regulation of non-pituitary prolacttn gene expression · rvork on this interesting and challenging...

REGULATION OF NON-PITUITARY PROLACTTN GENE EXPRESSION

BY

Michelle Lynn Gaasenbeek

Department of Biochemistry

Submitted in partial fûlfillment

of the requirements for the degree of

Masters of Science

Faculty of Graduate Studies

The University of Western Ontario

London. Ontario

January. 1998

Michelle Lynn Gaasenbeek 1998

National Library Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 W e U i Street 395. rue Wellington OttawaON K 1 A W OttawaON K 1 A W Canada canada

The author has granted a non- exclusive licence allowing the National Lhrary of Canada to reproduce, loan, distribute or sell copies of this thesis in microfom, paper or electronic formats.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts ikom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur format électronique.

L'auteur consenre la propriété du droit d'auteur qui protège cette thèse. Ni fa thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

ABSTRACT

Differentitiation or decidualization of the human endometrial stroma is controlled

by steroid hormones. Our aim was to study prolactin (PRL) gene expression. which

occurs concomitant with decidualization. by DNase 1 hypersensitivity analysis and

transient transfection analysis. Two endometnal stroma1 ce11 lines. B l OTl and M4.

treated with 8-Bromo-CAMP (cyclic adenosine monophosphate) and MPA

(medroxyprogesterone acetate). did not produce PRL. Using lymphoblast ce11 lines IM-9-

P X (positive-PRL) and IM-9-P6 (negative-PRL) for DNase I hypersensitivity. no sites

were detected in 22.5 kb of decidual PRL 5' flanking DNA. Intron A-1 contained three

sites in IM-9-PX PEU promoter deletion constmcts containing 5000 bp of 5' Hanking

DNA and deletions therein m s i e n t l y transfected into IM-9-P33. IM-9-P6. non-treated

and treated B lOTl and HeLa cell lines revealed basal activation. Transient transfections

of the region into the same ce11 lines revealed basal activation in the sense orientation and

60-80-fold increase when placed in the antisense orientation.

. . . I l l

ACKNOWLEDGMENTS

1 would like to thank my supervisor. Dr. Gabriel DiMattia. for allowing me to

rvork on this interesting and challenging project and for his extensive scientific

knowledge. This is an expenence 1 will never forget for 1 have not only broadened my

knowledge in science but also in life: it has been both a difficult time and a rewardine

time.

i am also grateful to my advisory committee. Dr. Trevor Archer. Dr. Chris Brandl.

and Dr. Geoff Hammond for their input into this project. 1 would especially like to thank

Dr. Archer for his support over the years as someone 1 could go to for guidance and to

Dr. Brandl for his critical review of this thesis.

1 would like to thank al1 my friends for always being there for me. I do not know

what 1 would have done without my f ~ e n d s on the 4'h Boor. Marja. Colleen. Catherine

and Huay-Leng. They provided a continual source of warmth. guidance and fiiendship:

they made me laugh through the long days and nights. 1 will forever be grateful to have

met them.

Finally. a special thanks to my parents who have ssupported me unconditionally.

both emotionally and financially. through the good times and especially through the bad

times. They continue to be a source of support and two people whom 1 truly admire and

hope to emulate.

TABLE OF CONTENTS

.. ............................................................. CERTIFICATE OF EXAMINATION 11

... .......................................................................................... ABSTRACT 111

......................................................................... ACKNOWLEDGEMENTS iv

........................................................................... TABLE OF CONTENTS v ... ................................................................................ LIST OF FIGURES xi11

................................................................................... LIST OF TABLES x

.................................................................... LIST OF ABBREVIATIONS ..xi

................................................. CHAPTER 1 - GENEML INTRODUCTION - 1

3 ............................................... 1.1 Human Endometrial Decidualization .-

............................................... 1.1.1 Primate Utenne Structure -3

1.1 . 2 Endometrial Changes Associated with the Ovulatory Cycle ........ -7

............... 1.1.3 Grne Expression Associated with the Menstrual Cycle 8

............................... 1.1.4 Endometrial Stroma1 Ce11 Mode1 System 9

................................................................................ 1.2 Prolactin 11

................................................ 1.7.1 Biochemistry of Prolactin II

........................................... 1.22 P i t u i t q Prolactin Expression 15

........................... 1 2.3 Extrapituitary Sites of Prolactin Expression 16

.................................................................... 1.3 Decidual Prolactin 18

............................................. 1.3.1 Decidual Prolactin Function 19

......................... 1.3.2 Regulation of Decidual Prolactin Expression 20

....................................... 1.4 Chromatin as a Modulator of Transcription 3 1

1.4.1 Chromatin Structure and Regulation of Prolactin Gene

7- ........................................................................ Expression -J

.................................................................... 1 -5 Purpose of Thesis -24

...... CHAPTER 2- MODELS OF HUMAN ENDOMETRIAL DECIDUALIZATION 76

.................................................................. 2.1 MTRODUCTION -27

.................................................... 2.2 MATERIALS AND METHODS 28

............................................................... 2.2.1 Ce11 Culture -28

4.2.2 Gel Electrophoresis and Transfer of Genomic DNA ................. 68

42.3 Hybridization and Quantification of 3 ' ~ - d ~ ~ ~ Labeled Probes ... -69

................................... 43.4 DNasr 1 Hypersensitivity Analysis -69

.............................................................................. 4.3 RESULTS 72

...................................................... 4.3.1 Expenmental Design 72

4.3 2 Charactenzation of DNase 1 Hypersensitivity Parent Fragments .. 73

........... 4.3.3 Analysis of the Superdistal Region of the Prolactin Gene 78

.................................. 4.3.4 Distal Analysis of the Prolactin Gene 78

............................. 4 . 3 Proximal Analysis of the Prolactin Gene -87

................................. 4.3.6 Analysis of Prolactin Gene Intron A-1 87

4.4 DISCUSSION ......................................................................... 98

............................. CHAPTER 5- TRANSIENT TRANSFECTION ANALYSIS 101

5.1 INTRODUCTION .................................................................. 102

.................................................. 5.2 MATERIALS AND METHODS 103

............................. 5.2.1 Prolactin Promoter Deletion Constructs -103

......................................... 5.2.2 Transient Transfection Assay -104

........................................................................... 5.3 RESULTS -109

....................... 5.3.1 Transfection of IM-9-P33 and IM-9-P6 Cells 109

........... 5.3.2 Transfection of Treated and Non-Treated B IOTI Cells -112

............................................. 5 . 3 . Transfection of HeLa CelIs 112

............. 5.3.4 Transfection of Intron A-1 Sequences of hPRL Gene -117

....................................................................... 5.4 DlSCUSSION -124

.............................. CHAPTER 6- SUMMARY AND FUTURE DIRECTIONS -128

................................................................................... REFERENCES -137

............................................................................................. VITAE -147

vii

FIGURE

LIST OF FIGURES

DESCRIPTION PAGE

............................................................... Illustration of hiinan uterus 5

........................................................ Structure of human prolactin gene 12

................................................ Sequence of hPRL prirners for RT-PCR -38

.......................................... Expression of hPRL mRNA in B 1 OT 1 cells ...-!O

................................... Expression of GR and PR in B 1 OT1 and M4 cells ..A3

.................................... Expression of AR and ER in B 1 OT1 and M4 cells .45

......................................... Expression of PR in B 1 OT1 cells by RT-PCR .47

................................................ Map of human PRL genomic clone 7D -58

.......................................... Map of genomic sequence of dPRL promoter 60

............................................ Map of genomic clone 7D with hPRL gene 62

............................................ DNase 1 hypersensitivity mapping strategy 71

..................... Characterization of DNase 1 hy persensitivity parent fragments 75

..................... Characterization of DNase 1 hypersensitivity parent fragments 77

......... Map of hPRL gene superdistal region for DNase 1 hypersensitivity expts 80

DNase 1 sensitivity of hPRL superdistal region in IM-9-P33 and IM-9-P6 cells.8 1

Map of hPRL gene distal region for DNase 1 hypersensitivity experiments ....... 84

DNase 1 sensitivity of hPRL distal region in IM-9-P33 and IM-9-P6 celis ........ 86

Map of hPRL gene proximal region for DNase 1 hypersensitivity experiments .. .89

... DNase 1 sensitivity of hPRL proximal region in IM-9-P33 and IM-9-P6 cells 91

Map of hPRL gene intronic region for DNase 1 hypersensitivity expeiiments .... 93

.................... DNase 1 sensitivity of hPRL intronic region in IM-9-P33 cells -95

....................... DNase I sensitivity of hPRL intronic region in IM-9-P6 cells 97

........................................... Map of pGL2-hPRL transfection constructs 106

........................ Sequence of rat PRL -36 minimal promoter in pGL2-Basic 108

Transient transfection of dPRL promoter constructs in IM-9-P3 3 and IM-9-P6

5.4 Transient transfection of dPRL promoter constnicts in non-treated and hormone- 9-0 treated BIOT1 cells at 33 C ............................................................. 114

5.5 Transient transfection of dPRL promoter constmcts in hormone-treated B 1 OT1

celts at 39°C and HeLa cells.. ........................................................... 1 16

5.6 Transient transtèction of intronic chimeric reporter constnicts in [M-9-P33 and

............................................................................ IM-9-P6 cells.. 1 19

5.7 Transient transfection of intronic chimeric reporter constructs in non-treated and

hormone-treated B 1 OTI cells at 33°C.. .............................................. -12 1

5.8 Transient transtèction of intronic chimeric reporter constructs in hormone-treated

B IOT1 cells at 39°C and HeLa cells.. ................................................ -123

LIST OF TABLES

7.1 Experimental Paradigrn of in i*Nro Decidualization.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -34

LIST OF ABBREVIATIONS

bp CAMP cDNA CBP CRE CREB CsCl D-PBS DEPC ddHzO DNA dPRL Ez ECM ERE ER FBS ,g GH GR hPRL HS IGF IRMA Kb kDa LB LDL LIF LINE

ng p h PL PRL

androgen receptor 8-bromo-cyclic adenosine 5' monophosphate base pair c yclic adenosine Ymonophosphate cornplimentary deoxyribonucleic acid CREB-binding protein cAMP response-element CAMP response element-binding protein cesium chloride Dulbeco's phosphate buffered saline diethy Ipyrocarbonate double distilled water deoxyribonucleic acid deciduai prolactin estradiol extracellular matrix estrogen response elernent estrogen receptor fetal bovine serum grarns grow-th hormone ~lucocorticoid receptor C

human prolactin hy persensitive insulin-like growth factor immunoradiometric assay kilobase ki lodalton Luria Broth low-density lipoproteins leukemic inhibitory factor long interspersed element millilitre molar miIlimetre millimolar medroxyprogesterone acetate messenger ribonucleic acid nanogram plaque forming units placental lactogen prolactin

PR RNA rPRL RT-PCR

SSC SV40 TRH U VIP

progesterone receptor ribonucleic acid rat prolactin reverse transcriptase- pol y merase chain reaction standard saline citrate simian virus 40 thyrotropin-releasing hormone units vasoactive intestinal peptide

CHAPTER 1

GENERAL NTRODUCTION

1.1 HUMAN ENDOMETMAL DECIDUALIZATION

The charactenzation of extra-pituitary prolactin (PRL) gene expression was the

focus of the research project described here. Initially. the aim was to characterize an in

vitro mode1 system with which to study the transcnptional regulation of human

endometrial PRL gene expression. In doing so. we wished to delineate DNA reguiatory

elements controlling endometrial-specific gene expression during decidualization. In

primates. decidualization is a process by which the endometrium of the utems is prepared

for implantation of a fertilized ovum. The resulting tissue. termed decidua provides a

favourable milieu for nourishment of the conceptus and is under the influence of the

ovarian hormones. estrogen and progesterone. In rats. the normal stimulus for the

decidual ce11 reaction is an implanting blastocyst but electrical stimulation. intraluminal

injection of oil. or simple mechanical traumatization of the endornetrium will induce

decidualization resulting in a mass of decidual cells. called a deciduoma (Abrahamsohn

et al.. l99j). In humans. formation of decidual cells during the ovulatory cycle coincides

with peak serum progesterone levels and occurs w-ithout utenne stimulation.

Decidualization is marked by a change in the rnorphology and h c t i o n of the

fibroblast-like stroma1 cells of the endornetrium to form fùlly differentiated deciduai cells

during the secretory phase of the menstrual cycle. In conjunction with this change in

cellular architecture, there is de novo synthesis of several proteins including epidermal

growth factor. type- 1 plasminogen activator inhibitor and prolactin. This process can be

successfully replicated in vitro using primary human endometnal stroma1 cells (Irwin ri

al.. 1989).

As mentioned earlier. progesterone c m initiate the decidualization process.

however. little is known about the molecular events downstrearn of progesterone action

with regard to endometrial decidualization. In vivo. several days pass between peak

senim progesterone levels and the formation of decidual tissue. Therefore. other

transcription factors are involved in conferring decidual-specific gene expression and

taken together. are responsible for denoting the function of the decidua.

The function of the decidua is still unclear: however. it is believed to play a role

in implantation and the maintenance of pregnancy (Weitlauf er al.. 1988). It is speculated

that decidual cells help guard against the extreme invasiveness of fetal

trophoblast cells which are the extraembryonic cells that function to connect the ernbryo

to the uterus. Nutrition of the blastocyst. endocrine secretion and protection of the fetus

against maternai immune rejection are al1 functions in which differentiated endometrial

stroma1 cells may play a role (reviewed in K e m s et al.. 1983). Decidual cells are aIso

thought to aid in the dissociation of the placenta at the termination of pregnancy.

1.1. I Primate Uterine Structure

The uterus is the portion of the reproductive tract that receives the fertilized ovum

from the oviduct. provides its attachment. and establishes the vascular connections

necessary for sustenance of the e m b l o throughout its development. Figure 1.1 shows the

structure of the uterus and the vascularization that occurs in the endometrium and the

myometrium . A major part of the thickness of the uterine wall consists of three layers

of smooth muscle and associated connective tissue fibres and matnx. termed the

myometrium. In the non-pregnant uterus. the sinooth muscle cells of the myometrium

usually have a length of 50 pm. In pregnancy however. the uterus increases about 24

times and the celfs of the myometriurn hypertrophy to a tength of more than 500 pm.

The secretion of estrogen from the ovaiy plays an important role in the maintenance of

the uterine smooth muscle celIs in terms of their size and differentiation.

The endometnum is positioned nearest to the uterine lumen. on top of the

myometrium As s h o w in Figure 1.1. the endometrium is formed by two distinct layers.

the stratum functionale and the stratum basale. differing in both structure and function.

