Glass,D.J. 2004. Conditional activation of akt in adult skeletal muscle induces rapid hypertrophy. Mol. Cell Biol. 24:9295-‐9304.
LeBlanc,P.J., Howarth,K.R., Gibala,M.J., and Heigenhauser,G.J. 2004a. Effects of 7 wk of endurance training on human skeletal muscle metabolism during submaximal exercise. J. Appl. Physiol (1985. ) 97:2148-‐2153.
LeBlanc,P.J., Peters,S.J., Tunstall,R.J., Cameron-‐Smith,D., and Heigenhauser,G.J. 2004b. Effects of aerobic training on pyruvate dehydrogenase and pyruvate dehydrogenase kinase in human skeletal muscle. J. Physiol 557:559-‐570.
Leger,B., Derave,W., De,B.K., Hespel,P., and Russell,A.P. 2008. Human sarcopenia reveals an increase in SOCS-‐3 and myostatin and a reduced efficiency of Akt phosphorylation. Rejuvenation. Res. 11:163-‐175B.
Leick,L., Wojtaszewski,J.F., Johansen,S.T., Kiilerich,K., Comes,G., Hellsten,Y., Hidalgo,J., and Pilegaard,H. 2008. PGC-‐1alpha is not mandatory for exercise-‐ and training-‐induced adaptive gene responses in mouse skeletal muscle. Am. J. Physiol Endocrinol. Metab 294:E463-‐E474.
Leloir,L.F. and CARDINI,C.E. 1955. The biosynthesis of sucrose phosphate. J. Biol. Chem. 214:157-‐165.
Leloir,L.F. and CARDINI,C.E. 1957. Biosynthesis of Glycogen from Uridine Diphosphate Glucose. Journal of the American Chemical Society 79:6340-‐6341.
Linn,T.C., Pettit,F.H., and Reed,L.J. 1969. Alpha-‐keto acid dehydrogenase complexes. X. Regulation of the activity of the pyruvate dehydrogenase complex from beef kidney mitochondria by phosphorylation and dephosphorylation. Proc. Natl. Acad. Sci. U. S. A 62:234-‐241.
Lipman,R.L., Raskin,P., Love,T., Triebwasser,J., Lecocq,F.R., and Schnure,J.J. 1972. Glucose intolerance during decreased physical activity in man. Diabetes 21:101-‐107.
Lipman,R.L., Schnure,J.J., Bradley,E.M., and Lecocq,F.R. 1970. Impairment of peripheral glucose utilization in normal subjects by prolonged bed rest. J. Lab Clin. Med. 76:221-‐230.
Love,L.K., LeBlanc,P.J., Inglis,J.G., Bradley,N.S., Choptiany,J., Heigenhauser,G.J., and Peters,S.J. 2011. The relationship between human skeletal muscle pyruvate dehydrogenase phosphatase activity and muscle aerobic capacity. J. Appl. Physiol (1985. ) 111:427-‐434.
Lowry,O.H. and Passonneau,J.V. 1972. A flexible system of enzymatic analysis. Academic Press.
Lutwak L and Whedon GD 1959. The effect of physical conditioning on glucose tolerance. Clinical Research 7:142-‐144.
![Page 74: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/74.jpg)
74
Mandarino,L.J., Consoli,A., Jain,A., and Kelley,D.E. 1996. Interaction of carbohydrate and fat fuels in human skeletal muscle: impact of obesity and NIDDM. Am. J. Physiol 270:E463-‐E470.
Mandarino,L.J., Consoli,A., Kelley,D.E., Reilly,J.J., and Nurjhan,N. 1990. Fasting hyperglycemia normalizes oxidative and nonoxidative pathways of insulin-‐stimulated glucose metabolism in noninsulin-‐dependent diabetes mellitus. J. Clin. Endocrinol. Metab 71:1544-‐1551.
Mandarino,L.J., Wright,K.S., Verity,L.S., Nichols,J., Bell,J.M., Kolterman,O.G., and Beck-‐Nielsen,H. 1987. Effects of insulin infusion on human skeletal muscle pyruvate dehydrogenase, phosphofructokinase, and glycogen synthase. Evidence for their role in oxidative and nonoxidative glucose metabolism. J. Clin. Invest 80:655-‐663.
McCoy,M., Proietto,J., and Hargreves,M. 1994. Effect of detraining on GLUT-‐4 protein in human skeletal muscle. J. Appl. Physiol (1985. ) 77:1532-‐1536.
Meex,R.C., Schrauwen-‐Hinderling,V.B., Moonen-‐Kornips,E., Schaart,G., Mensink,M., Phielix,E., van de Weijer,T., Sels,J.P., Schrauwen,P., and Hesselink,M.K. 2010. Restoration of muscle mitochondrial function and metabolic flexibility in type 2 diabetes by exercise training is paralleled by increased myocellular fat storage and improved insulin sensitivity. Diabetes 59:572-‐579.
Meng,Q., Makinen,V.P., Luk,H., and Yang,X. 2013. Systems Biology Approaches and Applications in Obesity, Diabetes, and Cardiovascular Diseases. Curr. Cardiovasc. Risk Rep. 7:73-‐83.
Meyer,M.M., Levin,K., Grimmsmann,T., Beck-‐Nielsen,H., and Klein,H.H. 2002. Insulin signalling in skeletal muscle of subjects with or without Type II-‐diabetes and first degree relatives of patients with the disease. Diabetologia 45:813-‐822.
Mikines,K.J., Dela,F., Tronier,B., and Galbo,H. 1989. Effect of 7 days of bed rest on dose-‐response relation between plasma glucose and insulin secretion. Am. J. Physiol 257:E43-‐E48.
Mikines,K.J., Richter,E.A., Dela,F., and Galbo,H. 1991. Seven days of bed rest decrease insulin action on glucose uptake in leg and whole body. J. Appl. Physiol (1985. ) 70:1245-‐1254.
Mikines,K.J., Sonne,B., Farrell,P.A., Tronier,B., and Galbo,H. 1988. Effect of physical exercise on sensitivity and responsiveness to insulin in humans. Am. J. Physiol 254:E248-‐E259.
Morine,M.J., McMonagle,J., Toomey,S., Reynolds,C.M., Moloney,A.P., Gormley,I.C., Gaora,P.O., and Roche,H.M. 2010. Bi-‐directional gene set enrichment and canonical correlation analysis identify key diet-‐sensitive pathways and biomarkers of metabolic syndrome. BMC. Bioinformatics. 11:499.
Mortensen,B., Hingst,J.R., Frederiksen,N., Hansen,R.W., Christiansen,C.S., Iversen,N., Friedrichsen,M., Birk,J.B., Pilegaard,H., Hellsten,Y., Vaag,A., and Wojtaszewski,J.F. 2013. Effect of birth weight and 12 weeks of exercise training on exercise-‐induced AMPK signaling in human skeletal muscle. Am. J. Physiol Endocrinol. Metab 304:E1379-‐E1390.
![Page 75: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/75.jpg)
75
Mourtzakis,M., Saltin,B., Graham,T., and Pilegaard,H. 2006. Carbohydrate metabolism during prolonged exercise and recovery: interactions between pyruvate dehydrogenase, fatty acids, and amino acids. J. Appl. Physiol (1985. ) 100:1822-‐1830.
Mueckler,M. 1990. Family of Glucose-‐Transporter Genes -‐ Implications for Glucose-‐Homeostasis and Diabetes. Diabetes 39:6-‐11.
Nedachi,T., Fujita,H., and Kanzaki,M. 2008. Contractile C2C12 myotube model for studying exercise-‐inducible responses in skeletal muscle. Am. J. Physiol Endocrinol. Metab 295:E1191-‐E1204.
Nielsen,J.N., Derave,W., Kristiansen,S., Ralston,E., Ploug,T., and Richter,E.A. 2001. Glycogen synthase localization and activity in rat skeletal muscle is strongly dependent on glycogen content. J. Physiol 531:757-‐769.
Nielsen,J.N. and Wojtaszewski,J.F. 2004. Regulation of glycogen synthase activity and phosphorylation by exercise. Proc. Nutr. Soc. 63:233-‐237.
NOVAK,M., MELICHAR,V., HAHN,P., and KOLDOVSKY,O. 1965. RELEASE OF FREE FATTY ACIDS FROM ADIPOSE TISSUE OBTAINED FROM NEWBORN INFANTS. J. Lipid Res. 6:91-‐95.
O'Doherty,R.M., Bracy,D.P., Granner,D.K., and Wasserman,D.H. 1996. Transcription of the rat skeletal muscle hexokinase II gene is increased by acute exercise. J. Appl. Physiol (1985. ) 81:789-‐793.
O'Gorman,D.J., Karlsson,H.K., McQuaid,S., Yousif,O., Rahman,Y., Gasparro,D., Glund,S., Chibalin,A.V., Zierath,J.R., and Nolan,J.J. 2006. Exercise training increases insulin-‐stimulated glucose disposal and GLUT4 (SLC2A4) protein content in patients with type 2 diabetes. Diabetologia 49:2983-‐2992.
Passonneau,J.V. and Lauderdale,V.R. 1974. A comparison of three methods of glycogen measurement in tissues. Anal. Biochem. 60:405-‐412.
Patel,M.S. and Korotchkina,L.G. 2001. Regulation of mammalian pyruvate dehydrogenase complex by phosphorylation: complexity of multiple phosphorylation sites and kinases. Exp. Mol. Med 33:191-‐197.
Patel,M.S. and Korotchkina,L.G. 2006. Regulation of the pyruvate dehydrogenase complex. Biochem. Soc. Trans. 34:217-‐222.
Pedersen,B.K. and Saltin,B. 2006. Evidence for prescribing exercise as therapy in chronic disease. Scand. J. Med. Sci. Sports 16 Suppl 1:3-‐63.
Pedersen,O., Bak,J.F., Andersen,P.H., Lund,S., Moller,D.E., Flier,J.S., and Kahn,B.B. 1990. Evidence against altered expression of GLUT1 or GLUT4 in skeletal muscle of patients with obesity or NIDDM. Diabetes 39:865-‐870.
![Page 76: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/76.jpg)
76
Pehleman,T.L., Peters,S.J., Heigenhauser,G.J., and Spriet,L.L. 2005. Enzymatic regulation of glucose disposal in human skeletal muscle after a high-‐fat, low-‐carbohydrate diet. J. Appl. Physiol (1985. ) 98:100-‐107.
Perry,C.G., Heigenhauser,G.J., Bonen,A., and Spriet,L.L. 2008. High-‐intensity aerobic interval training increases fat and carbohydrate metabolic capacities in human skeletal muscle. Appl. Physiol Nutr. Metab 33:1112-‐1123.
Perseghin,G., Price,T.B., Petersen,K.F., Roden,M., Cline,G.W., Gerow,K., Rothman,D.L., and Shulman,G.I. 1996. Increased glucose transport-‐phosphorylation and muscle glycogen synthesis after exercise training in insulin-‐resistant subjects. N. Engl. J. Med 335:1357-‐1362.
Peters,S.J., Harris,R.A., Heigenhauser,G.J., and Spriet,L.L. 2001a. Muscle fiber type comparison of PDH kinase activity and isoform expression in fed and fasted rats. Am. J. Physiol Regul. Integr. Comp Physiol 280:R661-‐R668.
Peters,S.J., Harris,R.A., Wu,P., Pehleman,T.L., Heigenhauser,G.J., and Spriet,L.L. 2001b. Human skeletal muscle PDH kinase activity and isoform expression during a 3-‐day high-‐fat/low-‐carbohydrate diet. Am. J. Physiol Endocrinol. Metab 281:E1151-‐E1158.
Peters,S.J., St Amand,T.A., Howlett,R.A., Heigenhauser,G.J., and Spriet,L.L. 1998. Human skeletal muscle pyruvate dehydrogenase kinase activity increases after a low-‐carbohydrate diet. Am. J. Physiol 275:E980-‐E986.
Pilegaard,H., Birk,J.B., Sacchetti,M., Mourtzakis,M., Hardie,D.G., Stewart,G., Neufer,P.D., Saltin,B., van,H.G., and Wojtaszewski,J.F. 2006. PDH-‐E1alpha dephosphorylation and activation in human skeletal muscle during exercise: effect of intralipid infusion. Diabetes 55:3020-‐3027.
Pilegaard,H., Keller,C., Steensberg,A., Helge,J.W., Pedersen,B.K., Saltin,B., and Neufer,P.D. 2002. Influence of pre-‐exercise muscle glycogen content on exercise-‐induced transcriptional regulation of metabolic genes. J. Physiol 541:261-‐271.
Pilegaard,H., Ordway,G.A., Saltin,B., and Neufer,P.D. 2000. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am. J. Physiol Endocrinol. Metab 279:E806-‐E814.
Pilegaard,H., Saltin,B., and Neufer,P.D. 2003a. Effect of short-‐term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes 52:657-‐662.
Pilegaard,H., Saltin,B., and Neufer,P.D. 2003b. Exercise induces transient transcriptional activation of the PGC-‐1alpha gene in human skeletal muscle. J. Physiol 546:851-‐858.
Plomgaard,P., Bouzakri,K., Krogh-‐Madsen,R., Mittendorfer,B., Zierath,J.R., and Pedersen,B.K. 2005. Tumor necrosis factor-‐alpha induces skeletal muscle insulin resistance in healthy human subjects via inhibition of Akt substrate 160 phosphorylation. Diabetes 54:2939-‐2945.
![Page 77: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/77.jpg)
77
Poulsen,P., Wojtaszewski,J.F., Petersen,I., Christensen,K., Richter,E.A., Beck-‐Nielsen,H., and Vaag,A. 2005. Impact of genetic versus environmental factors on the control of muscle glycogen synthase activation in twins. Diabetes 54:1289-‐1296.
Prats,C., Cadefau,J.A., Cusso,R., Qvortrup,K., Nielsen,J.N., Wojtaszewski,J.F., Hardie,D.G., Stewart,G., Hansen,B.F., and Ploug,T. 2005. Phosphorylation-‐dependent translocation of glycogen synthase to a novel structure during glycogen resynthesis. J. Biol. Chem. 280:23165-‐23172.
Prats,C., Helge,J.W., Nordby,P., Qvortrup,K., Ploug,T., Dela,F., and Wojtaszewski,J.F. 2009. Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization. J. Biol. Chem. 284:15692-‐15700.
Priestman,D.A., Orfali,K.A., and Sugden,M.C. 1996. Pyruvate inhibition of pyruvate dehydrogenase kinase. Effects of progressive starvation and hyperthyroidism in vivo, and of dibutyryl cyclic AMP and fatty acids in cultured cardiac myocytes. FEBS Lett. 393:174-‐178.
Prior,S.J., Ryan,A.S., Stevenson,T.G., and Goldberg,A.P. 2013. Metabolic inflexibility during submaximal aerobic exercise is associated with glucose intolerance in obese older adults. Obesity. (Silver. Spring).
Putman,C.T., Spriet,L.L., Hultman,E., Lindinger,M.I., Lands,L.C., McKelvie,R.S., Cederblad,G., Jones,N.L., and Heigenhauser,G.J. 1993. Pyruvate dehydrogenase activity and acetyl group accumulation during exercise after different diets. Am. J. Physiol 265:E752-‐E760.
Randle,P.J. 1986. Fuel selection in animals. Biochem. Soc. Trans. 14:799-‐806.
Randle,P.J., Garland,P.B., Hales,C.N., and Newsholme,E.A. 1963. The glucose fatty-‐acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet 1:785-‐789.
Randle,P.J., Kerbey,A.L., and Espinal,J. 1988. Mechanisms decreasing glucose oxidation in diabetes and starvation: role of lipid fuels and hormones. Diabetes Metab Rev. 4:623-‐638.
Randle,P.J., Sugden,P.H., Kerbey,A.L., Radcliffe,P.M., and Hutson,N.J. 1978. Regulation of pyruvate oxidation and the conservation of glucose. Biochem. Soc. Symp.47-‐67.
Ren,J.M., Semenkovich,C.F., Gulve,E.A., Gao,J., and Holloszy,J.O. 1994. Exercise induces rapid increases in GLUT4 expression, glucose transport capacity, and insulin-‐stimulated glycogen storage in muscle. J. Biol. Chem. 269:14396-‐14401.
Richter,E.A., Kiens,B., Mizuno,M., and Strange,S. 1989. Insulin action in human thighs after one-‐legged immobilization. J. Appl. Physiol (1985. ) 67:19-‐23.
Ringholm,S., Bienso,R.S., Kiilerich,K., Guadalupe-‐Grau,A., Aachmann-‐Andersen,N.J., Saltin,B., Plomgaard,P., Lundby,C., Wojtaszewski,J.F., Calbet,J.A., and Pilegaard,H. 2011. Bed rest reduces metabolic protein content and abolishes exercise-‐induced mRNA responses in human skeletal muscle. Am. J. Physiol Endocrinol. Metab 301:E649-‐E658.
![Page 78: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/78.jpg)
78
Roach,P.J. 1990. Control of glycogen synthase by hierarchal protein phosphorylation. FASEB J. 4:2961-‐2968.
Roach,P.J. 2002. Glycogen and its metabolism. Curr. Mol. Med 2:101-‐120.
Roach,P.J., Depaoli-‐Roach,A.A., Hurley,T.D., and Tagliabracci,V.S. 2012. Glycogen and its metabolism: some new developments and old themes. Biochem. J. 441:763-‐787.
Roach,P.J. and Larner,J. 1976. Rabbit skeletal muscle glycogen synthase. II. Enzyme phosphorylation state and effector concentrations as interacting control parameters. J. Biol. Chem. 251:1920-‐1925.
Roach,P.J., Rosell-‐Perez,M., and Larner,J. 1977. Muscle glycogen synthase in vivo state: Effects of insulin administration on the chemical and kinetic properties of the purified enzyme. FEBS Lett. 80:95-‐98.
Roach,P.J., Takeda,Y., and Larner,J. 1976. Rabbit skeletal muscle glycogen synthase. I. Relationship between phosphorylation state and kinetic properties. J. Biol. Chem. 251:1913-‐1919.
Roach,R.J. and Larner,J. 1977. Covalent phosphorylation in the regulation glycogen synthase activity. Mol. Cell Biochem. 15:179-‐200.
Roche,T.E., Baker,J.C., Yan,X., Hiromasa,Y., Gong,X., Peng,T., Dong,J., Turkan,A., and Kasten,S.A. 2001. Distinct regulatory properties of pyruvate dehydrogenase kinase and phosphatase isoforms. Prog. Nucleic Acid Res. Mol. Biol. 70:33-‐75.
Roche,T.E., Rahmatullah,M., Powers-‐Greenwood,S.L., Radke,G.A., Gopalakrishnan,S., and Chang,C.L. 1989. The lipoyl-‐containing components of the mammalian pyruvate dehydrogenase complex: structural comparison and subdomain roles. Ann. N. Y. Acad. Sci. 573:66-‐75.
Rothman,D.L., Magnusson,I., Cline,G., Gerard,D., Kahn,C.R., Shulman,R.G., and Shulman,G.I. 1995. Decreased muscle glucose transport/phosphorylation is an early defect in the pathogenesis of non-‐insulin-‐dependent diabetes mellitus. Proc. Natl. Acad. Sci. U. S. A 92:983-‐987.
Ruderman,N.B., Keller,C., Richard,A.M., Saha,A.K., Luo,Z., Xiang,X., Giralt,M., Ritov,V.B., Menshikova,E.V., Kelley,D.E., Hidalgo,J., Pedersen,B.K., and Kelly,M. 2006. Interleukin-‐6 regulation of AMP-‐activated protein kinase. Potential role in the systemic response to exercise and prevention of the metabolic syndrome. Diabetes 55 Suppl 2:S48-‐S54.
Sakamoto,K., Arnolds,D.E., Ekberg,I., Thorell,A., and Goodyear,L.J. 2004. Exercise regulates Akt and glycogen synthase kinase-‐3 activities in human skeletal muscle. Biochem. Biophys. Res. Commun. 319:419-‐425.
Sale,G.J. and Randle,P.J. 1980. Incorporation of [32P]phosphate into the pyruvate dehydrogenase complex in rat heart mitochondria. Biochem. J. 188:409-‐421.
![Page 79: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/79.jpg)
79
Saltin,B., Blomqvist,G., Mitchell,J.H., Johnson,R.L., Jr., Wildenthal,K., and Chapman,C.B. 1968. Response to exercise after bed rest and after training. Circulation 38:VII1-‐78.
Schantz,P.G. and Henriksson,J. 1987. Enzyme levels of the NADH shuttle systems: measurements in isolated muscle fibres from humans of differing physical activity. Acta Physiol Scand. 129:505-‐515.
Schinner,S., Scherbaum,W.A., Bornstein,S.R., and Barthel,A. 2005. Molecular mechanisms of insulin resistance. Diabet. Med 22:674-‐682.
Sjogaard,G., Zebis,M.K., Kiilerich,K., Saltin,B., and Pilegaard,H. 2013. Exercise training and work task induced metabolic and stress-‐related mRNA and protein responses in myalgic muscles. Biomed. Res. Int. 2013:984523.
Skurat,A.V., Dietrich,A.D., and Roach,P.J. 2000. Glycogen synthase sensitivity to insulin and glucose-‐6-‐phosphate is mediated by both NH2-‐ and COOH-‐terminal phosphorylation sites. Diabetes 49:1096-‐1100.
Skurat,A.V. and Roach,P.J. 1995. Phosphorylation of sites 3a and 3b (Ser640 and Ser644) in the control of rabbit muscle glycogen synthase. J. Biol. Chem. 270:12491-‐12497.
Skurat,A.V. and Roach,P.J. 1996. Multiple mechanisms for the phosphorylation of C-‐terminal regulatory sites in rabbit muscle glycogen synthase expressed in COS cells. Biochem. J. 313 ( Pt 1):45-‐50.
Skurat,A.V., Wang,Y., and Roach,P.J. 1994. Rabbit skeletal muscle glycogen synthase expressed in COS cells. Identification of regulatory phosphorylation sites. J. Biol. Chem. 269:25534-‐25542.
Smith,U., Axelsen,M., Carvalho,E., Eliasson,B., Jansson,P.A., and Wesslau,C. 1999. Insulin signaling and action in fat cells: associations with insulin resistance and type 2 diabetes. Ann. N. Y. Acad. Sci. 892:119-‐126.
Smorawinski,J., Kaciuba-‐Uscilko,H., Nazar,K., Kubala,P., Kaminska,E., Ziemba,A.W., Adrian,J., and Greenleaf,J.E. 2000. Effects of three-‐day bed rest on metabolic, hormonal and circulatory responses to an oral glucose load in endurance or strength trained athletes and untrained subjects. J. Physiol Pharmacol. 51:279-‐289.
St Amand,T.A., Spriet,L.L., Jones,N.L., and Heigenhauser,G.J. 2000. Pyruvate overrides inhibition of PDH during exercise after a low-‐carbohydrate diet. Am. J. Physiol Endocrinol. Metab 279:E275-‐E283.
Steensberg,A., Keller,C., Starkie,R.L., Osada,T., Febbraio,M.A., and Pedersen,B.K. 2002. IL-‐6 and TNF-‐alpha expression in, and release from, contracting human skeletal muscle. Am. J. Physiol Endocrinol. Metab 283:E1272-‐E1278.
Stellingwerff,T., Watt,M.J., Heigenhauser,G.J., and Spriet,L.L. 2003. Effects of reduced free fatty acid availability on skeletal muscle PDH activation during aerobic exercise. Pyruvate dehydrogenase. Am. J. Physiol Endocrinol. Metab 284:E589-‐E596.
![Page 80: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/80.jpg)
80
Stephens,J.M., Lee,J., and Pilch,P.F. 1997. Tumor necrosis factor-‐alpha-‐induced insulin resistance in 3T3-‐L1 adipocytes is accompanied by a loss of insulin receptor substrate-‐1 and GLUT4 expression without a loss of insulin receptor-‐mediated signal transduction. J. Biol. Chem. 272:971-‐976.
Storlien,L., Oakes,N.D., and Kelley,D.E. 2004. Metabolic flexibility. Proc. Nutr. Soc. 63:363-‐368.
Stumvoll,M., Goldstein,B.J., and van Haeften,T.W. 2005. Type 2 diabetes: principles of pathogenesis and therapy. Lancet 365:1333-‐1346.
Sugden,M.C. and Holness,M.J. 1994. Interactive regulation of the pyruvate dehydrogenase complex and the carnitine palmitoyltransferase system. FASEB J. 8:54-‐61.
Sugden,M.C. and Holness,M.J. 2003. Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDKs. Am. J. Physiol Endocrinol. Metab 284:E855-‐E862.
Sugden,P.H., Hutson,N.J., Kerbey,A.L., and Randle,P.J. 1978. Phosphorylation of additional sites on pyruvate dehydrogenase inhibits its re-‐activation by pyruvate dehydrogenase phosphate phosphatase. Biochem. J. 169:433-‐435.
Summers,S.A. and Birnbaum,M.J. 1997. A role for the serine/threonine kinase, Akt, in insulin-‐stimulated glucose uptake. Biochem. Soc. Trans. 25:981-‐988.
Summers,S.A., Yin,V.P., Whiteman,E.L., Garza,L.A., Cho,H., Tuttle,R.L., and Birnbaum,M.J. 1999. Signaling pathways mediating insulin-‐stimulated glucose transport. Ann. N. Y. Acad. Sci. 892:169-‐186.
Thomas,J.A., Schlender,K.K., and Larner,J. 1968. A rapid filter paper assay for UDPglucose-‐glycogen glucosyltransferase, including an improved biosynthesis of UDP-‐14C-‐glucose. Anal. Biochem. 25:486-‐499.
Towbin,H., Staehelin,T., and Gordon,J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A 76:4350-‐4354.
Treebak,J.T., Frosig,C., Pehmoller,C., Chen,S., Maarbjerg,S.J., Brandt,N., Mackintosh,C., Zierath,J.R., Hardie,D.G., Kiens,B., Richter,E.A., Pilegaard,H., and Wojtaszewski,J.F. 2009. Potential role of TBC1D4 in enhanced post-‐exercise insulin action in human skeletal muscle. Diabetologia 52:891-‐900.
Treebak,J.T., Pehmoller,C., Kristensen,J.M., Kjobsted,R., Birk,J.B., Schjerling,P., Richter,E.A., Goodyear,L.J., and Wojtaszewski,J.F. 2014. Acute exercise and physiological insulin induce distinct phosphorylation signatures on TBC1D1 and TBC1D4 proteins in human skeletal muscle. J. Physiol 592:351-‐375.
Treebak,J.T., Taylor,E.B., Witczak,C.A., An,D., Toyoda,T., Koh,H.J., Xie,J., Feener,E.P., Wojtaszewski,J.F., Hirshman,M.F., and Goodyear,L.J. 2010. Identification of a novel
![Page 81: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/81.jpg)
81
phosphorylation site on TBC1D4 regulated by AMP-‐activated protein kinase in skeletal muscle. Am. J. Physiol Cell Physiol 298:C377-‐C385.
Tsatsoulis,A., Mantzaris,M.D., Bellou,S., and Andrikoula,M. 2013. Insulin resistance: an adaptive mechanism becomes maladaptive in the current environment -‐ an evolutionary perspective. Metabolism 62:622-‐633.
van Loon,L.J., Greenhaff,P.L., Constantin-‐Teodosiu,D., Saris,W.H., and Wagenmakers,A.J. 2001. The effects of increasing exercise intensity on muscle fuel utilisation in humans. J. Physiol 536:295-‐304.
van,H.G., Steensberg,A., Sacchetti,M., Fischer,C., Keller,C., Schjerling,P., Hiscock,N., Moller,K., Saltin,B., Febbraio,M.A., and Pedersen,B.K. 2003. Interleukin-‐6 stimulates lipolysis and fat oxidation in humans. J. Clin. Endocrinol. Metab 88:3005-‐3010.
Vary,T.C. and Hazen,S. 1999. Sepsis alters pyruvate dehydrogenase kinase activity in skeletal muscle. Mol. Cell Biochem. 198:113-‐118.
Vary,T.C., Hazen,S.A., Maish,G., and Cooney,R.N. 1998. TNF binding protein prevents hyperlactatemia and inactivation of PDH complex in skeletal muscle during sepsis. J. Surg. Res. 80:44-‐51.
Vary,T.C. and Martin,L.F. 1993. Potentiation of decreased pyruvate dehydrogenase activity by inflammatory stimuli in sepsis. Circ. Shock 39:299-‐305.
Vestergaard,H., Bjorbaek,C., Hansen,T., Larsen,F.S., Granner,D.K., and Pedersen,O. 1995. Impaired activity and gene expression of hexokinase II in muscle from non-‐insulin-‐dependent diabetes mellitus patients. J. Clin. Invest 96:2639-‐2645.
Vind,B.F., Birk,J.B., Vienberg,S.G., Andersen,B., Beck-‐Nielsen,H., Wojtaszewski,J.F., and Hojlund,K. 2012. Hyperglycaemia normalises insulin action on glucose metabolism but not the impaired activation of AKT and glycogen synthase in the skeletal muscle of patients with type 2 diabetes. Diabetologia 55:1435-‐1445.