In addition to its primary functions of implantation of a fertilized ovum. this tissue also

contributes in formation of the matemal portion of the placenta. The endometrium

differentiates to form decidual cells under the control of both estrogen and progesterone.

secreted from the ovary. Upon removal of these hormones (with the rernoval of the

ovaries) the endometrium atrophies. A rise in serum estrogen levels marks the increase in

blood flow to the uterus. This in turn causes the endometrium to become edematous. the

cells begin to hypertrophy. and there is an increase in the metabolic activity of the cells.

Figure 1.1 Schematic diagram of the human femde reproductive system

(A) Diagrarn of the fernale reproductive system. The

endometrium. where the process of decidualization occurs. along

with the myometrium are s h o w . (Adapted from Ross. M..

Rornrell. L.J.. and Kaye. G.I.. (eds): Histology: A Text and Atlas.

jrd ed. Baltimore. Williams and Wilkins. 1995. pg 679).

(B) Diagrarn of the endometriurn and the myometrium illustraring

the invasive blood vessels. (Adapted from (Taken from Ross. M..

Romrell. L.J.. and Kaye. G.I.. (eds): Histology: A Text and Atlas,

jrd ed. Baltimore. Williams and Wilkins. 1995 pg 693).

Endocervical canal

The endometrium is approximately 5 mm in thickness at the height of its

development in a normal menstmal cycle. It consists of a surface epitheliurn invaginated

to form nurnerous tubular glands that extend down into a very thick lamina propria the

endometrial stroma. These cells represent an unusually diverse population with

distinctive progams of proliferation and differentiation. It is the surface epithelial cells

lining the cavity that corne into direct contact with the embryo. Ultrastructural analysis

of the adult endometrium reveals complex physical contact between epithelial and

stromal cells, including evidence for local transport andor secretion of materials at the

epithelial-stroma1 interface (Roberts et ut.. 1988). This lends support to the theo- that

stromal cells regulate epithelial ce11 hnction. For example. it has been shown that

stroma1 production of interleukin-6 plays a role in controlling epithelial ce11 replication

(Tabibzadeh et ai.. 1989.)

Stroma1 cells resemble mesenchyme: these irregular stellate celis have large

nuclei. The proliferative endometrium contains characteristic spindle-shaped stroma1

cells during the estrogen-dominated follicular phase of the menstrual cycle and are

precursors of rounder decidual cells present during the luteal phase. The proliferative

potential of stromal cells is substantially greater than that of most other adult tissues. with

30% of cells exhibiting 50 or more doublings (Gurpide et ni.. 1992). Despite the

interaction between stromal and epithelial cells. stromal cells apparently undergo their

steroid hormone-induced differentiation independently of epithelial cells (More et al..

1974). Blood vessels are usually the t int site of formation of decidual cells. Vessels

proliferate in response to the thickening endometrium and there is an increase in capillan;

luminal size towards the end of the secretory phase of the menstrual cycle. Another

cellular component of the endornetrium are immune cells that include leukocytes and

macrophages.

1.1.2 Endometrial Changes Associated with the Ovulatory Cycle

During the course of a normal menstrual cycle. the endometrium passes through a

sequence of morphological and functional changes. The cycle cm be divided into three

recognizable stages: the proli ferative. the secreto- and the menstrual phases. They are

strictiy regulated by changes in ovarian biochemistry. The proliferative phase is marked

by a two to three fold increase in thickness of the endometriurn and it coincides with the

penod of growth of the ovarian follicles and their secretion of estrogen. The

concentration of endometrial progesterone receptors was found to increase dunng the

proIiferative phase and this is shown eo be due to estrogen (Kreitmann et al.. 1979) and

growth factor stimulation (Sumida et al.. 1988). Stroma1 cells of the proliferative phase

resemb[e tibroblasts in that they are long and spindle-like with a high nuclear to

cytoplasmic ratio. As blood levels of estradiol rise from the developing follicle. the

tubular epithelial glands increase in nurnber and in size. The extracellular matnx of the

stroma is abundant and metachromatic. During the proliferative phase. mitoses are

numerous in the epithelium and in the stroma. In an ideal 28-day cycle. the proliferative

phase ends at ovulation. or day 14. This marks the beginning of the secretory phase of

the cycle. which is regulated by the steroid hormone progesterone. Blood estradiol (E7)

levels are seen to decreasc during this phase. During the secretory phase of the cycle

there is some further thickening of the endometrium. This is caused by edema of the

stroma. and the accumulation of secretion in the utenne epithelial glands. The epithelial

elandular secretory activity reaches a maximum about 6 days after ovulation. The stroma1 C

cells begin to take on a more polygonal shape and have a higher cytoplasmic to nuclear

ratio as the secretory phase continues. This is due to the increased expression and cle

now ssynthesis of many proteins that are specific to the decidual ceil (Johannisson.. 1985)

The endometrium in mid-secretory and Iate secretory phases is 5 to 6 mm thick

and well vasculanzed. Characteristic of the secretory phase is the appearance of spiral

artenes: these vessels become increasingly coiled as they lengthen more rapidly than the

endornetriurn thickens. Srrum progesterone levels peak at approximately day 20 of the

cycle (released from the corpus luteum of the ovary). Progesterone regulates a cascade of

gene expression that includes growth factors and their receptors. extracellular matrix

proteins and enzymes involved in cellular metabolism (Ferenczy et al.. 1 99 1. Fay et czi..

1 99 1 ). This cascade of gene networks involves both activation and repression of gene

expression in the endometriurn. Although the stroma1 cells are refractory to estradiol

alone. E2 enhances the expression of progestin-mediated endpoints in the endornetrium.

It has been s h o w that stroma1 cells retain progesterone receptor (PR) despite the high

proeesterone L. levels dunng pregnancy which in other tissues uould normaily down-

regulate the PR number (Ingamells ri al.. 1 996). The fact that PR has not been found in

the secretory glandular epitheliurn strongly suggests a paracrine link between

decidualized stroma1 cells and epithelial cells as mentioned earlier (Bouchard ri al..

1994). If implantation occurs on day 2 1. the decidual ce11 reaction continues and by dap

27. proceeds to occupy the upper two thirds of the endometriurn. If implantation fails to

occur. s e m levels of progesterone fa11 off and the third stage of the cycle begins.

The termination of secretion from the uterine glands marks the beginning of

menstration. Hormonal stimulation of the endometrium by the ovaries rapidly declines

during this phase. The endometrium initially shnnks to 3 to 4 mm in thickness owing to

the loss in interstitial fluid. As menstruation proceeds. the endometrium fùrther shrinks

to approximately 0.5 to 3 mm with the glands and arteries appearing more collapsed and

shortened. When implantation occurs under the influence of progesterone. the process

spreads so that decidual cells becomes the main component of the endometrium of

pregnancy (Bell.. 1983).

1.1.3 Gene Expression Associated with the Menstrual Cycle

It has been well documented that factors promoting the differentiation of

endornetrial stroma1 cells include progesterone. estradiol. epidermal growih factor.

prostaglandin Ei, CAMP. and relaxin (Tabanelli et (il.. 1992). One of the primary

functions of decidual cells is prevention of hemorrhage during trophoblast invasion in

those species with a hemochorial placenta. During decidualization. the interstitial

extracellular matrix (ECM) surrounding the precursor decidual cells is converted to the

basal larninar-type ECM which foms a b h e r against invading trophoblast (Kislaus el

ni .. 1 987). This larninar-type ECM charactenstically contains high levels of larninin.

fibronectin. heparin sulphate proteoglycan and collagen type IV (Wewer r? a l . . 1985).

Therefore a key factor in implantation is the turnover of the ECM surrounding the pre-

decidual cells. Several proteins are known to be expressed during the decidual ce11

reaction. These include epidermal gro wth factor (Giudice et al.. 1 99 1 ). tissue factor

(Lockwood et al.. 1993). and the plasminogen activators (Schatz et al.. 1995). Two

proteins expressed only in the decidual cell and not by undifferentiated endometrial

stromal cells are prolactin and insulin-like growth factor binding protein-l (Imin rr cd. .

1993). These proteins are therefore ideal markers of deciduai cells. In vitro. there is a

tight correlation between decidualization and PRL gene activation. There is

approximately a 3-day delay between peak serum progesterone levels and prolactin

production (Invin et ol.. 1990). This indicates a possible cascade of events at the gene

level which regulate activation of the PRL gene as well as other phenotypic markers of

decidualization. Prolûctin is unique amongst these genes. however. as it is activated frorn

a quiescent state utilizing a tissue-specific promoter. Therefore. the elucidation of the

regulation of PRL gene expression in the decidua could possibly offer insight into the

molecuiar control of decidualization.

1.1.4 Endometrial Stroma1 Cell Mode1 System

Our knowledge of the molecular mechanisms goveming decidualization and the

role it plays in human reproduction is still quite limited. This can be attributed to the

complexity. both physiologically and biochemically. of this process. The establishment

of an in vitro mode1 for decidualization (primary human stromal ceIl culture) has enabled

researchers to begin to determine the mechanisms controlling this process. Previous

studies have shown that in vitro decidualization of primary endometrial stromal cells can

be achieved with the addition of progesterone. relaxin. CAMP and analogues (Irwin et al..

1989). The criteria which define the decidual phenotype are based upon PRL. laminin

and fibronectin production as well as morphological changes as observed with the

electron microscope. To date however. there are no decidual ce11 lines available with

which to study this process. Recently. there have been two endornetrial stromal ce11

lines, BIOT1 and M4. that were developed in order to study the neoplastic changes

involved in cancer of the uterus (Rinehart el al.. 1993). Primary endometrial stromal

cells were immortalized using a temperature sensitive SV40 large T antigen.

Imrnortalization of celis generally results in aneuploidy. a p h e n o ~ p e also seen in cancer.

In addition. the T antigen of the DNA simian virus 40 functions to extend the life span of

cells in culture; transformation of human cells with SV40 has become a standard

approach in the generation of ce11 lines. When the B 1 OTl and M4 cell lines are placed at

the restrictive temperature of 39°C. they undergo proliferative arrest such that they cease

to grow after one or two celi doublings. The temperature sensitive T antigen is non-

functional at the higher temperature because a point mutation in the protein results in

destabilization thereby allowing growth arrest. The cessation of growth is thought to be

due to an altered balance of p53 and other inhibitory proteins which interact with the

large T antigen. In addition. failure of the remaining SV40 T antigen to bind to p53 and

pRB at 39°C contributes to the proliferative arrest (Rinehart et al.. 1993). Afier

approximately three days in culture at 39°C the B 1 OT1 and M4 cells assume an enlarged

and flattened morphology characteristic of the senescent phenotype and remain viable for

up to two weeks. These cells have not been studied with regard to their decidualization

potential. in ternis of morphology and protein production such as that of PRL. and may

therefore represent 'an important tool in deciphenng the molecular regulation of

decidualization and utenne PRL gene expression.

In addition. there are two ce11 lines of human lymphoid origin that can be used to

ascertain the transcriptional regulation of non-pituitary PRL expression with a

mechanism potentially similar to that occumng in the human dscidual cell. The B-

lymphoblast ce11 line. IM-9-P. was originally established from the IM-9 line which had

been generated in 1967 from a wornan with multiple myeloma (Fahey rr rd.. 1971 ).

From the IM-9-P cells. a series of clonal lines were developed that were found to express

PRL at varying levels. IM-9-P33 cells stably express PRL and it is indistinguishable

from pituitary prolactin by immunological and biological cntena (DiMania et al.. 1988).

Another line. IM-9-P6 does not express the PKL gene. As will be discussed in a later

section. these human lymphoblast lines provide an easily manageable resource with

which to study non-pituitary PRL gene transcription. The regulation of lymphoblast PRL

gene transcription c m be compared to that of the hurnan decidual ce11 to tùrther refine

those components of the transcriptional machinery unique to the decidual cell.

1.2 Prolactin

Prolactin is a polypeptide hormone whose expression is not restricted to a single

ce11 type. Prolactin is most highly expressed in the vertebrate pituitary and at lower

levels in decidua. the myometnurn. and cells of the immune system. PRL has also been

detected in areas that do not produce this protein. Some tissues can transfer PRL from

the circulation into another compartment via PRL-binding proteins or receptors acting as

transporters. Proiactin can also be delivered to other sites by infiltrating lymphoc'es or

migratory macrophages. The diversity and compleiity of PRL Fmctions in humans have

not been fùlly elucidated. PRL is known to have mitogenic. morphogenic and secretoF

activities in a variety of tissues. It is important in rnarnrnary gland development.

initiation and maintenance of pregnancy. immune modulation. osmoregulation. and c m

affect behavior. The wide range of functions attributed to PRL c m be due to the diverse

areas of PRL production. posttranscriptional and posttranslational modifications. and

variant intramolecular signaling pathways and the respective target genes (reviewed in

Ben-Jonathan et al.. 1996).

1.2.1 Biochemistry of Prolactin

Prolactin is a 23-kDa protein hormone composed of 197 (rodent) or 199 (human)

amino acids with three intrarnolecular disulphide bonds. The gene is present in single

copy on chromosome 6 in humans and 17 in rats. Prolactin shares JO% homology with

growth hormone (GH) and placental lactogen (PL) based on amino acid sequence. The

structure of GH and PL is remarkedly similar with 5 exons and 4 introns: the genes

sharing identical positioning of introns. An additional altemate noncoding sixth exon in

the human PEU (hPRL) gene differentiates this structure from GH and PL. The PRL

gene however. contains the identical 5 exons and 4 introns seen in both GH and PL

(Figure 1.2). The upstream exon (la) encodes the transcription start site for expression

of extrapituitary PRL. whereas the downstrearn exon (exon 1) contains the start site for

pituitary-specific expression. Based on the relatedness of the sequences of

HUMAN PROLACTIN GENE

decidualAyrnphoid PRL pltuitary PRL start site start site

f-+ 5663bp intron A-1

EXON SIZE : 8Obp pituitary PRL rnRNA : 85bp 176bp 1 08bp 177bp 341 bp

decidual4ymphoid PRL rnRNA : 125bp

5'

2935bp

EXON COORDINATES : pituitary PRL mRNA :57bp 5' UTR + 1-9 aa

10-68 aa 69-1 04 aa 105-164 aa 165-227 aa 1 - 80bp decidualAymphoid PRL mRNA : 97bp 5' UTR + + 155bp 5' UTR 1-9 aa 3' UTR

1

A enhancer prorndw

these genes. (PRL. GH and PL). researchers estimated that they evolved by duplication

over 400 million years ago fiom a common origin (Miller et cri., 1983). The mature PRL

mRhA is about 1 kb and encodes a 227 amino acid protein that includes a 28 arnino acid

signal peptide that is cleaved upon entering the endoplasmic reticulum. The resultant

single polypeptide of 74 kDa has three intramolecular disulphide bridges and three

phosphorylation sites (Sinha et al.. 1992)

There are many different variants of PRL that are formed through transcnptional

or translational modifications. In the brain. a mRNA transcript has been reported

missing exon 4 and encoding a PRL protein of 137 amino acids in lenDgth (Emanuel et

d.. 1992). Posttranslational modifications. including proteolytic cleavage.

glycosylation. and phosphorylation. produce most of the variants seen. Most of these

variants do not retain PRL-like activities. and some are found to have unique propenies

or no knottn functions (Sinha et al.. 1995). One variant, a 16 kDa molecule. has been

found to possess antiangiogenic properties. It is produced by cathepsin D-like

proteolytic cleavage at residues 145-1 49. This cleavage results in the peneration of two

chains linked by a disulphide bond. It has been found in the hypothalamus. pituitary

and serum (Sinha er cil.. 1985). Interestingly enough. this activity is mediated through a

receptor distinct Bom the prolactin receptor (Clapp et al.. 1992).

The prolactin receptor belongs to the hematopoietic receptor farnily that includes

receptors for interleukins 2 to 7. granulocyte and granulocyte macrophage colony

stimulating factors. leukemic inhibitory factor (LIF) and GH (Kelly el al.. 199 1 ) . The

receptor contains a transmembrane domain. an extracellular domain and an intracellular

domain. The extracellular domains have specific regions of contact with ligands.

whereas the intrace1luIa.r domain functions in eiiciting the signal in response to ligand

binding (Kelly et cd.. 199 1 ).

1.2.2 Pituitary Prolactin Expression

Prolactin was first discovered as the hormone responsible for mammalian

lactation over 60 years ago (Neal et al.. 1994). Since then it has been well established

that pituitary expressed prolactin functions in regulation of mammary gland development.

and initiation and maintenance of lactation. PRL is secreted From the lactotropes of the

antenor pituitary. which are the last anterior pituitary ce11 type to differentiate. The

mechanism goveming pituitary prolactin expression is complex and has been well

documented. A POU-homeodornain transcription factor. Pit-1. is required for the

developrnent of somatotropes (GH secreting). lactotropes and thyrotropes (thyroid

stimulating hormone- secreting cells). The absence of this transcription factor results in

the Ioss of all these ce11 types (Rhodes et al.. 1994). It has also been found to be

essential for the activation of pituitary expressed PRL and GH (Lin et ol.. 1992). In

rodents. there is a 2.5 kb sequence of the PEU 5' flanking region that confers pituitary

specific expression: a proximal promoter (between +33 and -250 bp) and a distal

enhancer (between -1 300 and -1 800 bp). Pit-1 binds to two dornains: the proximal

prornoter (4 sites. 1 P to 4P) and the distal enhancer (sites lD-4D) (Ingraham et (il..

1988). Binding of a repressor molecule at position -85 to -1 12 is thought to restrict

expression of the rat PRL gene to lactotropes (Jackson et cd.. 1992). Conversely. the

human gene has three. rather than four. Pit-1 binding sites. and the distal enhancer has

eight binding sites. Interestingly enough. only two of these sites. D2 and D6 contain the

consensus sequence for Pit- 1 (Peers et d.. 1 99 1 ).

In addition to being regulated by Pit-1. many hormones. neurotransmitters. and

growth factors affect the PRL gene. Three main 5' regulatory regions control the

pituitary- specific transcription of the human prolactin gene. These regions include the

proximal promoter (-250 and 4 0 ) . the distal region (-1 750 to -1320) and a suprrdistal

region (-NO0 to -3500). Hormones such as thyrotropin-releasing hormone and

dopamine (Lavemere et al.. 1988: Maurer et al.. 1980): growth factors such as epidermal

erowth factor (Murdoch et al.. 1982): and steroid hormones such as glucocorticoids C

(Sakai et al.. 1988) control pituitary prolactin expression. These factors function in

activating protein kinase A. protein kinase C andor calcium/caImodulin-dependent

pathways (Gourdji et al.. 1994). In addition. while it does contain a degenerate estrogen

response element. (ERE) sequence. the human PRL promoter responds poorly to estrogen

(Gellersen et al.. 1995). However. in the rat. an irnperfect palindromic estrogen response

element is located in the distal enhancer, adjacent to the Dl Pit-1 site and mediates a

potent estrogen effect on the P R , gene. Estrogen requires multiple Pit-1 binding sites to

exert its actions. Binding of the estrogen receptor to the ERE is believed to initiate

looping of the DNA. bringing the enhancer and the promoter regions to juxtaposition via

protein-protein interactions for induction of gene transcription (Cullen et al.. 1993).

Dopamine has been shown to be one of the most important inhibitory factors of prolactin

eene expression. albeit mostly by indirect actions. It acts in part by decreasing the lrvel L

of intracellular cyclic AMP. which is a known inducer of PRL expression (DeCamili rr

(il.. 1979). While the rat PRL prornoter contains a degenerate cAMP response element

that partially mediates the response to CAMP. the cAMP response element binding

protein (CREB) does not bind to the promoter (Liang er d.. 1992). The rat Pit-1

promoter however has two functional CREB sites and therefore dopamine can affect the

PRL gene expression by altering Pit-1 gene expression. Transient transtèction

expenments involving 260 bp of Pit- 1 promoter containing two cAMP response-elements

(CREs) showed a marked decrease in activity in response to dopamine treatment (60-65%

decrease) (Elsholtz et al.. 199 1 ). This is comparable to that seen with 420 bp and 171 bp

prolactin promoters. also containing CREs (Liang rr al.. 1992). The Fact that deletion of

both the CREs in the promoter partially reduces the response to dopamine indicates that

the minimal promoter of the Pit- 1 gene is dopamine responsive (Elsholtz et ul.. 199 1 ). It

is not definitely known however. whether Pit-1 plays a role in dopamine signaling.

Studies have revealed hormone-induced modifications of transcription factors and or of

specific factor-binding proteins c m alter transcriptional efficiency (Gonzales et O!..

1989).

1.23 Extrapituitary Sites of PRL Expression

Prolactin is produced in the brain. by immune cells and in the uterus. In the brain.

immunoreactive PRL-material was first detected in nerve terminais of the hypothalamus

in intact. and later. in hypophysectomized rats (Fux et al.. 1977). PRL mRNA has been

detected in several areas of the brain. thereby substantiating that the gene is expressed

there. It appears that the mrchanisms goveming neuronal PRL gene expression differ

fiom those operating in the piniitary but none have been determined thus far. A

neurornodulatory role for brain PRL has been suggested as it has been shown to affect

the release of neuropeptides (Emmanuel et al.. 1987 ).

As mentioned previously. the myornetriurn is another source of PRL production.

The smooth muscle cells of the myornetriurn share a cornmon mesenchymal embryonic

origin with the stroma1 cells of the endometnum. It has been shown that myometrial PEU

is identical to pituitary PRL based on physiochemical and biological criteria (Gellersen et

LI/.. 199 1 ) . Like other non-pituitary sources of PRL. myometrial PRL utiIizes the

alternative upstrearn promoter. and is spliced to a position 98 bp from the pituitary

transcriptional start site. As will be discussed below. progesterone is the most important

stimulator of decidual PRL. The regulation of myometrial PRL however. differs

significantly from that of decidual ce11 PRL. Progesterone has been shown to inhibit

myometrial PRL expression (Gellersen et al.. 1990). This represents a unique situation in

that for the same gene (PRL). two adjacent tissues are regulated in opposite directions by

progesterone. To date. the role of myometrial PRL has not been elucidated.

Cells of the immune system are also a source of PRL. The synthesis of PRL from

immune cells is very low and requires activation of the cells to produce PRL. Initial

zvidence was based on a study showing an increase in bioactive PRL in the medium of

cuItured mouse splenocytes following stimulation with concanvalin A. In addition.

researchers found that antisemm directed against PRL prevented Nb2 ce11 proliferation

induced by conditioned medium from Con A-pretreated cultures of spleenocytes

(Montgomery er al.. 1 987). These observations were substantiated by demonstrations

that PRL is synthesized by and released from normal (Sabharwal et al.. 1992) and

malignant mononuclear cells such as the IM-9-P33 ce11 line (DiMattia et cil.. 1988).

PRL mRNA in rat and hurnan lymphocytes has been detected by Northem analysis. RT-

PCR. and in sitzr hybridization (Houwert-Dejong et al.. 1990). The PRL transcript in

human lymphocytes is identical to pituitary-derived PRL except for a longer 5'

untranslated region (O'Neal er al.. 1992).

It is generally believed that PRL functions in an autocrine/paracnne manner in

immune cells. For this to be true however. both hormone and receptor must be present.

This has been found to be the case as receptors have been detected. albeit at differinç

levels. in spleenocytes. in B-lymphocytes (highly expressed) and T lymphocytes (low

level of expression). The level of receptors in T-lymphocytes Vary; upon mitogen

activation. receptor number has been s h o m to increasr (Gagnerault et al.. 1993). PRL

functions are wide and diverse in immune cells. It has been associated with antibody

production. graft survival. mitogen-induced lymphocyte proliferation. and alteration of

spleenocytes and thymocytes (Kooijman e l ai.. 1996). In addition PRL c m associate

with cytokines and fùnction as coactivators. For example. in murine T helper L2 cells.

PRL requires coincubation with IL-? for inducing c-mye. proliferating ce11 nuclear

antigen, thymidine kinase. cyclin B. and histones (Clevenger et cil.. 1993).

1.3 Decidual Proiactin (dPRL)

Next to the pituitary. decidua is the major source of PRL. PRL is first detected in

decidualized endometrium dunng the late luteal phase of the menstrual cycle. If

pregnancy ensues. the decidual content of PRL increases markedly following

implantation. However. this rise in PRL is not dependent upon uterine implantation as a

similar rise in PRL is seen with tubal pregnancies (Maslar e~ al.. 1980). An increase in

PRL production is also seen in those women receiving progesterone or combined

estrogen-progesterone therapy (Meuris et al.. 1980)- These results strongly suggest that

the induction of PRL synthesis depends upon progesterone-induced decidualization of the

endometrium. PRL found in the amniotic fluid has been shown to bs transported there

by PRL receptors on the chorio-amniotic membrane. The source of the PRL was not

known (Josimovich rr ai-. 1977). Amniotic fluid. in addition to containing the 23-kDa

native PRL contains several variants of various sizes. It has now been established that

the source of arnniotic fluid PRL is the materna1 decidua (Riddick el al.. 1982).

Decidual prolaciin has chemical. biological. and immunologie properties identical

to those of pituitary prolactin (Golander et al.. 1978). While sequence analysis of

decidual PRL cDNA has established its structural identity with pituitary PEU. the mRNA

is approximately 130 nucleotides longer due to the presence of a 5' untranslated exon

located 5.6 kb upstream of the p i tu i tq transcriptional start site (Gellersen el al.. 1989).

This upstream exon is spliced to a position 98-bp upstream of the pituitary transcriptional

start site. effectively eliminating it. Sequence and primer extension analysis revealed that

PRL transcription occun from an identical site (exon la) in decidual cells and

lymphoblast cells (DiMattia ri al.. 1988). Therefore the use of an alternate promoter

accounts for the tissue-specific regulation of PRL gene expression at non-pituitq sites.

1.3.1 Decidual PRL Function

As mentioned earlier. PRL has a diverse repertoire of functions. In the case of

decidual PRL. it has been shown to be transported. through the action of specific PRL-

bindine C proteins. to the fetal arnniotic fluid where it reaches concentrations 50 to 100-fold

over materna1 and fetal blood PR. levels. This is due to the high rate of production of

PRL in the decidua (1 pg/g) and the relatively long half life in compared to other areas

(4.5 hours to 20 minutes in the blood) (Riddick et al., 1982). The local function of

decidual PRL, remains to be deterrnined and its role in the arnniotic fluid remain

speculative. Possible functions include effects on implantation. prevention of

immunological rejection of the blastocyst and inhibition of utenne contractility before

labor (Handwerger et cd.. 1992). Based on studies performed on Iower vertebrates which

show that PRL regulates water balance and rlectrolytes. a similar osrnoregulato~

function for PRL in the arnnion has been proposed. PRL causes a loss of water to the

matemal cornpartment from the arnniotic fluid when injected into pregnant rhesus

monkeys (Josimovich et rd.. 1977). -4dditionally a condition called polyhydramnios or

excessive production of arnniotic fluid coincides with a low level of PRL in the amniotic

tluid.

Presumably. PRL reaches the fetal circulation due to the swallowing of large

amounts of amniotic fluid. It has been proposed that fetal PRL might function in nbbit

fetal lung maturation by enhancing lung surfactant production (Hamosh ei al.. 1977).

These studies however have not been repeated with other species. There is also evidence

to support the Function of PRL in the development of the fetal immune system. The

amniotic fluid could thrrefore be a supply of PRL when fetal PEU synthesis is low

(Aubert et al., 1975).

1.3.2 Regdation of Decidual PRL Expression

Due to the existence of an alternative tissue specific promoter. regulation of

decidual PEU expression differs from that seen in the pituitary. Studies have shown that

hormonal regulatoa of pituitary prolactin expression such as dopamine. thyrotropin-

releasing hormone (TRH) and vasoactive intestinal peptide (VIP) have no effect on dPRL

expression (Golander et al.. 1979). Previous studies of 3000 bp of 5' flanking decidual

PRL promoter DNA by sequence analysis have shown the presence of two consensus Pit-

1 binding sites (localized between -40 to -250 and -1300 to -1 750). It was discovered

however that Pit-l is not required for expression (Gellersen et ni.. 1994). In addition

seven half-sites for glucocorticoid and progesterone receptor binding were found in 3000

bp of the decidual/lyrnphoid promoter. M i l e half sites have been s h o w in some cases

to represent functional regions of the DNA. these sites proved to be ineffectual in binding

either glucocorticoid and/or progesterone receptors (Gellersen et al.. 1 994). However it

has been shown that progesterone is necessary for PRL expression: proliferative phase

endometrial stroma1 cells do not secrete PRL. and secretory cells. following the removal

of progesterone. no longer produce PRL after 2-3 days (Irwin et d.. 1989). It is therefore

believed that progesterone activates PRL expression indirectly. In fact Wang and

coworkers ( 1994) have provided evidence that progesterone receptors do not CO-Iocalize

in PRL-producing decidual cells (Wang et d.. 1994). Furthemore. when activated

progesterone receptor was stably transfected into the PR-negative IM-9-PX B-lymphoid

ce11 line. it was s h o w to have no effect on the transcription of the endogenous PRL gene

or on a reporter gene construct containing 3000 bp of dPRL promoter transfected into

these cells (Gellersen et d.. 1994).