Vind,B.F., Pehmoller,C., Treebak,J.T., Birk,J.B., Hey-‐Mogensen,M., Beck-‐Nielsen,H., Zierath,J.R., Wojtaszewski,J.F., and Hojlund,K. 2011. Impaired insulin-‐induced site-‐specific phosphorylation of TBC1 domain family, member 4 (TBC1D4) in skeletal muscle of type 2 diabetes patients is restored by endurance exercise-‐training. Diabetologia 54:157-‐167.
Ward,G.R., Sutton,J.R., Jones,N.L., and Toews,C.J. 1982. Activation by exercise of human skeletal muscle pyruvate dehydrogenase in vivo. Clin. Sci. (Lond) 63:87-‐92.
Wasserman,D.H. and Ayala,J.E. 2005. Interaction of physiological mechanisms in control of muscle glucose uptake. Clin. Exp. Pharmacol. Physiol 32:319-‐323.
Wasserman,D.H., Kang,L., Ayala,J.E., Fueger,P.T., and Lee-‐Young,R.S. 2011. The physiological regulation of glucose flux into muscle in vivo. J. Exp. Biol. 214:254-‐262.
![Page 82: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/82.jpg)
82
Watt,M.J., Heigenhauser,G.J., LeBlanc,P.J., Inglis,J.G., Spriet,L.L., and Peters,S.J. 2004. Rapid upregulation of pyruvate dehydrogenase kinase activity in human skeletal muscle during prolonged exercise. J. Appl. Physiol (1985. ) 97:1261-‐1267.
Whiteman,E.L., Cho,H., and Birnbaum,M.J. 2002. Role of Akt/protein kinase B in metabolism. Trends Endocrinol. Metab 13:444-‐451.
Wild,S., Roglic,G., Green,A., Sicree,R., and King,H. 2004. Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 27:1047-‐1053.
Wilkes,E.A., Selby,A.L., Atherton,P.J., Patel,R., Rankin,D., Smith,K., and Rennie,M.J. 2009. Blunting of insulin inhibition of proteolysis in legs of older subjects may contribute to age-‐related sarcopenia. Am. J. Clin. Nutr. 90:1343-‐1350.
Wojtaszewski,J.F., Hansen,B.F., Gade, Kiens,B., Markuns,J.F., Goodyear,L.J., and Richter,E.A. 2000. Insulin signaling and insulin sensitivity after exercise in human skeletal muscle. Diabetes 49:325-‐331.
Wojtaszewski,J.F., Hansen,B.F., Kiens,B., and Richter,E.A. 1997. Insulin signaling in human skeletal muscle: time course and effect of exercise. Diabetes 46:1775-‐1781.
Wojtaszewski,J.F., Jorgensen,S.B., Frosig,C., MacDonald,C., Birk,J.B., and Richter,E.A. 2003. Insulin signalling: effects of prior exercise. Acta Physiol Scand. 178:321-‐328.
Wojtaszewski,J.F., Jorgensen,S.B., Hellsten,Y., Hardie,D.G., and Richter,E.A. 2002a. Glycogen-‐dependent effects of 5-‐aminoimidazole-‐4-‐carboxamide (AICA)-‐riboside on AMP-‐activated protein kinase and glycogen synthase activities in rat skeletal muscle. Diabetes 51:284-‐292.
Wojtaszewski,J.F., Nielsen,J.N., and Richter,E.A. 2002b. Invited review: effect of acute exercise on insulin signaling and action in humans. J. Appl. Physiol (1985. ) 93:384-‐392.
Wojtaszewski,J.F., Nielsen,P., Kiens,B., and Richter,E.A. 2001. Regulation of glycogen synthase kinase-‐3 in human skeletal muscle: effects of food intake and bicycle exercise. Diabetes 50:265-‐269.
Wolsk,E., Mygind,H., Grondahl,T.S., Pedersen,B.K., and van,H.G. 2010. IL-‐6 selectively stimulates fat metabolism in human skeletal muscle. Am. J. Physiol Endocrinol. Metab 299:E832-‐E840.
Wu,P., Blair,P.V., Sato,J., Jaskiewicz,J., Popov,K.M., and Harris,R.A. 2000. Starvation increases the amount of pyruvate dehydrogenase kinase in several mammalian tissues. Arch. Biochem. Biophys. 381:1-‐7.
Wu,P., Sato,J., Zhao,Y., Jaskiewicz,J., Popov,K.M., and Harris,R.A. 1998. Starvation and diabetes increase the amount of pyruvate dehydrogenase kinase isoenzyme 4 in rat heart. Biochem. J. 329 ( Pt 1):197-‐201.
Yenush,L. and White,M.F. 1997. The IRS-‐signalling system during insulin and cytokine action. Bioessays 19:491-‐500.
![Page 83: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/83.jpg)
83
Yeo,W.K., Paton,C.D., Garnham,A.P., Burke,L.M., Carey,A.L., and Hawley,J.A. 2008. Skeletal muscle adaptation and performance responses to once a day versus twice every second day endurance training regimens. J. Appl. Physiol (1985. ) 105:1462-‐1470.
Yfanti,C., Nielsen,A.R., Akerstrom,T., Nielsen,S., Rose,A.J., Richter,E.A., Lykkesfeldt,J., Fischer,C.P., and Pedersen,B.K. 2011. Effect of antioxidant supplementation on insulin sensitivity in response to endurance exercise training. Am. J. Physiol Endocrinol. Metab 300:E761-‐E770.
Zeigerer,A., McBrayer,M.K., and McGraw,T.E. 2004. Insulin stimulation of GLUT4 exocytosis, but not its inhibition of endocytosis, is dependent on RabGAP AS160. Mol. Biol. Cell 15:4406-‐4415.
Zell,R., Geck,P., Werdan,K., and Boekstegers,P. 1997. TNF-‐alpha and IL-‐1 alpha inhibit both pyruvate dehydrogenase activity and mitochondrial function in cardiomyocytes: evidence for primary impairment of mitochondrial function. Mol. Cell Biochem. 177:61-‐67.
Zimmet,P., Alberti,K.G., and Shaw,J. 2001. Global and societal implications of the diabetes epidemic. Nature 414:782-‐787.
![Page 84: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/84.jpg)
Study I
Biensø RS, Ringholm S, Kiilerich K, Aachmann-Andersen NJ, Krogh-Madsen R, Guerra
B, Plomgaard P, van Hall G, Treebak JT, Saltin B, Lundby C, Calbet JA,Pilegaard H, Wojtaszewski
JF. GLUT4 and glycogen synthase are key players in bed rest-induced insulin resistance. Diabetes. 2012
May;61(5):10909.
![Page 85: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/85.jpg)
GLUT4 and Glycogen Synthase Are Key Players in BedRest–Induced Insulin ResistanceRasmus S. Biensø,1,2,3 Stine Ringholm,1,2,3 Kristian Kiilerich,1,2,3 Niels-Jacob Aachmann-Andersen,1,4
Rikke Krogh-Madsen,1,2,5 Borja Guerra,6 Peter Plomgaard,1,2,5 Gerrit van Hall,1,4 Jonas T. Treebak,1,7
Bengt Saltin,1,4 Carsten Lundby,1,4 Jose A.L. Calbet,6 Henriette Pilegaard,1,2,3
and Jørgen F.P. Wojtaszewski1,7
To elucidate the molecular mechanisms behind physical inactivity–induced insulin resistance in skeletal muscle, 12 young, healthymale subjects completed 7 days of bed rest with vastus lateralismuscle biopsies obtained before and after. In six of the subjects,muscle biopsies were taken from both legs before and after a 3-hhyperinsulinemic euglycemic clamp performed 3 h after a 45-min,one-legged exercise. Blood samples were obtained from one fem-oral artery and both femoral veins before and during the clamp.Glucose infusion rate and leg glucose extraction during the clampwere lower after than before bed rest. This bed rest–inducedinsulin resistance occurred together with reduced muscleGLUT4, hexokinase II, protein kinase B/Akt1, and Akt2 proteinlevel, and a tendency for reduced 3-hydroxyacyl-CoA dehydro-genase activity. The ability of insulin to phosphorylate Akt andactivate glycogen synthase (GS) was reduced with normal GSsite 3 but abnormal GS site 2+2a phosphorylation after bed rest.Exercise enhanced insulin-stimulated leg glucose extractionboth before and after bed rest, which was accompanied by higherGS activity in the prior-exercised leg than the rested leg. The pres-ent !ndings demonstrate that physical inactivity–induced insulinresistance in muscle is associated with lower content/activity ofkey proteins in glucose transport/phosphorylation and storage.Diabetes 61:1090–1099, 2012
Lifestyle-related diseases like type 2 diabetes arerapidly increasing worldwide, and there is strongevidence that physical inactivity contributes tothis development (1). The prediabetic and di-
abetic states are characterized by peripheral insulin re-sistance (2), and due to the large mass of skeletal muscle,the insulin action in this tissue has major in"uence onwhole-body insulin sensitivity, especially in lean adults (3).Insulin sensitivity in skeletal muscle is to a large extent adynamic parameter that can be enhanced by exercisetraining and decreased by physical inactivity (4–7). Thus,research attempting to combat diseases related to insulin
resistance has focused on mechanisms by which the sen-sitivity of the glucose uptake to insulin is regulated.
Type 2 diabetes patients with peripheral insulin re-sistance have impaired GLUT4 translocation in skeletalmuscle (8). Moreover, muscle insulin–resistant individualsand type 2 diabetes patients have impaired insulin-stimulatedAkt Thr308 and Ser473 phosphorylation (9–11), lower insulin-stimulated Akt substrate of 160 kDa (AS160/TBC1D4)phosphorylation on multiple sites (7,9–11), and impairedinsulin-stimulated glycogen synthase (GS) activity (9). Theimpaired GS activity in type 2 diabetes patients is associ-ated with hyperphosphorylation of GS site 2+2a duringinsulin stimulation, whereas GS site 3a phosphorylationappears to be unaffected (9,12), indicating that GS phos-phorylation downstream of Akt is maintained despite lowerAkt phosphorylation. Exercise training has been shownto enhance the capacity for glucose transport and glyco-gen storage in skeletal muscle by increasing GLUT4,hexokinase II (HKII), and TBC1D4 protein content as wellas GS activity in both healthy and type 2 diabetic patients,and these adaptations may contribute to the training-inducedimprovements in insulin sensitivity (13–15). In addition, theimproved insulin sensitivity observed after exercise traininghas been reported to be associated with improved, and infact normalized, insulin-induced phosphorylation of TBC1D4in type 2 diabetes (7). In line with the changes observed withtraining, physical inactivity has been demonstrated to induceinsulin resistance (5,16). However, to the best of ourknowledge, no study has reported the effects of physicalinactivity on key proteins in glucose metabolism in humanskeletal muscle.
Muscle insulin sensitivity has been shown to be in-creased in the period after a single bout of exercise (17).Thus, enhanced insulin-mediated glucose clearance is ob-served for up to 48 h after a single exercise bout (17–19). Ithas been shown in rat skeletal muscle that the increasedinsulin sensitivity to glucose uptake is associated with anincreased GLUT4 translocation to the plasma membrane (20).Moreover, multiple studies have documented that insulin-mediated activation of the most proximal insulin signalingelements (e.g., insulin receptor, insulin receptor substrate,phosphatidylinositol-3 kinase, and Akt) is not enhancedafter a single bout of exercise (21–23). Interestingly, recentstudies have revealed that basal and insulin-induced TBC1D4phosphorylation are increased in the period after a singlebout of exercise (24,25), although unchanged TBC1D4phosphorylation has also been reported, but in a study notdetecting increased glucose uptake after exercise (26).Studies have also reported an increased GS activity 3–4 hafter exercise (27), and thus a combination of increasedphosphorylation of TBC1D4 (regulating glucose transport)
From the 1Copenhagen Muscle Research Centre, University of Copenhagen,Copenhagen, Denmark; the 2Centre of In"ammation and Metabolism, Uni-versity of Copenhagen, Copenhagen, Denmark; the 3Department of Biology,University of Copenhagen, Copenhagen, Denmark; the 4Rigshospitalet, Sec-tion 7652, Copenhagen, Denmark; the 5Rigshospitalet, Section 7641, Copen-hagen, Denmark; the 6Department of Physical Education, University of LasPalmas de Gran Canaria, Las Palmas de Gran Canaria, Spain; and the7Molecular Physiology Group, Department of Exercise and Sport Sciences,University of Copenhagen, Copenhagen, Denmark.
Corresponding author: Rasmus S. Biensø, [email protected] 27 June 2011 and accepted 16 January 2012.DOI: 10.2337/db11-0884B.G. and J.A.L.C. were visiting CopenhagenMuscle Research Centre, Rigshospitalet
7652, during this study.! 2012 by the American Diabetes Association. Readers may use this article as
long as the work is properly cited, the use is educational and not for pro!t,and the work is not altered. See http://creativecommons.org/licenses/by-nc-nd/3.0/ for details.
1090 DIABETES, VOL. 61, MAY 2012 diabetes.diabetesjournals.org
ORIGINAL ARTICLE
![Page 86: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/86.jpg)
and increased GS activity (regulating glycogen synthesis)may explain the increased sensitivity of insulin to stimu-late glucose uptake 3–4 h after a single bout of exercise.
Knowing the underlying molecular mechanisms behindphysical inactivity–induced insulin resistance and the im-pact of physical inactivity on exercise-induced insulinsensitivity may provide the basis for developing pharma-ceutical agents and interventions that can counteract thedevelopment of insulin resistance in skeletal muscle dur-ing bed rest after surgery/illness as well as induced bya physically inactive lifestyle. The aim of the current studywas to test the hypotheses that 1) physical inactivity–induced insulin resistance in human skeletal muscle is dueto dysregulation of both GS and TBC1D4 and 2) exercise-induced enhancement of insulin sensitivity is lost withphysical inactivity.
RESEARCH DESIGN AND METHODSSubjects. Twelve young, healthy male subjects participated in the study(Table 1). The subjects were physically active, as they all walked or bicycledfor .1 h/day. The subjects were given both oral and written information aboutthe experimental protocol and procedures as well as the discomfort they mightexperience during the experiment. After having received this information, thesubjects gave their written consent. The study was performed according to theDeclaration of Helsinki and was approved by the Copenhagen and Freder-iksberg Ethics Committee in Denmark (H-C-2007-0085).Bed rest. The subjects were placed in bed for 7 days and were given in-formation about the importance of not moving their legs. All transport ofsubjects took place in wheelchairs and subjects were told to sit down duringshowers. The subjects were encouraged to sit in the wheelchair for up to 5 h perday to avoid vascular complications. The daily energy intake during the bed restcame from meals containing 10–20% protein, 50–60% carbohydrates, and25–35% fat. The meals were served ad libitum.Physical performance and body composition. Twelve subjects were in-cluded in the bed rest part (Table 1). Six of these subjects were chosen randomlyto follow a study protocol involving one-legged exercise and a hyperinsulinemiceuglycemic clamp. The characteristics of these subjects are given in brackets inTable 1.
Approximately 2 weeks before the bed rest, maximal oxygen uptake (VO2max)was determined by an incremental test on a cycle ergometer (Monarch Ergo-medic) for all 12 subjects. Body composition and body weight were determinedby dual-emission X-ray absorptiometry scanning (GE Healthcare). The VO2max
test and the dual-emission X-ray absorptiometry scan were repeated at the endof the bed rest period. In addition, the six subjects participating in the exerciseand clamp protocol performed an incremental one-legged knee extensor exer-cise test to exhaustion on a modi!ed cycle ergometer bike (Monarch Ergo-medic) to determine Wattmax as previously described (28).Experimental protocol. The day before the experimental day (both beforeand after the bed rest period), the subjects consumed a prepackaged, stan-dardized meal and evening snack regulated for body weight (14.3 kcal/kg and2.9 kcal/kg, respectively). On the experimental day, the subjects arrived to thelaboratory in the morning. Catheters were placed in the femoral vein of each legand in one femoral artery. Three and a half hours after consuming a stan-dardized breakfast (2.9 kcal/kg), the subjects completed 45 min of one-leggedknee extensor exercise at 60% of Wattmax. This relatively low intensity waschosen to ensure that the subjects would be able to complete the exercise
bout after the bed rest. Three hours into recovery, a 3-h euglycemic hyper-insulinemic clamp with a constant rate of insulin infusion (50 mU/[min $ m2])(Actrapid; Novo Nordisk, Bagsvaerd, Denmark) was performed. Arterial bloodsamples were obtained every 5–10 min for immediate determination of plasmaglucose concentration (Radiometer ABL 725 series Acid-Base Analyser).Euglycemia was maintained by subsequent adjustment of the glucose infusionrate (GIR). The duration of 3 h was chosen to approach clamp steady-stateconditions at the sampling time points.
Muscle biopsies were obtained from the vastus lateralis of both the pre-viously exercised (Ex leg) and the rested leg (Rest leg) both before (B) and after(I) the clamp using the needle biopsy technique (29) with suction. Incisions forbiopsies were made under local anesthesia (lidocaine; AstraZeneca, Södertälje,Sweden) and individual incisions were used for each biopsy. The biopsies werequickly frozen in liquid nitrogen (within 10–20 s) after removing visual bloodand connective tissue.
Before as well as at 2, 2.5, and 3 h of the insulin clamp, blood samples weredrawn from the three femoral catheters and placed in EDTA-treated tubes.Plasma was collected by centrifugation and stored at 280°C.Plasma analyses. The femoral arterial and venous plasma glucose con-centrations were measured using an acid-base analyzer (Radiometer ABL 725series Acid-Base Analyser), and arterial insulin concentration was measuredby ELISA (K6219; DAKO, Glostrup, Denmark). Glucose extraction across theleg was calculated as the difference between the glucose concentration in thearterial and venous plasma samples. The plasma palmitate concentration wasdetermined by gas chromatography (30)
Muscle samples were freeze dried for .48 h. Visible blood, fat, and con-nective tissue were removed under a microscope.
Glycogen was measured as glycosyl units after acid hydrolysis using anautomatic spectrophotometer as previously described (31,32).Enzyme activities. The activity of 3-hydroxyacyl-CoA dehydrogenase (HAD)and citrate synthase (CS) was analyzed spectrophotometrically as previouslydescribed (32). The GS activity was determined in muscle homogenates aspreviously described (22,33).SDS-PAGE and Western blotting. Muscle homogenate, muscle lysate, andprotein concentration determination were prepared as previously described(25,34).
The protein or phosphorylation of b-actin, HKII, GLUT4, Akt, GS kinase 3b(GSK-3b), and TBC1D4 in muscle lysates and GS protein and protein phos-phorylation in muscle homogenates were measured by SDS-PAGE and West-ern blotting (25,34). Primary polyclonal antibodies against b-actin (4967; CellSignaling Technology, Beverly, MA), HKII (2867; Cell Signaling Technology),GLUT4 (ABR-PAI1065; Thermo Scienti!c, Golden, CO), Akt1 and Akt2 (2967and 3063, respectively; Cell Signaling Technology), GSK-3a and -3b (9338 and9315, respectively; Cell Signaling Technology), and TBC1D4 protein (ABCAM,Cambridge, U.K.) as well as against protein phosphorylation of Akt Thr308 (05-669;Upstate Biotechnology, Lake Placid, NY) and Ser473 (05-802; Millipore, Bedford,MA), GSK-3a Ser21 and GSK-3b Ser9 (9331 and 9323, respectively; CellSignaling Technology), TBC1D4 Ser588 and Thr642 (3028-P2 and 3028-P1,respectively; Symansis, Auckland, N.Z.), and TBC1D4 Ser751 (provided byGraham Hardie, Dundee University, Dundee, U.K.) were used. Primary poly-clonal antibodies against GS protein (provided by Oluf Pedersen, University ofCopenhagen) and phosphospeci!c antibodies against 2+2a, 1b (provided byGraham Hardie), and 3a (3891; Cell Signaling Technology) were also used.Membranes probed with phosphospeci!c antibodies were stripped to allowfor determination of the level of the corresponding protein as previouslydescribed (25).Statistics. Values presented are means6 SE. Two-way ANOVA with repeatedmeasures was applied to evaluate the effect of exercise and insulin before aswell as after bed rest. Also, a two-way ANOVA with repeated measures was
TABLE 1Subject characteristics before and after bed rest
Subject characteristics Before bed rest After bed rest
Age (years) 26 6 3 (29 6 5) —Height (cm) 181 6 2 (183 6 7) —Weight (kg) 75.2 6 3.2 (81.6 6 4.9) 75.1 6 3.3 (81.4 6 5.0)VO2max (L/min) 3.9 6 0.2 (4.1 6 1.0) 3.7 6 0.2 (3.9 6 0.4)†Leg muscle mass (kg) 20.6 6 1.0 (21.7 6 1.9) 20.0 6 0.9 (21.0 6 1.7)†Percentage of whole body fat (kg) 18.2 6 2.1 (21.7 6 3.3) 18.5 6 2.1 (21.7 6 3.1)
Age, height, weight, VO2max, leg muscle mass, and percentage of whole body fat before and after 7 days of bed rest. Values are means6 SE; n = 12.Values given in parentheses represent the six subjects randomly chosen for the invasive exercise and clamp study. †Signi!cantly different frombefore bed rest, P , 0.05.
R.S. BIENSØ AND ASSOCIATES
diabetes.diabetesjournals.org DIABETES, VOL. 61, MAY 2012 1091
![Page 87: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/87.jpg)
used to evaluate the effect of bed rest and insulin within the rested leg as wellas within the exercised leg. The data were log transformed if normality orequal variance tests failed. If signi!cant main effects were found, theStudent-Newman-Keuls post hoc test was used to locate differences.Differences were considered signi!cant at P , 0.05. A tendency is reportedfor 0.05 # P , 0.1. Statistical calculations were performed using SigmaStatversion 3.1.
RESULTS
Physical characteristics and performance. Total bodyweight and BMI were unaffected by 7 days of bed rest(Table 1). Leg muscle mass was reduced 3 6 0.7% (P ,0.05), whereas whole body fat did not change signi!cantlywith bed rest (Table 1). Seven days of bed rest reducedwhole body VO2max 5 6 1.4% (P , 0.05) (Table 1).Protein content and enzyme activity. Skeletal muscleHAD activity tended to decrease 8 6 4.7% (0.05 # P , 0.1)by bed rest, whereas CS activity did not change signi!-cantly (Table 2). The protein content of HKII (66 6 15%),GLUT4 (74 6 14%), Akt1 (56 6 6%), and Akt2 (68 6 7%)was reduced after bed rest relative to before (P , 0.05),whereas the protein level of TBC1D4 and GS and GS totalactivity were unchanged with bed rest (Fig. 1 and Table 2).Plasma insulin. The average plasma insulin concentrationbefore exercise, immediately after, and 3 h into recoverywas not signi!cantly different before and after bed rest,with an average of 32 6 15 mmol/L before and 74 6 20mmol/L after bed rest. However, during the last hour of theclamp, plasma insulin concentration tended to be higherafter (452 6 66 pmol/L) than before (341 6 30 pmol/L) bedrest (0.05 # P , 0.1) (Table 3).Plasma palmitate. The plasma palmitate concentrationwas unaffected by bed rest both before and after the in-sulin clamp. Insulin reduced the plasma palmitate con-centration both before and after bed rest (P , 0.05).Plasma glucose and GIR. The arterial plasma glucoseconcentration during the clamp was similar, 4.9 6 0.1mmol/L before and after bed rest. The GIR did not reacha steady state even after 180 min (Fig. 2A). At all timepoints after 50 min, GIR was higher before than afterbed rest (P , 0.05). During the last hour of the clamp,
GIR after bed rest was 75 6 12% of the level before bedrest (P , 0.05) (Fig. 2A).Glucose extraction. Glucose extraction was evaluatedduring the last hour as the arterio-venous concentration dif-ference across the leg. It has previously been reported thatglucose extraction increased only in the exercising leg duringthe one-legged exercise (35). Three hours after exercise,glucose extraction across the leg was similar in the exercisedand rested leg, re"ecting that the acute exercise effect onglucose extraction was fully diminished at 3 h of recoveryfrom exercise (corresponding to pre-insulin) (Fig. 2B). Thiswas seen both before and after bed rest. Insulin infusion in-creased glucose extraction both in the prior-exercised andthe rested leg, both before and after bed rest (Fig. 2B). Duringthe last hour of the clamp before bed rest, glucose extrac-tion in the rested leg was 11-fold (P , 0.05), and the prior-exercised leg sixfold (P , 0.05), higher after insulin than atbasal. After bed rest, glucose extraction was six- and seven-fold (P , 0.05) higher after insulin than at basal in the restedand prior-exercised leg, respectively. The insulin-stimulatedglucose extraction in the rested leg after bed rest was78 6 10% (P , 0.05) of the level before bed rest. Also,insulin-stimulated glucose extraction before bed rest was1.6 6 0.2-fold (P , 0.05), and after bed rest 1.9 6 0.2-fold(P, 0.05), higher in the prior-exercised than in the restedleg (Fig. 2B).Muscle glycogen. Three hours after exercise, muscleglycogen content was ;20% (P , 0.05) lower in the prior-exercised than the rested leg. This was observed both
TABLE 2Muscle protein content and activity before and after bed rest
Protein Before bed rest After bed rest
GLUT4 protein 1 6 0.18 0.74 6 0.14†HKII protein 1 6 0.14 0.66 6 0.15†Akt1 protein 1 6 0.13 0.56 6 0.06†Akt2 protein 1 6 0.13 0.68 6 0.07†TBC1D4 protein 1 6 0.22 0.79 6 0.21GS protein 1 6 0.15 0.82 6 0.21GS total activity(nmol $ min21 $ mg21) 30.7 6 2.3 30.8 6 1.5
HAD activity(mmol $ min21 $ kg21) 23.5 6 1.2 21.4 6 1.4(†)
CS activity(mmol $ min21 $ kg21) 44.9 6 3.8 41.9 6 4.2
GLUT4 protein, HKII protein, Akt2 protein, TBC1D4 protein, and GSprotein content, as well as GS total activity (nmol $ min21 $ mg21),HAD activity (mmol $ min21 $ kg21 dry weight), and CS activity(mmol $ min21 $ kg21 dry weight) in vastus lateralis before and after7 days of bed rest. Target protein content is normalized to b-actinprotein content. Values are means6 SE; n = 12. †Signi!cantly differentfrom before bed rest, P , 0.05. (†)Tendency, 0.05 # P , 0.1.
FIG. 1. Representative blots showing GLUT4, HKII, Akt1, Akt2, TBC1D4,and GS protein before and after 7 days of bed rest in rested (Rest) andprior-exercised (Ex) leg for the same subject. Although the averageAkt2 protein content of all subjects is reduced with bed rest (Table 2),it may be noted that the abundance of Akt2 is not reduced with bed restin the subject used for the representative blots. kD, kilodaltons.
BED REST–INDUCED INSULIN RESISTANCE
1092 DIABETES, VOL. 61, MAY 2012 diabetes.diabetesjournals.org
![Page 88: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/88.jpg)
before and after bed rest. There was no change in themuscle glycogen level in response to insulin infusion. Bedrest per se tended to enhance the muscle glycogen content;20% (0.05 # P , 0.1) in the rested leg (Fig. 2C).Muscle signalingAkt phosphorylation. Akt Thr308 phosphorylation wassimilar in the rested and exercised leg at 3 h of recoveryboth before and after bed rest. Insulin infusion increasedAkt Thr308 phosphorylation similarly four- to !vefold in bothlegs before and after bed rest. No effect of prior exercise wasobserved on insulin-induced Akt phosphorylation. However,bed rest decreased Akt Thr308 phosphorylation 20–30% (P ,0.05) after the clamp (Fig. 3A and C). This decrease wasobserved in both the prior-exercised and rested leg. A similarphosphorylation pattern was observed for Akt Ser473 (datanot shown). Thus, the insulin resistance induced by bedrest was associated with decreased signaling through Akt,even after accounting for decreased Akt2 protein expres-sion (Table 2).GSK-3 phosphorylation. The phosphorylation pattern ofAkt target sites (GSK-3a Ser21 and GSK-3b Ser9) did not re-"ect the 20–30% lower Akt phosphorylation after bed rest.Phosphorylation of GSK-3b Ser9 was however 10–20%(P , 0.05) lower in the prior-exercised than the restedleg at 3 h recovery both before and after bed rest, but theability of insulin to induce phosphorylation was apparentlynot signi!cantly changed by either bed rest or prior exer-cise (Fig. 3B and C). Effects of insulin on GSK-3a Ser21
phosphorylation were too small to be detected with theantibody applied (data not shown).TBC1D4 phosphorylation. Being a direct target of AktTBC1D4 phosphorylation was evaluated by the use of phos-phospeci!c antibodies toward three phosphorylationsites (Ser588, Thr642, and Ser751). The general phosphory-lation pattern revealed by these antibodies was similar(Fig. 4). Thus, both before and after bed rest, TBC1D4 phos-phorylation 3 h after exercise was similar in the rested andprior-exercised leg. Insulin stimulation increased the TBC1D4phosphorylation 1.5- to 3-fold (P , 0.05) in both legsbefore and after bed rest, and there was no change in theinsulin-stimulated TBC1D4 phosphorylation with bed rest(Fig. 4).Glycogen synthase activity and phosphorylationGS activity. The GS activity was evaluated both as %I-form(not shown) and percent fractional velocity (%FV). Thetwo measures of GS activity revealed the same pattern ofregulation. GS %FV activity was enhanced (P , 0.05) inthe prior-exercised leg relative to the rested leg 3 h afterexercise both before (P , 0.05) and after bed rest (0.05 #P , 0.1). Insulin increased GS activity in both legs beforeand after bed rest and with a similar magnitude (P , 0.05).
However, in both legs, the level of GS activity tended to belower after bed rest than before (0.05 # P , 0.1) (Fig. 5A).GS phosphorylation. GS phosphorylation at site 2+2awas, in general, elevated after bed rest relative to before(P , 0.05). Site 2+2a phosphorylation was 30% (P , 0.05)lower in the prior-exercised leg than in the rested leg 3 hafter exercise only before bed rest (Fig. 5B and C). Insulinstimulation decreased site 2+2a phosphorylation by 70%(P , 0.05) before but not after bed rest.
GS site 3a phosphorylation was reduced 40% (P , 0.05)by insulin in the rested leg after bed rest and was reduced45% in the prior-exercised leg (P , 0.05) before andtended to be reduced 35% (0.05 # P , 0.1) after bed restin response to insulin. Bed rest resulted in an apparent(P , 0.05) 1.2-fold higher GS site 3a phosphorylation inboth legs 3 h after exercise (Fig. 5B and D). GS phos-phorylation at site 1b was not different between legs andwas not affected by insulin, exercise, or bed rest (data notshown).
DISCUSSION
The main !ndings of the current study are that bed rest–induced insulin resistance is associated with reducedinsulin-stimulated muscular GS activity and Akt signalingas well as decreased protein level of HKII and GLUT4.Thus, this study may indicate that decreased glucose ex-traction with bed rest occurs as a consequence of bothdecreased glucose transport/phosphorylation as well asdecreased nonoxidative glucose metabolism in skeletalmuscle. In addition, the ability of acute exercise to increaseinsulin-stimulated glucose extraction is well maintainedeven after 7 days of bed rest. However, acute exerciseafter bed rest does not fully normalize the ability of skel-etal muscle to extract glucose to the level seen when ex-ercise is performed before bed rest.
The observation that 7 days of bed rest resulted in lowerinsulin-stimulated glucose extraction across the leg is inaccordance with previous bed rest studies (5,16). Un-fortunately, we are not able to evaluate whether this relatesto changes in blood "ow. However, based on previousobservations, insulin-stimulated blood "ow is expected todecrease with bed rest (5,36). Thus, it seems unlikely thatthe decreased glucose extraction observed after bed restis a compensation for an increased blood "ow. Thus, weare con!dent that the decreased leg glucose extractionobserved re"ects decreased leg glucose uptake after bedrest.
The current study provides some indications for the mo-lecular mechanisms behind the observed bed rest–inducedinsulin resistance. Although it is assumed that the observed
TABLE 3Plasma concentrations before and after bed rest
Before bed rest After bed restPlasma parameter B I B I
Glucose (mmol/L) 5.3 6 0.03 4.9 6 0.1* 5.3 6 0.08 5.0 6 0.07*Insulin (pmol/L) 32 6 15 341 6 30* 74 6 20 452 6 66*(†)Palmitate (mmol/L) 183 6 11.1 20 6 1.3* 166 6 9.8 20 6 3.3*
Glucose (mmol/L), insulin (pmol/L), and palmitate (mmol/L) concentration in arterial blood plasma before and after 7 days of bed rest.Samples were obtained before (B) and after (I) a 3-h hyperinsulinemic euglycemic clamp performed 3 h after a one-legged exercise bout.Values are means 6 SE; n = 6. *Signi!cantly different from B, P , 0.05. (†)Tends to be signi!cantly different from before bed rest,0.05 # P , 0.1.
R.S. BIENSØ AND ASSOCIATES
diabetes.diabetesjournals.org DIABETES, VOL. 61, MAY 2012 1093
![Page 89: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/89.jpg)
molecular changes are due to the physical inactivity initself, a contribution from a potential positive energy bal-ance cannot be ruled out (37). But the !nding that the bodyweight was maintained by the ad libitum food intake dur-ing the bed rest period indicates that the subjects were inenergy balance. Central to the observed bed rest–inducedinsulin resistance is the !nding that both basal and insulin-stimulated GS activity was lower after bed rest than be-fore. This impairment is likely one explanatory factor forthe decreased leg glucose extraction. The observed lowerGLUT4 protein content after bed rest is similar to the pre-viously reported decrease in GLUT4 protein after a periodof physical inactivity in trained humans (38) and rats (39).This suggests a similar effect of bed rest and detraining onthe regulation of GLUT4 expression. Although our datasuggest that physical inactivity–induced insulin resistance isassociated with reduced GLUT4 abundance, it is notablethat other studies have found no relationship betweenGLUT4 protein content and insulin action (40). Further-more, the lower HKII and GLUT4 protein levels after bedrest likely decrease glucose transport and phosphorylationin skeletal muscle. These modi!cations are likely addi-tional explanatory factors. Although we can only speculateas to the mechanism for the latter observations, it is temptingto suggest that the absence of muscle use during bed restleads to lack of stimulation of transcriptional/translationalprocesses normally seen in contracting skeletal muscle(41,42).
The current study does not provide insight as to whethertranslocation of GLUT4 to the plasma membrane is alsocompromised in bed rest–induced insulin resistance asseen in, for example, insulin-resistant muscle (40). But the20–30% decreased protein and phosphorylation level ofAkt after bed rest, similar to what has recently been ob-served with reduced levels of physical activity (43), maysuggest such a mechanism because impaired Akt phos-phorylation is seen in skeletal muscle of type 2 diabetessubjects. A possible upstream regulator responsible for theobserved decreased Akt phosphorylation could be phospha-tidylinositol-3 kinase, but due to lack of suf!cient tissue, thiscannot be elucidated further in the current study. However,the impaired phosphorylation on both of the key regulatorysites for Akt activity did not translate to two endogenoussubstrates of Akt. Thus, in contrast to insulin resistance intype 2 diabetes subjects (7), basal and insulin-induced phos-phorylation of TBC1D4 was fully normal on multiple pro-posed Akt target sites after bed rest. In addition, the presentobservations do not indicate that reduced TBC1D4 phos-phorylation is responsible for muscle insulin resistance afterbed rest. However, other mechanisms involved in the GLUT4recruitment to the plasma membrane, dependent on Akt,may be impaired (e.g., cytoskeleton rearrangements) (44).
Interestingly, the impaired activity and activation of GSafter bed rest might be linked to impaired covalent regu-lation of the enzyme. Thus, whereas GS site 3a dephos-phorylation was not compromised after bed rest, theability of insulin to induce dephosphorylation on site 2+2awas lost. Furthermore, the general level of site 2+2aphosphorylation was increased and potentially contribut-ing to the suppressed GS activity after bed rest. Such apattern of dysregulation of site 2+2a rather than site 3a is
FIG. 2. A: GIR during 3 h of hyperinsulinemic euglycemic clamp initiated3 h after 45 min of one-legged knee extensor exercise before and after 7days’ bed rest. B: Arterio-venous (a-v) glucose difference across rested(Rest leg) and prior-exercised (Ex leg) vastus lateralis during 3 h ofhyperinsulinemic euglycemic clamp performed 3 h after 45 min of one-legged knee extensor exercise before and after bed rest. Samples wereobtained before (B) as well as during (I) the clamp, presented here bythe accumulated data during the last hour of the clamp (2–3 h). C:Muscle glycogen concentration (mmol/kg dry weight [dw]) in rested andprior-exercised leg before (B) and after (I) 3 h of hyperinsulinemic eugly-cemic clamp performed 3 h after one-legged knee extensor exercise before
and after bed rest. Values are means 6 SE; n = 6. *Signi!cantly dif-ferent from B, P < 0.05. †Signi!cantly different from before bed rest,P < 0.05. #Signi!cantly different from Rest leg at given time point,P < 0.05. (†)Tendency, 0.05 £ P < 0.1.
BED REST–INDUCED INSULIN RESISTANCE
1094 DIABETES, VOL. 61, MAY 2012 diabetes.diabetesjournals.org
![Page 90: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/90.jpg)
FIG. 3. Akt Thr308 phosphorylation (A), GSK-3b Ser9 phosphorylation (B), and representative blots (C) in rested (Rest leg) and prior-exercised(Ex leg) vastus lateralis before (B) and after (I) 3-h hyperinsulinemic euglycemic clamp performed 3 h after one-legged knee extensor exercisebefore and after 7 days of bed rest. AU, arbitrary units; kD, kilodaltons. Values are means 6 SE; n = 6. *Signi!cantly different from B, P < 0.05.†Signi!cantly different from before bed rest, P < 0.05. #Signi!cantly different from Rest leg at given time point, P < 0.05. (#)Tendency, 0.05 £P < 0.1.
R.S. BIENSØ AND ASSOCIATES
diabetes.diabetesjournals.org DIABETES, VOL. 61, MAY 2012 1095
![Page 91: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/91.jpg)
in agreement with observations in muscle insulin resistancerelated to obesity and type 2 diabetes (9,12). Site 2+2a isapparently not a direct target of either GSK-3 or Akt. Yet it isuncertain whether the impaired Akt signaling indirectlyrelates to the lack of site 2+2a dephosphorylation seen afterbed rest. Site 2+2a is directly targeted by multiple kinases,but so far we have not been able to !nd indications thatthese kinases are dysregulated with bed rest. Thus, the fullynonresponsive site 1b phosphorylation indicates that neithercalcium calmodulin–dependent kinase nor cAMP-dependentprotein kinase is regulated under these conditions (45).Also, AMP-activated protein kinase activity/phosphorylationis not regulated by either insulin or bed rest (data notshown). In addition, both GS site 3 and site 2+2a aredephosphorylated by the multisubstrate phosphatase (PP1)(46), and a dysregulation of PP1 activity would be expectedto affect phosphorylation at both sites, and not only site2+2a as seen in the current study.
Previous studies have suggested that GS site 2+2a phos-phorylation is affected by muscle glycogen levels, and thatGS site 2+2a phosphorylation is a possible link between theinverse relationship between muscle glycogen and GS ac-tivity (47,48). Thus, although mechanistically unresolved,the lower GS activity and higher site 2+2a phosphorylation
after bed rest might be related to the higher muscle glyco-gen level after bed rest. Of notice is, however, that the dif-ferences in muscle glycogen concentration eliciting changesin GS activity in previous studies (47–50) are larger than the20% difference seen in the current study. This makes it lesslikely that the enhanced glycogen level is the only reasonfor the differences observed in the current study. The!ndings that resting muscle glycogen was elevated despiteimpaired insulin-induced glucose extraction and reducedGS activity after bed rest may at !rst seem contradictory.However, the impact of the dysregulated GS activation onthe glycogen level likely !rst becomes evident when a sig-ni!cant amount of glycogen has to be synthesized (e.g., inthe period after glycogen-depleting exercise).
The !nding that insulin-stimulated GS activity in theprior-exercised leg was higher than in the rested leg bothbefore and after bed rest is in line with previous studies(14,22) and indicates that activation of GS may play a rolein the exercise-induced enhanced glucose uptake severalhours after exercise both before and after the inactivityperiod. The similar insulin-mediated regulation of GS site 3aand Akt phosphorylation in the rested and prior-exercisedleg both before and after bed rest is also in accordancewith earlier studies (22,48) and suggests that changes in
FIG. 4. TBC1D4 Ser588 phosphorylation (A), TBC1D4 Ser751 phosphorylation (B), TBC1D4 Thr642 phosphorylation (C), and representative blots(D) in rested (Rest leg) and prior-exercised (Ex leg) vastus lateralis before (B) and after (I) 3-h hyperinsulinemic euglycemic clamp performed 3 hafter one-legged knee extensor exercise before and after 7 days of bed rest. AU, arbitrary units; kD, kilodaltons. Values are means 6 SE; n = 6.*Signi!cantly different from B, P < 0.05.
BED REST–INDUCED INSULIN RESISTANCE
1096 DIABETES, VOL. 61, MAY 2012 diabetes.diabetesjournals.org
![Page 92: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/92.jpg)
GS site 3a and Akt phosphorylation do not contribute tothe observed exercise-induced effects on GS activity. Previous!ndings show that reduced muscle glycogen is associatedwith dephosphorylation of GS site 2+2a (34), and thus themore marked dephosphorylation of GS site 2+2a could bea link between the reduced muscle glycogen and the in-creased GS activity in the prior-exercised leg. Previous studiesshowing that prior exercise increased TBC1D4 phosphoryla-tion both before and after insulin stimulation (25) suggesta role of TBC1D4 in the enhanced glucose clearance ina prior-exercised muscle. However, the current study does notcon!rm these observations, although it cannot be excludedthat a more intense or more prolonged bout of exercisewould elicit such changes. Thus, the analyses performed inthis study do not bring further insights to the mechanismsbehind exercise-induced enhanced insulin sensitivity but doprovide the important observation that the mechanisms stillseem fully functional in bed rest–induced insulin-resistantmuscle.
We are well aware of the limitation in the study by havinginvestigated the effect of acute exercise in only six subjects,leaving us in some cases with near-signi!cant trends. Stillwe are able to draw some conclusions to potential mecha-nisms involved in bed rest–induced insulin resistance inskeletal muscle. Thus bed rest–induced insulin resistance inskeletal muscle relates to decreased expression and impaired
activation of central players regulating glucose uptake andstorage in skeletal muscle, together with a possible im-paired insulin-stimulated blood "ow. In addition, the similarenhancement of glucose removal by prior exercise beforeand after bed rest demonstrates that the ability of exerciseto increase skeletal muscle insulin sensitivity is maintainedafter 7 days of physical inactivity.
ACKNOWLEDGMENTS
This study was supported by grants from the LundbeckFoundation, Denmark; The Danish Medical Research Council,Denmark; and the Novo Nordisk Foundation, Denmark. TheCentre of In"ammation and Metabolism (CIM) is supportedby a grant from the Danish National Research Foundation(02-512-55). The Copenhagen Muscle Research Centre issupported by a grant from the Capital Region of Denmark.CIM and the Molecular Physiology Group (Department ofExercise and Sport Sciences) are part of UNIK: Food,Fitness & Pharma for Health and Disease, supported bythe Danish Ministry of Science, Technology, and Innova-tion. The experimental part was funded by a grant to B.S.,while laboratory analyses were funded by grants to H.P.and J.F.P.W.
No potential con"icts of interest relevant to this articlewere reported.
FIG. 5. Glycogen synthase (GS) activity (%FV) (A), representative blots (B), GS site 3a phosphorylation (C), and GS site 2+2a phosphorylation(D) in rested (Rest leg) and prior-exercised (Ex leg) vastus lateralis before (B) and after (I) 3-h hyperinsulinemic euglycemic clamp performed 3 hafter one-legged knee extensor exercise before and after 7 days of bed rest. AU, arbitrary units; kD, kilodaltons. Values are means 6 SE; n = 6.*Signi!cantly different from B, P< 0.05. †Signi!cantly different from before bed rest, P< 0.05. #Signi!cantly different from Rest leg at given timepoint, P < 0.05. Symbols within parentheses indicate tendency, 0.05 £ P < 0.1.
R.S. BIENSØ AND ASSOCIATES
diabetes.diabetesjournals.org DIABETES, VOL. 61, MAY 2012 1097
![Page 93: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/93.jpg)
R.S.B. designed the study, took part in conducting thehuman experiments, performed the laboratory analyses,wrote the manuscript, and commented on the manuscript.S.R. designed the study, took part in conducting the humanexperiments, performed the laboratory analyses, and com-mented on the manuscript. K.K., C.L., and P.P. designed thestudy, took part in conducting the human experiments, andcommented on the manuscript. N.-J.A.-A., R.K.-M., B.G., G.v.H.,and J.A.L.C. took part in conducting the human experi-ments and commented on the manuscript. J.T.T. providedvaluable guidance for speci!c laboratory analyses andcommented on the manuscript. B.S. designed the studyand commented on the manuscript. H.P. and J.F.P.W. de-signed the study, took part in conducting the human ex-periments, assisted with writing the manuscript, andcommented on the manuscript. J.F.P.W. is the guarantor ofthis work and, as such, had full access to all the data in thestudy and takes responsibility for the integrity of the dataand the accuracy of the data analysis.
Parts of this study were presented in poster form at the70th Scienti!c Sessions of the American Diabetes Associ-ation, Orlando, Florida, 25–29 June 2010.
The authors would like to thank the subjects for theirextraordinary effort during the study. In addition, theauthors have sincere appreciation for the whole Copenha-gen 2008 Bed Rest Team for a fantastic collaboration. Theauthors are grateful to Oluf Pedersen (University of Copen-hagen), Graham Hardie, and Carol Mackintosh (DundeeUniversity) for donating antibodies essential for this study.
REFERENCES1. Venables MC, Jeukendrup AE. Physical inactivity and obesity: links with
insulin resistance and type 2 diabetes mellitus. Diabetes Metab Res Rev2009;25(Suppl. 1):S18–S23
2. Chen YD, Golay A, Swislocki AL, Reaven GM. Resistance to insulin sup-pression of plasma free fatty acid concentrations and insulin stimulation ofglucose uptake in noninsulin-dependent diabetes mellitus. J Clin Endo-crinol Metab 1987;64:17–21
3. DeFronzo RA, Ferrannini E, Sato Y, Felig P, Wahren J. Synergistic in-teraction between exercise and insulin on peripheral glucose uptake. JClin Invest 1981;68:1468–1474
4. King DS, Dalsky GP, Clutter WE, et al. Effects of exercise and lack of exerciseon insulin sensitivity and responsiveness. J Appl Physiol 1988;64:1942–1946
5. Mikines KJ, Richter EA, Dela F, Galbo H. Seven days of bed rest decreaseinsulin action on glucose uptake in leg and whole body. J Appl Physiol1991;70:1245–1254
6. Richter EA, Kiens B, Mizuno M, Strange S. Insulin action in human thighsafter one-legged immobilization. J Appl Physiol 1989;67:19–23
7. Vind BF, Pehmoller C, Treebak JT, et al. Impaired insulin-induced site-speci!c phosphorylation of TBC1 domain family, member 4 (TBC1D4) inskeletal muscle of type 2 diabetes patients is restored by endurance exercise-training. Diabetologia 2010;54:157–167
8. Zierath JR, He L, Gumà A, Odegoard Wahlström E, Klip A, Wallberg-Henriksson H. Insulin action on glucose transport and plasma membraneGLUT4 content in skeletal muscle from patients with NIDDM. Diabetologia1996;39:1180–1189
9. Højlund K, Staehr P, Hansen BF, et al. Increased phosphorylation ofskeletal muscle glycogen synthase at NH2-terminal sites during physio-logical hyperinsulinemia in type 2 diabetes. Diabetes 2003;52:1393–1402
10. Højlund K, Glintborg D, Andersen NR, et al. Impaired insulin-stimulatedphosphorylation of Akt and AS160 in skeletal muscle of women withpolycystic ovary syndrome is reversed by pioglitazone treatment. Diabetes2008;57:357–366
11. Karlsson HK, Zierath JR, Kane S, Krook A, Lienhard GE, Wallberg-Henriksson H. Insulin-stimulated phosphorylation of the Akt substrateAS160 is impaired in skeletal muscle of type 2 diabetic subjects. Diabetes2005;54:1692–1697
12. Højlund K, Birk JB, Klein DK, et al. Dysregulation of glycogen synthaseCOOH- and NH2-terminal phosphorylation by insulin in obesity and type 2diabetes mellitus. J Clin Endocrinol Metab 2009;94:4547–4556
13. Christ-Roberts CY, Pratipanawatr T, Pratipanawatr W, et al. Exercisetraining increases glycogen synthase activity and GLUT4 expression butnot insulin signaling in overweight nondiabetic and type 2 diabetic sub-jects. Metabolism 2004;53:1233–1242
14. Frøsig C, Rose AJ, Treebak JT, Kiens B, Richter EA, Wojtaszewski JF.Effects of endurance exercise training on insulin signaling in humanskeletal muscle: interactions at the level of phosphatidylinositol 3-kinase,Akt, and AS160. Diabetes 2007;56:2093–2102
15. O’Gorman DJ, Karlsson HK, McQuaid S, et al. Exercise training increasesinsulin-stimulated glucose disposal and GLUT4 (SLC2A4) protein contentin patients with type 2 diabetes. Diabetologia 2006;49:2983–2992
16. Mikines KJ, Dela F, Tronier B, Galbo H. Effect of 7 days of bed rest ondose-response relation between plasma glucose and insulin secretion. AmJ Physiol 1989;257:E43–E48
17. Richter EA, Mikines KJ, Galbo H, Kiens B. Effect of exercise on insulinaction in human skeletal muscle. J Appl Physiol 1989;66:876–885
18. Dela F, Mikines KJ, von Linstow M, Secher NH, Galbo H. Effect of trainingon insulin-mediated glucose uptake in human muscle. Am J Physiol 1992;263:E1134–E1143
19. Mikines KJ, Sonne B, Farrell PA, Tronier B, Galbo H. Effect of physicalexercise on sensitivity and responsiveness to insulin in humans. Am JPhysiol 1988;254:E248–E259
20. Hansen PA, Nolte LA, Chen MM, Holloszy JO. Increased GLUT-4 trans-location mediates enhanced insulin sensitivity of muscle glucose transportafter exercise. J Appl Physiol 1998;85:1218–1222
21. Holloszy JO. Exercise-induced increase in muscle insulin sensitivity. JAppl Physiol 2005;99:338–343
22. Wojtaszewski JF, Hansen BF, Gade, et al. Insulin signaling and insulinsensitivity after exercise in human skeletal muscle. Diabetes 2000;49:325–331
23. Wojtaszewski JF, Hansen BF, Kiens B, Richter EA. Insulin signaling inhuman skeletal muscle: time course and effect of exercise. Diabetes 1997;46:1775–1781
24. Arias EB, Kim J, Funai K, Cartee GD. Prior exercise increases phosphor-ylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle. AmJ Physiol Endocrinol Metab 2007;292:E1191–E1200
25. Treebak JT, Frøsig C, Pehmøller C, et al. Potential role of TBC1D4 inenhanced post-exercise insulin action in human skeletal muscle. Dia-betologia 2009;52:891–900
26. Howlett KF, Mathews A, Garnham A, Sakamoto K. The effect of exerciseand insulin on AS160 phosphorylation and 14-3-3 binding capacity inhuman skeletal muscle. Am J Physiol Endocrinol Metab 2008;294:E401–E407
27. Wojtaszewski JF, Nielsen P, Kiens B, Richter EA. Regulation of glycogensynthase kinase-3 in human skeletal muscle: effects of food intake andbicycle exercise. Diabetes 2001;50:265–269
28. Pilegaard H, Saltin B, Neufer PD. Exercise induces transient transcrip-tional activation of the PGC-1alpha gene in human skeletal muscle. JPhysiol 2003;546:851–858
29. Bergstrom J. Muscle electrolytes in man. Scand J Clin Lab Invest 1962;14(Suppl. 68):1–110
30. Van Hall G, Bülow J, Sacchetti M, Al Mulla N, Lyngso D, Simonsen L.Regional fat metabolism in human splanchnic and adipose tissues; theeffect of exercise. J Physiol 2002;543:1033–1046
31. Passonneau JV, Lauderdale VR. A comparison of three methods of glyco-gen measurement in tissues. Anal Biochem 1974;60:405–412
32. Lowry OH, Passonneau JV. A Flexible System of Enzymatic Analysis.New York, Academic Press, 1972
33. Thomas JA, Schlender KK, Larner J. A rapid !lter paper assay for UDP-glucose-glycogen glucosyltransferase, including an improved biosynthesisof UDP-14C-glucose. Anal Biochem 1968;25:486–499
34. Prats C, Helge JW, Nordby P, et al. Dual regulation of muscle glycogensynthase during exercise by activation and compartmentalization. J BiolChem 2009;284:15692–15700
35. Kiilerich K, Ringholm S, Bienso RS. Exercise-induced pyruvate de-hydrogenase activation is not affected by 7 days of bed rest. J Appl Physiol2011;111:751–757
36. Sonne MP, Alibegovic AC, Højbjerre L, Vaag A, Stallknecht B, Dela F.Effect of 10 days of bed rest on metabolic and vascular insulin action:a study in individuals at risk for type 2 diabetes. J Appl Physiol 2010;108:830–837
37. Newsom SA, Schenk S, Thomas KM, et al. Energy de!cit after exerciseaugments lipid mobilization but does not contribute to the exercise-inducedincrease in insulin sensitivity. J Appl Physiol 2010;108:554–560
38. Vukovich MD, Arciero PJ, Kohrt WM, Racette SB, Hansen PA, Holloszy JO.Changes in insulin action and GLUT-4 with 6 days of inactivity in endur-ance runners. J Appl Physiol 1996;80:240–244
BED REST–INDUCED INSULIN RESISTANCE
1098 DIABETES, VOL. 61, MAY 2012 diabetes.diabetesjournals.org
![Page 94: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/94.jpg)
39. Host HH, Hansen PA, Nolte LA, Chen MM, Holloszy JO. Rapid reversal ofadaptive increases in muscle GLUT-4 and glucose transport capacity aftertraining cessation. J Appl Physiol 1998;84:798–802
40. Garvey WT, Maianu L, Zhu JH, Brechtel-Hook G, Wallace P, Baron AD.Evidence for defects in the traf!cking and translocation of GLUT4 glucosetransporters in skeletal muscle as a cause of human insulin resistance. JClin Invest 1998;101:2377–2386
41. Pilegaard H, Ordway GA, Saltin B, Neufer PD. Transcriptional regulation ofgene expression in human skeletal muscle during recovery from exercise.Am J Physiol Endocrinol Metab 2000;279:E806–E814
42. Williams RS, Neufer PD. Regulation of gene expression in skeletal muscleby contractile activity. In The Handbook of Physiology. Exercise: Regu-lation and Integration of Multiple Systems. Bethesda, MD, AmericanPhysiological Society, 1996, p. 1124–1150
43. Krogh-Madsen R, Thyfault JP, Broholm C, et al. A 2-wk reduction of am-bulatory activity attenuates peripheral insulin sensitivity. J Appl Physiol2010;108:1034–1040
44. Thong FS, Dugani CB, Klip A. Turning signals on and off: GLUT4 traf!cin the insulin-signaling highway. Physiology (Bethesda) 2005;20:271–284
45. Chasiotis D, Sahlin K, Hultman E. Regulation of glycogenolysis in humanmuscle in response to epinephrine infusion. J Appl Physiol 1983;54:45–50
46. Cohen P. The structure and regulation of protein phosphatases. Annu RevBiochem 1989;58:453–508
47. Nielsen JN, Wojtaszewski JF. Regulation of glycogen synthase activity andphosphorylation by exercise. Proc Nutr Soc 2004;63:233–237
48. Jensen J, Jebens E, Brennesvik EO, et al. Muscle glycogen inharmoniouslyregulates glycogen synthase activity, glucose uptake, and proximal insulinsignaling. Am J Physiol Endocrinol Metab 2006;290:E154–E162
49. Nielsen JN, Derave W, Kristiansen S, Ralston E, Ploug T, Richter EA. Gly-cogen synthase localization and activity in rat skeletal muscle is stronglydependent on glycogen content. J Physiol 2001;531:757–769
50. Danforth WH. Glycogen synthetase activity in skeletal muscle. In-terconversion of two forms and control of glycogen synthesis. J Biol Chem1965;240:588–593
R.S. BIENSØ AND ASSOCIATES
diabetes.diabetesjournals.org DIABETES, VOL. 61, MAY 2012 1099
![Page 95: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/95.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE
3A. Co-authorship statement
All papers/manuscripts with multiple authors enclosed as annexes to a PhD thesis synopsisshould contain a co-author statement, stating the PhD student's contribution to the paper.
, . r . r '
. : . : . . , . : , . . : . r . . .
Regulation of PDH, GS and insulin signalling in skeletal muscle; effect of physical activity level and inflammation
3.This eo-authorship declaration applies to the following paper
GLUT4 and glycogen synthase are key players in bed rest-induced insulin resistance
The extent of the PhD student's contribution to the article is assessed on the following scale
A. has contributed to the work (0-33%)
B. has made a substantial contribution (34-66%)
C. did the majority of the work independently (67-100%).
PhD student
NameRasmus SjOrup BiensoCiv.reg.no. (lf not applicoble, then birth date)[email protected] of Biology
Pleose morkPhD Scheme
x 5+3 Scheme 4+4 Scheme Industr ial PhD
Principal supervisor
NameHenriette PilegaardE-mai [email protected]
Ll4Revised 29 Jonuory 2073
![Page 96: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/96.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE
4. Declaration on the individual elements Extent (A, B, C)
l. Formulation in the concept phase of the basic scientific problem on the basis of
theoretical questions which require clarification, including a summary of the general
questions which it is assumed will be answerable via analyses or concrete
experiments/investigations.
B
2. Planning of experiments/analyses and formulation of investigative methodology in
such a way that the questions asked under (l) can reasonably be expected to be
answered, including choice of method and independent methodological development. B
3. Involvement in the analysis or the concrete experiments/investigation.C
4. Presentation, interpretation and discussion of the results obtained in article form. C
5. Material in the paper from another degree / thesis :Articles/work published in connection with another degree/thesis must not form part of the PhD thesis.Data collected and preliminarywork carried out as part of another degree/thesis may be part af the PhD thesis if
further research, analysis andwriting are carried out as part of the PhD study.