Cyclic AMP and analogues have a direct effect on decidual prolactin production.

Decidual prolactin deletion promo ter constmcts transient1 y transfected into

undifferentiated and fully differentiated endometrial stroma1 cells were shown to be

inducible by 8-Br-cAiiP. with 332 bp of dPRL promoter being essential for induction

(GelIersen et al., 1997). In addition this effect was compounded with the introduction of

medroxyprogesterone acetate (MPA). a synthetic progestin analogue. However. MPA

alone does not have any transcriptional effect on the dPRL gene (Gellersen et al.. 1994).

This therefore implies that the prirnary inducer of decidual PRL production is through a

cAMP signaling pathway. However. as previously seen in other in vitro experiments.

MPA has no effect when administered alone (Gellersen et al., 1994). Other factors such

as relêuin released from the corpus luteurn of the ovary and produced by the

endometrium: [GF-1: and insulin al1 stirnulate decidual prolactin release. Relaxin is a

potent stimulator and is believed to iünction via the cAMP sipnaling pathway and

activates PRL gene expression (Tseng et cil.. 1992). How these factors regulate dPRL at

the gene level is unknown. Chromatin structure aiso plays a key role in the regulation of

gene transcription and has been implicated in the control of pituitary PRL gene

espression: however. its contribution to extrapiniitary PRL gene expression has not been

rxplored. Therefore the following sections introduce the concept of chromatin structure

and its effect on gene expression.

1.4 Chromatin as a Modulator of Transcription

The field of transcriptional regulation and chromatin structure has exploded in the

recent years. Over the last twenty years there has been extensive evidence to suppon the

idea that chromatin tùnctions as more than just a passive mechanism for packing DNA

and repressing transcription. The transcriptional capability of a gene c m be rnodulated

through the presence or the absence of nucleosomes on a particular piece of DNA

(Felsenfeld er al.. 1992). For example in the Fas t PH05 gene. nucleosomes rnust be

remodeled by the binding of PH04 transcription factor to its response element in order

for transcription to occur. As a result of binding. four nucleosomes are disrupted and this

allows for transcription (Ventor et cil.. 1994 ). In contrast however. some promoters are

packaged in a chromatin structure such that cis-acting elements are always accessible to

tram-acting factors. In these genes. such as the heat shock gene HSP26. the

nucleosomes are not remodeled as a result of transcription factor binding (Cartwright rr

1 1986). Positioned nucleosomes can aid in bringing the widely spaced promoter and

enhancer sequences in closer proximity to help regulate gene transcription (Wolffe et al..

1994). Nucleosornes are commonly altered by pst-translational mechanisms such as

acetylation. de-acetylation and phosphorylation. Recently. several transcriptional co-

activaton have been found to possess acetyl-tramferase activity and this acety-tramferase

activity facilitates gene expression. One of these CO-activators

CBP and the related p300. has been shown to have histone

CREB- binding protein or

acety 1-tram ferase activity

(Ogryzko et al.. 1996). These CO-activators function in response to ligand binding to

nuclear hormone receptors which in turn. triggers RNA polymerase II transcription.

CREB. upon phosphorylation through the cyciic-AMP dependent-protein kinase .A

pathway. is then able to interact with CBPlp300 to affect transcription (Karnei et of..

1996). Therefore the activity of these transcriptional CO-activators on particular

nucleosomes could aid in the transcriptional activation of specific promoters (Brownell et

LI/.. 1996).

Enhancers are regions of DNA that function to increase the rate of transcription of

a particular gene. These regions act in both a position and orientation independent

manner with some enhancers located in intronic and 3' flanking regions of genes.

Additionallv. gene-and tissue-specific transcription factors. binding to regions upstrearn

and downstream of initiation sites. also hnction to effectively regulate transcription. The

binding of tram-acting factors to cis-acting elements of a particular gene may involve a

specific re-arrangement of proteins and of chromatin. The packaging of DNA in

chromatin can limit the accessibility of trnns-acting factors to specific DNA sequencrs

(Dillon et cd.. 1994). Regions known as DNase 1 liypersensitive sites represent areas that

allow for these rrcrns-acting factors to bind to cis-acting elements. Hypersensitive sites

represent gaps in the distribution of nucleosomes along the chromatin fibre that reveal the

location of transcriptional regulatory motifs. Chromatin of an actively transcnbed gene

locus is sensitive to DNase 1 digestion and cell-type specific DNase 1 sites are generally

found in and around the gene. These sites therefore are significant enough to clarify

structural features of chromatin that serves as the template for transcription (Gross er cri..

1988). DNase l hypersensitivity experiments have been used successfully to show

changes in chromatin structure of many genes such as heat shock inducible genes

(Canright et al.. 1986). steroid hormone regulated genes (Kaye et ai.. 1986) and cell

cycle regulated genes (Moreno et ui.. 1986). Obviously to understand how these factors

function to initiate vmsct-iption also includes understanding the constraints imposed upon

the tnnscriptional machinery by the pac kaging of eukaryotic DNA into chromatin.

1.4.1 Chromatin Structure and Regulation of PRL Gene Expression

Chrornatin is organized in a hierarchy of structures. from the basic repeating unit.

i-e. the winding of DNA around the histone octamer to form nucleosomes. to the

complex appearance of metaphase chromosomes. The most prominent proteins

associated with DNA in packaging are the farnily of basic proteins found in al!

eukaryotic nuclei. Histone proteins are of five varieties. termed Hl. HIA. H2B. H3 and

H4. Histones. along with a segment of DNA. are packaged into structures called

nuc1eosomes. When chromatin is condensed. a fifih histone is present. H l . H 1 binds to

the DNA between nucleosomes. In intact nuclei. DNA is bound to the core histones and

also to HI. and the chromatin exists largely in a compact helical arrangement or

solenoid. Specific sequences of DNA are precisely arranged with respect to HI. In

addition. the tetrarner associates with target regions of certain genes such that key

recognition elrments For transcription factors are accessible to the proteins.

Nucleosome spacing has been shown to play a role in the regulation of transcriptional

initiation and advancement of the transcriptional machinery (Hayes et al.. 1 99 1 ).

While the transcriptional regulation of pituitary specific prolactin expression has

been well characterized. not much is known about its decidual and lymphoblast specific

regulation. With regard to chromatin structure. investigation of pituitary PRL gene

expression has revealed a dependence on chromatin structure for transcription. In the

rat prolactin (rPRL) gene. studies have shown that in addition to having the estrogen

receptor complex bound to the estrogen response element (ERE) in the distal enhancer

element. this attachment helps facilitate its interaction with the transcription machinery

located 1500 bp Y of the proximal promoter. This is accomplished by the estrogen-

mediated chromatin looping that allows the contiguous placement of the proximal

promoter and the distal enhancer element. Furthemore. this looping was shown to be

restricted oniy to certain regions of the chromatin through specific protein-protein

contacts between the enhancer and promoter regions of the rat prolactin gene (Gothard et

al.. 1996). In addition. studies from DNase 1 hypersensitivity experiments have

revealed that the chromatin structure of the rPRL gene is primed for E2-mediated

transcriptional activation. The ERE found in the 5' distal enhancer of the rPRL gene

appears to be free of positioned nucleosomes in the absence of E2 allowing for binding

of transcription factors (Willis rr cil.. 1996). As a negative control. the chromatin

structure of the PRL gene in rat fibroblasts was investigated. The fibroblast PRL gene

was shown to be refractory to DNase 1 treatment and with nucleosornes. translationally.

out of phase. This suggested to researchers that pituitary specific factors. suc h as Pit- 1.

might function in altering the chromatin structure in the pituitary lactotrope (Willis et

cil.. 1996). Further studies into the chromatin structure of the prolactin gene would offer

insight into how it affects the transcriptional regulation of this gene.

1.5 Purpose of Thesis

As prolactin is a gene activated during the earliest stages of decidualization.

elucidating its transcriptional regulation could be an important step in delineating the

cascade of molecular events regulating decidualization. Progesterone has been shown to

be essential in the formation of the decidual ceIl as well as expression of the PRL gene.

Due to the fact that there is a 2-3 day delay between peak serum proçesterone levels and

the formation of the pre-decidual ce11 and PRL expression. it is hypothesized that

decidualization is regulated in a multi-stepwise manner. Most studies to date have

established an in ivirro correlation between progesterone and PRL production usine

primary endometrial stromal cells (Invin et al.. 1989). However. because there are no

decidual ce11 lines available. I have undertaken the initial characterization of two human

endometrial stromal ce11 lines BIOT1 and M4 with regard to their decidualization

potential as well as steroid hormone content. These studies were done as a way of

detemining their potential usefulness in studies of decidual-specific gene expression.

Characterization of these ceIl lines would allow us to study the decidualization process

in a controlled and relatively easy manner cornpared to working with primary human

endometrial cultures which are dificult to generate due to the paucity and diversity of

patient tissue samples.

In addition. 1 have isolated a large region of 5' flanking DNA of the PEU gene in

order to devise a strategy to identiw DNase 1 hypersensitive sites associated \hith

nonpituitary PRL expression. The identification of these sites would provide unique in

vivo data regarding potential transcriptional regulatory motifs functioning in response to

various factors such as steroid hormones and other transcription factors. To this end. 1

have studied the human lyrnphoblast ce11 lines IM-9-PX and IM-9-P6 which

differentially express the PRL fiom the nonpituitary transcription start site in an effort to

identi@ regulatory regions responsible For nonpituitary PRL gene expression.

CHAPTER 2

MODELS OF HUMAN ENDOMETRIAL DECIDUALIZ'4TTON

2.1

of the

ability

INTRODUCTION

The lack of any ceIl lines of human decidual origin has limited our understanding

complex process of decidualization and human endometrial physiology. The

to establish primary cultures of hurnan endometrial stromal cells has offered some

insight to the hormonal regulation of decidualization. However, poor tissue availabi li t y

and patient-to-patient variation severely limits the use of these cultures for mechanistic

studies of decidualization at the gene level. As an alternative, imrnortalized hurnan ce11

lines expressing the PRL gene from the nonpituitary transcription start site would provide

an easy. manipulatible system For gene transcription studies. With regard to the

endometrim. two new ceII Iines have become available. B 1 OT1 and M4. which are of

stromal origin (Rinehart et al.. 1993). As mentioned earlier. these lines have not been

rxamined with regard to their ability to decidualize whrn treated with a variety of

homones.

In addition. there are two ceIl lines of lymphoblast origin IM-9-P33 and IM-9-P6

with which to study PRL gene expression. The human lymphoblastoid IM-9-P33 cell

line constitutively produces PRL from the upstream nonpituitary start site. as seen in

decidual cells. This ce11 line therefore offers a unique opportunity to study PRL gene

expression. in terms of prornoter-specific di fferences as well as tissue speci fic

differences. Conversely. the clona1 IM-9-P6 ce11 line which appears to be identical to

IM-9-P33 cells. acts as a negative control because the PRL Bene is silent. The first

objective of this research therefore. was to determine whether the B 1 OT1 and M4 ce11

lines could be induced to decidualize upon treatment with progesterone and CAMP. This

would represent the first demonstration of in vitro decidualization of an immortalized ceIl

line and thus provide an appropriate system for the study of decidual-specific PRL gene

transcription.

2.2 MATERIALS AND METHODS

2.2.1 Cell Culture

The IM-9-P line is a PRL-secreting variant of the human B-lymphoblastoid ce11

line IM-9 that has been characterized previously (DiMattia et al.. 1988). A clonal

subline. IM-9-PX. used for the studies described here secretes about 80 ng hPRL/loh

cells /24h (Gellsrsen et al.. 1989). The IM-9-P-6 ce11 line is also a clona1 subline of the

IM-9-P: however these cells do not secrete detectable Ievels of PRL. These lines were

ïnaintained in RPMI-1640 medium supplemented with 10% fetal bovine s e m (FBS)

(Gibco. MD). 50 U/mi penicillin- and 50 pg/ml streptomycin (Gibco- MD).

The BlOTl and M4 ceil lines were originally supplied by Dr. Clifford Rinehart

[The University of North Carolina. Chape1 Hill. NC]. These irnmortalized stroma1

ceils. transformed nith a plasmid containing an ori-. temperature-sensitive mutant SV40.

A109 (tsSV4O) grow unconditionally at the permissive temperature of X ° C whiie

proliferative arrest occurs at 39OC. These lines were originally cultured in a 1 : 1 mixture

of Ham's F l 2 and Medium 199 (Gibco. MD). supplemented with 10% îètal bovine serum

(Gibco. MD). 2 pg/ml insulin and JmM glutamine. Later. the cells were switched to a

richer medium to optimize growth: in Opti-MEM medium (Gibco. MD). 10% fetal

bovine serurn. 50 Ulrnl penicillin. 50 &ml strepomycin . and 1x1 0" M estradiol (Sigma.

MO). Routinely. cells were subcultured at a 1 :4 split ratio. and the medium was changed

twice weekly. Cells were maintained at 3 j °C in a humidified atmosphere of 95% air-5%

carbon dioxide.

2.2.2 M4 and BIOT1 Culture Conditions

In order to test the effect of progesterone on the ability of M4 and BlOTl ce11

lines to decidualize. a growth medium lacking steroids was produced by eliminating

small molecules from the fetal bovine serum. Charcoal was used to strip FBS of

endogenous steroids. To do this. 100 g of neutralized charcoal (BDH. Ont) was added to

500 ml double distilled water (ddH20) and allowed to mix cornpletely for 10 minutes.

The charcoal mixture was then placed at 4OC for one hour to senle the grains. Excess

water was then poured off and log of T-80 dextran was added and stirred. Subsequentlg.

2 ml of IM Tris (unbuffered) was added to achieve a pH of -7.7. The mixture was then

brought to a volume of 1 litre with ddHzO and incubated. with shaking in an

environmental shaker. at 55°C for one hour. The solution was then poured into 50 ml

centrifuge tubes (Falcon. ON) containing 25 mls of fetal bovine serum and centrifuged at

1650 xg for 60 minutes. The supernatant was removed and filtered twice under sterilc

conditions. through a 0.45-micron syringe or bottle-top filter (Nalgene. NY). This was

followed by filtration through a 0.22-micron filter using a peristaltic pump or another

bottle top filter (Nalgene. NY) to ensure removal of any residual charcoal. Stripped

serum was stored in 50 ml centrifuge tubes at -30°C.

The synthetic progestin. rnedroxy-progesterone acetate (Sigma MO) was

reconstituted in 95% ethanol at a concentration of2.58 x 1 O-' M and stored at -20°C.

8-Bromo-cy c lic adenosine monophosphate ( Boehnnger Mannheim. Que) was dissolved

in sterile ddHtO at a concentration of 20 mM followed by sterile filtration through a 0.22-

micron syringe filter and stored at -70°C.

2.2.3 Hormonal Treatment of Human Endometrial Ce11 Lines

B 1 OTI and M4 cells were subcultured to approximately 55% confluency one day

pnor to incubation at 39°C into either 3 cm' tissue culture flasks or 60 mm plates (Nunc.

IL). Ce11 nurnbers pnor to subculturing were determined using a Coulter counter (Coultcr

Electronics. Inc.. Hialeah. FI) or a hemocytometer. When these cultures were placed at

the restrictive temperature of 39°C. the medium was removed and replaced with Opti-

MEM containing 10 % charcoal-stripped fetal bovine serum. 50 U/ml penicillin. 50

pg/rnl streptornycin. and 1 x10" M estradiol. In addition. cells were treated with either

0.2 mM or O. 5 mM 8-Br-CAMP (to initially optimize the conditions) and 1 x 10" M MPA.

Cells were incubated under these conditions for two days. the medium was collected.

replaced with fiesh medium and the flasks were retumed to 39°C incubator for a total

penod of 5-9 days. PRL concentrations in conditioned media were determined using an

imrnunoradiometric assay (IRMA) specific for human PRL purchased from the Nichols

Institute (San Juan Capistrano. CA. USA). This assay utilizes three monoclonal

antibodies directed against distinct epitopes on the prolactin molecule.

2.2.4 Isolation of Total RNA from Cells

Buffers were prepared with diethylpyrocarbonate (DEPC) treated water and

autoclaved For 30 minutes. Cells were harvested by conventional trypsinization.

collected into 50 ml centrifuge tubes and cenvifùged for 3 minutes at 1650 xg. Cells

were then washed with Dulbeco's-phosphate buffered saline (D-PBS) (Gibco. MD).

centrifuged and the supernatant was removed by aspiration. For approximately 1 x 10'

cells. 1 ml of GITC homogenization solution. pH 7.0 (4 M guanidinium isothiocyanate.

0.5% N-lauiyl sarcosyl. beta-mercaptoethanol and 0.25 M sodium citrate. 0.1 % antifoam

4). Cells were homogenized for 3045 seconds using a polytron (Kinematica GmbH) at

a setting of 7. Five hundred microlitres of 0.2 M sodium acetate solution. pH 5.2 was

added to the homogenate and the solution extracted with equal volumes of phenol and

chlorofom. Sarnples were vortexed and centrifüged at 5874 xg. 4°C for 30 minutes in

order to separate the organic and aqueous phases. The aqueous layer was removed and

mixed with 5 ml isopropanol and stored at -20°C for at least 30 minutes to precipitate

RNA. Sarnples were centrifuged for 12 minutes at 4°C at 10444 xg. and the resultant

pellet was dissolved in DEPC treated water. plus 0.3 M sodium acetate. pH 5.7 and

extracted with phenol and chloroform as described above. RNA was re-extracted mith an

equivalent volume of chlorofonn/isoamyl alcohol. The aqueous phase was recovered by

centrifugation as stated above and an equivalent volume of isopropanol was added to

precipitate the RNA which was recovered by centrifugation at 10444 xg for 12-15

minutes. The RNA pellet was washed with 70% ethanol. dissolved in sterile DEPC

water. and stored at -20°C or -80°C. (Maniatis. 1982).

2.2.5 Reverse Transcription and Polymerase Chain Reaction.

For the reverse transcription reaction. between 3-5 pg of total RNA was used. To

this. I pl of random hexamers (at 50 ngiul) and DEPC treated water were added for a

total of 10.5 ul RNNhexarner mix. This solution was incubated at 65°C for 10 minutes

to fully denature the RNA. Irnrnediately following. 4 pl of reverse transcriptase 5x stock

buffer (Gibco, MD. supplied with enzyme). and 0.01 M dithiothreitol. I mM dNTP were

added. The contents of the tube were mixed gently and incubated for 2 minutes at 42°C.

A total of 200 U of Superscnpt II (Gibco. MD) reverse transcriptase was added to the

mixture and incubated for 10 minutes at 25°C followed by 50 minutes at P C . The

reaction was inactivated by heating at 76°C for 15 minutes.

Generaily. 5 pl of the reverse transcription reaction was used as a template for

PCR. Both the anti-sense and the sense primes were added at 50 pmoles/pl. along with

0.7 mM of dNTP. 5 Ulpl of Taq and 5pl BRL restriction endonuclease buffer Xi (Gibco.

MD. supplied with the enzyme). Samples were denatured at 94°C For 30 seconds.

followed by annealing at the temperatures specific for each primer pair for 1 minute and

rlongation at 72°C for 1 minute. This cycle was repeated for 30 rounds followed by a 10

minute incubation at 72°C to insure complete elongation of al1 PCR products.

Oligonucleotide sequences are as follows: #98 (position +43 to +72 in hPRL exon la and

position -1 36 to -1 07 in the 5' UTR of the decidual PRL mRNA. annealing temperature

65°C j. 5'-GACAGAGACACCAAGAAGAATCGGAATCGGAACATA-3338 99 (position -53 to -

23 in the PRL mRNA Y-UTR. annealing temperature 65°C). 5 .

TGAGACTTCCAGATCTTCTCTGGTGAAGTG-3'. 102 (antisense to position 592-622

of the hPRL mRNA ). 5'-TGAATCCCTGCGTAGGC4GTGGAGCAGGTT-3'. human

PR sense primer 5' TGGTCTAAATCATTGCCAGGTTTTCG33 and antisense primer

5.-ACGCTGTGAGCTCGACACAACTC-Y. annealing temperature 5J°C.

2.2.6 Preparation of RNA BIots

Fifty micrograrns of total RNA were denatured by heating at 6j°C in a solution

containing 50% deionized formamide. 0.0 15 M formaldehyde. i x MOPS (3-(n-

morpholino) Propanesulphonic acid) and cooled on ice before loading. Sarnples were

subjected to electrophoresis through a 1.1 % agarose gel prepared with lx MOPS buffer

containing 3% formaldehyde. Gels were nin at 100 V for 10 minutes and then at 30 V

ovemight (approximately 8-10 hours). Agaroselformaldehyde gels were soaked in 20x

SSC (staqdard saline citrate: 3 M sodium chloride. 0.3 M trisodium citrate) prior to

ovemight transfer (in 20x SSC) of RNA ont0 NitroPlus 2000 nitrocellulose/nylon

membrane (MSI. MA). Filters were subsequently baked at 80°C for up to two hours.

2.2.7 Preparation of Radiolabelled DNA

Restriction endonucleases and other DNA modi@ing enzymes were purchased

from Gibco. NEB or Pharmacia LKB Biotechnology and used according to the

manufacturer's instructions. Intact plasmids were digested with the appropriate

restriction enzymes and DNA fragments were separated on a 1% low-melt agarose gel by

electrophoresis. DNA fragments of interest were isolated from the gel using a razor

blade. placed in a 1.5 ml centrifuge tube and incubated in a 68°C waterbath for

approximately 10 minutes to melt the gel slices. A Y 3 volume of pre-warmed (65°C).

equilibrated phenol was added to the melted gel slices. vortexed. placed back in the 65°C

water bath for 5 minutes and subsequently centrifuged for 15 minutes at 4OC in a

microcentrifuge at mavimum speed. The aqueous layer was removed and a 1 /3 volume

of 3 M sodium acetate. pH 5.2 was added followed by another 2/3 volume of room-

temperature phenol. The mixture was vortexed and centrifuged for 10 minutes to

separate the phases. The DNA insert in the aqueous layer was precipitated with 95%

rthanol and the pellet dissolved in TE. pH 7.4.

The purified DNA fragments (25 ng) were radiolabeled with "P using the High

Prime Kit (Borrhinger Mannheim. Que): 1 UIpl Klenow. 0.125 mM dATP. dTTP. dGTP.

and 5% stabilized reaction buffer in 50% glycerol) and 5 pl '"P-CTP (50 pCi.

Amersham. IL) at 37°C for 15 minutes. The labeled DNA was separated from

unincorponted nucleotides using Probe Quant G5O Micorcolumns (Phmacia. Que) as

per manufacturer's instructions. Probes used for detection of steroid hormone receptors

were as follows: for propsterone receptor (PR). a 709 bp HNldIIII.;lfnI fragment

containing approximately 85 bp of 3'UTR and 624 bp of coding sequence isolated from

hPRO (Kastner et al.. 1990): for estrogen receptor (ER) a 1.83 kb KpnI/SacI fiagment

also containing portion of the 3' UTR (Green et al.. 1986): for glucocorticoid receptor

(GR). a 1.5 kb BumHIISacl fragment located in the coding region of the gene (Hollenberp

et d.. 1985): and for androgen receptor (AR). a 71 8 bp fiagment also containing a portion

of the coding region (Lubahn el al.. 1988).

2.2.8 Hybridizatioo and Quantification of 3 ' ~ - d ~ ~ ~ Labeled Probes

Prehybridization of RNA blots (1-2 hours) and hybridization (overnight) was

perfoned at 42OC in a Robbins Scientific rotating incubator. The prehybridization

buffer is identical to the hybridization buffer (50 % formamide. 0.025 M KP04 pH 7.4.

5x SSPE. 5 , Denhardt's. 0.5% SDS and 100 pg/ml sheared salmon sperm DNA filtered

through a 0.2 Fm syringe acetate filter) except that it is devoid of the ''P-~cv labeled

probe (added at 1 x 1 0-6 dprn/mI). Followfng hybridization. filters were briefly rinsed in a

solution containing lx SSC. 0.1% SDS (sodium dodecyl sulphate) at room temperature.

This was followed by a senes of washes first in 5x SSC. 0.5% SDS (room temperature).

then in lx SSC. 0.5% SDS (37OC) and finally a high stringency wash at 65°C in O. IX

SSC. 1% SDS in sealed plastic containers for a total of 30 minutes per wash. The blots

were then esposed to Kodak XAR-5 film at -80°C. for 1-5 days with an intensi-ing

screen.

2.3 RESULTS

2.3.1 Prolactin Production in M 4 and BIOT1 cells.

M4 and BIOT1 cells were treated in a varie- of ways to determine their

decidualization potential and the abilitp to produce PRL. Table 2.1 .4 and B outlines the

cxprrimental paradigm that was followed. Cells were plated at 50% and 75% confluency

in 60 mm dishes (Nunc. IL) and placed at 33°C the day prior to hormone treatment under

optimal conditions. These cells were then treated. in triplicate. with two different

concentrations of 8-Br-CAMP alone (0.2 mM and 0.5 mM). 1 x 1 0 ~ M MPA

(medroxyprogesterone acetate) alone and then in combination in the presence of

charcoal-stnpped fetal bovine serum and placed at 39°C. Medium was collected at 2 day

intervals and replaced with fresh medium. Following the 8 day experiment. the

conditioned medium was tested by IRMA for PRL content and the cells were harvested

and counted. The lowest measurable concentration detected by the IRMA kit was 0.14

ndml. PRL

CONDITIONS FOR DIFFERENTIATION OF HUMAN ENDOMETRIAL STROMAl. C U L LINES

CULTURE MEDIA SAMPLING DAY

1 DAYP YELL TYPE & GROWTH

CONDITIONS

0.5mM 8-Br-CAMP

1 x 10-6M MPA @ 50% & 75% confluency ---

0.2rnM ~ - B ~ - G M P & 1 x 10-6M MPA

0.5mM 8-Br-CAMP & 1 x 10-6M MPA

1 CULTURE MEDIA SAMPLING DAY 1 DAYP

CELL TYPE & GROWTH 1 TREATMENT CONDITIONS

8 50% & 75% confluency

0.2mM 8-Br-CAMP & 1 x 10-6M MPA

- - - . - - - - - - - .

05mM 8-Br-CAMP & 1 x 10.6M MPA

production by M4 cells was not detected by this method under any of the test conditions

outlined in Table 2.1. BlOTl cells were tested in the same mariner and IRMA results

were highly variable and either at or below the detection limit of the hPRL IRMA (Le

levels between O and 0.1 ngml). Therefore. we concluded that. based on PRL

production. the M4 and B 1 OTl ce11 lines were incapable of a robust decidualization using

treatrnents and culture conditions described above. The more sensitive technique of RT-

PCR was utilized to determine whether PRL gene transcription had been activated but not

detectable at the secreted protein level (see below). As a control. BlOTl and M4 cells

were platrd and placed at X ° C under both non-treated and treated conditions as stated

above. Following the 8-day experiment. the conditioned medium was collected and

tested by IRMA. For both cells lines. PRL was not detectable at any time point. This

was an important control as in normal. undifferentiated endometrial stroma1 cells. the

PRL gene is silent.

2.3.2 Utilization of Decidual ProIactin Promoter.

As the hPRL IRMA results were inconclusive with respect to the decidualization

potential of BlOTl cells. we used an RT-PCR systern to determine PRL expression and

promoter utilization. Figure 2.1 shows the position of the hPRL primers used in PCR

reactions. An expected fragment size of 756 bp was obtained and represents

decidual/lyrnphoid specific region of 5' UTR (primer #98) and a portion of the PRL

coding region (primer #102). A 673 bp fragment was obtained only with human

pituitary tissue representing pituitary-specific PRL mRNA (primer #99. data not shown).

Southem hybridization analysis (Figure 2.2) shows the expected size fragment for

decidual/lymphoid promotcr usage in BlOTl cells as seen with RT-PCR product

produced from human decidual tissue (lane 5). Interestingly. a hPRL RT-PCR product

was found only in B 1 OT1 cells treated with both 8-Br-CAMP and MPA in the presence or

absence of Ez (lanes 3 and 4).

2.3.3 Steroid Receptor Content in Human Endometrial Stroma1 Cell Lines

Because decidualization is dependent upon the presence of certain steroid

hormone receptors. it was important to determine whether the B lOTl and M4 human

Figure 2.1 Sequence and position of hPRL primers for use in RT-PCR to

determine human PRL promoter utilization in BIOT1 cells.

Sequence of human deciduai/lymphoblast PRL cDNA indicating

the location of primers for analysis of PRL promoter usage.

Positions of the primers (#98. #99. and fi102) are indicated with

arrows. A graphical representation of the location of the primers is

also presented. The decidual/lymphoid YUTR is represented by a

clear box along with the 3' UTR. the coding region is indicated by

the black box and the pituitary-specific PRL YUTR is hatched.