Does the paper contain data material, which has also formed part of a previous degree / thesis(e.g. your masters degree)
Please indicate which degree / thesis: Master degree
Yes: E
No: t]
Percentage of the paper that
Percentage of the paper that
is from the PhD degree work
is from the other desree / thesis
%
%
Please indicate which specific part(-s) of the paper that has been produced as part of the PhD study:
6.Signatu res of co-authors:
Date Name Signature
Stine Ringholm Jorgensen
Kristian Kiilerich l . " o '
,|'niu*t" L{i Lu.*-"-,
13n-20t4Niels Jacob Aachmann-Andersen
2/4Revised 29 Januory 2013
![Page 97: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/97.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE
Rikke Krogh-Madsen
20140r04 Boja Guerra
Peter Plomgaard
13.01 .2014 Genit van Hall
1301.2014 Jonas Thue Treebak
08.01.2014 Bengt Saltin
Carsten Lundby
I
02-01-2014 Jose Antonio Calbet
Henriette Pilegaard ?4J argen Frank Pind Wojtaszewski dul&b'
T.Signature
By signing the document, the PhD student hereby declares that the above information is correct.
' ) / - 1
phD stude n. '/(q.c
ru^ ,5 ,*tt 6 ,'",-, / Date: o ) a'2 zc I y'
Signature " r
@d'mm'YYYY)
3/4Revised 29 Jonuary 2073
![Page 98: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/98.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE
When completed, the form should be sent to the relevant department's PhD secretary who on your behalf willfolward it to the PhD School ([email protected]).
To find your departments PhD secretory, please see:
http:'/www.science.ku.dk/english/research /phd/student/contact,
414Revised 29 Jonuory 2O73
![Page 99: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/99.jpg)
Study II
Biensø RS, Olesen J, Gliemann L, Smith JF, Matzen MS, Wojtaszewski JFP, Hellsten Y,
Pilegaard H. Effects of exercise training on regulation of skeletal muscle glucose metabolism in
skeletal muscle of elderly men. Submitted Journal of Gerontology: Medical Scinces 2014
![Page 100: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/100.jpg)
1
Effects of exercise training on regulation of skeletal muscle glucose
metabolism in skeletal muscle of elderly men
1Rasmus Sjørup Biensø, 1Jesper Olesen, 2Lasse Gliemann, 2Jacob Friis Smith, 1Mikkel Sillesen Matzen, 2Jørgen F. P. Wojtaszewski, 2Ylva Hellsten, 1Henriette Pilegaard
1Centre of Inflammation and Metabolism, The August Krogh Centre, Molecular Integrative Physiology Department of Biology, University of Copenhagen
2The August Krogh Centre, Department of Nutrition, Exercise and Sports, University of Copenhagen
Short title: Skeletal muscle glucose regulation in elderly
Key word: Physical activity, aging, pyruvate dehydrogenase, glycogen synthase, insulin signaling
Corresponding author: Henriette Pilegaard
Universitetsparken 13
2100 Copenhagen Ø,
Email: [email protected]
Telephone:+4535321687
Fax:+4535321567
![Page 101: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/101.jpg)
2
Abstract
BACKGROUND: The aim was to investigate the molecular mechanisms behind exercise training-
induced improvements in glucose regulation in aged subjects, METHODS: Twelve elderly males
completed 8 weeks of exercise training. Before and after the training period, the subjects were given
an oral glucose tolerance test (OGTT) and a muscle biopsy was obtained from the vastus lateralis
before and 45 min into the OGTT. Blood samples were collected before and up to 120 min after
glucose intake. RESULTS: exercise training increased Hexokinase II, GLUT4, Akt2, glycogen
synthase (GS), pyruvate dehydrogenase (PDH)-E1 and PDK2 protein and glycogen content in
skeletal muscle. Furthermore, in response to glucose GS activity was increased and the
dephosphorylation on GS site 2+2a and 3a was enhanced after the training intervention. The
glucose-mediated insulin stimulation of TBC1D4 Thr642 phosphorylation was increased. The PDHa
activity was reduced following glucose intake and without changes in phosphorylation level on
PDH-E1. CONCLUSIONS: This suggests that exercise training improves glucose regulation in
elderly subjects by enhancing the capacity for glucose uptake and improving glycogen storage
rather than oxidation.
![Page 102: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/102.jpg)
3
Introduction
Aging is associated with impaired glucose metabolism as demonstrated both by reduced glucose
tolerance during an oral glucose tolerance test [1] and reduced glucose disposal during a
hyperinsulinemic euglycemic clamp [2;3]. Such changes may pre-dispose to diseases like Type 2
diabetes [4] and prevention of age-related dysfunctional glucose metabolism through physical
activity is therefore important. Regular physical activity has been shown to increase glucose
tolerance [1;5] and insulin sensitivity in elderly subjects [3] to a similar extent as in young subjects
[6;7]. Aging and exercise training associated changes in glucose tolerance and insulin sensitivity
involve several tissues, but changes in skeletal muscle metabolism have a particularly large impact
on whole body metabolism [8].
Insulin-stimulated glucose uptake in skeletal muscle involves glucose transporter (GLUT)4
translocation to the plasma membrane regulated through phosphorylation and activation of Akt and
concomitant phosphorylation and inactivation of Akt substrate of 160 kD (AS160/TBC1D4) [9]. G-
6-P will in a resting muscle cell either be incorporated into glycogen or be oxidized within the
mitochondria. The rate limiting enzyme in glycogen formation is glycogen synthase (GS), while the
pyruvate dehydrogenase (PDH) complex converts pyruvate to acetyl CoA in an irreversible step,
which represents the only entry of carbohydrate-derived substrates into the mitochondria for
oxidation [10]. GS is stimulated allosterically by G-6-P [11] and inactivated by phosphorylation
[12;13] Insulin is known to increase the activity of GS through insulin-stimulated activation of Akt
and concomitant phosphorylation and inactivation of GSK3[12;13]. Activity of PDH in the active
form (PDHa) is primarily determined by the phosphorylation level of the PDH-E1α subunit
regulated by PDH kinases (PDK), which phosphorylate and inactivate PDH, and PDH phosphatases
(PDP), which dephosphorylate and activate PDH [14;15]. PDHa activity has previously been shown
![Page 103: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/103.jpg)
4
to increase in human skeletal muscle in response to oral glucose intake [16], and to either increase
[17] or remain unchanged [18] during a hyperinsulinemic euglycemic clamp in humans. In
accordance with an insulin-mediated regulation of PDHa activity, insulin has been reported to
increase PDP activity [19] and to reduce PDK4 protein in rat skeletal muscle [20].
Previous studies have observed either reduced or unchanged GLUT4 [21;22] protein content in
human skeletal muscle with increasing age. Moreover, the recent finding that aging was associated
with impaired insulin-induced TBC1D4 phosphorylation in skeletal muscle [2] suggests that
reduced insulin-mediated GLUT4 translocation may contribute to insulin resistance in aged
subjects. Furthermore, skeletal muscle HKII activity has been shown to be lower in elderly than in
young subjects [23] indicating that a reduced ability to maintain the transmembrane glucose
gradient also may affect skeletal muscle glucose uptake in aged subjects. Knowledge about
potential age-related effects on GS and PDH regulation in skeletal muscle is scarce. However total
GS activity has been reported to be reduced with age [24]. Moreover insulin-stimulated GS
activation has been demonstrated to be impaired in Type 2 diabetic (T2D) patients [22;25].
Similarly, an insulin-induced increase in PDHa activity has been reported to be abolished in Type 2
diabetes patients [17]. In line with this observation, T2D has been shown to be associated with
impaired insulin-mediated down-regulation of PDK4 in skeletal muscle suggesting that PDK4-
induced inhibition of PDH and hence inhibition of glucose oxidation may contribute to insulin
resistance [26]. Together, this indicates that both oxidative and non-oxidative glucose removal are
reduced in skeletal muscle of T2D patients. This may suggest that GS and PDH dysregulation also
contributes to age-associated glucose intolerance and insulin resistance.
Exercise training has previously been shown to increase skeletal muscle protein content of GLUT4,
HKII, Akt, TBC1D4, GS, PDK2 and PDH-E1α in young subjects [7;22;27] and similarly for
GLUT4 and Akt2, but not TBC1D4 in elderly subjects [2;28]. Furthermore, exercise training has
![Page 104: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/104.jpg)
5
been demonstrated to enhance insulin-mediated TBC1D4 and GS regulation in young subjects as
well as to reverse the age-associated impairment of insulin-stimulated TBC1D4 phosphorylation
[2;22].
Therefore, the purpose of the present study was to test the hypotheses that exercise training-induced
improvements in whole body glucose metabolism in elderly men are associated with increased
content of key factors involved in GS and PDH regulation in skeletal muscle, and enhanced acute
regulation of GS and PDH in skeletal muscle upon glucose intake.
![Page 105: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/105.jpg)
6
Methods
Results from the current experiment have previously been published [29]
Subjects. Twelve physically inactive but healthy male subjects 60-72 years of age with a average
body mass index 26.0±0.5 participated in the study. Subject characteristics have previously been
published [29] including fasting glucose (5.3±0.1 mmol/l) and fasting blood insulin concentration
(49.3±12 pmol/l) [29].
Exercise training. The subjects exercise trained for 8 weeks, 4 days a week as previously described
[29]. The training was a combination of high intensity cycling exercise (Spinning) 2 times per
week, strength and mobility training (crossfit) once per week and a 5 km walk once a week.
Experimental setup. Before and after the intervention period, the subjects were challenged with an
oral glucose tolerance test (OGTT; 1g·kg-1 body mass). A muscle biopsy was obtained from vastus
lateralis using the Bergström needle biopsy method with suction and blood samples were obtained
before and up to 2h after (see supplementary for details),
Plasma and muscle analyses: see supplementary
Statistics: see supplementary
![Page 106: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/106.jpg)
7
Results
Performance
Exercise training increased (p<0.05) VO2max as previously published [29].
Blood analyses
Fasting glucose and insulin
Fasting plasma insulin and plasma glucose concentrations were not different before and after the 8
weeks of exercise training as in part previously reported [29].
OGTT
Plasma glucose: The plasma glucose response during the OGTT was similar in the untrained and
trained state increasing (p<0.05) in both conditions to approximately 8 mM 30 min after glucose
intake and returning to the basal level (5 mM) at 120 min after intake. There was no difference in
the plasma glucose concentration between the untrained and the trained state (Fig 1A).
Plasma Insulin: The plasma insulin concentration increased (p<0.05) ~10 fold 60 min after the
glucose intake and remained elevated (p<0.05) 120 min after intake relative to before both in the
untrained and trained state. Moreover, the plasma insulin concentration was at 15 min after glucose
intake higher (p<0.05) and at 90 and 120 min lower (p<0.05) in the trained than in the untrained
state (Fig 1B). The insulin AUC was 15% lower (p<0.05) after exercise training than before
exercise training. There was no difference in the HOMA-IR index before and after exercise training.
Plasma C-peptide: The plasma C-peptide concentration increased (p<0.05) similarly in the
untrained and trained state to 5 fold at 60 min after glucose intake and remained in both conditions
elevated (p<0.05) at 120 min relative to before intake. Moreover, as for the plasma insulin
![Page 107: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/107.jpg)
8
concentration, the C-peptide concentration was at 90 and 120 min after glucose intake lower
(p<0.05) in the trained than in the untrained state (Fig 1C). The C-peptide AUC was 15% lower
(p<0.05) after exercise training than before.
Muscle analyses
Muscle glycogen
The muscle glycogen concentration increased (p<0.05) from 496±29 mmol·kg-1dw before to
686±43 mmol·kg-1dw after exercise training.
Protein content
Skeletal muscle protein content of GLUT4, Akt2, GS, PDK2 and PDH-E1 (all p<0.05) and HKII
(0.05≤p<0.1) increased 1.2 to 1.8 fold with exercise training. There was no difference in Akt1,
TBC1D4, GSK-3 or PDK4 protein content before and after exercise training (Fig 2).
Intracellular signaling
Akt phosphorylation: Forty five min after glucose intake, the absolute Akt Thr308 phosphorylation
increased (p<0.05) 2.8 and 3.7 fold in the untrained and trained skeletal muscle, respectively, with
no difference between training status (Fig 3A). Insulin-stimulated Akt phosphorylation occurs
primarily if not exclusive on Akt2 in human skeletal muscle [36], The absolute phosphorylation on
Akt Ser473 increased (p<0.05) 2.1 and 3 fold in the untrained and trained state, respectively,
reaching a 2 fold higher (p<0.05) level in the trained than untrained state (Fig 3B)
![Page 108: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/108.jpg)
9
TBC1D4 phosphorylation: The absolute TBC1D4 Thr642 phosphorylation in skeletal muscle
increased (p<0.05) 1.8 fold in the untrained state and 2.5 fold in the trained state reaching a higher
(p<0.05) level in the trained than the untrained condition (Fig 3C).
GSK3β phosphorylation: Absolute GSK3β Ser9 phosphorylation in skeletal muscle increased
(p<0.05) similarly 1.3-1.4 fold 45 min after glucose intake before and after the exercise training
period with no difference between the two conditions (Fig 4A).
Glycogen synthase regulation
GS site 2+2a: Glucose intake had no effect on the absolute GS site 2+2a phosphorylation in skeletal
muscle before exercise training, but after exercise training the absolute GS site 2+2a
phosphorylation decreased (p<0.05) 20% in response to glucose intake. Furthermore, the absolute
GS site 2+2a phosphorylation was in the trained state 1.4 fold higher (p<0.05) in the basal state and
tended to be 1.2 fold higher (0.05≤p<0.1) 45 min after glucose intake than in the untrained state
(Fig 4B).
GS site 3a: The absolute GS site 3a phosphorylation in skeletal muscle tended to decrease
(0.05≤p<0.1) 25% in response to glucose intake before exercise training and decreased (p<0.05)
40% with glucose intake after exercise training. The absolute GS site 3a phosphorylation was 1.3-
1.7 fold higher (p<0.05) in the trained state than in the untrained state (Fig 4C).
GS activity: The GS activity (I-form) in skeletal muscle did not change with glucose intake before
exercise training, but increased (p<0.05) 1.3 fold 45 min after glucose intake in the exercise trained
state. There was no difference in GS activity between the untrained and trained state (Fig 4D).
PDH regulation
![Page 109: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/109.jpg)
10
PDH phosphorylation: There was no effect of glucose intake on the absolute or the normalized PDH
site 1 and site 2 phosphorylation in skeletal muscle. Exercise training increased (p<0.05) the
absolute phosphorylation level of both sites with 1.3-1-8 fold, but this effect was removed by
normalization to PDH-E1α protein, except for site 2 phosphorylation in the basal state (Fig 5A,Fig
5B; Supplementary Fig 3A; Fig 3B).
PDHa activity: There was no effect of glucose intake on skeletal muscle PDHa activity before
exercise training, but glucose intake decreased (p<0.05) the PDHa activity 30% after the exercise
training period (Fig 5C).
PDK4 protein:
PDK4 protein content overall (untrained and trained state together) tended to be lower (0.05≤p<0.1)
after glucose intake (Fig 6B).
![Page 110: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/110.jpg)
11
Discussion
The main findings of the present study are that exercise training-improved glucose regulation in
elderly healthy subjects was associated with increased HKII, GLUT4, Akt2, PDK2, GS and PDH-
E1 protein content. Moreover, exercise training resulted in an enhanced response of TBC1D4 and
GS and a reduced PDHa activity in response to glucose intake relative to before training.
The present observation that the plasma glucose response to an oral glucose intake was similar
before and after the exercise training period shows that glucose tolerance was unaffected by the
exercise training intervention. However, there was a strong indication of improved insulin
sensitivity after training in the present study as the insulin and C-peptide plasma concentrations as
well as AUC for insulin and C-peptide were lower during the OGTT after training than before. Such
an exercise training effect is in accordance with the observations in previous studies using
hyperinsulinemic euglycemic clamp in elderly subjects demonstrating enhanced whole body insulin
action [1;2] as well as improved insulin sensitivity in skeletal muscle after exercise training [2;6].
The finding in the current study that glucose intake induced a more marked absolute TBC1D4
phosphorylation after exercise training than before is in accordance with a recent study
demonstrating that aged subjects increased the insulin-stimulated TBC1D4 phosphorylation during
a hyperinsulinemic euglycemic clamp [2]. This indicates that exercise training enhances skeletal
muscle GLUT4 translocation upon glucose intake in elderly subjects as previously reported in
young subjects [2]. Although the effect of exercise training on TBC1D4 phosphorylation
normalized to TBC1D4 protein did not reach statistical significance in the present study, the lack of
change in TBC1D4 protein content with exercise training both in the present and the previous study
[2;22] suggests that the observed training effect on TBC1D4 phosphorylation upon glucose intake is
due to acute regulation rather than a change in TBC1D4 protein content. Although Akt Thr308
![Page 111: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/111.jpg)
12
phosphorylation after glucose intake was similar in the untrained and trained state, the present
observation that Akt Ser473 phosphorylation level after glucose intake was higher in the trained
muscle than the untrained is in line with the higher TBC1D4 phosphorylation after the training
period. This indicates that Akt mediate the exercise training effect on TBC1D4 phosphorylation in
the present study, which is different from previous findings [2] reporting that insulin-stimulated Akt
Ser473 phosphorylation could not explain the observed exercise training-induced changes in
TBC1D4 phosphorylation. This difference between the two studies may be related to the use of
hyperinsulinemic euglycemic clamp [2] and an oral glucose intake. In addition, the observed higher
plasma insulin concentration in the trained state than in the untrained 15 min after glucose intake
may have contributed to the enhanced Akt Ser473 response in the present study. The observed
increase in GLUT4 and HKII protein content with exercise training in the current study is in line
with previous studies showing that exercise training increases skeletal muscle GLUT4 protein
content in aged subjects [1;28]. Together these observations indicate that exercise training-induced
increased capacity for glucose transport and phosphorylation also contributes to improved
regulation of glucose uptake in elderly subjects.
The observation that glucose intake did not affect GS activity in the elderly subjects in the untrained
state is in contrast with previous observations in young subjects [16] suggesting an age-associated
impairment in GS regulation [24]. However, the finding that glucose intake induced an increase in
GS activity in the elderly subjects after the exercise training period in the present study may
indicate that exercise training restored the ability of the aged muscle to activate GS in response to
glucose intake.
The observation that glucose intake in the untrained state did not change GS site 2+2a
phosphorylation is in contrast to the previously observed GS site 2+2 dephosphorylation in skeletal
muscle of middle aged [25] and young subjects [24;25;31], but is in line with the unchanged GS
![Page 112: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/112.jpg)
13
activity in the present study. Furthermore, the observed dephosphorylation of GS site 2+2a in
response to glucose intake after the exercise training period is in accordance with the observed
increase in GS activity upon glucose intake in the exercise trained state. The present observation
that glucose uptake-stimulated phosphorylation of GSK-3β was similar before and after the exercise
training period suggests that a difference in GSK-3 is not a likely explanation for the changes in GS
regulation with exercise training. However, previous studies have indicated that GS site 2+2a
hyperphosphorylation may contribute to impairment of insulin-induced GS activation in T2D
patients [25] and in young subjects after 1 week of bed rest [31]. This suggests that the exercise
training-induced change in glucose intake-stimulated site 2+2a phosphorylation may explain the
associated changes in GS activation in the present study. The increased muscle glycogen
concentration with exercise training is a possible reason for the elevated level of GS 2+2a
phosphorylation after exercise training, because GS site 2+2a is regulated by the glycogen level
[37]. But the lack of change in muscle glycogen after glucose intake does not support that muscle
glycogen influenced the acute changes in GS site 2+2a phosphorylation in the present study.
The finding that PDHa activity was unaffected by the glucose intake in the untrained state is not in
accordance with the previously reported increase in PDHa activity in young subjects during an
OGTT [16]. It is possible that the elderly subjects in the present study had an impaired PDH
regulation in response to glucose intake in the untrained state, but this needs to be further
investigated. The finding that glucose intake even reduced skeletal muscle PDHa activity in the
trained state was unexpected and has not previously been reported. However, it may suggest that
downregulation of PDHa activity combined with an increased GS activity after glucose intake in the
trained state serves to reduce carbohydrate oxidation ensuring that carbohydrate enters glycogenesis
rather than oxidation.
![Page 113: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/113.jpg)
14
The observation that the exercise training-induced elevation in basal PDH-E1α phosphorylation was
associated with a similar increase in PDH-E1α protein content indicates that the same fraction of
PDH-E1α molecules was phosphorylated in the trained and the untrained state. Furthermore, the
concomitant exercise training-induced increase in PDK2 protein suggests that the enhanced PDH-
E1α phosphorylation was executed by PDK2. In addition the observed overall tendency for
reduction in PDK4 protein in response to glucose intake may be expected to influence the
phosphorylation status of PDH-E1α and thus affect PDHa activity. However the lack of change in
PDH-E1α phosphorylation with glucose intake in the trained state shows that the regulation of
PDHa activity was independent of the phosphorylation status of site 1 and 2 on PDH-E1α. As PDH-
E1α has been shown to be phosphorylated on at least 2 further sites [38] as well as being regulated
by acetylation [38], additional post-translational modifications may explain the observed regulation
of PDHa activity in the trained state.
In conclusion, the present findings suggest that exercise training-improved glucose regulation in
elderly subjects is associated with enhanced potential for GLUT4 translocation, glucose
phosphorylation and intracellular glucose removal to glycogen synthesis rather than oxidation.
![Page 114: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/114.jpg)
15
Funding
This work was supported by grants from the Ministry of Culture. The Centre of Inflammation and
Metabolism (CIM) is supported by a grant from the Danish National Research Foundation
(DNRF55). The Centre for Physical Activity Research (CFAS) is supported by a grant from
Trygfonden. CIM is part of the UNIK Project: Food, Fitness & Pharma for Health and Disease,
supported by the Danish Ministry of Science, Technology.
Acknowledgement
We would like to thank Ninna Iversen, Marie Henriksen, Line Nielsen, Simon Granjean and
Sebastian Peronard for technical assistance. The authors are grateful to Oluf Pedersen (University of
Copenhagen), Graham Hardie and Carol Mackintosh (Dundee University) for donating antibodies
essential for this study.
![Page 115: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/115.jpg)
16
Reference List
1 Hughes VA, Fiatarone MA, Fielding RA, Kahn BB, Ferrara CM, Shepherd P, Fisher EC, Wolfe RR, Elahi D, Evans WJ: Exercise increases muscle GLUT-4 levels and insulin action in subjects with impaired glucose tolerance. Am J Physiol 1993;264:E855-E862.
2 Consitt LA, Van MJ, Newton CA, Collier DN, Dar MS, Wojtaszewski JF, Treebak JT, Tanner CJ, Houmard JA: Impairments in Site-Specific AS160 Phosphorylation and Effects of Exercise Training. Diabetes 2013;62:3437-3447.
3 Dela F, Mikines KJ, Larsen JJ, Galbo H: Training-induced enhancement of insulin action in human skeletal muscle: the influence of aging. J Gerontol A Biol Sci Med Sci 1996;51:B247-B252.
4 Defronzo RA, Tripathy D: Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care 2009;32 Suppl 2:S157-S163.
5 Houmard JA, Egan PC, Neufer PD, Friedman JE, Wheeler WS, Israel RG, Dohm GL: Elevated skeletal muscle glucose transporter levels in exercise-trained middle-aged men. Am J Physiol 1991;261:E437-E443.
6 Dela F, Mikines KJ, Von LM, Secher NH, Galbo H: Effect of training on insulin-mediated glucose uptake in human muscle. Am J Physiol 1992;263:E1134-E1143.
7 Frosig C, Rose AJ, Treebak JT, Kiens B, Richter EA, Wojtaszewski JF: Effects of endurance exercise training on insulin signaling in human skeletal muscle: interactions at the level of phosphatidylinositol 3-kinase, Akt, and AS160. Diabetes 2007;56:2093-2102.
8 Tsintzas K, Norton L, Chokkalingam K, Nizamani N, Cooper S, Stephens F, Billeter R, Bennett A: Independent and combined effects of acute physiological hyperglycaemia and hyperinsulinaemia on metabolic gene expression in human skeletal muscle. Clin Sci (Lond) 2013;124:675-684.
9 Cartee GD, Wojtaszewski JF: Role of Akt substrate of 160 kDa in insulin-stimulated and contraction-stimulated glucose transport. Appl Physiol Nutr Metab 2007;32:557-566.
10 Randle PJ, Garland PB, Newsholme EA, Hales CN: The glucose fatty acid cycle in obesity and maturity onset diabetes mellitus. Ann N Y Acad Sci 1965;131:324-333.
11 Roach PJ, Takeda Y, Larner J: Rabbit skeletal muscle glycogen synthase. I. Relationship between phosphorylation state and kinetic properties. J Biol Chem 1976;251:1913-1919.
12 Skurat AV, Roach PJ: Phosphorylation of sites 3a and 3b (Ser640 and Ser644) in the control of rabbit muscle glycogen synthase. J Biol Chem 1995;270:12491-12497.
13 Skurat AV, Dietrich AD, Roach PJ: Glycogen synthase sensitivity to insulin and glucose-6-phosphate is mediated by both NH2- and COOH-terminal phosphorylation sites. Diabetes 2000;49:1096-1100.
14 Randle PJ, Sugden PH, Kerbey AL, Radcliffe PM, Hutson NJ: Regulation of pyruvate oxidation and the conservation of glucose. Biochem Soc Symp 1978;47-67.
![Page 116: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/116.jpg)
17
15 Yeaman SJ, Hutcheson ET, Roche TE, Pettit FH, Brown JR, Reed LJ, Watson DC, Dixon GH: Sites of phosphorylation on pyruvate dehydrogenase from bovine kidney and heart. Biochemistry 1978;17:2364-2370.
16 Pehleman TL, Peters SJ, Heigenhauser GJ, Spriet LL: Enzymatic regulation of glucose disposal in human skeletal muscle after a high-fat, low-carbohydrate diet. J Appl Physiol (1985 ) 2005;98:100-107.
17 Mandarino LJ, Consoli A, Kelley DE, Reilly JJ, Nurjhan N: Fasting hyperglycemia normalizes oxidative and nonoxidative pathways of insulin-stimulated glucose metabolism in noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab 1990;71:1544-1551.
18 Nellemann B, Vendelbo MH, Nielsen TS, Bak AM, Hogild M, Pedersen SB, Bienso RS, Pilegaard H, Moller N, Jessen N, Jorgensen JO: Growth hormone-induced insulin resistance in human subjects involves reduced pyruvate dehydrogenase activity. Acta Physiol (Oxf) 2013.
19 Huang B, Wu P, Popov KM, Harris RA: Starvation and diabetes reduce the amount of pyruvate dehydrogenase phosphatase in rat heart and kidney. Diabetes 2003;52:1371-1376.
20 Wu P, Sato J, Zhao Y, Jaskiewicz J, Popov KM, Harris RA: Starvation and diabetes increase the amount of pyruvate dehydrogenase kinase isoenzyme 4 in rat heart. Biochem J 1998;329 ( Pt 1):197-201.
21 Cox JH, Cortright RN, Dohm GL, Houmard JA: Effect of aging on response to exercise training in humans: skeletal muscle GLUT-4 and insulin sensitivity. J Appl Physiol (1985 ) 1999;86:2019-2025.
22 Vind BF, Pehmoller C, Treebak JT, Birk JB, Hey-Mogensen M, Beck-Nielsen H, Zierath JR, Wojtaszewski JF, Hojlund K: Impaired insulin-induced site-specific phosphorylation of TBC1 domain family, member 4 (TBC1D4) in skeletal muscle of type 2 diabetes patients is restored by endurance exercise-training. Diabetologia 2011;54:157-167.
23 Pastoris O, Boschi F, Verri M, Baiardi P, Felzani G, Vecchiet J, Dossena M, Catapano M: The effects of aging on enzyme activities and metabolite concentrations in skeletal muscle from sedentary male and female subjects. Exp Gerontol 2000;35:95-104.
24 Poulsen P, Wojtaszewski JF, Petersen I, Christensen K, Richter EA, Beck-Nielsen H, Vaag A: Impact of genetic versus environmental factors on the control of muscle glycogen synthase activation in twins. Diabetes 2005;54:1289-1296.
25 Højlund K, Staehr P, Hansen BF, Green KA, Hardie DG, Richter EA, Beck-Nielsen H, Wojtaszewski JF: Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes. Diabetes 2003;52:1393-1402.
26 Rosa G, Di RP, Manco M, Greco AV, Castagneto M, Vidal H, Mingrone G: Reduced PDK4 expression associates with increased insulin sensitivity in postobese patients. Obes Res 2003;11:176-182.
27 Leblanc PJ, Peters SJ, Tunstall RJ, Cameron-Smith D, Heigenhauser GJ: Effects of aerobic training on pyruvate dehydrogenase and pyruvate dehydrogenase kinase in human skeletal muscle. J Physiol 2004;557:559-570.
![Page 117: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/117.jpg)
18
28 Dela F, Ploug T, Handberg A, Petersen LN, Larsen JJ, Mikines KJ, Galbo H: Physical training increases muscle GLUT4 protein and mRNA in patients with NIDDM. Diabetes 1994;43:862-865.
29 Gliemann L, Schmidt JF, Olesen J, Bienso RS, Peronard SL, Grandjean SU, Mortensen SP, Nyberg M, Bangsbo J, Pilegaard H, Hellsten Y: Resveratrol blunts the positive effects of exercise training on cardiovascular health in aged men. J Physiol 2013;591:5047-5059.