Decidual/lymphoblast-specific mRNA generates a 756 bp PCR

fragment.

dPRL-OS sense ~rirnor > 1 ctgacgtttctataaagtaggtcataagaaccttcattccagaataccctcaaagacagagacaccaagaagaatcgga 3 0

dP-

8 1 acatacaggctttgatatcaaaggtttataaagccaatatctgggaaagagaaaaccgtgagacttccagacttccctg 1 6 0

1 6 1 gtgaagtgtgtttcctgcaacgatcacgaac ATG AAC ATC AAA GGA TCG CCA TGG AAA GGG TCC CTC 2 2 7

1 M N I K G Ç P W K G S L 12

2 2 8 CTG CTC CTG CTG GTG TCA 1WC CTG CTG CTG TGC CAG AGC GTG GCC CCC ïTG CCC ATC TGT 2 8 7

~ ~ L L L L V S N L L L C Q S V A P L P I C 3 2

3 4 8 CTG TCC CAC TAC ATC CAT AAC CTC l'CC TCA GAA ATG TZY: AGC GAA TIY: GAT AAA CGG TAT 4 0 7 S ~ L S H Y I H N L S S E M F S E P D K R Y 72

4 0 8 ACC CAT GGC CGG GGG TV2 ATT ACC AAG GCC ATC AAC AGC TGC CAC ACT TCT TCC ClT' GCC 4 6 7 ~ ~ T G R G P I T K A I N S C H T S S L A 9 2

5 2 8 GTC AGC ATA TTG CGA TCC TGG AAT GAG CCT CTG TAT CAT CTG GTC ACG GAA GTA CGT GGT 5 8 7 ~ ~ ~ V S I L R S W N E P L Y H L V T E V R G 1 3 2

5 8 8 ATG CAA GAA GCC CCG GAG GCT ATC CTA TCC GTA GAG A m GAG GAG CAA ACC AAA 6 4 7 ~ ~ ~ M Q E A P E A I L S K A V E I E E Q T K 152

7 0 8 GAG ATC TAC CCT GTC TGG TCG GGA C'M' CCA TCC CTG CAG ATG GCT GAT GAA GAG TCT CGC 7 6 7 ~ ~ ~ E I Y P V W S G L P S L Q M A D E E S R 1 9 2

7 6 8 C?T TCT GCT TAT TAT AAC CTG CTC CAC TGî CTA CGC AGG GAT TCA CAT AAA ATC GAC 8 2 7 ~ ~ ~ L S A Y Y N L L H C L R R D S H K I D N 2 1 2

-

dPR~-1û2 antisense primer

8 2 8 TAT CTC AAG CTC CTG AAG TGC CGA ATC ATC CAC AAC AAC M C TGC TAA gcccacatccactcca 8 9 1 2 1 3 Y L K L L K C R I I H N N N C ' 2 2 8

8 9 2 tctatttctgagaaggtccttaatgatccgttccattgcaacttctcttagttgtatctcttttgaatccagcttggg 9 7 1

9 7 2 tgtaacaggtctcctcttaaaaaataaaaactgactcgttagagacatc 1 0 2 0

Human PRL mRNA

Figure 2.2 Expression of human PRL mRNA from non-treated and

treated BIOT1 cells.

Total RNA was isolated h m non-treated (Iane 1). MPA

treated (lane 2). 8-Br-CAMP. MPA and estradiol treated (lane 3).

8-Br-cAMPand MPA treated (lane 4) B 1OT1 cells and used in RT-

PCR reactions. Treatrnents are as indicated. Aliquots of the

reaction mixture were electrophoresed through a 1 .O% agarose

gel. The gel was bloaed and probed using a 28 1 bp hPRL

Fragment labeled with "P representing a rnultimer of decidual exon

1 a sequence. The RT-PCR product from decidual RNA. isolated

from tissue (lane 5) was used as a positive control for the

hybridization.

MPA ONLY - + 8-Br-CAMP +MPA + E , - f

8-Br-CAMP +MPA - E , - - -+

endometrial stromal cells lines contained receptors for androgen. glucocorticoid.

progesterone and estrogen. To this end. 1 performed northem hybridization studies as

described above. As a control for presence of receptor mRNA. Al-2 cells were used (a

derivative of the breast cancer ce11 line T47D kindly provided by Dr. T. Archer. Dept of

Biochernistry. University of Western Ontario). Figure 2.3 A shows that while

~lucocorticoid receptors were found in dl cells lines tested (at -6.1 kb. arrow) including C

treated and non-treated M4 and B 1 OTl cells. RNA signal for progesterone receptor (-8.2

kb. arrow) was only seen in Al-2 cells fwhich are present at 200 000 receptors/cell:

Nordeen et al.. 1989. Figure 2.38). As a control for RNA loading and integnty. the blots

were probed for the presence of 18s rRNA (Figure 2.3 C and D). These blots were then

stnpped of radioactive cDNA probe and re-hybridized to determine androgen and

estrogen receptor presence. Estrogen and androgen receptor mRNAs were detectable in

A 1-2 cells only (-6.2 kb and - 1 1 kb respectively: Figures 2.4 A. B respectively).

Because tùnctional PR is critical to the decidualization process. we utilized a more

sensitive technique. RT-PCR with RNA isolated from BlOTl cells. in order to ascertain

the presence or absence of PR. As seen in Figure 2.5 -4. PR mRNA was present in

B 1 OTl cells. both treated with hormone (39°C. lane 4) and untreated (33°C. lane 2).

whereas in M4 cells. detectable levels were only seen in non-treated cells (33°C. lane 3).

As a positive control Al-2 cells were again used and progesterone receptor cDNA was

detected by this method. HT1080 cells. a human tibrosarcoma ce11 line. was used as a

negative control (tane 6). Beta-2 rnicro~lobulin (120 bp) was used as an intemal control

for the Functionality of the RT-PCR reaction in those RNA samples where a receptor RT-

PCR product was not detectable (Figure 2.5 B)

2.4 DISCUSSION

The lack of hurnan endometrial stromal ce11 lines capable of decidualization

significantly hindered Our understanding of how stromal cells are regulated at the

molecular level. The two endometrial stromal ce11 Iines used in this study (M4 and

B 1 OTI ) were exarnined based on the hypothesis that they were capable of decidualization

Figure 2.3 Expression of GR and PR in BlOTl and M4 cells

Total RNA isolated from non-treated (NT) (without MPA and 8-Br

CAMP) and treated (T) BIOT1 and M4 cells (0.5 mM 8-Br-CAMP

and lod M MPA). as weil as the human breast cancer ce11 line A l - 2 was electrophoresed through a 1.1 % denaturing agarose gel and

transferred to a Nitroplus 2000 membrane (MSI). The blots were

probed with 1.5 kb BamHIISacI cDNA fragment for GR ( A ) and a

709 bp HindIII/.-lfi'll cDNA fragment for PR (B) labeled with "P.

An 18s rRNA probe was used to control for equal loading (C and

W.

Figure 2.4 Expression of Androgen Receptor (AR) and Estrogen Receptor

(ER) in BlOTl and M4 cells

Total R N 4 isolated fiom non-treated (NT) (without MPA and 8-

Br-CAMP) and treated (T) B 1 OT 1. M 4 (0.5 mM 8-Br-CAMP and 1

x 10" m MPA). and A1-2 cells was electrophoresed through a

1.1% denaturing agarose gel and transferred to a Nitroplus 2000

membrane (MSI). The blots were probed for AR (A) using a 71 8

bb Spe Il Kpnl cDNA fragment and a 1.83 kb Kpnl/Sncl cDNA

fragment for ER (B).

Figure 2.5 Expression of PR mRNA in BlOTl and M4 cells as determined

by RT-PCR

A) BlOTl and M4 cells were cultured with and without

decidualizing agents (0.5 mM 8-Br-CAMP and 10" hl MP.4) and

totai RNA was isolated (lanes 2-5). A 1-2 RNA ( h e 1 ) was used a

control for PR mRNA and HT1080 celIs (lane 6) were used as a

negative control. Primer sequences used in the PCR reaction are

listed in Section 2.2.3. B) RT-PCR for beta-2 microglobulin as an

intemal control (120 bp) for the functionality of the RT-PCR

reaction.

Progesterone Receptor

Beta-2 microglubulin

under optimal culture conditions (Tables 2.1. A and B respectively). Using known

inducers of hPRL production and decidualization. the M4 ce11 line did not produce

detectable levels of secreted PRL as determined using the hPRL- specific

imrnunoradiometric assay. The lowest measurable concentration that the IRMA kit can

detect is 0.14 ng/ml. The B lOTl ce11 iine under the same conditions produced variable

results some of which indicated the presence of PRL in the conditioned medium.

However. overall the data were not reproducible. Because the B lOTl cells had not been

characterized in this mariner, combined with the fact that a small arnount of secreted P M

was detected. a more sensitive technique was utiIized to detemine whether the PRL gene

had been activated following the hormone treatment conditions descnbed above.

Moreover. this analysis would provide evidence For the tissue-specific promoter utilized.

Using sense primer specific for the deciduai PRL 5' UTR. RT-PCR and Southem blot

analysis revealed that the upstream transcription start site was being used in hormone-

treated B I OTI cells cultured at 39°C (Figure 2.2).

There are several explanations that could account for the lack of robust

decidualization by BlOTl and M4 ceIl lines. Firstly. the precise stage of the menstrual

cycle during which stromal cells were harvested for the in vitro transformation

(generation of BIOT1 and M4 ce11 lines) is not known. This is important because it is

well known that progesterone down-regulates uterine estrogen and progesterone receptors

(Shupnik et cd.. 1989. Pavlik et ai.. 1976 respectively). Therefore. stromal cells removed

during the final stages of the secretory phase are already facing a decline in stromal PR

levels fin a non-pregnant utexus). Secondly. progesterone has been shown to block

estradiol-induced progesterone receptor upregulation which could harnper the effects

seen in early proliferative stage stromal cells (Kraus ei al.. 1993). In addition. when

cells undergo immortalization, the chromosomal content is altered and becomes

aneuplastic. It is possible therefore that the genes for. or invoived in regdation of the

PRL, progesterone receptor and related genes. may have been altered dunng the

immortalization process. Furthemore. cells will ofien change under culture conditions

over time; this can affect their ability to grow and their biochemical makeup. The B 1 OTI

and M4 cells were created several years ago (Rinehart et al.. 199 1). It is possible that

these cells have undergone genotypic changes that could affect their ability to produce

PRL. To circumvent these possibilities. 1 utilized Fresh cells (cells stored at -80°C or

-150°C) periodically throughout the course of the experiments descnbed here.

Additionally. the experimental design was not exhaustive in its scope of treatment

conditions. It is possible that decidualization. based on PRL production. rnay have been

more robust upon longer incubation periods with MPA and CAMP. These cells however.

have been reported to be viable for only up to two weeks at the restrictive temperature of

39°C. In our hands. the longer the cells were cultured at 39°C (under the expenmental

conditions). the greater the degree of ce11 death as indicated by the density of non-

adherent or tloating cells. Excessive ce11 density cannot be excluded as the cause of cell

death. Cells may have been initially plated at too high a density and upon doubling of the

cells at 39°C. cell density rnay have exceedsd the threshold of ce11 viability. In addition.

all conditioned medium was removed every two days and replaced with fresh medium

with the same hormonal content. Perhaps. as indicated by the RT-PCR results. secreted

hPRL would have been detectable by allowing a longer conditioning period. Moreover.

the conditioned media could have been concentrated and thereby indirectly increased the

scnsitivity of the hPRL IRMA. Also. it is establish that cells in culture release factors

that provide a favourable environment for ce11 viability: it rnay be the rernoval of

conditioned media every two days çompromised the ability of these ce11 lines to

decidualize.

Steroid hormones. as mentioned earlier. play an important role in the

differentiation of endometnal stroma1 cells. Progesterone is an important mediator of the

decidual process. Northern analysis however did not reveal the presence of PR in either

non-treated and treated B1 OT1 and M4 ce11 lines. Again. this could be due in part to the

stage of the menstrual cycle during which the original stromal cells were isolated.

Altematively. the level of PR in these cells could be below the detection lirnit of northem

hybridization. In fact. RT-PCR analysis indicated the presence of PR mRNA in BIOT1

and M4 ce11 lines. however. actual receptor level was not determined: therefore it is

unclear whether the level of PR in these lines was physiologically relevant. Indeed.

northem analysis performed to detect receptoa for androgen. glucocorticoid and estrogen

indicated the presence of the plucocorticoid receptor only.

These studies were designed to provide new information regarding the endocrine

phenotype of these two endornetriai stroma1 cell lines. Given the fact that no currently

available endometrial ce11 lines capable of decidualization have been developed. vie have

set out to modify the B lOTl line to enhance its decidualization potential. To this end. we

have stably transfected the B 1 OT1 ce11 line with a human progesterone receptor cDNA to

significantly elevate the level of functional PR which may enhance the resultant clonal

ce11 line decidualization potential. The decidualization experirnents performed and

described herein will form the ba i s of future analysis. in ternis of hormonal treatrnent. of

B 1 OT 1 -progesterone receptor stable subclones.

CHAPTER 3

ISOLATION i\ND CHARACTERIZATION OF HUMAN PROLACTIN GENOMIC

CLONES

3.1 INTRODUCTION

To date. 3000 bp of 5' Banking DNA to the decidual PRL transcription start site

has been cloned and characterized (Gellersen et (11.. 1994). Studies have shown that

while both human decidual cells and lymphoblast cells (IM-9-P33) transcribe PRL from

the upstrearn exon la. regulation of this expression appears to be tissue-specific. As

mentioned previously. the pituitary-specific transcription factor Pit- 1. does not play a role

in human decidual/lymphoid PRL expression. even though two canonical Pit-1 binding

motifs were located upstream of exon l a (Gellersen et al.. 1994). Transient transfection

studies have shown that a minimal promoter of 332 bp flanking the dPRL transcription

start site is sufficient to mediate PRL expression in primary endornetrial stromal ce11

cultures (Gellersen et d.. 1994). It has been s h o w that whife progesterone is not

sufficient to activate the silent PRL promoter. cAMP alone can induce the PEU prornoter

in undifferentiated endometrial stroma1 cells. It was therefore speculated that cAMP is

the primary inducer of the PRL gene expression. Conversely in lymphoblast ce11 lines

IM-9-P33 and IM-9-P6 cells. cAMP h a no effect (Gellersen et al.. 1994). These results

demonstrate tissue-specific differences in the regulation of decidual and lymphoblast

PRL gene expression.

Introduction of 3 kb of dPRL 5' flanking DNA into IM-9-P32 lymphoblast cells ( a

clona1 line of IM-9-P which has a slightly lower lesel of PRL production than that seen in

IM-9-P33 cells) and IM-9-P6 (PRL gene is silent) resulted in comparable transient

transfected reporter gene activities. Deletions of the 3 kb reçion of the PRL gene did not

reveal regions of regdatory DNA specific to either clona1 lymphoblast ce11 line and

therefore did not match the activity of the endogenous PRL gene. This is in sharp

contrast to the results obtained in primary endometrial stromal cells. In undifferentiated

endometnal stromal cells in which the PEU gene is silent. no activity of the same PRL

prornoter-reporter deletion constmcts were detected. However. when the cells were pre-

treated with known inducers of decidualization and PRL expression (MPA and relaxin).

strong activation of these constructs was observed (Gellersen et al.. 1994). This implies

that 3 kb of 5' flanking region of the dPRL promoter contain cis-acting elements

controlling tissue-specific expression of the PRL gene in decidual cells.

My first objective therefore was to isolate a larger fragment of 5' flanking dPRL

DNA to be used in studies to identiS. cis-acting elements controlling dPRL expression

primarily in lymphoblasts and which may be important for endornetrial stroma1 ce11

expression. The work descnbed in this thesis on regulation of PRL gene expression \.as

performed on the endogenous hurnan PRL gene through DNase 1 hypersensitivity

analysis. and on artiticial genes using the transient transfection assay. Therefore.

understanding the regulation of the human PRL gene in different tissues may help to

identify new cis-active transcnptional regulatory rlements that may bind factors which

play a global role in the regulation of decidualization.


3.2.1 Human Genomic Library Screening

In order to perform DNase 1 hypersensitivity studies and construct large chimeric

reporter fusion genes to study nonpituitary PRL gene transcription. a large fragment of

the 5 - flanking region of the hPRL gene was required. 1 therefore set out to isolate a

hurnan genomic clone containing a large region of 5' flanking DNA. A genomic library

constructed in the lambda Fix II Vector (catalogue # 946305) was obtained fkom

Strategene and screened according to the manufacturer's instructions such that 50 000 pfu

(plaque forming units) were present on each of fifieen 150 mm bacterial petn dishes.

Therefore a total of s'O 000 x 15 or 750 000 clones were screened with an 892 bp

Srlrllfiol fragment located in the first 3000 bp of decidual PRL Y flanking DNA.

Nitrocellulose membranes (Scheicher and Schuell) were used for plate-litts of the

above mentioned culture plates containing the genomic library which was performed as

described previously (Maniatis. 1989). Hybridization of these plate-lifts was performed

as described in section 2.2.8. Clones were screened by hybndization until al1 plaques

w r e shown to be positive. Pure human PRL phage clone DNA was obtained by Iiquid

lysis. Top agar plugs containing the clone of interest were added to 500 pl of LE 392

cells (Escherichia coli strain used to propagate bacteriophage lambda vectors) and

incubated for 20 minutes at 37OC. One hundred millilitres of pre-warmed Luria Broth

(LB) medium was added to the above culture and incubated for -3- 5 hours at 3 7°C or

until complete lysis. Five hundred microlitres of chloroform were added to the solution.

vortexed and centrifuged for 10 minutes at 6380 ?cg. Mini-preps of clones were purified

using Lambda Quiagen Midi-prep kit (Quiagen. Il).

3.2.2 Transformation of Bacteria with PIasmids

Escherichiu coli D H j n was used to maintain and grow recombinant plasmids

containing different DNAs. D H j a cells were made competent using the calcium

chloride/rubidium chloride procedure (Krushner et ni.. 1978). One hundred millilitres of

LB were inoculated with 0.5 ml of D H j a cells. The cells were grown with vigorous

shaking at 37°C until a ce11 density of 5 xloi cells/ml was reached. The culture was

centrifuged in sterile 50 ml centrifuge tubes for 10 minutes at 3920 xg and the

supematant discarded. The cells were resuspended in 50 mls of Solution 1 (10 m M

morpholinopropane sulfonic acid. pH 7.0: 10 mM rubidium chloride) and centrifuged at

3929 xg for 10 minutes at 4°C. The supematant was discarded and the cells were gently

resuspended in cold Solution II (0.1 M morpholinopropane sulfonic acid. pH 6.5: 50 mM

calcium chloride and I O mM rubidium chloride). The bacterial suspension was placed on

ice for 15 minutes and centrifuged for 10 minutes at 4OC. The recovered cells were

gently resuspended in 23 mis of Solution II and stored at 4°C where rhey remained

competent for up to two weeks.

Transformation of D H j a was done with one to five micrograms of plasmid DNA

added to 200 pl of competent bacterial cells. The mixture was incubated on ice for 20-45

minutes. heat-shocked at 42°C for 90- 120 seconds. placed back on ice for an additional 2

minutes. and then grown with 1 ml of LB for 1 hour. The bacteria was gently

centrifuged. resuspended and plated on agar plates containing X-gal (0-nitrophenyl-B-D-

çalactopyranoside). IPTG (isopropylthio-B-D-galactoside) and the appropnate antibiotic

(e.g. 200 pgml of ampicillin). Bacterial plates were incubated at 37°C ovemight and

single colonies were picked the next moming and used to innoculate 3 mls of LB

containing 200 pg/ml ampicillin. Alkaline-lysis (Maniatis. 1989) was used for mini-prep

DNA analysis to identifj successfül clones. One hundred microliters of these 3 ml

cultures (above) were expanded ovemight in 150-500 mls LB or Terrific Broth

(bactotryptone. bactoyeast extract and glycerol) containing ampicillin. Bacterial cells

were harvested by centrifugation at 3920 xg for 20 minutes. supematants discarded and

pellets stored at -80°C until M e r processing.

3.2.3 Purification of Plasmid DNA

Pellets of bacterial cells containing the plasmid of interest were resuspended in 8

mls of resuspension buffer (25mM Tris-HCL pH 8.0. 10 m M EDTA. 50 mM glucose). a

volume of 1.5 rnls of lysis buffer (same solution as listed above but containing Smg/ml

lysozyme) was added. The samples were incubated at room temperature for 15 minutes.

mixing by gently inverting the tube several tirnes. To this mixture. 1.8 ml of EDTA was

added mixed as above and allowed to sit at room temperature for 5 minutes. Following

incubation, 12 mls of Triton-lysis buffer (0.1% Triton X-100. 60 mM EDTA. 5OmM

Tris-HCI pH 8.0) was added and the sarnples were rnixed by gentle inversion and

incubated on ice for minimum of 20 minutes. The bacterial debris was pelleted by

centrifugation at 20 070 xg for 10 minutes. The supernatant was removed. the volume

recorded and an equivalent amount in grarns. of crsium chloride (CsCl) was added and

dissolved by repeated inversion. Ethidium bromide was added to the mixture at 800 pl

of 5 mgml which was then transferred to Beckman quick-seal 16 x 76mm polyallomer

tubes for ultracentrifugation in a Beckman vti65.l rotor. Samples were centrifuged in

Beckman ultracentrifuge at 60 000 rpm for at least 6-8 hours at room temperature. The

lower plasmid band in the CsCl gradient was removed using an 18 gauge needle on a 3cc

syringe and ejected into 15 ml centrifuge tube containing 1 ml double distilled water and 2

rnls CsC1-water-saturated butanol to extract the ethidium bromide. Isolated DNA was

precipitated with 95% ethanol and recovered by centrifugation for 20 minutes at 6380 xp

(4°C).

3.2.4 Restriction Mapping and Sequenciog of DNA

To characterize DNA inserts of interest, restriction enzyme digests were

performed as stated in Section 2.1.6. Sarnples were subjected to electrophoresis on 0.8-

1.0% agarose gels and analyzed according to size of resultant fragments obtained. In

addition. the DNA clones were sequenced following the Sanger method using the T7

Sequenase Version 7.0 kit purchased from Amersharn (IL). A 6.3 % polyacrylamide gel

containing 50% urea was used to resolve al1 sequencing reactions. The BioRad Sequi-

Gen sequencing cell system was used for analysis of the sequencing reactions followed

by fixation of the gel in 0.5% methanol. 0.5% acetic acid and drying of the

polyacrylarnide gel on Whatmann paper to facilitate autoradiography using Kodak film

with an exposure of 1-5 days at room temperature.

3.3 RESULTS

3.3.1 isolation of Human PRL Genomic Clone

A radiolabelled probe was generated from a 892 bp SrzrllX7101 fragment isolated

from the 3kb of 5' flanking decidual P E U promoter region and a genomic libraq was

screened to isolate more 5' flanking DNA. Threr independent clones. 7D. 8B and 1 3 3

were isolated afier a stringent screening process. Afier prelirninary restriction digestion

analysis of al1 clones. it was found that clone 7D contained the largest amount of 5'

flanking DNA relative to hPRL exon la. In addition. 7D also contained a srnaIl portion

of intron A- 1 as well as exon la therefore this clone was used in al1 future studies.

3.3.2 Characterization of Human PRL Genomic Clone 7D

The approximately 16 kb human PRL genomic insert from lambda clone 7D was

subcloned into pBKSII as a contiguous Nui1 fragment. The orientation of the insert and

an extensive restriction map is shown in Figure 3.1. Sequence analysis and restriction

mapping showed that this clone contained 746 bp of intron A-1 and al1 of exon la-

containing the decidual/lymphoid transcription start site. In addition. the total length of

the 5' flanking DNA obtained in this clone was detemined to be approximately 16 kb.

This included the proximal 3 kb region previously characterized. Restriction enzymes

hPRL gclone 7 0 in pBKSll

decidual/îyrnphoid PRL

SF known DNA sequence (525Qbp) >

Pst 1, ..., BspD 1, Apa l, Kpn l

putabive v

Stu I Iymphoid-spedfic - -6kb

Figure 3.2 Map of Geaomic Sequence Obtained of dPRL Promoter

The sequence was obtained using the Sanger method of

sequencing. Sequence obtained is shown and begins at -5259 bp

From the dPRL transcriptional start site. ~VCO 1 site is presented in

itaiics. the -4hi 1 region is underlined and exon 1 A is bolded. Map

of the region is shown below the sequence. The hatched box

represents the Alu 1 fragment. dotted box is the 2334 bp of original

sequence obtained and exon 1A is represented by a black box.

Nco I ccatggcgtgtagtagagagtttaatagacacaaagctgggcacgccacgtgggatgcagagttagtactcaaatcattc ttttccaaagcttgtagttagggatttttctttttttcttctttttttttttttcgagacagagtcttgctctgtcgccc aggctggagtgccgtggcgcgctatccatccgggcagaggcctaataactcacacctat~tcauaucacttt~aa~r

cccatcactact=-aata caaqaggatcgctccaccc

agaggcaaggtgtggtgagctgaggtcgcgacactgcctccagcctggggcacaagcaagaactctgtcccaaaaaaaaa aaaaaaaatagtagacatcaaaggtcattgcagaataattaaagaagtaataatgatattagccctggagtacaagaatt atcacagattatgttcttcaagatggataggacaaagtcttccattccacataattttcttacaatgtgatattgacacc tctcaatgagagttcgggtctattttatcccttgaatccaggcctgccagcaaccacgaaggaaatgatactctgtactt ccaaggctgtttataaaaggaggtagagtttctgcatagtctttttgggttaattgctctagagactttcccccatgctg tgagcaagcctggagcatatggagaggccctgagtaggattctgatggacaatcccagctgacagccagtatcaactaac aaacatggtttgtttagctctagccaccatttggctgcccctgcaaaccacatgaaagatcccaagcaagagccatgaga garaacaaattgattgttgttgttttaagccacaaaatttgagggtactttttttgttttgttttgtttttgcagccata gataatcaaaacaactatttatagtctctcttactgaggatattctaaacattattcaaaagtatcaccaaatgagccct atgcagagaggccactgttgcaaatgagtacttggcctgtctgatttcataataccttggcaggattgggtatcactgga agttgctagctatagctagtttatgaagcttcatgaccaaaaggaaatgtggaggcatcaggaattttcacaaagcatga csaatcgtatccatcaaatttggtaataaagtaactattttgtcatgtaggtactgatggagtaagccagaactggagca aataatttaattcaaaacttctttccccttattcaataatgtatacatgagtctatataactcgttaacaaacaataatg taaaatttgttcttaaaaataagcatattgcttcattaacatcttggagtttgctttcatacaaccctttctacaaagac aaggcttaagacataaatttgtaatttggggtaatgaaagtaaaacagttgtaatgtcatctttatgaactgcccta aaatatgtctgtccaaaggcaaaatatacataataaaaatctttcataacagtacaaaacaatatttttgatttcatgtct gggatgatataaagtttcttatgcttgaaatgacattgaagtaaactgccagaaaagacttctgaggttttatttattta ttttttttgacaaggacaaacccatgacatttttacaaagcctttggtcttaaccttggaatcttactgcttaggataaa ggcagagaaaatgagcaagaaagctctaaaggtaagatgctattattaaatgcaaatatattcattaaggaattggccaa acaggaaggaatattccacttttaatgaattctttaaacacacaaatattctgcagtgtgcattttaatttaacctttga agcagtggttatcagtggaaatggacctgggtgataaatgctatctagaacttatttttttaccctttattttatataca tatatatatgtatatrttttaagtccattaaaagctgtcttattttcactttcatattctagaccttcctgcagagttac taaaagctccaatggaatcatttttatgggatttgaaattttgagatgtattgctagaaacacttcatataatgaaaata ctatatgtaatttttaaaaatatatcttccaaaaatttttaaacactgacgaggaattaaagtatattttgcatgtag~a aagttttgtgatc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2925b p previousiy derived sequence

AGTAGOTCATMQMCCTTCATTCCAOMGTACCCTCAAAOACAOAGACACCMGMGAATCGGAACAT ACAGGCTTTG

426 Nru I 366 Xrna 1 366 Sma l 1525 Afl I l 366 Ava l 1424 Hpa l deciduau

245 Fau l 1401 Xcal iymphoid PR1 177 BSSH II 1401 Snal Unique Sites 4673 S P ~ 1 start 171 BceFl 1205 Nhe l 4001 Sau l -

47 Prnl l 1114 Ban Il 2499 Bcl l 3700 Dra l I l 4671 Nsi l 47 Wl 937 BstY 1 2494 BsaB I 3482 Ase I 4455 Bsm l 5d19 EcoN I

1 Nco 1 904 MM 1 2023 Ava II 3289 Sai l 4001 bu36 1 4978 B6a l

II I I I I I I 1 I I 1 I 1 1 I 1 2925 base pairs

2334 base pairs

HUMAN PROLACTIN GENE 5' REGION

deciduaVlymphoid PRL start site +

-5259 NCO I S ~ U 1

-1 6kb

hPRL gclone 7D

deciduaVlymphoid PRL pituitary PRL starî site dari site

Sac l

5'

2935bp 5663bp A

pitultary PRL mRNA : 85bp

decldual/lymphold PAL mRNA : 125b~

with relatively infiequent restriction sites were mapped to facilitate the design of DNase

1 hypersensitivity expenments and construction of chimeric reporter genes. Regions of

this clone were sequenced to identi- potential unique restriction sites for generating

DNA probes required for DNase 1 hypersensitivity expenments. Approximately 2 kb of

sequence were obtained between -3000 bp and -5000 bp of decidual/lymphoid PRL

transcription start site (Figure 3.2). In addition. 2 kb of sequence from intron A-1

downstream of exon la was also detemined. Sequences were examined using the DNA

Strider computer program. Several ALU-1 repeat sequences along wlth a LINE (Long

lntenpersed Element) were found throughout clone 7D as shown in Figure 3.1. Figure

3.3 shows the alignment of genornic clone 7D with the PRL gene to show the position of

the clone.