30 Passonneau JV, Lauderdale VR: A comparison of three methods of glycogen measurement in tissues. Anal Biochem 1974;60:405-412.
31 Bienso RS, Ringholm S, Kiilerich K, Aachmann-Andersen NJ, Krogh-Madsen R, Guerra B, Plomgaard P, van HG, Treebak JT, Saltin B, Lundby C, Calbet JA, Pilegaard H, Wojtaszewski JF: GLUT4 and glycogen synthase are key players in bed rest-induced insulin resistance. Diabetes 2012;61:1090-1099.
32 Cederblad G, Carlin JI, Constantin-Teodosiu D, Harper P, Hultman E: Radioisotopic assays of CoASH and carnitine and their acetylated forms in human skeletal muscle. Anal Biochem 1990;185:274-278.
33 Constantin-Teodosiu D, Cederblad G, Hultman E: A sensitive radioisotopic assay of pyruvate dehydrogenase complex in human muscle tissue. Anal Biochem 1991;198:347-351.
34 Putman CT, Spriet LL, Hultman E, Lindinger MI, Lands LC, McKelvie RS, Cederblad G, Jones NL, Heigenhauser GJ: Pyruvate dehydrogenase activity and acetyl group accumulation during exercise after different diets. Am J Physiol 1993;265:E752-E760.
35 Højlund K, Birk JB, Klein DK, Levin K, Rose AJ, Hansen BF, Nielsen JN, Beck-Nielsen H, Wojtaszewski JF: Dysregulation of glycogen synthase. J Clin Endocrinol Metab 2009;94:4547-4556.
36 Vind BF, Birk JB, Vienberg SG, Andersen B, Beck-Nielsen H, Wojtaszewski JF, Hojlund K: Hyperglycaemia normalises insulin action on glucose metabolism but not the impaired activation of AKT and glycogen synthase in the skeletal muscle of patients with type 2 diabetes. Diabetologia 2012;55:1435-1445.
37 Friedrichsen M, Birk JB, Richter EA, Ribel-Madsen R, Pehmoller C, Hansen BF, Beck-Nielsen H, Hirshman MF, Goodyear LJ, Vaag A, Poulsen P, Wojtaszewski JF: Akt2 influences glycogen synthase activity in human skeletal muscle through regulation of NH(2)-terminal (sites 2 + 2a) phosphorylation. Am J Physiol Endocrinol Metab 2013;304:E631-E639.
38 Gnad F, Gunawardena J, Mann M: PHOSIDA 2011: the posttranslational modification database. Nucleic Acids Res 2011;39:D253-D260.
![Page 118: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/118.jpg)
19
Fig. 1. Plasma glucose (A), plasma insulin (B) and plasma C-peptide (C) during a 120 min oral
glucose tolerance test in untrained (UT) (●) and exercise trained (T) (○) aged male subjects,. *:
Significantly different from before glucose intake OGTT, p<0.05. #: Significantly different from
UT, p<0.05. Symbols within parentheses indicate tendency for statistical significance, 0.05≤p<0.1.
Fig. 2. Skeletal muscle protein content of hexokinase (HK)II, glucose transporter (GLUT)4, protein
kinase B(Akt)1, Akt2, TBC1D4, glycogen synthase (GS), pyruvate dehydrogenase (PDH)-E1 and
glycogen synthase kinase (GSK)3 in untrained (UT) and exercise trained (T). # Significantly
different from UT, p<0.05. Symbols within parentheses indicate tendency for statistical
significance, 0.05≤p<0.1.
Fig. 3. Skeletal muscle Akt Thr308 phosphorylation (A), Akt Ser473 (B) and TBC1D4 Thr642
phosphorylation (C) and glycogen synthase kinase (GSK)-3 Ser9 phosphorylation (D) before (Pre)
and 45 min into and oral glucose tolerance test (Post) in skeletal muscle of untrained (Untrained)
and exercise trained (Trained) aged male subjects. *: Significantly different from Pre p<0.05. #:
Significantly different from UT, p<0.05.
Fig. 4. Skeletal muscle Glycogen synthase (GS) site 2+2a phosphorylation (A), GS site 3a
phosphorylation (B) and GS activity (I-form) (C) before (Pre) and 45 min into and oral glucose
tolerance test (Post) in untrained (Untrained) and exercise trained (Trained) aged male subjects. *:
Significantly different from Pre p<0.05, #: Significantly different from UT, p<0.05. Symbols within
parentheses indicate tendency for statistical significance, 0.05≤p<0.1.
![Page 119: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/119.jpg)
20
Fig. 5. Skeletal muscle pyruvate dehydrogenase (PDH) site 1 phosphorylation (A), PDH site 2
phosphorylation (B) and PDH activity in the active form (C) before (Pre) and 45 min into and oral
glucose tolerance test (Post) in skeletal muscle of untrained (Untrained) and exercise trained
(Trained) aged male subjects. *: Significantly different from Pre p<0.05, #: Significantly different
from UT, p<0.05. Symbols within parentheses indicate tendency for statistical significance,
0.05≤p<0.1.
Fig. 6. Skeletal muscle pyruvate dehydrogenase kinase (PDK)2 (A) and PDK4 (B) before (Pre) and
45 min into and oral glucose tolerance test (Post) in untrained (Untrained) and exercise trained
(Trained) aged male subjects. *: Significantly different from Pre p<0.05, #: Significantly different
from UT, p<0.05. Symbols within parentheses indicate tendency for statistical significance,
0.05≤p<0.1.
Fig.7 Representative blots before (B) and 45 min into and oral glucose tolerance test (G) in skeletal
muscle of untrained (UT) and exercise trained (T) subjects.
![Page 120: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/120.jpg)
Time (min)0 20 40 60 80 100 120
Pla
sma
gluc
ose
(mm
ol/l)
0
2
4
6
8
10
UT T
(#)*
*
*
*
*
**
*
Time (min)0 20 40 60 80 100 120
Pla
sma
insu
lin (p
mol
/l)
0
200
400
600
800
1000
#
#
#
*
*
*
*
*
* *
*
*
**
*
Time (min)0 20 40 60 80 100 120
Plas
ma
C-p
eptid
e (p
mol
/l)
0
500
1000
1500
2000
2500
3000
3500
4000#
#
*
**
**
*
*
**
* **
Fig.1
A)
B)
C)
![Page 121: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/121.jpg)
Pro
tein
con
tent
(AU
.)
0.0
0.5
1.0
1.5
2.0
2.5 UTT
(#)
#
#
##
HKII GLUT4 Akt1 Akt2 TBC1D4 GS PDH-E1 GSK-3
Fig. 2
![Page 122: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/122.jpg)
Untrained Trained
Akt S
er47
3 pho
spho
ryla
tion
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
*
*#
Untrained Trained
Akt T
hr30
8 pho
spho
ryla
tion
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8 Pre Post
*
*
Fig. 3
A)
Untrained Trained
TBC
1D4
Thr64
2 pho
spor
ylat
ion
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
*
*#
C)
C) Untrained Trained
GSK
3- S
er9 p
hosp
hory
latio
n (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
**
B)
D)
![Page 123: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/123.jpg)
Untrained Trained
GS
site
3a
phos
phor
ylat
ion
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
*
*#
#
Untrained Trained
GS
activ
ity (
I-for
m)
0
5
10
15
20
25
30
*
Untrained Trained
GS
site
2+2
a ph
osph
oryl
atio
n (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4 Pre Post
*
#(#)
Fig. 4
A)
B)
C)
![Page 124: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/124.jpg)
Untrained Trained
PDH
site
1 p
hosp
hory
latio
n (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4Pre Post
(#) #
Untrained Trained
PDH
site
2 p
hosp
hory
latio
n (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
##
Fig.5
A)
B)
Untrained Trained
PDH
a ac
tivity
/ to
tal C
r (m
mol
·kg-1
·min
-1)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
*
C)
![Page 125: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/125.jpg)
Untrained Trained
PDK2
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2 Pre Post
# #
Fig.6
A)
Untrained Trained
PD
K4
prot
ein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0 (*)B)
![Page 126: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/126.jpg)
GS site 3a
TBC1D4 Thr642
GAPDH
HKII
PDH site 2
GLUT4
PDK4
PDH-E1
GSK-3 Ser9
GSK-3
GS site 2+2a AKT2
Akt Thr308
PDH site 1 GS total
Akt1
TBC1D4
UT UT T T B G B G
UT UT T T B G B G 50 kD
37 kD
150kD 100 kD
50 kD 37 kD
75 kD 50 kD
75 kD 50 kD
250 kD 150 kD
100 kD 75 kD
50 kD 37 kD
50 kD 37 kD
75 kD 60 kD
50 kD 37 kD
250 kD 150 kD
100 kD 75 kD
100 kD 75 kD
50 kD 37 kD
50 kD 37 kD
50 kD 37 kD
75 kD 60 kD
Akt Ser473
50 kD 37 kD
PDK2
Fig.7
![Page 127: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/127.jpg)
Supplemenray methods
Ethics: The subjects were informed of the risk and discomfort associated with the experimental
protocol and provided oral and written consent to participate. The study was approved by the Ethics
Committee of Copenhagen and Frederiksberg communities (H-2-2011-079) and was conducted in
accordance with the guidelines of the Declaration of Helsinki.
Experimental setup. The subject arrived to the laboratory after 10-12h of fasting and 24h after the
last exercise session. A venflon was inserted into an antecubital vein in the forearm and a blood
sample was taken. The glucose beverage was ingested within 4 min and additional blood samples
were obtained 15 min, 30 min, 45 min, 60 min, 90 min and 120 min after the glucose intake and a
second biopsy 45 min after the glucose intake. The incisions for the biopsy needles were made
under local anesthesia (lidocain; AstraZeneca, Södertälje, Sweden) and new incisions were made
for each biopsy. Superficial blood was quickly removed from the biopsies, which were frozen in
liquid nitrogen within 20 seconds and stored at -80°C.
Blood parameters: The blood plasma was analyzed for glucose, insulin and C-peptide
concentrations at Department of Clinical Biochemistry at Rigshospitalet, Copenhagen, Denmark.
Muscle analyses
Muscle biopsies. Each muscle biopsy was cut in smaller pieces for determination of PDHa activity
and the rest was freeze-dried for at least 48h. The freeze-dried samples were dissected free of blood,
fat and connective tissue under the microscope.
Muscle glycogen. The muscle glycogen concentration was determined as previously described [30]
![Page 128: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/128.jpg)
SDS-PAGE and western blotting. The freeze-dried muscle tissue was homogenized using a Tissue
LyserII (Qiagen, Hilden, Germany) and muscle lysate was prepared as previously described [31].
SDS-PAGE and western blotting were performed as previously described [31] using hand casted
gels. Protein and phosphorylation levels were determined in muscle lysate using antibodies towards
HKII, GSK-3 Ser9, GSK-3, Akt Ser473, Akt1 and Akt2 (#2867, #9323, #9315, #9271, #2967,
#3063 respectively; Cell Signaling Technology, Berverly, MA, USA), GLUT4 (#998-101; ABR,
Golden, CO, USA), PDK2 (#ST1643, Millipore, Billerica, MA, USA), Akt Thr308 (#05-669,
Upstate Biotechnology, Lake Placid, NY, USA), TBC1D4 (#AB24469; Abcam, Cambridge, MA,
USA), TBC1D4 Thr642 (#3028 p1; Symansis, New Zealand) as well as PDH site1 (Ser293), PDH site
2 (Ser300) phosphorylation, PDH-E1 and PDK4 (provided by Graham Hardie, Dundee University,
Dundee, U.K) or in muscle homogenate using antibodies towards GS 2+2a, GS 3a (provided by
Graham Hardie) and GS (provided by Oluf Pedersen, University of Copenhagen, Denmark). The
bands on the membranes were visualized with ECL reagent (Millipore, Billerica, MA, USA) in a
digital image system (GE healthcare, München, DE).
PDHa activity. PDHa activity in each sample was determined in muscle homogenate as previously
described [32-34].
GS activity. GS activity in each sample was determined in muscle homogenate as previously
described [35]
Statistics. Values are presented as mean ± SE unless otherwise stated. A student paired t-test was
used to test the effect of exercise training on fasting plasma insulin and glucose as well as protein
content. Two-way ANOVA with repeated measures was used to test the effect of exercise training
and glucose intake on plasma glucose, insulin and c-peptide as well as skeletal muscle protein and
protein phosphorylation levels. When a main effect was observed, a Student-Newman-Keuls post
![Page 129: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/129.jpg)
hoc test was used to locate differences between groups if the data set was log transformed if the data
did not pass equal variance test. The data were considered significant at P<0.05 and a tendency is
reported when 0.05≤P<0.1. Statistical calculations were performed in SigmaPlot 11.0.
Supplementary Results
Plasma glucose
There was no difference in plasma glucose when comparing the area under the curve (AUC) for
glucose before and after the training intervention.
Intracellular signaling
GSK3β phosphorylation: Normalized GSK3β Ser9 phosphorylation in skeletal muscle increased
(p<0.05) similarly 1.3-1.4 fold 45 min after glucose intake before and after the exercise training
period with no difference between the two conditions (Fig 1A).
Akt phosphorylation: Akt Thr308 phosphorylation normalized to Akt2 protein content increased
(p<0.05) 2.5 fold after glucose intake both before and after exercise training with no difference
between the conditions (supplementary Fig 1B).
Akt Ser473 phosphorylation normalized to Akt2 protein increased (p<0.05) similarly 2.2 fold and 3.5
fold in the untrained and trained state, respectively, with no difference between training status
(supplementary Fig 1C).
TBC1D4 phosphorylation: TBC1D4 Thr642 phosphorylation normalized to TBC1D4 protein content
increased (p<0.05) similarly ~2.5 fold in response to glucose intake in the untrained and trained
![Page 130: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/130.jpg)
state with no difference in TBC1D4 phosphorylation level before and after exercise training
(supplementary Fig 1D.
Glycogen synthase regulation
GS site 2+2a: GS site 2+2a phosphorylation normalized to GS protein increased (p<0.05) ~1.8 fold
with glucose intake before exercise training, but was unchanged in response to glucose intake after
the exercise training period (Supplementary Fig 2A).
GS site 3a: GS site 3a phosphorylation normalized to GS protein showed a similar pattern as the
absolute phosphorylation level both in response to glucose intake and exercise training
(Supplementary Fig 2B).´
PDH regulation
PDH phosphorylation: There was no effect of glucose intake on the normalized PDH site 1 and site
2 phosphorylation in skeletal muscle. Exercise training had no effect on PDH phosphorylation when
normalization to PDH-E1α protein, except for site 2 phosphorylation in the basal state
(Supplementary Fig 3A, 3B).
Supplementary figure legends
Supplementary figure 1. Skeletal muscle protein kinase B (PKB/Akt) Thr308 normalized to Akt2
protein (A) Akt Thr473 normalized to Akt2 protein (B) glycogen synthase kinase (GSK)-3 Ser9
phosphorylation normalized to GSK3 protein (C) and TBC1D4 Thr642 phosphorylation normalized
![Page 131: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/131.jpg)
to TBC1D4 protein (D) before (Pre) and 45 min into and oral glucose tolerance test (Post) in
untrained (Untrained) and exercise trained (Trained) aged male subjects. *: Significantly different,
from Pre p<0.05, #: Significantly different from UT, p<0.05. Symbols within parentheses indicate
tendency for statistical significance, 0.05≤p<0.1.
Supplementary figure. 2. Skeletal muscle glycogen synthase (GS) site 2+2a phosphorylation
normalized to GS protein (A) and GS site 3a phosphorylation normalized to GS protein (B) before
(Pre) and 45 min into and oral glucose tolerance test (Post) in skeletal muscle of untrained
(Untrained) and exercise trained (Trained) aged male subjects. *: Significantly different, from Pre
p<0.05, #: Significantly different from UT, p<0.05. Symbols within parentheses indicate tendency
for statistical significance, 0.05≤p<0.1.
Supplementary figure.3. Skeletal muscle pyruvate dehydrogenase (PDH) site 1 phosphorylation
normalized to PDH-1Eα protein (A) and PDH site 2 phosphorylation normalized to PDH-1Eα
protein (B) before (Pre) and 45 min into and oral glucose tolerance test (Post) in untrained
(Untrained) and exercise trained (Trained) aged male subjects. #: Significantly different from UT,
p<0.05.
![Page 132: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/132.jpg)
Untrained Trained
Akt
Ser
473 p
hosp
hory
latio
n / A
kt2
prot
ein
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
**
Untrained Trained
TBC
1D4
Thr64
2 pho
spho
ryla
tion
/ TBC
1D4
prot
ein(
AU)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
*
*
Untrained TrainedGSK
3 S
er9 p
hosp
hory
latio
n / G
SK3
pro
tein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0 Pre Post
*
*
A)
C)
Supplementary fig. 1
Untrained TrainedAKT
Thr30
8 pho
spho
ryla
tion
/ Akt
2 pr
otei
n (A
U)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
*
(#)
*
B)
D)
![Page 133: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/133.jpg)
Untrained TrainedGS
site
2+2
a ph
osph
oryl
atio
n / G
S pr
otei
n (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6 Pre Post
(#)
*
Untrained TrainedGS
site
3a
phos
phor
ylat
ion
/ GS
prot
ein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
(*)
*
#
#
A)
C)
B)
Supplementary fig. 2
![Page 134: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/134.jpg)
Supplementary fig. 3
Untrained Trained
PDH
site
1 p
hosp
hory
latio
n/ P
DH
-E1a
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6 Pre Post
A)
Untrained Trained
PDH
site
2 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
#
B)
![Page 135: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/135.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
ffiThe phD School of scIENCE -ffi
-"6d#'Lra+r-
3A. Co-authorship statement
All papers/manuscripts with multiple authors enclosed as annexes to a PhD thesis synopsis
should contain a co-author statement, stating the PhD student's contribution to the paper.
2.Title of PhD thesis
Regulation of PDH, GS and insulin signalling in skeletal muscle; effect of physical activity level and inflammation
3.This co-authorship declaration applies to the following paper
Effects of exercise training on regulation of skeletal muscle glucose metabolism in skeletal muscle of elderly men
The extent of the PhD student's contribution to the article is assessed on the following scale
A. has contributed to the work (0-33%)
B. has made a substantial contribution (34-66%)
C. did the majority of the work independently (67-100%).
w
1. General information
PhD student
NameRasmus SjOrup BiensoCiv.reg.n o. (lf not applicable, then birth dote)[email protected] of Biology
Please mark
PhD Schemex 5+3 Scheme 4+4 Scheme Industr ial PhD
Principal supervisor
NameHenriette Pi legaardE-mai lHPi [email protected]
7/tRevised 29 Jonuary 2073
![Page 136: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/136.jpg)
THE FACULTYU N I V E R S I T Y O F
OF SCIENCE,C O P E N H A G E N
The PhD School of SCIENCE
4. Declaration on the individual elements Extent (A, B, C)
l. Formulation in the concept phase of the basic scientific problem on the basis of
theoretical questions which require clarification, including a summary of the general
questions which it is assumed will be answerable via analyses or concrete
experiments/investigations.
C
2. Planning of experiments/analyses and formulation of investigative methodology in
such a way that the questions asked under (1) can reasonably be expected to be
answered, including choice of method and independent methodological development.
C
3. Involvement in the analysis or the concrete experiments/investigation.C
4. Presentation, interpretation and discussion of the results obtained in article form. C
5. Material in the paper from another degree / thesis :Articles/work published in connectionwith another degredthesis must notform part of the PhD thesis.Data collected and preliminary work carried out as part of another degree/thesis may be part of the PhD thesis if
further research, analysis andwriting are carried out as part of the PhD study.
Does the paper contain data material, which has also formed part of a previous degree / thesis(e.g. your masters degree)
Please indicate which desree / thesis:
Yes: E
No: E
Percentage of the paper that
Percentage of the paper that
is from the PhD degree work
is from the other degree / thesis
%
%
Etl
Please indicate which specific part(-s) of the paper that has been produced as part of the PhD study:
6.Signatures of co-authors :
i+li- lt,1
Jacob Friis Smith
2/3Revised 29 Januory 20L3
![Page 137: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/137.jpg)
THE FACULTYU N I V E R S I T Y O F
OF SCIENCE,C O P E N H A G E N
The PhD School of SCIENCE
n/a- - flo/lMikkel Sillesen Matzen kahlmJargen Frank Pind Wojtaszewski t{1ulYlvaHellsten Ir
U\fKWHenriette Pilegaard rhlou^*)
T.Signature
By signing the document, the PhD student hereby declares that the above information is correct.
03o2 2o /V(dd.mm.yy14t)
when completed, the form shoutd be sent to the relevant department's phD secretary who on your behalf wiltforward it to the PhD School ([email protected]).
To find your departments phD secretary, please see:
3/zRevised 29 January 20t3
![Page 138: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/138.jpg)
Study III
Biensø RS, Olesen J, van Hauen L, Meinertz S, Halling JF, Gliemann L, Plomgaard P,
Pilegaard H.. Exercise-induced AMPK and pyruvate dehydrogenase regulation is maintained
during LPS-induced inflammation. Submitted Pflugers Archive, European Journal of Physiology
2014
![Page 139: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/139.jpg)
Exercise-induced AMPK and pyruvate dehydrogenase regulation is
maintained during LPS-induced inflammation
1Rasmus Sjørup Biensø, 1Jesper Olesen, 1Line van Hauen, 1Simon Meinertz, 1Jens Frey Halling,
2Lasse Gliemann, 3Peter Plomgaard, 1Henriette Pilegaard
1Centre of Inflammation and Metabolism, CFAS and August Krogh Centre, Department of Biology,
University of Copenhagen, Denmark
2Department of Nutrition Sport and Exercise, University of Copenhagen, Denmark
3Centre of Inflammation and Metabolism and The Centre for Physical Activity Research (CFAS),
Department of Clinical Biochemistry, Rigshospitalet, Denmark
Keywords: LPS, TNFα, skeletal muscle, substrate oxidation, human, AMPK, exercise
Corresponding author
Henriette Pilegaard
Universitesparken 13, 4sal
2100 Copenhagen Ø
Mail: [email protected]
Phone no. : +45 35321687
![Page 140: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/140.jpg)
ABSTRACT
The aim of the present study was to examine the effect of LPS-induced inflammation on AMPK and
PDH regulation in human skeletal muscle at rest and during exercise. Nine young healthy
physically inactive male subjects completed two trials. In an LPS trial, the subjects received a single
lipopolysaccharide (LPS) injection (0.3ng/kg body weight) and blood samples and vastus lateralis
muscle biopsies were obtained before and 2h after the LPS injection and immediately after a 10 min
one-legged knee extensor exercise bout performed approximately 2½ hour after the LPS injection.
The exercise bout with muscle samples obtained before and immediately after was repeated in a
control trial without LPS injection. The plasma tumor necrosis factor (TNF)α concentration
increased 17 fold 2h after LPS relative to before. Muscle lactate and muscle glycogen were
unchanged from before to 2h after LPS and exercise increased muscle lactate and decreased muscle
glycogen in the control (P<0.05) and the LPS (0.05≤P<0.1) trial with no differences between the
trials. AMP-activated kinase (AMPK), acetyl-CoA carboxylase (ACC) and pyruvate dehydrogenase
(PDH) phosphorylation as well as PDHa activity were unaffected 2h after LPS relative to before.
Exercise decreased (P<0.05) PDH and increased (P<0.05) AMPK and ACC phosphorylation as well
as increased (P<0.05) PDHa activity similarly in the LPS and control trial. In conclusion, LPS-
induced inflammation does not affect resting or exercise-induced AMPK and PDH regulation in
human skeletal muscle. This suggests that metabolic flexibility during exercise is maintained during
short-term low grade inflammation in humans.
![Page 141: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/141.jpg)
INTRODUCTION
Skeletal muscle has an extraordinary ability to regulate substrate choice and utilization according to
availability [13;32]. The exercise-induced enhancement of glucose and fat oxidation in skeletal
muscle ensures ATP production for muscle contractions and the interaction between fatty acids and
glucose regulates the relative fatty acid and glucose oxidation contributes to efficient substrate
utilization [32]. Regulation of substrate choice and substrate utilization may however be influenced
by metabolic changes and contribute to metabolic dysfunction. For example chronically elevated
plasma free fatty acid (FFA) levels will inhibit glucose oxidation and elevated plasma glucose may
inhibit fat oxidation in skeletal muscle [19;23;27;32]. Similarly, metabolically related diseases are
often associated with low grade inflammation characterized by chronically elevated levels of
circulating cytokines [25] like the pro-inflammatory cytokine tumor necrosis factor (TNF).
Previous studies have linked TNFα to insulin resistance in rat and human skeletal muscle [17;30],
as well as indicated TNFα-mediated effects on substrate utilization [35;40;47].
The pyruvate dehydrogenase (PDH) complex has a key position in the regulation of substrate choice
as it catalyzes the decarboxylation of pyruvate to acetyl CoA, which represents the entry of
carbohydrate-derived substrate into the mitochondria for oxidation [33]. In accordance, exercise has
been shown to induce a rapid increase in the activity of PDH in the active form (PDHa) in human
skeletal muscle [18] concomitant with increased glucose oxidation [31]. Furthermore, elevated
plasma FFA has been shown to reduce the exercise-induced increase in PDHa activity in human
skeletal muscle [20] supporting that PDH contributes to regulating substrate utilization during
exercise as part of the interaction between fatty acids and carbohydrates [32;33]. The PDHa activity
is thought mainly to be regulated by phosphorylation of the PDH-E1 subunit [22;28] determined
by the activity of PDH kinases (PDK), which phosphorylate and inactivate the enzyme and PDH
phosphatases (PDP), which dephosphorylate and activate PDH. Previous studies have shown that
![Page 142: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/142.jpg)
the PDK4 protein content is up-regulated in rat and/or human skeletal muscle by fasting and high-
fat diet [26;46] and this regulation has been suggested to contribute to the associated changes in
PDHa activity [16]. Although the PDK4 protein content has been shown to be unaffected during
even prolonged exercise, the PDK4 protein content has been demonstrated to be rapidly regulated in
human skeletal muscle by carbohydrate availability [20] indicating a potential role of acute changes
in PDK4 protein content in PDH regulation.
Several previous studies suggest that inflammation influences PDH regulation. Repeated E-coli
injections in rats have been shown to reduce the concentration of active PDH complex (PDC) and
increase PDK activity [39;40]. Moreover the observations that treatment with TNFα reduced PDH
activity in rat cardiomyocytes [47] and human immune cells [36] as well as the finding that
treatment with TNF binding protein alleviated the effects of inflammation on PDH activity [40]
indicate that TNFα influences PDH regulation. These findings are further supported by a recent
study showing that LPS infusion for 24 hours decreased PDHa activity and increased PDK4 protein
content in rat skeletal muscle [12]. On the other hand, local infusion of LPS or TNF in one leg did
not change resting PDH-E1 phosphorylation in human skeletal muscle [6;9], which may suggest
that the impact of inflammation on PDH regulation at rest depends on species, dose or duration of
the treatment.
The intracellular energy sensor, AMP-activated protein kinase (AMPK), is also a key factor in the
regulation of substrate utilization. AMPK activity is increased both by AMP mediated allosteric
regulation and by phosphorylation [44] leading to stimulation of several downstream processes
aiming at increasing ATP production. In accordance, exercise increases AMPK phosphorylation
and activity in skeletal muscle leading to an enhancement of fat oxidation in skeletal muscle
through AMPK-mediated phosphorylation and inactivation of acetyl-CoA carboxylase (ACC) [43].
As ACC catalyzes the production of malonyl CoA, an inactivation of ACC leads to reduced
![Page 143: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/143.jpg)
production of malonyl-CoA with concomitantly less inhibition of carnitine palmitoyltransferase I
and an increased fatty acid oxidation [15].
AMPK has been suggested to have anti-inflammatory effects [14], and AMPK phosphorylation has
been reported to increase in human skeletal muscle after an LPS injection, although a concomitant
increase in ACC phosphorylation was not observed [3]. This may suggests that inflammation
modify AMPK-mediated intracellular signaling in resting skeletal muscle.
Although previous studies indicate that inflammation affects PDH and AMPK regulation, it is yet
unresolved how inflammation influences exercise-induced AMPK and PDH regulation in human
skeletal muscle. Therefore the aim of the present study was to investigate the effects of LPS-
induced inflammation on AMPK and PDH regulation in human skeletal muscle at rest and in
response to an acute exercise bout.
![Page 144: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/144.jpg)
METHODS
Subjects
Nine physically inactive young healthy male subjects in the range from 20-26 years of age with an
average body mass index of 25.6±1.3 (mean±SE) participated in the study. The subjects were
physically active physical less than 1h per week. Each subject underwent a health examination by a
medical doctor. The subjects could participate in the study if the VO2max was less than 45 ml·min-
1·kg-1 and was approved by the medical doctor. The subjects were given both written and oral
information about the study and the subjects gave their written consent to participate in the study.
The study performed according to the Declaration of Helsinki and approved by the Copenhagen and
Frederiksberg Ethical committee in Denmark (H-1-2012-108).
Pre-testing
The VO2max was measured for each subject using an incremental ergometer bicycle test (Monarch
Ergomedic 839E) for use as inclusion criteria. In addition, Wattmax was determined during an
incremental one-legged knee extensor exercise test on a modified ergometer bicycle as previously
described [29]. The Wattmax was used to determine the resistance during the experimental trials.
Experimental protocol
The subjects completed a LPS trial and a control trial separated by a least 7 days. For both trials, the
subjects were instructed to eat a carbohydrate rich meal 1h before arriving to the laboratory.
LPS trial. After arriving to the laboratory, a catheter was placed in the femoral artery and in the
femoral vein of one leg and a venflon was placed in an antecubital vein in the forearm. Blood
samples were obtained from the femoral catheters and a muscle biopsy was obtained from the
![Page 145: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/145.jpg)
vastus lateralis muscle using the needle biopsy method [8] with suction. Insertions for biopsies were
made under local anesthesia (Lidocaine, AstraZeneca, Södertälje, Sweden). A LPS solution (100
ng/ml) was either freshly prepared from a LPS stock (The Clinical Center, Critical Care Medicine
Department, Bethesda, MD, USA) or used within a week from the preparation with storage at -
20°C. An intravenous injection of 0.3 ng/kg LPS was given through an arm venflon approximately
2.5 hours after the subjects had eaten breakfast. Additional blood samples were obtained 30 min, 60
min, 90 min and 120 min after LPS injection and additional muscle biopsies at 1 hour and 2 hour
after LPS was given. The 1 hour biopsy, all venous blood samples and arterial blood samples
obtained at 30, 60 and 90 min after the LPS injection are not used in the present study except the
venous sample before LPS for comparison of the arterial and venous TNFα level. After the 2h blood
and tissue sampling, the subjects were transferred to a chair connected to a one-legged knee
extensor ergometer bicycle with the back of the chair lying down. The right foot of the subject was
tied to a rod connected to the crank set of the modified ergometer bicycle. The subjects first
performed 1 min passive knee extensions to warm up the leg followed by 5 min exercise at 50% of
Wattmax and 5 min exercise at 60% of Wattmax. Additional blood samples were obtained 8 min into
the exercise and an additional muscle biopsy was obtained from the vastus lateralis muscle of the
working leg immediately as the exercise was terminated after 10 min of exercise.
Individual insertions were made for each biopsy. Visual fat, connective tissue and blood were
removed from the biopsies, which were quickly frozen in liquid nitrogen. The muscle biopsies were
stored at -80°C. The blood was collected in EDTA containing tubes, which were centrifuged and
plasma was collected and stored at -80°C.
Ear temperature, mean arterial blood pressure (MAP) and heart rate were recorded every 15 min
until 3h after the LPS injection. MAP and heart rate monitoring continued until at least 4 hours after
the LPS injection to insure that normal blood pressure regulation was re-established.
![Page 146: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/146.jpg)
Control trial. After arriving to the laboratory, a venflon was inserted in a vein in the forearm and a
blood sample was obtained through the venflon. In addition, a muscle biopsy was obtained from the
vastus lateralis muscle as described above. The subjects were placed in the chair connected to the
one-legged knee extensor ergometer bicycle with the back of the chair lying down. The right leg of
the subject was tied to the modified ergometer bicycle and 1 min of passive knee extensions were
performed followed by 5 min exercise at 50% Wattmax and 5 min exercise at 60% Wattmax as in the
LPS trial. An additional blood sample was drawn after 8 min of exercise and an additional Vastus
lateralis muscle biopsy was obtained from the working leg immediately after 10 min of exercise.
Blood and muscle biopsies were handled as described for the LPS trial above.
Plasma analyzes
Plasma glucose and insulin. The blood was analyzed immediately for blood glucose (ABL,
Radiometer 725 series Acid-Base Analyzer, Denmark) and insulin was measured at The
Department of Clinical Biochemistry at Rigshospitalet, Copenhagen, Denmark.
Plasma TNF. The plasma TNF was determined using a MSD multi-spot 96 wells plate with pre-
coated antibodies (MesoScaleDiscovery, Gaithersburg, ML, USA). The plates were measured on
MSD Sector Image 2400 plate reader. The data were analyzed using the Discovery Workbench 3.0
(MSD). The results were converted to a concentration by use of a standard curve constructed from a
serial dilution of recombinant TNF run alongside on each plate.
Muscle analyses
![Page 147: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/147.jpg)
Freeze-drying. Muscle biopsies were freezed-dried for at least 48 hours and the samples were
dissected free from visual blood and connective tissue under the microscope. The muscle tissue was
weighted out for the different analyses and stored at -80°C.
Muscle glycogen. The muscle glycogen concentration was determined on freeze-dried muscle tissue
as glycosyl units after acid hydrolysis as previously described [24]
Muscle lactate. PCA extract was made on freeze-dried muscle tissue as previously described [7].
Muscle lactate was measured using the auto-fluorescence ability of NADH as previously described
[7].
SDS-PAGE and Western blotting. The freeze-dried muscle was homogenized using a Tissue LyserII
(Qiagen, Hilden, Germany) and the homogenized muscle samples were made into lysates as
previously described [38]. The protein concentration was determined with the bicinchoninic acid
method (Pierce, ThermoScientific, Rockford, IL, USA) using BSA as a standard.
The lysate samples were loaded on hand casted gels (7.5%-10%). After the gel electrophoresis, the
proteins were blotted from the gel to a PVDF membrane (Millipore, Bedford, USA), blocked in 3%
fish gelatin solution and incubated with antibodies. The protein content and phosphorylation level
were determined using antibodies towards AMPK Thr172 phosphorylation (2535; Cell Signaling
Technology, Berverly, MA, USA), ACC Ser79 phosphorylation (07-303; Millipore, Bedford, USA),
PDH Ser293 (site1), PDH Ser300 (site 2), PDH Ser295 (site 4) phosphorylation, PDH-E1 protein,
AMPKα2 protein and PDK4 protein (provided by Graham Hardie, Dundee University, Dundee,
U.K). ACC protein content was detected using streptavidin-HRP (Dako, Glostrup, Denmark). The
![Page 148: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/148.jpg)
bands on the membranes were visualized with ECL reagent (Millipore, Billerica, MA, USA) in a
digital image system (GE healthcare, München, DE).
PDHa activity. The PDHa activity was determined as previously described [10;11;31]). In brief,
muscle homogenate was prepared on ice from wet weight muscle tissue using a glass homogenizer
(Kontes, Vineland, NJ, USA). Pyruvate was converted to acetyl CoA followed by determination of
the acetyl CoA content by use of a radioactive assay. The PDHa activity was determined as the rate
of conversion of pyruvate to acetyl CoA and normalized to the total creatine content in each sample
as previously described [34].
Statistics
Values presented are means±SE. A paired t-test was used to test the effect of LPS at rest. A Two
Way ANOVA with repeated measures was used to evaluate the effect of LPS and exercise. The data
were log transformed if normality or equal variance test failed. If a significant main effect was
detected, the student Newman-Keuls test was used to locate differences. Differences are considered
significant at p<0.05 and a tendency is reported for 0.05≤p0.1. Statistical calculations were
performed using SigmaPlot 11.0
![Page 149: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/149.jpg)
RESULTS
Physical parameters
The mean arterial pressure was stable around 85-90 mmHg and the ear temperature was unchanged
around 37-37.6°C. The heart rate increased (P<0.05) from 63±3 before LPS to 83±4 beats/min 3h
after the LPS injection (Table 1).
Plasma parameters
Plasma glucose and insulin
The arterial plasma glucose concentration decreased (P<0.05) 2h after LPS relative to before the
LPS injection. Exercise did not change the plasma glucose concentration in the LPS trial (Table 1).
The arterial plasma insulin concentration decreased (P<0.05) 2h after LPS injection relative to
before LPS. Exercise did not affect the plasma insulin level in the LPS trial (Table 1).
Plasma TNFα
Plasma TNFα was determined as a measure of the LPS induced inflammation. The plasma TNF
concentration before LPS injection was similar in the femoral artery and femoral vein suggesting
that arterial and venous levels can be compared at least in a non-inflammatory state. The arterial
plasma TNF concentration increased (P<0.05) ~17 fold 2h after LPS injection relative to before
LPS. Exercise did not change the plasma TNF concentration in either trial. The arterial plasma
TNF concentration was 13-15 fold higher (P<0.05) in the LPS trial than the venous plasma TNF
in the control trial before and at the end of exercise (Table 2).
![Page 150: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/150.jpg)
Muscle analyses
Muscle glycogen
The muscle glycogen concentration was unaffected from before LPS injection to 2h after LPS.
Exercise reduced (p<0.05) muscle glycogen 27% in the control trial and tended to reduce
(0.05<P<0.1) muscle glycogen 6% in the LPS trial. There was no significant difference in the
muscle glycogen concentration between the two trials neither before nor after exercise (Table 3).
Muscle lactate
Muscle lactate did not change from before the LPS injection to 2h after LPS. Exercise increased
(P<0.05) muscle lactate 6.8 fold in the control trial and tended to increase (0.05<P<0.1) muscle
lactate 4.9 fold in the LPS trial with no difference between the two trials neither before exercise nor
after exercise (Table 3).
AMPK and ACC phosphorylation
There was no difference in AMPK Thr172 and ACC Ser79 phosphorylation in skeletal muscle before
and 2 hours after LPS injection (Figure 1A and 1C).
The exercise bout increased (P<0.05) skeletal muscle AMPK phosphorylation ~3 fold and ACC
phosphorylation 6-7 fold in the control and LPS trial with no difference in the responses between
the trials. The AMPK and ACC phosphorylation levels were similar in the two trials both before
and after exercise (Figure 1B and 1D).
PDH-E1 phosphorylation
![Page 151: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/151.jpg)
PDH-E1 phosphorylation at Ser293, Ser300 and Ser295 was unchanged 2 hours after LPS injection
relative to before (Figure 2A, 2C and 2E).
Exercise decreased (P<0.05) the PDH-E1 phosphorylation at site Ser293 40-50%, site300 60-70%
and site Ser295 30-40 % in the control and LPS trial with no difference in the responses between the
trials. The PDH-E1 phosphorylation level was for each of the three sites similar in the control and
LPS trial both before and after exercise (Figure 2B, 2D,2F).
PDHa activity
The PDHa activity was unchanged 2 hours after LPS injection relative to before LPS. Exercise
increased (P<0.05) the PDHa activity ~1.8 fold in the control trial and ~2.2 fold in the LPS trial
with no difference in the response between the trials. The PDHa activity was similar in the two
trials both before and after exercise (Figure 3).
![Page 152: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/152.jpg)
DISCUSSION
The main findings of the present study are that LPS-induced inflammation with elevated plasma
TNFα concentration does not affect the exercise-induced AMPK and PDH regulation in human
skeletal muscle. In addition, short-term inflammation does not affect AMPK and PDH regulation at
rest.
The present human study used a single LPS injection to induce a controlled inflammation in young
volunteers as a model for low grade inflammation as frequently used [4;5;36;37]. The present
observation that the LPS injection increased the plasma TNFα concentration 17 fold to 15 ng/l 2
hours after the LPS injection is in accordance with several previous studies [4;5;37] and shows that
the anticipated inflammatory state was obtained.
The observation that skeletal muscle PDHa activity and PDH phosphorylation did not change 2h
after LPS injection in the current study is different from previous observations in rats [12;39;40].
Hence 24h of LPS infusion in rats has been shown to reduce the PDHa activity in skeletal muscle
[12] and sepsis induced by repeated treatments with E-coli was associated with reduced
concentration of active PDC in skeletal muscle [41]. The additional finding that treatment with
TNF binding protein prevented the E-coli-induced reduction in PDH activity suggested that TNF
is important in the LPS-induced effects on PDH during sepsis in rats [40]. Although the different
observations may be due to species or model differences, it seems possible that the dose and the
duration of treatment could be important. While a single injection of 0.3 ng·kg-1 was used in the
present study, effects on PDH was observed in rats with 24h of LPS infusion resulting in an 8.9 fold
increase in plasma TNFα [2;12]. In addition, while the present study did not observe any change in
muscle lactate 2h after the LPS injection, a previous rat study using a high dose of LPS infusion
![Page 153: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/153.jpg)
(150µg·kg-1·h-1) reported that muscle lactate increased after 2 hours of LPS treatment [2] indicating
that the inflammation inhibited the PDH.
Previous studies have also indicated a link between TNFα and AMPK, although different effects
have been reported. The unchanged AMPK phosphorylation 2h after the LPS injection in the
present human study is hence not in accordance with a previous study showing that treatment of
muscle cells with TNFα decreased the AMPK activity [35]. The current finding is in line with
previous observations in humans, although AMPK phosphorylation increased in human skeletal
muscle 4h after a single LPS injection [3]. This may suggest that the different observations are due
to model differences and the present findings do not oppose the possibility that LPS-induced
inflammation in humans increases AMPK phosphorylation in skeletal muscle.
The present study is (to our knowledge) the first to examine the impact of LPS-induced
inflammation on exercise-induced metabolic regulation in humans. The exercise-induced decrease
in PDH phosphorylation and increase in AMPK and ACC phosphorylation as well as in PDHa
activity in the control trial are as expected based on many similar previous studies [20;21;28;45].
The present finding that the exercise-induced regulation of PDH phosphorylation and PDHa activity
was similar in the LPS trial, where TNFα was elevated, as in the control trial is however not as
hypothesized. As PDH activation increases carbohydrate oxidation [31;42] and AMPK-mediated
ACC inactivation increases fat oxidation [15;43], these observations suggest that human skeletal
muscle maintains the ability to increase carbohydrate and fat oxidation in response to exercise
despite the presence of short-term systemic inflammation. This conclusion is supported by the
similar increase in the muscle lactate concentration in the two trials in the present study.
The lack of effect of inflammation on exercise-induced PDH and AMPK regulation suggests that
exercise-induced metabolic flexibility is maintained during inflammation, which is in contrast to
![Page 154: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/154.jpg)
previous studies showing that elevated systemic TNFα levels [30] and a single LPS injection [1]
induce whole body insulin resistance in humans. These findings may suggest that insulin-signaling
and exercise-induced metabolic regulation are affected differently by inflammation. However of
notice is that the lack of effect on the exercise-induced responses was observed 2½ hours after LPS
injection, while the LPS-induced lowering of insulin sensitivity was demonstrated 420 min after
LPS was injected. On the other hand, the previously reported TNFα-induced insulin resistance was
observed within 2h of TNFα infusion with similar plasma levels of TNFα [30] as in the present
study, while the previous LPS study resulted in more than 50 fold higher plasma TNFα
concentration [1] than in the present and previous TNFα study [30]. Although the TNFα infusion
did result in a constant elevation in plasma TNFα, while the present study induced a gradual
increase in plasma TNF, these considerations do support a different impact of TNFα on insulin-
mediated glucose uptake than on exercise-induced AMPK and PDH regulation in human skeletal
muscle.
As the purpose of the present study was to examine the potential effect of inflammation with
elevated plasma TNFα, the exercise bout was placed at the time point where the plasma TNFα
concentration was expected to peak. In accordance, the observation that plasma TNFα was at a
similar level (15 fold elevated) and not further increased at the sampling time point during exercise
(approximately 2½ h after LPS injection) relative to 2h after LPS is in line with previous studies
showing that plasma TNF peaks at approximately 2h after a single LPS injection [1;3;5;37].
However, it is certainly possible that more long-term inflammation with more sustained elevation in
plasma TNF will affect the exercise-induced AMPK and PDH regulation in skeletal muscle, but
this remains to be determined.
![Page 155: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/155.jpg)
As previous studies examining the impact of LPS-induced inflammation and TNFα on PDH
regulation have observed that a down-regulation of the PDHa activity was associated with increased
PDK activity [39;40] and PDK4 protein content [12], it may be that inflammation-induced effects
on PDH regulation require changes in PDK4 expression. The present observation that the lack of
effect of inflammation on PDH regulation was associated with unchanged PDK4 protein content in
skeletal muscle does support this possibility that changes in PDK4 protein underlies part of the
effect of inflammation on PDH.
In conclusion, a single LPS injection resulting in 17 fold increase in plasma TNFα concentration did
not change AMPK and PDH phosphorylation and/or activity in human skeletal muscle at rest and
did not affect exercise-induced AMPK and PDH regulation in human skeletal muscle. This suggests
that the ability of skeletal muscle to increase glucose and fat oxidation during exercise is maintained
during short-term inflammation with elevated plasma TNFα levels. Hence, short-term low grade
inflammation does not seem to elicit metabolic inflexibility during exercise in humans as has been
reported for insulin resistance.
![Page 156: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/156.jpg)
Acknowledgement
We would very much like to thank to subjects for the participation in the study. In addition, we are
very grateful to Professor AF. Suffredini, National Institutes of Health, Bethesta, USA, for
providing the LPS for the present study. The study was supported by The Danish Council for
Independent Research, Danish Medical Research Council and The Danish Ministry of Culture for
Sports Research. The Centre of Inflammation and Metabolism (CIM) is supported by a grant from
the Danish National Research Foundation (DNRF55). The Centre for Physical Activity Research
(CFAS) is supported by a grant from Trygfonden. CIM is part of the UNIK Project: Food, Fitness &
Pharma for Health and Disease, supported by the Danish Ministry of Science, Technology, and
Innovation. CIM is a member of DD2 - the Danish Centre for Strategic Research in Type 2 Diabetes
(the Danish Council for Strategic Research, grant no. 09-067009 and 09-075724). The Copenhagen
Muscle Research Centre (CMRC) is supported by a grant from the Capital Region of Denmark.
![Page 157: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/157.jpg)
Reference List
1. Agwunobi AO, Reid C, Maycock P, Little RA, Carlson GL (2000) Insulin resistance and substrate utilization in human endotoxemia. J Clin Endocrinol Metab 85:3770-3778
2. Alamdari N, Constantin-Teodosiu D, Murton AJ, Gardiner SM, Bennett T, Layfield R, Greenhaff PL (2008) Temporal changes in the involvement of pyruvate dehydrogenase complex in muscle lactate accumulation during lipopolysaccharide infusion in rats. J Physiol 586:1767-1775
3. Andreasen AS, Kelly M, Berg RM, Moller K, Pedersen BK (2011) Type 2 diabetes is associated with altered NF-kappaB DNA binding activity, JNK phosphorylation, and AMPK phosphorylation in skeletal muscle after LPS. PLoS One 6:e23999
4. Andreasen AS, Krabbe KS, Krogh-Madsen R, Taudorf S, Pedersen BK, Moller K (2008) Human endotoxemia as a model of systemic inflammation. Curr Med Chem 15:1697-1705
5. Andreasen AS, Pedersen-Skovsgaard T, Berg RM, Svendsen KD, Feldt-Rasmussen B, Pedersen BK, Moller K (2010) Type 2 diabetes mellitus is associated with impaired cytokine response and adhesion molecule expression in human endotoxemia. Intensive Care Med 36:1548-1555
6. Bach E, Nielsen RR, Vendelbo MH, Moller AB, Jessen N, Buhl M, Hafstrom T, Holm L, Pedersen SB, Pilegaard H, Bienso RS, Jorgensen JO, Moller N (2013) Direct effects of TNF-alpha on local fuel metabolism and cytokine levels in the placebo-controlled, bilaterally infused human leg: increased insulin sensitivity, increased net protein breakdown, and increased IL-6 release. Diabetes 62:4023-4029
7. Bergmeyer H.U. (1965) Methods of Enzymatic Analysis.
8. Bergstrom, J. Muscle electrolytes in man. 1-110. 1962. Scand J Clin Lab Invest. Ref Type: Generic
9. Buhl M, Bosnjak E, Vendelbo MH, Gjedsted J, Nielsen RR, Hafstrom T, Vestergaard ET, Jessen N, Tonnesen E, Moller AB, Pedersen SB, Pilegaard H, Bienso RS, Jorgensen JO, Moller N (2013) Direct effects of locally administered lipopolysaccharide on glucose, lipid, and protein metabolism in the placebo-controlled, bilaterally infused human leg. J Clin Endocrinol Metab 98:2090-2099
10. Cederblad G, Carlin JI, Constantin-Teodosiu D, Harper P, Hultman E (1990) Radioisotopic assays of CoASH and carnitine and their acetylated forms in human skeletal muscle. Anal Biochem 185:274-278
11. Constantin-Teodosiu D, Cederblad G, Hultman E (1991) A sensitive radioisotopic assay of pyruvate dehydrogenase complex in human muscle tissue. Anal Biochem 198:347-351
12. Crossland H, Constantin-Teodosiu D, Gardiner SM, Constantin D, Greenhaff PL (2008) A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J Physiol 586:5589-5600
![Page 158: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/158.jpg)
13. E.Christensen, O Hansen (1939) Untersuchungen über die Verbrennungsvorgänge bei langdauernder, schwerer Muskelabbeit. Skandinavisches Archiv für Physiologie 81:152-159
14. Green CJ, Pedersen M, Pedersen BK, Scheele C (2011) Elevated NF-kappaB activation is conserved in human myocytes cultured from obese type 2 diabetic patients and attenuated by AMP-activated protein kinase. Diabetes 60:2810-2819
15. Hardie DG, Corton J, Ching YP, Davies SP, Hawley S (1997) Regulation of lipid metabolism by the AMP-activated protein kinase. Biochem Soc Trans 25:1229-1231
16. Harris RA, Bowker-Kinley MM, Huang B, Wu P (2002) Regulation of the activity of the pyruvate dehydrogenase complex. Adv Enzyme Regul 42:249-259
17. Hotamisligil GS, Shargill NS, Spiegelman BM (1993) Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259:87-91
18. Howlett RA, Parolin ML, Dyck DJ, Hultman E, Jones NL, Heigenhauser GJ, Spriet LL (1998) Regulation of skeletal muscle glycogen phosphorylase and PDH at varying exercise power outputs. Am J Physiol 275:R418-R425
19. Kelley DE, Mandarino LJ (2000) Fuel selection in human skeletal muscle in insulin resistance: a reexamination. Diabetes 49:677-683
20. Kiilerich K, Gudmundsson M, Birk JB, Lundby C, Taudorf S, Plomgaard P, Saltin B, Pedersen PA, Wojtaszewski JF, Pilegaard H (2010) Low muscle glycogen and elevated plasma free fatty acid modify but do not prevent exercise-induced PDH activation in human skeletal muscle. Diabetes 59:26-32
21. Kiilerich K, Ringholm S, Bienso RS, Fisher JP, Iversen N, van HG, Wojtaszewski JF, Saltin B, Lundby C, Calbet JA, Pilegaard H (2011) Exercise-induced pyruvate dehydrogenase activation is not affected by 7 days of bed rest. J Appl Physiol 111:751-757
22. Linn TC, Pettit FH, Reed LJ (1969) Alpha-keto acid dehydrogenase complexes. X. Regulation of the activity of the pyruvate dehydrogenase complex from beef kidney mitochondria by phosphorylation and dephosphorylation. Proc Natl Acad Sci U S A 62:234-241
23. Mandarino LJ, Consoli A, Jain A, Kelley DE (1996) Interaction of carbohydrate and fat fuels in human skeletal muscle: impact of obesity and NIDDM. Am J Physiol 270:E463-E470
24. Passonneau JV, Lauderdale VR (1974) A comparison of three methods of glycogen measurement in tissues. Anal Biochem 60:405-412
25. Pedersen BK (2009) The diseasome of physical inactivity--and the role of myokines in muscle--fat cross talk. J Physiol 587:5559-5568
26. Peters SJ, Harris RA, Wu P, Pehleman TL, Heigenhauser GJ, Spriet LL (2001) Human skeletal muscle PDH kinase activity and isoform expression during a 3-day high-fat/low-carbohydrate diet. Am J Physiol Endocrinol Metab 281:E1151-E1158
27. Peters SJ, St Amand TA, Howlett RA, Heigenhauser GJ, Spriet LL (1998) Human skeletal muscle pyruvate dehydrogenase kinase activity increases after a low-carbohydrate diet. Am J Physiol 275:E980-E986
![Page 159: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/159.jpg)
28. Pilegaard H, Birk JB, Sacchetti M, Mourtzakis M, Hardie DG, Stewart G, Neufer PD, Saltin B, van HG, Wojtaszewski JF (2006) PDH-E1alpha dephosphorylation and activation in human skeletal muscle during exercise: effect of intralipid infusion. Diabetes 55:3020-3027
29. Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin B, Neufer PD (2002) Influence of pre-exercise muscle glycogen content on exercise-induced transcriptional regulation of metabolic genes. J Physiol 541:261-271
30. Plomgaard P, Bouzakri K, Krogh-Madsen R, Mittendorfer B, Zierath JR, Pedersen BK (2005) Tumor necrosis factor-alpha induces skeletal muscle insulin resistance in healthy human subjects via inhibition of Akt substrate 160 phosphorylation. Diabetes 54:2939-2945
31. Putman CT, Spriet LL, Hultman E, Lindinger MI, Lands LC, McKelvie RS, Cederblad G, Jones NL, Heigenhauser GJ (1993) Pyruvate dehydrogenase activity and acetyl group accumulation during exercise after different diets. Am J Physiol 265:E752-E760
32. Randle PJ, GARLAND PB, HALES CN, NEWSHOLME EA (1963) The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet 1:785-789
33. Randle PJ, Sugden PH, Kerbey AL, Radcliffe PM, Hutson NJ (1978) Regulation of pyruvate oxidation and the conservation of glucose. Biochem Soc Symp47-67
34. St Amand TA, Spriet LL, Jones NL, Heigenhauser GJ (2000) Pyruvate overrides inhibition of PDH during exercise after a low-carbohydrate diet. Am J Physiol Endocrinol Metab 279:E275-E283
35. Steinberg GR, Michell BJ, van Denderen BJ, Watt MJ, Carey AL, Fam BC, Andrikopoulos S, Proietto J, Gorgun CZ, Carling D, Hotamisligil GS, Febbraio MA, Kay TW, Kemp BE (2006) Tumor necrosis factor alpha-induced skeletal muscle insulin resistance involves suppression of AMP-kinase signaling. Cell Metab 4:465-474
36. Sutendra G, Dromparis P, Bonnet S, Haromy A, McMurtry MS, Bleackley RC, Michelakis ED (2011) Pyruvate dehydrogenase inhibition by the inflammatory cytokine TNFalpha contributes to the pathogenesis of pulmonary arterial hypertension. J Mol Med (Berl) 89:771-783
37. Taudorf S, Krabbe KS, Berg RM, Pedersen BK, Moller K (2007) Human models of low-grade inflammation: bolus versus continuous infusion of endotoxin. Clin Vaccine Immunol 14:250-255
38. Treebak JT, Frosig C, Pehmoller C, Chen S, Maarbjerg SJ, Brandt N, Mackintosh C, Zierath JR, Hardie DG, Kiens B, Richter EA, Pilegaard H, Wojtaszewski JF (2009) Potential role of TBC1D4 in enhanced post-exercise insulin action in human skeletal muscle. Diabetologia 52:891-900
39. Vary TC (1991) Increased pyruvate dehydrogenase kinase activity in response to sepsis. Am J Physiol 260:E669-E674
40. Vary TC, Hazen SA, Maish G, Cooney RN (1998) TNF binding protein prevents hyperlactatemia and inactivation of PDH complex in skeletal muscle during sepsis. J Surg Res 80:44-51
41. Vary TC, Martin LF (1993) Potentiation of decreased pyruvate dehydrogenase activity by inflammatory stimuli in sepsis. Circ Shock 39:299-305
![Page 160: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/160.jpg)
42. Watt MJ, Heigenhauser GJ, LeBlanc PJ, Inglis JG, Spriet LL, Peters SJ (2004) Rapid upregulation of pyruvate dehydrogenase kinase activity in human skeletal muscle during prolonged exercise. J Appl Physiol 97:1261-1267
43. Winder WW, Hardie DG (1996) Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol 270:E299-E304
44. Winder WW, Hardie DG (1999) AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol 277:E1-10
45. Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG, Kemp BE, Kiens B, Richter EA (2003) Regulation of 5'AMP-activated protein kinase activity and substrate utilization in exercising human skeletal muscle. Am J Physiol Endocrinol Metab 284:E813-E822
46. Wu P, Sato J, Zhao Y, Jaskiewicz J, Popov KM, Harris RA (1998) Starvation and diabetes increase the amount of pyruvate dehydrogenase kinase isoenzyme 4 in rat heart. Biochem J 329 ( Pt 1):197-201
47. Zell R, Geck P, Werdan K, Boekstegers P (1997) TNF-alpha and IL-1 alpha inhibit both pyruvate dehydrogenase activity and mitochondrial function in cardiomyocytes: evidence for primary impairment of mitochondrial function. Mol Cell Biochem 177:61-67
![Page 161: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/161.jpg)
Table 1: Physiological and plasma parameters in the LPS trial
Pre 2h LPS/Pre exercise 3h LPS
Temperature (°C) 37.4±0.2 37.3±0.1 37.6±0.2
MAP (mmHg) 87.8±2.9 88.0±3.4 87.9±3.6
Heart rate (BPM) 63±3 68±4 86±4*
Arterial plasma glucose (mmol/l) 6.4±0.6 5.0±0.1 * 4.9±0.2
Arterial plasma insulin (pmol/l) 135.8±18.2 65.3±10.8* 69.3±8.9
Table 2: Plasma TNFα concentrations
Pre LPS 2h LPS/Pre Exercise Exercise
TNF (ng/l) Control - 0.97±0.1 1.0±0.1
LPS 0.90±0.1 15.5±1.6 *# 13.6±1.3*#
Table 3: Muscle glycogen and lactate concentrations
Pre LPS 2h LPS/Pre Exercise Post Exercise
Glycogen (mmol·kg-1 dw) Control - 365±38 267±44*
LPS 329±32 391±49 367±35(*)
Lactate (mmol·kg-1 dw) Control - 9.7±1.9 66.4±15.6*
LPS 10.9±1.3 10.8±1.4 53.2±13.3(*)
![Page 162: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/162.jpg)
Table and figure legends
Table 1
Ear temperature (˚C), mean arterial pressure (MAP; mmHg) and heart rate (beats/min) before (Pre
LPS) and 2h (2h LPS) and 3h (3h LPS) after a single LPS injection as well as arterial glucose
(mmol/liter) and arterial insulin (pmol/liter) at Pre LPS, 2h LPS corresponding to before exercise
(Pre Exercise) and at 8 min of exercise (Exercise). The values are mean±SE. *:significantly
different from Pre LPS, P<0.05.
Table 2
Arterial (LPS trial) and venous (control trial) plasma tumor necrosis factor (TNF)α (ng/liter)
concentration before a single LPS injection (Pre LPS) and 2h after the LPS injection corresponding
to before exercise (2h LPS/Pre Exercise) and 8 min into an one-legged knee extensor exercise bout
(Exercise). The values are mean±SE. *: significantly different from Pre LPS, P<0.05; #:
significantly different from control at the given time point, P<0.05.
Table 3
Glycogen (mmol·kg-1 dry weight) and lactate (mmol·kg-1 dry weight) concentration in the vastus
lateralis muscle before a single injection of LPS (Pre LPS), 2h after the LPS injection corresponding
to before exercise (2h LPS/Pre Exercise) and immediately after 10 min of one-legged knee extensor
exercise (Post exercise). The values are mean±SE. *: significantly different from Pre LPS, P<0.05;
(*): tends to be significantly different from Pre LPS, 0.05≤P<0.1
Figure 1
![Page 163: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/163.jpg)
AMPK Thr172 phosphorylation normalized to AMPKα2 protein content A) before (Pre LPS) and 2
h after LPS (2h LPS) and B) before (Pre Exercise) and immediately after 10 min of one-legged knee
extensor exercise (Post Exercise). ACC Ser 79 phosphorylation normalized to ACC2 protein
content C) Pre LPS and 2h LPS as well as D) Pre Exercise and Post Exercise. The results are
presented as arbitrary Units (AU). Values are mean±SE. *: significantly different from Pre
Exercise, P<0.05.
Figure 2
PDH Ser293 phosphorylation normalized to PDH-E1α protein content A) before (Pre LPS) and2 h
after LPS (2h LPS) and B) before (Pre Exercise) and immediately after 10 min of one-legged knee
extensor exercise (Post Exercise). PDH Ser300 phosphorylation normalized to PDH-E1α protein
content C) Pre LPS and 2h LPS as well as D) Pre Exercise and Post Exercise. PDH site Ser295
phosphorylation normalized to PDH-E1α protein content E) Pre LPS and 2h LPS as well as F) Pre
Exercise and Post Exercise. The results are presented as arbitrary Units (AU). Values are mean±SE.
*: significantly different from Pre Exercise, P<0.05.
Figure 3
PDHa activity (mmol ·min-1·kg-1) A) before (Pre LPS) and2 h after LPS (2h LPS) and B) before
(Pre Exercise) and immediately after 10 min of one-legged knee extensor exercise (Post Exercise).
The PDHa activity is normalized to total creatine in the samples. Values are mean±SE. *:
significantly different from Pre Exercise, P<0.05.
![Page 164: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/164.jpg)
Pre LPS 2 h LPS
AMPK
Thr
172 p
hosp
hory
latio
n / A
MPK
2
prot
ein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Pre Exercise Post Exercise
AMPK
Thr
172 p
hosp
hory
latio
n / A
MPK
2
prot
ein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0 Control LPS *
*
Pre LPS 2 h LPS
ACC
Ser
79 p
hosp
hory
latio
n / A
CC
pro
tein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Pre Exercise Post Exercise
ACC
Ser
79 p
hosp
hory
latio
n / A
CC
pro
tein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0 * *
A) B)
C) D)
AMPK Thr172
ACC ser227
ACC protein
Pre Post Pre Post
LPS Control
LPS Pre 2h
LPS Pre 2h Pre Post Pre Post
LPS Control
AMPK 2
ACC ser227
ACC protein
AMPK Thr172
AMPK 2
Rested Exercise
75 kD 50 kD
75 kD 50 kD
75 kD 50 kD
75 kD 50 kD
250 kD 150 kD
250 kD 150 kD
250 kD 150 kD
250 kD 150 kD
Figure 1
![Page 165: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/165.jpg)
Pre LPS 2 h LPS
PDH
Ser
295 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Pre Exercise Post Exercise
PDH
Ser
295 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
* *
E) F) LPS
Pre 2h
PDH Ser295
PDH- E1
PDH Ser295
PDH- E1
50 kD 37 kD
50 kD 37 kD
Pre Post Pre Post
LPS Control
50 kD 37 kD
50 kD 37 kD
Pre LPS 2 h LPS
PDH
Ser
300 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
Pre Exercise Post Exercise
PDH
Ser
300 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
* *
50 kD 37 kD
50 kD 37 kD
PDH Ser300
PDH- E1
Pre Post Pre Post
LPS Control
50 kD 37 kD
50 kD 37 kD
LPS Pre 2h
PDH Ser300
PDH- E1
C)
Pre LPS 2 h LPSPD
H S
er29
3 pho
spho
ryla
tion
/ PD
H-E
1 p
rote
in (A
U)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Pre Exercise Post Exercise
PDH
Ser
293 p
hosp
hory
latio
n / P
DH
-E1
pro
tein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2 Control LPS
* *
A) B)
LPS Pre 2h
PDH Ser293
PDH- E1
50 kD 37 kD
50 kD 37 kD
LPS Control
Pre Post Pre Post
50 kD 37 kD
50 kD 37 kD
PDH Ser293
PDH- E1
Rested Exercise Figure 2
D)
![Page 166: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/166.jpg)
Figure 3 Rested
Pre LPS 2 h LPS
PD
H a
ctiv
ity (m
mol
·kg-1
·min
-1) /
tota
l Cr
0,0
0,5
1,0
1,5
2,0
2,5
Exercise
Pre Exercise Post Exercise
PD
H a
ctiv
ity (m
mol
·kg-1
·min
-1) /
tota
l Cr
0,0
0,5
1,0
1,5
2,0
2,5
Control LPS
*
*A) B)
![Page 167: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/167.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE ffi
3A. Co-authorship statement
All papers/manuscripts with multiple authors enclosed as annexes to a PhD thesis synopsis
should contain a co-author statement, stating the PhD student's contribution to the paper.
I;Tifle,, Of,,PhD the$ij
Regulation of PDH, GS and insulin signalling in skeletal muscle; effect of physical activity level and inflammation
Exercise-induced AMPK and pyruvate dehydrogenase regulation is maintained during LPS-induced
inflammation.
The extent of the PhD student's contribution to the article is assessed on the followine scale
A. has contributed to the work (0-33%)
B. has made a substantial contribution (34-66%)
C. did the majority of the work independently (67-100%).
ffi
1. General inforrnation
PhD student
NameRasmus Sjorup BiensoCiv.reg.n o. (lf not applicable, then birth date)[email protected] of Biology
Please markPhD Scheme
X 5+3 Scheme 4+4 Scheme Industrial PhD
Principal supervisor
NameHenriette PilegaardE-mai lHPi [email protected]
t/3Revised 29 Jonuary 2073
![Page 168: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/168.jpg)
THE FACULTY OF SCIENCE,U N I V E R S I T Y O F C O P E N H A G E N
The PhD School of SCIENCE
4. Declaration on the individual elements Extent (A, B, C)
t. po..ulation in the concept phase of the basic scientific problem on the basis of
theoretical questions which require clarification, including a summary of the general
questions which it is assumed will be answerable via analyses or concrete
experiments/inve stigations.
C
Z. ftunnltrg of experiments/analyses and formulation of investigative methodology in
such a way that the questions asked under (l) can reasonably be expected to be
answered, including choice of method and independent methodological development.C
3. Involvement in the analysis or the concrete experiments/investigation.C
4. P.esentation, interpretation and discussion of the results obtained in article form. c
5. Material in the paper from another degree I thesis :
Articles/work pubt*nia n connection with another degree/thesis must no1lform part of the PhD thesis-
Data collectei and preliminary work carried aut as pirt of another degree/thesis may be part of the PhD thesis if
further reseqrch, analysis andwriting are carried out as part of the PhD study. ,
Does the paper contain data material, which has also formed part of a previous degree / thesis
(e.g. your masters degree)
Please indicate which degree / thesis:
Yes: E
No: E
Percentage of the paper that
Percentage of the paper that
is from the PhD degree work
is from the other degree / thesis
%
%
tlT
please indicate which specific part(-s) of the paper that has been produced as part of the PhD study:
6.Signatures of co-authors :
Date Name sisnat? ,.,r
'Lc'lt.- lLl
Jesper Olesen 7, ///1,Line Van Hauen / d- ,,;-"/'.
t 8/t - /LrSimon Meinertz -r-r,%
7Z li - lt{Jens Frey Halling trNI{dL\}.,Lasse Gliemann
*,* 6t0,4,Aru/./l
2/3Revised 29 January 2013
![Page 169: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/169.jpg)
THE FACULTYU N I V E R S I T Y O F
OF SCIENCE,C O P E N H A G E N
T.Signature
By signing the document, the PhD student hereby declares that the above information is correct.
PhD student:13 o2 2o/f
(dd.mm.yyyy)
When completed, the form should be sent to the relevant department's PhD secretary who on your behalf will
forward it to the PhD School ([email protected]).
To find your departments PhD secretary, please see:
http : //www.scie nce. ku.d k'. nel ish/resea rch /phd /student/contact/
3/3Revised 29 Jonuory 2073
![Page 170: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/170.jpg)
Study IV
Biensø RS, Knudsen JG, Brandt N, Pedersen PA, Pilegaard H. Effects of IL-6 on pyruvate
dehydrogenase regulation in mouse skeletal muscle. Pflugers Arch. 2013 Nov 14.
![Page 171: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/171.jpg)
SIGNALING AND CELL PHYSIOLOGY
Effects of IL-6 on pyruvate dehydrogenase regulationin mouse skeletal muscle
Rasmus S. Biensø & Jakob G. Knudsen & Nina Brandt &Per A. Pedersen & Henriette Pilegaard
Received: 26 June 2013 /Revised: 28 October 2013 /Accepted: 29 October 2013# The Author(s) 2013. This article is published with open access at Springerlink.com
Abstract Skeletal muscle regulates substrate choice accord-ing to demand and availability and pyruvate dehydrogenase(PDH) is central in this regulation. Circulating interleukin(IL)-6 increases during exercise and IL-6 has been suggestedto increase whole body fat oxidation. Furthermore, IL-6 hasbeen reported to increase AMP-activated protein kinase(AMPK) phosphorylation and AMPK suggested to regulatePDHa activity. Together, this suggests that IL-6 may be in-volved in regulating PDH. The aim of this study was toinvestigate the effect of a single injection of IL-6 on PDHregulation in skeletal muscle in fed and fasted mice. Fed and16–18 h fasted mice were injected with either 3 ng·g−1 re-combinant mouse IL-6 or PBS as control. Fasting markedlyreduced plasma glucose, muscle glycogen, muscle PDHaactivity, as well as increased PDK4 mRNA and protein con-tent in skeletal muscle. IL-6 injection did not affect plasmaglucose or muscle glycogen, but increased AMPK and ACCphosphorylation and tended to decrease p38 protein content inskeletal muscle in fasted mice. In addition IL-6 injectionreduced PDHa activity in fed mice and increased PDHa
activity in fasted mice without significant changes in PDH-E1α phosphorylation or PDP1 and PDK4 mRNA and proteincontent. The present findings suggest that IL-6 contributes toregulating the PDHa activity and hence carbohydrate oxida-tion, but the metabolic state of the muscle seems to determinethe outcome of this regulation. In addition, AMPK and p38may contribute to the IL-6-mediated PDH regulation in thefasted state.
Keywords IL-6 . Pyruvate dehydrogenase activity . AMPK .
p38 . Skeletal muscle
Introduction
Skeletal muscle has an exceptional ability to adjust the sub-strate choice during fasting and exercise according to thesubstrate availability [9, 24]. During prolonged exercise, skel-etal muscle first oxidizes blood glucose and stored glycogen,but an increasing fraction of the energy is derived from fatoxidation as the exercise proceeds [37, 38]. This ensures thatexercise can continue, although at a lower exercise intensity.Similarly, fasting is associated with a switch in substrateoxidation from carbohydrates to fat markedly increasing sur-vival without food intake.
The pyruvate dehydrogenase complex (PDC) is central inthe regulation of substrate choice in skeletal muscle. PDCconverts pyruvate into acetyl CoA thereby linking glycolysiswith the citric acid cycle and represents the only entry forcarbohydrate-derived substrate into the mitochondria for oxi-dation. PDC is composed of several copies of three catalyticenzymes, which includes the pyruvate dehydrogenase (PDH)-E1α. Fasting has been shown to downregulate the activity ofPDH in the active form (PDHa) [43]. In addition, PDHaactivity increases with exercise [37], but declines towardsresting level as the exercise duration exceeds 2 h [25, 39].
R. S. Biensø : J. G. Knudsen :N. Brandt :H. PilegaardCentre of Inflammation and Metabolism and The August KroghCentre, University of Copenhagen, Copenhagen, Denmark
R. S. Biensø : J. G. Knudsen :N. Brandt : P. A. Pedersen :H. PilegaardDepartment of Biology, University of Copenhagen, Copenhagen,Denmark
H. Pilegaard (*)Universitesparken 13, 2100 Copenhagen Ø, Denmarke-mail: [email protected]
Present Address:N. BrandtExercise and Metabolic Disease Research Laboratory, TranslationalSciences Section, School of Nursing, University of California, LosAngeles, CA, USA
Pflugers Arch - Eur J PhysiolDOI 10.1007/s00424-013-1399-5
![Page 172: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/172.jpg)
Although PDHa activity can be allosterically regulated [2],phosphorylation/dephosphorylation of the α subunit of PDH-E1 is thought to be the mainmechanism regulating the activityof PDH. Phosphorylation and concomitant inactivation ofPDH is catalyzed by pyruvate dehydrogenase kinases(PDK), and dephosphorylation and concomitant activationof PDH is catalyzed by pyruvate dehydrogenase phosphatases(PDP). The decrease in PDHa activity during fasting seems tobe due to increased PDK4 protein and decreased PDP1 proteincontent in the muscle [43], while the reduction duringprolonged exercise does not appear to be caused by increasedPDK4 protein content but may be due to increased PDKactivity as previously reported [39]. The underlying mecha-nisms initiating the regulation of PDH during prolonged ex-ercise remains unresolved.
Interleukin (IL)-6 is a myokine released from contractingmuscle during exercise and suggested to exert autocrine,paracrine and endocrine effects [23]. The plasma IL-6 con-centration has been reported to increase in both humans andmice during prolonged exercise [20, 21]. In humans, theincrease in plasma IL-6 concentration during exercise is de-tectable after about 2 hour with moderate exercise intensityand increases further with exercise duration [12, 34], while anincrease in plasma IL-6 has been detected already after 30 minof intense exercise in mice [20]. Recombinant IL-6 has beenshown to increase free fatty acid release from myotubes [1]and increase fat oxidation in human skeletal muscle in vivo[35, 42]. In addition, IL-6 has been reported to increase AMP-activated protein kinase (AMPK) phosphorylation in rat skel-etal muscle [13], and rodent studies suggest that AMPK mayregulate PDH [17, 32]. Furthermore, IL-6 has been shown toincrease phosphorylation of the stress mitogen activated pro-tein (MAP) kinase p38 in incubated human muscle [6] andMAPK p38 has been demonstrated to be involved in theregulation of IL-6 transcription [36]. Furthermore, previousfindings suggest an association between increased p38 phos-phorylation and decreased PDHa activity in cardiomyocytes[29]. Together this suggests that IL-6 could be involved inregulating the substrate choice of muscle either by directlyregulating PDH or potentially via AMPK and p38. Therefore,the aim of the present studywas to examine the isolated effectsof a single injection of recombinant mouse (rm) IL-6 on PDHregulation in mouse skeletal muscle. As IL-6 normally iselevated during exercise in the presence of severe metabolicchallenge, the effect of IL-6 injection was determined in boththe fed and fasted state.
Methods
Mice Female C57BL/6 mice (Taconic, Lille Skensved, Den-mark) 8 weeks of age were used in the study. Female mice wereused because a previous study showed no indications of
gender-specific regulation of PDH [14] and because regularoestrous cycle has been reported to be absent in the majority offemale mice housed in large groups [41]. The mice had adlibitum access to water and normal chow diet (Altromin 1324,Brogaarden, Lynge, Denmark) and had a 12:12 light–darkcycle. The experiments were approved by the Danish AnimalExperimental expectorate (license no. 2009, 561 1607) andcomplied by the European Convention for the protection ofvertebrate animals used for experiments and other scientificpurpose (Council of Europe no. 123. Strasbourg, France 1985).
Experimental setup The mice were housed individually 24 hbefore initiation of the experiment and divided into two groupseither fed or fasted for 16–18 h. The mice were given anintraperitoneal injection of either phosphate-buffered saline(PBS) or rm IL-6 (3 ng·g−1) dissolved in PBS. The mice wereeuthanized by cervical dislocation 30 or 60 min after the injec-tion. Quadriceps muscles were removed and frozen in liquidnitrogen. Trunk blood was collected in EDTA containing tubesand plasma was collected after centrifugation at 2,600×g ,15 min, 4 °C. Muscle and plasma samples were stored at −80 °C.
Plasma glucose and plasma IL-6 Plasma glucose concentra-tion was analyzed fluorometrically [18]. The plasma IL-6concentration was determined using Meso Scale Discovery(Rockville, MD, USA) as described by the manufacturer.
Muscle glycogen Muscle samples were hydrolyzed in 1 MHCl and the muscle glycogen concentration was determinedfluorometrically as glycosyl units as previously described [22].
RNA isolation and reverse transcription Quadriceps musclesfrom the mice were crushed in liquid nitrogen to ensurehomogeneity of each sample. RNA was isolated using aguanidinium thiocyanate phenol-choloroform method as pre-viously described [4, 26] except that the samples were ho-mogenized using a Tissue LyserII (Qiagen, Hilden, Germany).Reverse transcription was performed using the Superscript IIRNase H- system (Invitrogen, Carlsbad, CA, USA) as previ-ously described [26].
Real time PCR mRNA content was determined by use of the5′ fluorogenic nuclease assay with TaqMan probes (ABIPRISM 7900 Sequence Detection System; AppliedBiosystems, Foster City, CA, USA) as previously described[19]. Primer and probe sequences are given in Table 1. Cyclethreshold values reflecting the content of a specific mRNAwere converted to an arbitrary amount by use of a standardcurve, constructed from a serial dilution of a representativesample run together with the unknown samples. For eachsample the amount of target cDNAwas normalized to the totalsingle stranded (ss)DNA content in the sample determined byOliGreen as previously described [19].
Pflugers Arch - Eur J Physiol
![Page 173: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/173.jpg)
SDS-PAGE and western blotting Crushed quadriceps muscleswere homogenized using a Tissue LyserII (Quagen, Hilden,Germany) and muscle lysate was prepared as previously de-scribed [25]. The protein content in each sample was determinedusing the bicinchoninic acidmethod (Pierce, Rockford, IL, USA).
Protein content and protein phosphorylation were deter-mined in muscle lysates using pre casted gels (Biorad, Hercu-les, CA, USA) or hand-casted gels and SDS-PAGE and West-ern blotting as previously described [16, 25] with primarypolyclonal antibodies against Signal Transducer and Activatorof Transcription (STAT)3 (9139; Cell Signaling Technology,Berverly, MA, USA), p38 (9212; Cell Signaling Technology),acetyl CoA carboxylase (ACC; P0397; DAKO, Glostrup, Den-mark), AMPKα2, PDP1, PDK4, and PDH-E1α (provided byProfessor Graham Hardie, Dundee University, Dundee, UK)and primary phospho-specific antibodies against STAT3 Tyr705
and AMPK Thr172 (9138 and 2535, respectively, Cell Signal-ing Technology), ACC Ser79 (07-303; Millipore, Bedford,USA), PDH-E1α site 1 (Ser293), site 2 (Ser300), and site 4(Ser295; provided by Professor Graham Hardie). Secondaryantibodies used were all species-specific horseradish peroxi-dase conjugated immunoglobulin (DakoCytomation, Glostrup,Denmark). The bands were visualized with ECL reagent(Millipore, Billerica, MA, USA) in a photo image system andquantified (Carestream Health, Rochester, NY, USA). ThePDP1 protein band was verified with recombinant protein.GAPDH protein was determined (2118, Cell Signaling Tech-nology) and showed no changes between groups.
PDHa activity PDHa activity was determined in muscle ho-mogenates as previously described [3, 5, 25, 31]. PDHaactivity in each sample was adjusted to the total creatinecontent in the homogenate as previously described [33].
Statistics Values are presented as means±SE. Two-wayANOVA tests were used to evaluate the effect of fasting andIL-6 injection by testing within each time point and within eachcondition. The data were log transformed if equal variance testfailed. If a main effect was observed, the Student–Newman–Keuls post hoc test was used to locate differences. In addition, aStudent’s t test was used to evaluate the effect of IL-6 within agiven time point and condition. Differences were consideredsignificant whenP <0.05 and a tendency is reported for 0.05≤P<0.1. The statistical tests were performed using SigmaPlot 11.0.
Results
Plasma IL-6
The plasma IL-6 concentration was measured to examine thetime course of plasma IL-6 after an IL-6 injection. The IL-6T
able1
Prim
erandTaqm
anprobes
Forw
ardprim
ers
Reverse
prim
ers
Taqm
anprobes
IL-6
5′GCTTA
ATTA
CACATGTTCTCTGGGAAA3′
5′CAAGTGCATCATCGTTGTTCATA
C3′
5′ATCAGAATTGCCATTGCACAACTCTTTTCTCAT′3
PDK4
5′GGAAGTA
TCGACCCAAACTGTGA′3
5′GGTCGCAGAGCATCTTTGC3′
5′CACTCAAAGGCATCTTGGACTA
CTGCTA
CCA3′
PDP1
5′CGGGCACTGCTA
CCTA
TCCTT′3
5′ACAATTTGGACGCCTCCTTA
CT3′
5′AGTGGCACAAGCACCCCAATGATTA
CTTC3′
Sequencesof
forw
ardandreverseprim
ersas
wellasTaqm
anprobes
used
forreal-tim
ePC
R
IL-6
interleukin6,PDK4pyruvatedehydrogenasekinase
4,PDP1pyruvatedehydrogenasephosphatase1
Pflugers Arch - Eur J Physiol
![Page 174: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/174.jpg)
injection increased (P <0.05) the plasma IL-6 concentration9.5-fold in fedmice and 40-fold in fastedmice 30min after theinjection relative to the PBS injected mice. After 60 min, theplasma IL-6 concentration was still elevated (P <0.05) 5-foldin fed mice and 12-fold in fasted mice relative to the PBS-injected mice (Fig. 1a).
In the IL-6-injected mice, the plasma IL-6 level was 2.4-fold higher (P <0.05) in fasted than fed mice at 30 min, whichmay be due to differences in blood volume or differences inuptake or removal of IL-6 from the blood. In the PBS-injectedmice, fasting reduced (P <0.05) the plasma IL-6 concentrationto 60 % compared with the fed mice (Fig. 1a). However, ofnotice is that such effect was not present at 30 min suggestingthat additional factors have contributed to the effect observedat 60 min (Fig. 1a).
STAT3 phosphorylation
STAT3 phosphorylation was determined in skeletal muscle toconfirm that IL-6 injections induced IL-6-mediated intracel-lular responses.
IL-6 injection increased (P <0.05) STAT3 Tyr705 phos-phorylation in skeletal muscle 2-fold in fed mice and 2.3-foldin fasted mice relative to PBS at 30 min after injection. At60 min, the injection of IL-6 increased (P <0.05) the STATTyr705 phosphorylation in skeletal muscle 2.2-fold in fed and2-fold in fasted mice relative to PBS-injected mice (Fig. 1b).
In the IL-6-injected mice, STAT3 Tyr705 phosphorylationwas at 30 min 1.8-fold higher (P <0.05) in the fasted than thefed mice (Fig. 1b).
Plasma glucose
The blood glucose concentration wasmeasured to describe themetabolic status of the mice during fasting and after IL-6injection. The IL-6 injection did not change the plasma
glucose concentration relative to PBS, neither in the fed northe fasted mice (Fig. 2a).
Plasma glucose concentration was at approximately 8 mMin fed mice independent of injection and decreased (P <0.05)to approximately 5 mM in the fasted mice both in the PBS andthe IL-6-injected mice (Fig. 2a).
Muscle glycogen
Muscle glycogen concentration was measured to describe themetabolic status of the mice during fasting and after IL-6injection. There was a main effect (P <0.05) of IL-6 injectionon muscle glycogen content at 30 min, but no changes wereobserved at 60 min (Fig. 2b).
Fasting reduced (P <0.05) the muscle glycogen contentwith 50–60 % compared with the fed mice independent ofinjection (Fig. 2b).
Signaling
AMPK, ACC and p38 phosphorylation were determined toexamine the effects of IL-6 on intracellular signaling in skel-etal muscle.
AMPK
There were no effects of IL-6 on AMPK Thr172 phosphoryla-tion in skeletal muscle of the fed mice. In the fasted mice, theIL-6 injection increased (P <0.05) AMPK Thr172 phosphory-lation 1.3-fold relative to PBS at 60 min (Fig. 3a).
In addition, at 30 min fasting tended to increase (0.05≤P <0.1) AMPK Thr172 phosphorylation 1.2-fold in the PBS-injected mice and in the IL-6-injected mice fasting increased(P <0.05) AMPK phosphorylation 1.2-fold relative to fed(Fig. 3a).
30 min 60 min
ST
AT
3 T
yr70
5 pho
spho
ryla
tion
/ ST
AT
3 pr
otei
n (A
U)
0.0
0.5
1.0
1.5
2.0
2.5
*
*
*
*
#
FED FASTED FED FASTEDPBS IL-6PBS IL-6 PBS IL-6 PBS IL-6
30 min 60 min
IL-6
pla
sma
conc
entr
atio
n (n
g·m
l-1)
0
20
40
60
80
100
120
140
160
180
FED PBS FED IL-6 FASTED PBS FASTED IL-6
*
*
**
#
#
a b 100kD
75kD100kD
75kD
p-STAT3
STAT
Fig. 1 Plasma concentration ofIL-6 and STAT3 phosphorylation.Plasma IL-6 concentration(nanograms per milliliter) (a) andSTAT3 phosphorylation (b) in fed(FED) and fasted (FASTED) mice30 and 60 min after a singleinjection of either PBS or rmIL-6.Values are means±SE; n=8. *P <0.05, significantly different fromPBS within given condition andtime point; #P<0.05,significantly different from FEDwithin given treatment and timepoint
Pflugers Arch - Eur J Physiol
![Page 175: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/175.jpg)
ACC
The IL-6 injection did not change ACC Ser79 phosphorylationin skeletal muscle of the fed mice. In the fasted mice, the IL-6injection increased (P <0.05) the ACC phosphorylation 1.4-fold in the fastedmice relative to the PBSmice at 60min whenusing a t test (Fig. 3b).
In line with the AMPK results, 30 min after injection, ACCSer79 phosphorylation was 1.5-fold higher (P <0.05) in fastedthan in fed mice injected with PBS and tended to be 1.4-foldhigher (0.05≤P <0.1) in fasted than in fed mice injected withIL-6 (Fig. 3b).
p38
The IL-6 injection did not change the phosphorylation level ofp38 when normalized to p38 protein content in skeletal mus-cle of fed or fasted mice (Fig. 3c). However, the IL-6 injectiontended to decrease (0.05≤P <0.1) the p38 protein content with70–85 % compared with PBS injection both at 30 and 60 min(Fig. 3c, d).
In addition, p38 protein content was 1.5- to 1.8-fold higher(P <0.05) in the fasted than the fed mice both at 30 and 60min(Fig. 3d).
IL-6 mRNA
IL-6 injection did not change the mRNA content of IL-6 inskeletal muscle of the fed and fasted mice (Fig. 4).
Furthermore, fasting increased (P <0.05) the IL-6 mRNAlevel 1.8- to 2.0-fold at 30 and 60 min but only in the IL-6-injected mice (Fig. 4).
PDH regulation
The mRNA and protein levels of PDK4 and PDP1 weredetermined together with the PDHa activity and PDH
phosphorylation to examine the effects of fasting and IL-6injection on PDH regulation.
PDK4 and PDP1 mRNA
IL-6 injection did not change the PDK4 mRNA content inskeletal muscle of the fed and fasted mice (Fig. 5a), but thePDP1 mRNA content tended to be higher (0.05≤P <0.1)60 min after IL-6 injection than PBS (Fig. 5c).
Fasting increased (P <0.05) the PDK4mRNA content 5- to6-fold Fig. 5a) and decreased (P <0.05) the PDP1 mRNAcontent with 60 % (Fig. 5c).
PDK4 and PDP1 protein
The PDK4 protein content in skeletal muscle increased (P <0.05) 1.6-fold in the fasted mice relative to the fed with noeffect of IL-6 injection (Fig. 5b). The PDP1 protein contentdid not change with IL-6 injection or with fasting (Fig. 5d).
PDHa activity
The PDHa activity in skeletal muscle tended overall to belower (0.05≤P <0.1) in the IL-6-injected fed mice than thePBS injected fed mice. In addition, the PDHa activity was inthe fed mice at 30 min 30 % lower (P <0.05) after IL-6injection than after PBS when using a t test. IL-6 injectionin the fasted mice increased (P <0.05) PDHa activity 2-fold at30 min and 1.8-fold at 60 min.
Furthermore, fasting overall reduced (P <0.05) the PDHaactivity in skeletal muscle to 15–30 % of the level in fed mice(Fig. 6a).
PDH-E1α phosphorylation
Overall, the effects on PDH-E1α phosphorylation were sim-ilar for the investigated PDH-E1α phosphorylation sites. IL-6
30 min 60 min
Pla
sma
gluc
ose
(mM
)
0
2
4
6
8
10
FED PBS FED IL-6 FASTED PBS FASTED IL-6
## #
#
30 min 60 min
Mus
cle
glyc
ogen
(m
mol
·kg-1
)
0
5
10
15
20
25
#
#
# #
*
a b
Fig. 2 Plasma glucose concentration and muscle glycogen. Plasma glu-cose concentration (millimolar) (a) and muscle glycogen (millimoles perkilogram) (b), in skeletal muscle of fed (FED) and fasted (FASTED) mice30 and 60 min after a single injection of either PBS or rmIL-6. Values are
means±SE; n =8. *P <0.05, significantly different from PBS withingiven condition and time point; #P <0.05, significantly different fromFED within given treatment and time point. Line indicates an overalleffect
Pflugers Arch - Eur J Physiol
![Page 176: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/176.jpg)
injection did not change PDH-E1α phosphorylation in the fedor fasted mice (Fig. 6b–d).
Fasted mice had 1.7- to 2.1-fold higher (P <0.05) PDH-E1α phosphorylation than fed mice independent of injection(Fig. 6b–d).
Discussion
The main finding of the present study is that IL-6 injectionsregulated PDHa activity in mouse skeletal muscle but differ-ently in fed and fasted conditions. In addition, an IL-6 injec-tion increased AMPK and ACC phosphorylation in mouseskeletal muscle only in the fasted state. This indicates that
AMPK did not mediate the IL-6-induced reduction in PDHaactivity in the fed state but could potentially be involved in theincrease in the fasted state. Furthermore, IL-6 reduced p38protein content in skeletal muscle in the fasted state, making itpossible that p38 could play a role in the observed IL-6-induced change in PDHa activity in the fasted state.
Skeletal muscle regulates substrate choice according toavailability and is therefore capable of coping with majormetabolic changes during exercise and fasting [2, 38]. Theprevious findings that IL-6 infusion in humans enhances fatoxidation in skeletal muscle [35] and that plasma IL-6 isincreased during prolonged exercise [21] suggest that IL-6could be involved in regulating substrate choice during exer-cise. The observation that the increase in plasma IL-6 after the
30 min 60 minAM
PK
Thr
172 p
hosp
hory
latio
n / A
MP
K
2 pr
otei
n (A
U)
0.0
0.1
0.2
0.3
0.4
FED PBS FED IL-6 FASTED PBS FASTED IL-6
*#
(#)
30 min 60 min
AC
C S
er79
pho
spho
ryla
tion
/ AC
C p
rote
in (
AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
#
(#)*
a b
30 min 60 min
p38
Ser
15 p
hosp
hory
latio
n / P
38 p
rote
in (
AU
)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
30 min 60 min
p38
prot
ein
(AU
)
0.0
0.2
0.4
0.6
0.8
1.0
(*)
(*)
(#)
#
#
c d
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
FED FASTED FED FASTEDPBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
FED FASTED FED FASTED
FED FASTED FED FASTED FED FASTED FED FASTED
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
50 kD
37 kD
50 kD
37 kD
250kD
150 kD
250kD
150 kDp-ACC
ACC
75
50kD
75kD
50 kD
p-AMPK
AMPK-2α
p-p38 p38
α
Fig. 3 Phosphorylation of AMPK, ACC, and p38. AMPK Thr172 phos-phorylation (a), ACC Ser79 phosphorylation (b), p38 Ser15 phosphory-lation (c), and p38 protein content (d) in skeletal muscle of fed (FED)and fasted (FASTED) mice 30 and 60 min after a single injection of eitherPBS or rmIL-6. Values are means±SE; n =8. *P<0.05, significantly
different from PBS within given condition and time point; #P<0.05,significantly different from FED within given treatment and time point.Symbols within parentheses indicate a statistical tendency, 0.05≤P<0.1.Line indicates an overall effect
Pflugers Arch - Eur J Physiol
![Page 177: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/177.jpg)
IL-6 injection in the present study was similar to the increasereported after a single exercise bout in mice [20], shows thatthe obtained IL-6 levels are at a physiologically relevant level.Furthermore, the increase in phosphorylation of the IL-6signaling marker STAT3 in skeletal muscle in the currentstudy demonstrates that IL-6 elicited an intracellular responsein skeletal muscle at the investigated time points. Together thissuggests that the present experimental setting can be used as amodel to investigate the isolated effects of IL-6 on PDHregulation in skeletal muscle during exercise. In addition, thepronounced fasting-induced decrease in muscle glycogen andplasma glucose concentration shows that the fasted mice wereseverely metabolically challenged. This provides a model toinvestigate the potential impact of the metabolic state for IL-6-mediated effects on PDH regulation in skeletal muscle.
The observation that IL-6 downregulated PDHa activity inskeletal muscle in the fed state is in accordance with the
30 min 60 min
PD
K4
mR
NA
/ ss
DN
A
0,0
0,5
1,0
1,5
2,0
FED PBS FED IL-6FASTED PBS FASTED IL-6
#
##
#
30 min 60 min
PD
P1
mR
NA
/ ss
DN
A
0.0
0.2
0.4
0.6
0.8
1.0
1.2
(*)
##
# #
30 min 60 min
PD
K4
prot
ein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
# ##
#
30 min 60 min
PD
P1
prot
ein
(AU
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
a b
c d
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
FED FASTED FED FASTED
FED FASTED FED FASTED
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
75 kD
50 kD
75 kD
50 kD
PDP1
PDK4
50 kD
37 kD
50 kD
37 kD
GAPDH
GAPDH
Fig. 5 mRNA and protein content of PDK4 and PDP1. PDK4 mRNA (a),PDK4 protein content (b), PDP1 mRNA (c), and PDP1 protein content (d)in skeletal muscle of fed (FED) and fasted (FASTED) mice 30 and 60 minafter a single injection of either PBS or rmIL-6. Values are means±SE; n=8.
*P<0.05, significantly different from PBS within given condition and timepoint; #P<0.05, significantly different fromFEDwithin given treatment andtime point. Symbols within parentheses indicate a statistical tendency, 0.05≤P<0.1. Line indicates an overall effect
30 min 60 min
IL-6
mR
NA
/ ss
DN
A
0.0
0.2
0.4
0.6
0.8
1.0
1.2
FED PBS FED IL-6 FASTED PBS FASTED IL-6
#
#
Fig. 4 IL-6mRNA content. IL-6 mRNA in skeletal muscle of fed (FED)and fasted (FASTED) mice 30 and 60 min after a single injection of eitherPBS or rmIL-6. Values are means±SE; n =8. #P<0.05, significantlydifferent from FED within given treatment and time point
Pflugers Arch - Eur J Physiol
![Page 178: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/178.jpg)
previously shown IL-6-induced fat oxidation [35, 42] andsuggests that IL-6 may contribute to regulating substratechoice during exercise towards increased skeletal muscle fatoxidation in part by regulating PDH. The previous observa-tion that an IL-6 injection increased AMPK phosphorylationin rat skeletal muscle suggests that AMPK may be mediatingIL-6-induced regulation [13]. Furthermore, AMPKα2 knock-out (KO) mice have been reported to exhibit an enhancedexercised-induced increase in PDHa activity [17] and theAMPK activator AICAR has been shown to increase PDK4mRNA in skeletal muscle [11]. Together this suggests that IL-6 mediates effects on PDH via AMPK. However, the presentobservation that AMPK and ACC phosphorylations wereunaffected by IL-6 injections in the fed state does not supportthat AMPK was directly involved in the observed IL-6-induced reduction in PDHa activity in the fed state.
The present findings that IL-6 elicited an increase in skel-etal muscle PDHa activity in the fasted state, despite the IL-6-induced downregulation in the fed state, indicate that themetabolic status influences the impact of IL-6 on PDH regu-lation. As IL-6 injections in the fasted state were associatedwith increased AMPK and ACC phosphorylation at 60 min, itis possible that AMPK was involved in the IL-6-mediatedPDH regulation at this time point. However, this potentialeffect of AMPK on PDH is opposite of the apparent AMPK-mediated suppression of the exercise-induced PDHa activa-tion, as suggested from the more marked exercise-inducedincrease in PDHa activity in AMPKα2 KO than wild-type(WT) mice [17]. However, the AMPKα2 KO mice in theprevious study had lower muscle glycogen and plasma glu-cose after exercise than WT [17]. Therefore, the more markedPDH activation in AMPKα2 KO mice may not be due to the
30 min 60 min
PD
H S
er30
0 pho
spho
ryla
tion
/ PD
H-E
1 (
AU
)
0
1
2
3
4
5
# #
##
30 min 60 min
PD
H S
er29
5 pho
spho
ryla
tion
/ PD
H-E
1
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
#
#
# (#)
30 min 60 min
PD
Ha
activ
ity (
mm
ol·m
in-1
·kg
-1 w
w)
0
1
2
3
4
FED PBS FED IL-6 FASTED PBS FASTED IL-6
* *
*
#
#
#
#
(¤)
30 min 60 min
PD
H S
er29
3ph
osph
oryl
atio
n / P
DH
-E1
(A
U)
0.0
0.5
1.0
1.5
2.0
2.5
#
# (#)
c d
a b
FED FASTED FED FASTED
FED FASTED FED FASTEDFED FASTED FED FASTED
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6
PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-6PBS IL-6 PBS IL-6 PBS IL-6 PBS IL-650 kD
37 kD50 kD
37 kD
50 kD
37 kD50 kD
37 kD
50 kD
37 kD50 kD
37 kD
p-PDH-E1
PDH-E1
p-PDH-E1
PDH-E1
p-PDH-E1
PDH-E1
Fig. 6 PDHa activity and phosphorylation of PDH. PDHa activity (mil-limoles per minute per kilogram) (a), PDH Ser293 phosphorylation (b),PDH Ser300 phosphorylation (c), and PDH Ser295 phosphorylation (d) inskeletal muscle of fed (FED) and fasted (FASTED) mice 30 and 60 minafter a single injection of either PBS or rmIL-6. Values are means±SE;
n =8. *P <0.05, significantly different from PBS within given conditionand time point; #P<0.05, significantly different from FED within giventreatment and time point; ¤0.05≤P<0.1, tendency for a difference be-tween IL-6 and PBS. Symbols within parentheses indicate a statisticaltendency 0.05≤P<0.1. Line indicates an overall effect
Pflugers Arch - Eur J Physiol
![Page 179: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/179.jpg)
lack of AMPK, but rather that the AMPKα2 KO mice weremore metabolically challenged than WT as also suggested inthe previous study [17, 25]. Furthermore, as low muscleglycogen has been suggested to enhance exercise-inducedIL-6 expression and release from skeletal muscle [12] themore marked PDHa activation in the AMPKα2 KO mice inthe previous study [17] may have been due to increased IL-6levels rather than lack of AMPK. This possibility is supportedby the previous finding that AICAR incubation elicited ahigher IL-6 release from AMPK kinase dead mouse musclethan WT muscle [7] and is also in line with the present IL-6-mediated increase in PDHa activity in the fasted state. Inaddition, the present findings that IL-6 injection tended toreduce p38 protein content in the fasted state may suggest thatp38 potentially have contributed to the observed IL-6-inducedincrease in PDHa activity, because increased p38 phosphory-lation has been associated with decreased PDHa activity incardiomyocytes [29]. Of notice, the IL-6-induced downregu-lation of p38 protein only 30 and 60 min after injection issurprisingly fast and indicates that IL-6 either inhibits p38synthesis or increases degradation.While a previous study hasshown that IL-6 regulates p38 phosphorylation in skeletalmuscle [40], no previous studies have to our knowledgereported IL-6-mediated regulation of p38 protein. However,it may be speculated that IL-6 mediates the regulation of p38mRNA targeting miRNA’s leading to reduced translation ofp38, but this remains to be determined.
As PDHa activity is known to be regulated by changes inNADH/NAD+, ATP/ADP, and acetyl CoA/acetyl [9, 24, 30],it may be speculated that IL-6 has mediated effects via chang-es in one of these ratios. Indeed a previous study has shownthat IL-6 incubation of rat EDL decreased the ATP concentra-tion and elevated the AMP concentration suggesting that IL-6-induced changes in nucleotides could play a role in the ob-served IL-6-mediated regulation of PDHa activity in the pres-ent study. An IL-6-induced decrease in ATP and increase inAMP concentrations would be expected to be associated withan enhanced PDHa activity, which is in accordance with thechanges observed in the fasted state in the present study.However, changes in ATP, ADP and AMP as well asNADH/NAD+ and acetyl CoA/acetyl are thought to exerteffects on PDHa activity through changes in PDH-E1α phos-phorylation [10, 24]. Because IL-6 injections did not affectPDH-E1α phosphorylation significantly neither in the fed northe fasted state in the present study, changes in these param-eters do not appear to be a likely mechanism for the observedIL-6-induced effects on PDH regulation.
It should be noted that IL-6 induced an increase in PDHaactivity when PDHa activity was at a very low level due to thefasting conditions. This means that the PDHa activity after IL-6 injections in the fasted state still was much lower than thelevel of PDHa activity after IL-6 induced downregulation ofPDH in the fed state. The mechanism behind such a switch is
unknown and additional studies are needed to answer this.The observations that PDHa activity, PDH-E1α phosphoryla-tion, PDK4 and PDP1 mRNA, as well as PDK4 protein weremarkedly changed by fasting in the present study are inaccordance with previous studies [27, 28]. This shows thatdifferences could be detected at the mRNA, protein phosphor-ylation, and activity level. Furthermore, the finding thatfasting elicited 90% reduction in PDHa activity in PBS, whileIL-6 injection only resulted in a 30 % reduction demonstratesthat the effect of 18 h of fasting is much more marked than asingle IL-6 injection. This may indicate that IL-6 only con-tributes to the regulation of PDH for example by sensitizingPDHa to the metabolic needs of the cell. However, it may alsobe worth noting that the magnitude of reduction in PDHaactivity in response to IL-6 injection is quite similar to thereduction previously reported in the exercise-induced increasein PDHa activity in human skeletal muscle, when muscleglycogen had been lowered prior to exercise [15]. This makesit possible that an enhanced IL-6 release contributed to thesmaller exercise-induced increase in PDHa activity whenmuscle glycogen was reduced in the previous study [15].Moreover, the similar magnitude of change in the presentstudy and the previous human study indicates that the ob-served change in PDHa activity with IL-6 injections is similarto changes observed in a physiological setting in humans [15].
PDH-E1α phosphorylation is known to be the dominantregulatory mechanism determining PDHa activity. The un-changed PDH-E1α phosphorylation with IL-6 injection inthe present study indicates that the observed changes in PDHaactivity was not due to changes in phosphorylation level. Suchdiscrepancy between PDHa activity and PDH-E1α phosphor-ylation has previously been reported in resting human andmouse skeletal muscle [14, 25], although the previous studiesobserved changes in PDH-1Eα phosphorylation withoutchanges in PDHa activity. As effects of PDK and PDP ex-pression and/or activity would be expected to influence thephosphorylation level of PDH-E1α, these PDH regulatoryproteins do not seem to be in play in the IL-6-mediated effects.This suggestion is in line with the unaffected PDK4 and PDP1protein level with a single IL-6 injection. Furthermore, theunchanged plasma glucose concentration and unchangedmuscle glycogen in the fed state upon IL-6 injection (althoughan overall difference was observed for muscle glycogen)indicate that IL-6 did not change the carbohydrate availabilityin the fed state. Thus, it seems unlikely that changes in themetabolic state have contributed to the observed downregula-tion of PDHa activity. It may therefore be speculated that IL-6has elicited alternative mechanisms like changes in acetylationstate, because several acetylation sites have been identified onPDH [8].
Based on the previous findings that reduced muscle glyco-gen has been shown to enhance IL-6 transcription in humanskeletal muscle [12] it may be expected that fasting would
Pflugers Arch - Eur J Physiol
![Page 180: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/180.jpg)
elevate muscle IL-6mRNA levels. However, the finding that afasting-induced elevation in IL-6 mRNA only was observedin IL-6 injected mice suggests that low glycogen is not suffi-cient to increase IL-6 mRNA, and that IL-6 exerts a positivefeedback on the expression of IL-6 when muscle glycogenlevels are low. In addition, the IL-6 induced intracellularsignaling observed both in the fed and fasted state while IL-6 mRNA only increased significantly in the fasted state in thepresent study, may suggest that an IL-6-mediated effect on IL-6 expression requires a factor which is only available whenmuscle glycogen is low. As p38 has been implicated in regu-lating IL-6 expression [36] the observed fasting-induced in-crease in p38 protein content may have contributed to theelevated IL-6 mRNA. However, the observed reduction inp38 protein content with IL-6 injection does not support thispossibility. Hence, the mechanism behind the fasting-inducedincrease in skeletal muscle IL-6 mRNA only when IL-6 wasinjected remains to be determined.
In conclusion, a single IL-6 injection reduces PDHa activityin mouse skeletal muscle in the fed state and increases PDHaactivity in the fasted state. This suggests that IL-6-mediatedPDH regulation contributes to regulating substrate choice, butthat the metabolic state determines the outcome. IL-6 appearsto regulate PDHa activity without clear changes in PDH-E1αphosphorylation and AMPK and p38 may be involved in theIL-6-mediated PDH regulation in the fasted state.
Acknowledgments This study was funded by the Danish MedicalResearch Council for Independent Research and the Novo nordisk Foun-dation. We would also like to thank Prof. Graham Hardy (DundeeUniversity, Dundee, U.K) for providing the PDH phospho specific,PDK4 and PDP1 antibodies. Centre of Inflammation and Metabolism,(CIM) is supported by a grant from the Danish National ResearchFoundation (# 02-512-55).
Open Access This article is distributed under the terms of the CreativeCommons Attribution License which permits any use, distribution, andreproduction in any medium, provided the original author(s) and thesource are credited.
References
1. Al-Khalili L, Bouzakri K, Glund S, Lonnqvist F, Koistinen HA,Krook A (2006) Signaling specificity of interleukin-6 action onglucose and lipid metabolism in skeletal muscle. Mol Endocrinol20:3364–3375
2. Behal RH, Buxton DB, Robertson JG, Olson MS (1993) Regulationof the pyruvate dehydrogenase multienzyme complex. Annu RevNutr 13:497–520
3. Cederblad G, Carlin JI, Constantin-Teodosiu D, Harper P,Hultman E (1990) Radioisotopic assays of CoASH and carnitineand their acetylated forms in human skeletal muscle. AnalBiochem 185:274–278
4. Chomczynski P, Sacchi N (1987) Single-step method of RNA isola-tion by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem 162:156–159
5. Constantin-Teodosiu D, Cederblad G, Hultman E (1991) A sensitiveradioisotopic assay of pyruvate dehydrogenase complex in humanmuscle tissue. Anal Biochem 198:347–351
6. Glund S, Deshmukh A, Long YC, Moller T, Koistinen HA, CaidahlK, Zierath JR, Krook A (2007) Interleukin-6 directly increases glu-cose metabolism in resting human skeletal muscle. Diabetes 56:1630–1637
7. Glund S, Treebak JT, Long YC, Barres R, Viollet B, WojtaszewskiJF, Zierath JR (2009) Role of adenosine 5′-monophosphate-activatedprotein kinase in interleukin-6 release from isolated mouse skeletalmuscle. Endocrinology 150:600–606
8. Gnad F, Gunawardena J, Mann M (2011) PHOSIDA 2011: theposttranslational modification database. Nucleic Acids Res 39:D253–D260
9. Harris RA, Bowker-Kinley MM, Huang B, Wu P (2002) Regulationof the activity of the pyruvate dehydrogenase complex. Adv EnzymRegul 42:249–259
10. Howlett RA, Parolin ML, Dyck DJ, Hultman E, Jones NL,Heigenhauser GJ, Spriet LL (1998) Regulation of skeletal muscleglycogen phosphorylase and PDH at varying exercise power outputs.Am J Physiol 275:R418–R425
11. Jorgensen SB, Wojtaszewski JF, Viollet B, Andreelli F, Birk JB,Hellsten Y, Schjerling P, Vaulont S, Neufer PD, Richter EA,Pilegaard H (2005) Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J 19:1146–1148
12. Keller C, Steensberg A, Pilegaard H, Osada T, Saltin B, Pedersen BK,Neufer PD (2001) Transcriptional activation of the IL-6 gene inhuman contracting skeletal muscle: influence of muscle glycogencontent. FASEB J 15:2748–2750
13. Kelly M, Gauthier MS, Saha AK, Ruderman NB (2009) Activationof AMP-activated protein kinase by interleukin-6 in rat skeletalmuscle: association with changes in cAMP, energy state, and endog-enous fuel mobilization. Diabetes 58:1953–1960
14. Kiilerich K, Adser H, Jakobsen AH, Pedersen PA, Hardie DG,Wojtaszewski JF, Pilegaard H (2010) PGC-1alpha increases PDHcontent but does not change acute PDH regulation in mouse skeletalmuscle. Am J Physiol Regul Integr Comp Physiol 299:R1350–R1359
15. Kiilerich K, Gudmundsson M, Birk JB, Lundby C, Taudorf S,Plomgaard P, Saltin B, Pedersen PA, Wojtaszewski JF, Pilegaard H(2010) Low muscle glycogen and elevated plasma free fatty acidmodify but do not prevent exercise-induced PDH activation in hu-man skeletal muscle. Diabetes 59:26–32
16. Kiilerich K, Ringholm S, Bienso RS, Fisher JP, Iversen N, van HG,Wojtaszewski JF, Saltin B, Lundby C, Calbet JA, Pilegaard H (2011)Exercise-induced pyruvate dehydrogenase activation is not affectedby 7 days of bed rest. J Appl Physiol 111:751–757
17. Klein DK, Pilegaard H, Treebak JT, Jensen TE, Viollet B, SchjerlingP, Wojtaszewski JF (2007) Lack of AMPKalpha2 enhances pyruvatedehydrogenase activity during exercise. Am J Physiol EndocrinolMetab 293:E1242–E1249
18. Lowry OH, Passonneau JV (1972) A flexible system of enzymaticanalysis. Academic, New York
19. Lundby C, Nordsborg N, Kusuhara K, Kristensen KM, Neufer PD,Pilegaard H (2005) Gene expression in human skeletal muscle:alternative normalization method and effect of repeated biopsies.Eur J Appl Physiol 95:351–360
20. Nedachi T, Fujita H, Kanzaki M (2008) Contractile C2C12 myotubemodel for studying exercise-inducible responses in skeletal muscle.Am J Physiol Endocrinol Metab 295:E1191–E1204
21. Ostrowski K, Rohde T, Zacho M, Asp S, Pedersen BK (1998)Evidence that interleukin-6 is produced in human skeletal muscleduring prolonged running. J Physiol 508(Pt 3):949–953
22. Passonneau JV, Lauderdale VR (1974) A comparison of threemethods of glycogen measurement in tissues. Anal Biochem 60:405–412
Pflugers Arch - Eur J Physiol
![Page 181: Regulation of PDH, GS and insulin signalling in skeletal ...20Sj%F8rup%20Biens%F8.pdf · training on glucose-mediated regulation of PDH and GS in skeletal muscle in elderly men, 3)](https://reader036.vdocuments.mx/reader036/viewer/2022081615/5fd80f5a57d06c542f7875cc/html5/thumbnails/181.jpg)
23. Pedersen BK, Febbraio M (2005) Muscle-derived interleukin-6—apossible link between skeletal muscle, adipose tissue, liver, and brain.Brain Behav Immun 19:371–376
24. Peters SJ (2003) Regulation of PDH activity and isoform expression:diet and exercise. Biochem Soc Trans 31:1274–1280
25. Pilegaard H, Birk JB, Sacchetti M, Mourtzakis M, Hardie DG,Stewart G, Neufer PD, Saltin B, van HG, Wojtaszewski JF (2006)PDH-E1alpha dephosphorylation and activation in human skeletalmuscle during exercise: effect of intralipid infusion. Diabetes 55:3020–3027
26. Pilegaard H, Ordway GA, Saltin B, Neufer PD (2000)Transcriptional regulation of gene expression in human skeletalmuscle during recovery from exercise. Am J Physiol EndocrinolMetab 279:E806–E814
27. Pilegaard H, Osada T, Andersen LT, Helge JW, Saltin B, Neufer PD(2005) Substrate availability and transcriptional regulation of meta-bolic genes in human skeletal muscle during recovery from exercise.Metabolism 54:1048–1055
28. Pilegaard H, Saltin B, Neufer PD (2003) Effect of short-term fastingand refeeding on transcriptional regulation of metabolic genes inhuman skeletal muscle. Diabetes 52:657–662
29. Puthanveetil P, Wang Y, Wang F, Kim MS, Abrahani A,Rodrigues B (2010) The increase in cardiac pyruvate dehydro-genase kinase-4 after short-term dexamethasone is controlled byan Akt-p38-forkhead box other factor-1 signaling axis.Endocrinology 151:2306–2318
30. Putman CT, Spriet LL, Hultman E, Dyck DJ, Heigenhauser GJ(1995) Skeletal muscle pyruvate dehydrogenase activity during ace-tate infusion in humans. Am J Physiol 268:E1007–E1017
31. Putman CT, Spriet LL, Hultman E, Lindinger MI, Lands LC,McKelvie RS, Cederblad G, Jones NL, Heigenhauser GJ(1993) Pyruvate dehydrogenase activity and acetyl group ac-cumulation during exercise after different diets. Am J Physiol265:E752–E760
32. Smith AC, Bruce CR, Dyck DJ (2005) AMP kinase activation withAICAR simultaneously increases fatty acid and glucose oxidation inresting rat soleus muscle. J Physiol 565:537–546
33. St Amand TA, Spriet LL, Jones NL, Heigenhauser GJ (2000)Pyruvate overrides inhibition of PDH during exercise after a low-carbohydrate diet. Am J Physiol Endocrinol Metab 279:E275–E283
34. Steensberg A, van HG, Osada T, Sacchetti M, Saltin B, Klarlund PB(2000) Production of interleukin-6 in contracting human skeletalmuscles can account for the exercise-induced increase in plasmainterleukin-6. J Physiol 529(Pt 1):237–242
35. van HG, Steensberg A, Sacchetti M, Fischer C, Keller C, SchjerlingP, Hiscock N, Moller K, Saltin B, Febbraio MA, Pedersen BK (2003)Interleukin-6 stimulates lipolysis and fat oxidation in humans. J ClinEndocrinol Metab 88:3005–3010
36. Vanden Berghe W, Vermeulen L, De WG, De BK, Boone E,Haegeman G (2000) Signal transduction by tumor necrosis factorand gene regulation of the inflammatory cytokine interleukin-6.Biochem Pharmacol 60:1185–1195
37. Ward GR, Sutton JR, Jones NL, Toews CJ (1982) Activation byexercise of human skeletal muscle pyruvate dehydrogenase in vivo.Clin Sci (Lond) 63:87–92
38. WattMJ, Heigenhauser GJ, Dyck DJ, Spriet LL (2002) Intramusculartriacylglycerol, glycogen and acetyl group metabolism during 4 h ofmoderate exercise in man. J Physiol 541:969–978
39. Watt MJ, Heigenhauser GJ, LeBlanc PJ, Inglis JG, Spriet LL, PetersSJ (2004) Rapid upregulation of pyruvate dehydrogenase kinaseactivity in human skeletal muscle during prolonged exercise. J ApplPhysiol 97:1261–1267
40. Weigert C, Dufer M, Simon P, Debre E, Runge H, Brodbeck K, HaringHU, Schleicher ED (2007) Upregulation of IL-6 mRNA by IL-6 inskeletal muscle cells: role of IL-6 mRNA stabilization and Ca2+-depen-dent mechanisms. Am J Physiol Cell Physiol 293:C1139–C1147
41. Whitten WK (1959) Occurrence of anoestrus in mice caged ingroups. J Endocrinol 18:102–107
42. Wolsk E, Mygind H, Grondahl TS, Pedersen BK, van HG (2010) IL-6 selectively stimulates fat metabolism in human skeletal muscle. AmJ Physiol Endocrinol Metab 299:E832–E840
43. Wu P, Sato J, Zhao Y, Jaskiewicz J, Popov KM, Harris RA (1998)Starvation and diabetes increase the amount of pyruvate dehydroge-nase kinase isoenzyme 4 in rat heart. Biochem J 329(Pt 1):197–201
Pflugers Arch - Eur J Physiol