The transcriptional regulation of the human PRL gene is complex because of the

alternative transcription start sites and the fact that PRL modulates so many seemingly

unrelated physiological functions. Tissue-specific differences in the regulation of gene

expression is one mechanism by which cells can control and maintain the function of a

particular gene product. These differences can be seen in promoters of genes containing

specific civ-acting elements active only in specific ceIl types in combination with specific

trcm.s-acting factors. Regulation of PRL gene expression occurs through a tissue-specific

mechanism because the gene contains cell-spec i fic promoters. The rationale for isolating

as large a region as possible (from a lambda library) of DNA upstrearn of the dPRL start

site was to enable an extensive and comprehensive analysis of putative regulatory

regions. To this end. I have isolated a hPRL genomic clone containing approximately 16

kb of 5' DNA to the dPRL start site. Extensive restriction mapping and sequencing of

this region has provided the data and biological reagents necessary to perform both

DNase 1 hypersensitivity analysis and transient transfections. To date. only 3000 bp of

decidualllymphoid PRL 5' flanking DNA has been sequenced and studied. I have

sequenced an additional -2 kb of 5' flanking DNA in addition to -2.5 kb of intron A-1.

Preliminary transient transfection studies revealed that 332 bp is essential for minimal

promoter activie in primary differentiated endometrial stromal cells whereas cell-

specific elements confemng Iymphoblast-specific PRL expression have not been isolated.

Studies in the IM-9-P33 and IM-9-P6 cells lines. which have opposing endogenous PRL

aene activity. using 3000 bp and deletions therein of 5' deciduaVlymphoid PRL flanking b

DNA revealed equivalent promoter activity in these ce11 lines. It was concluded that the

activity of the transiently introduced Fusion genes did not reflect the expression of the

endogenous PRL locus (Gellersen et cd.. 1994). This irnplied that cis-acting regulatory

elements specific for the lymphoblast PRL expression are not present within the 3000 bp

of 5 - flanking DNA. Alternatively. the PRL gene in the IM-9-P6 cells could be modified.

epigenetically. such that transcription factors are denied access to their binding sites.

Finally. the differences seen between the two ce11 lines could rest in the chromatin

structure such that in IM-9-P6 cells. the structure is not conducive to transcription. The

results presented in this thesis represent preliminary studies directed at answenng these

questions.

Preliminary studies on primary hurnan decidual cells in vitro revealed that the

state of the endogenous gene correlated with the activity of the transfected PRL fusion

constructs. Whereas high activity of the transfected constructs was seen in hormone-

treated endometrial stromal cells in which the endogenous PEU gene was active. thrse

constnicts were not active in non-treated and therefore non-decidualized endometrial

stromal cells (Gellersen et cri.. 1994). [t was concluded therefore that the 3000 bp of Y

flanking DNA contained cis-active elements controlling differentiation-specific

expression of this promoter in human decidual cells.

Another indicator of tissue specific differences in PRL production between

endometrial stroma1 cells and lymphoblasts is reflrcted in the response to progesterone.

This hormone is known to act as a potent indirect activator of decidual PRL production

but inhibits PRL secretion in the IM-9-P33 ce11 line (Gellersen et cd. . 1989). As

mentioned previously. there are seven half sites for glucocorticoid/progesterone receptor

in the 3000 bp of dPRL 5' flanking DNA. These sites have been proven to be non-

functional. In addition. dexmethasone (a synthetic glucocorticoid). which is a known

inhibitor of pituitary PEU production. also inhibits PRL in IM-9-P33 cells. Another

difference seen behveen decidual cells and lymphoblasts is their response to CAMP.

Cyclic AMP has been shown to induce decidualization and PRL production in primary

endometrial stroma1 cells in the absence of progesterone whereas it has no effect in

lymphoblast cells (Gellersen er cd.. 1994). By studying the 5' flanking DNA of the PRL

gene in both IM-9-P33 and IM-9-P6 cells as well as in decidualized BlOTl ce11 lines C

using clone 7D. we hope to elucidate the mechanism goveming the tissue-specific

differences in PRL expression. Clone 7D will be used to devise hPRL promoter deletion

constnicts for transient transfection assays: in addition. Fragments of this clone will be

used as probes for DNase 1 hypersensitivity analysis. These two expenments will be

performed together as a complirnentq and parallel approach in determining the complex

transcriptional regulation of the human PEU gene.

CNAPTER J

DNASE I HYPERSENSITIVITY STUDIES

4.1 INTRODUCTION -- -- - --

It is well estnblished that chromatin structure and chromosomal organization

influence gene expression in a directed and non-random mariner. The packaging of DNA

into chromatin results in several different levels of structure. including higher order

structures such as the 30 nrn tibre (Felsenfeld et ai.. 1986). Within these structures, the

repeated nucleosomal organization results frorn the winding of DNA around the histone

octamer cores. The nucleosome represents the first level of compaction of DNA in the

nucleus. Disruption of DNA-histone contacts is necessary for transcription because the

complex rnust rotate with respect to the DNA helix once every 10 bp as the transcript is

synthesized (Felsenfeld er (11.. 1992). Interestingly. deletion of the histone H4 gene in

Succhnromyces cerevisirze results in the constitutive expression of many genes which

suggests that nucleosomes are directly involved in repressing transcription (Kim et ai..

1988).

DNase 1 hypersensitive (HS) sites represent regions associated with non-histone

chromosomal proteins and map as protein-frer DNA. DNase 1 HS sites aïe believed to

allow trrrns-acting factors access to ch-acting elements and have been found in conrrol

regions of al1 active or inducible genes (Gross rr nl.. 1988). The presence of functional

regulatory elements in DNA is usually associated with a disruption in chrornatin structure

resulting in hypersensitivity of the DNA to nucleases such as DNase 1 . Identification of

these sites therefore provides valuable information about the location of regions of

protein-DNA contracts that may regulate transcription. We therefore chose this rnethod

of experimentation to identiS regions of the hPRL gene responsible for controlling

tissue-specific expression. This analysis allows for direct examination of the native PRL

gene locus which most closely resembles an in vivo gene configuration. A

comprehensive study of the PRL gene was conducted using the human lymphoblast ce11

lines IM-9-P33 and IM-9-P6. It is possible that differences between the expression of

PRL in these two lines might be observed as differential IocaIization of DNase 1

hypersensitive sites. Determining the potential binding sites for transcription factors by

DNase 1 hypersensitivity will facilitate closer analysis of the DNA region containing

these sites by transient transfection analysis.


2 . 1 Isolation of Genomic DNA

Tissue andor tissue culture cells were resuspended in room temperature lysis

buffer (0.1 M Tris-HCI pH 8.0. 0.1 M NaCI. O.OO5M EDTA. 1% SDS and 100 p@ml

proteinase K) at a ratio of 1 ml lysis buffer to 0.5 g tissue or 4 x106 cells. This mixture

was incubated ovemight in a 37°C waterbath. Subsequently. 0.25 @ml of RNase A was

added and incubated at 55°C for 30 minutes. Then 1 ml stenle TE (pH 7.5) and 2 mls of

0.01 M Tris-HCl. pH8.0 equilibrated phenol was added and the solution was gently

mixed by manual inversion to reduce shearing of the high molecular weight DNA and

subsequently centrifuged at 1630 rg for 10 minutes. The aqueous phase was then

extracted with an equivalent vo lurne of equilibrated phenol/chloroforrn-isoamy 1 alco ho1

and centrifuged as above. A final chloroform-isoamyl alcohol extraction was perfonned.

centrihged and the aqueous phase removed. The genomic DNA was then precipitated

with l / 3 volume 3 M sodium acetate pH 5.3 and 95% ethanol and centrifuged at 6380 xg

for 15 minutes. The resulting pellet was redissolved in TE pH 8.0 and stored at -20°C.

4.2.2 Gel Electrophoresis and Transfer of Genomic DNA

Twenty-five to thirty micrograms of genomic DNA were digested with the

oppropriate enzymes overnight and the DNA precipitated with 95% ethanol before

loading onto a 0.8 % agarose gel. Electrophoresis was camed out at 40 V for 8-10 hours.

Agarose gels were then treated with 1.5 M NaCI. 0.5 M NaOH for 2x 30 minutes

followed by I M NH4CH3CO0. 0.02 M NaOH for another 2 x 30 minute treatment prior

to ovemight. conventional transfer of the genomic DNA ont0 Nitroplus 2000 (MSI. MA)

membranes (Ciment Protocols. Chapter 2). Filters were baked at 80°C for 2 hours and

stored at 4°C until use.

42.3 Hybridization and Quantification of "P-~CTP Labeled Probes

Prehybndization ( 1 -2 hours) and hy bridization (ovemight) of the DNA

membranes was performed at 42°C in a rotating incubator as previously mentioned. The

prehybridization buffer and therefore the hybridization buffer minus the radiolabeled

probe. was composed of 6.6X SCP. 1% N-lauryl sarcosine. 100 pg/ml sheared salmon

spenn DNA. 4X Denhardts. 50% formamide. The filter was pre-wet in 4X SCP before

hybridization. Approximateiy 3.54 x 10' dpm/ml of denatured DNA probe was added to

the hybridization buffer. Membranes were washed at 15 minute intervals with 6.6X SCP

1% N-lauryl sarcosine: 1 X SCP. 1% N-lauryl sarcosine and findly with 0.2X SCP. 1%

N-lauryl sarcosine at 6j°C. Blots were exposed to Kodak XAR-5 fast film for 1-8 days.

43.4 DNase 1 Hypersensitivity Analysis

For each reaction in these experiments. 50 million nuclei were needed. As IM-9-

P33 and IM-9-P6 cells grow in suspension. 500 pl of cells were collected and counted

using a hemacytometer. Sixty million cells per sample were aliquoted and centrifuged at

775 xg for 4 minutes at 4 O C . Cells were then gently washed with cold D-PBS and re-

centrifuged as above. D-PES was removed and 10 rnls of homogenization buffer (10

m M Tris-HCL pH 7.4. 15 mM NaCl. 60 mM KCl. 1 m M EDTA. 0.1 mM EGTA. 0.1%

NP-40). 0.1 5 mM spermine. 0.5 mM spermidine and 5% sucrose) was added. The tube

was gently swirled to disiodge the pellet and transferred to a cold 15 ml Dounce

homogenizer ( 1 5 ml Wheaton units with pestle B-tight). Pipetting up and down several

tirnes. avoidinç bubbles. dispersed the pellet. After a 2 minute incubation on ice. the

homgenizer was stroked ten times to lyse the cells. The mixture was transferred to cold

I I ml centrifuge tubes and 2 mls of sucrose pad was added to the boaom o f the tube (1 0

mM Tris-HCI pH7.4. 15 mM NaCl. 60 mM KCl. 0.15 mM spermine. 0.5 mM

spermidine. last two chemicals added fresh. 10% sucrose). Nuclei were pelleted by

centrifugation at 1525 xg for 20 minutes: the supernatant was removed. The pellet of

nuclei was gently resuspended in 8 mls of wash buffer (1 0 mM Tris-HCl

pH 7.4. 15 mM NaCl. 60 mM KCI. 0.15 rnM spermine. 0.5 mM spennidine). Each

sample was then centrifuged for 4 minutes at 775 xg and the supernatant rernoved.

To begin DNase 1 analysis. 50 million nuclei were isoiated per sample reaction as

stated above. The nuclei were digested in I ml DNase 1 digestion buffer (0.15 mM

spermine. 0.5 mM spermidine. 15 mM Tris-HCl pH 7.4. 60 mM KCI. 15 mM NaCl. 0.2

mM EDTA. 0.2 mM EGTA. 0.1 mM PMSF) with 0. 2. 4. 6. 10. 16 and 25 unitdm1 of

DNase 1 (Worthington. New Jersey) and incubated at 37°C for 15 minutes. Each reaction

was initiated with the addition of 5 mM MgClz. The reactions were terminated by adding

10 pl of 10 mM EDTA and the nuclei collected by centrifugation at 1525 xg for 5

minutes. Proteins were inactivated with the addition of proteinase K buffer ( 10 mM Tris-

HCl pH7.6. 10 mM EDTA. 0.5% SDS. 0.2 mgml proteinase K) for ovemight incubation

at 37°C. Following this. RNA was removed by digestion with DNase-kee. RNase A to

25 p@ml at 5j°C for 30 minutes. Nucleic acid was purified by repeated organic

extractions using equivalent volumes of phenoVchloroform isoarny 1 alcohol and

centrifuged at 1650 xg for 10 minutes to separate the phases. To rid the sarnple of

residual phenol. chloroform/isoarnyl alcohol extractions were done and centrifuged as

above. Isolated DNA was precipitated using 95% ethanol and 1/10 volume of sodium

acetate pH 5.3 with the resulting pellet resuspended in 400 ul TE pH 8.0 (Dirks et tri.,

1993). Digestion of 30 pg DNA. electrophoresis. Southern transfer and hybndization

was performed as stated in Section 4 - 3 2

4.2 RESULTS

4.3.1 Experimental Design

In order to perform DNase 1 hypersensitivity experiments. convenient restriction

enzyme sites that were unique or rare in the areas of the gene to be studied were

identified. Concentrations of DNase 1 were used such that a selected region of DNA

bound by restriction enzymes was cut less than once on average. Restriction sites were

chosen to generate parent fragments of sufficient size that upon digestion with DNase 1

resulted in fragments easily resolvable on an agarose gel. The identification of DNase 1

HS sites associated with expression from the upstrearn decidual/lymphoid specific

transcription start site aided in determining the position of DNA-protein interactions on

the endogenous PRL gene. Figure 4.1 outlines the DNase 1 hypersensitivity mapping

strategy we designed using the information gained from restriction mapping and

sequencing of clone 7D. This figure represents al1 of the 5' flanking DNA obtained from

clone 7D. along with exons la. 1 and intron 4-1. These studies were repeatedly

harnpered by the presence of DNA repetitive elements duoughout the 5' flanking region

of the PRL gene in the form of dhr 1 repeats (light hatched bars in Figure 4.1). These

repeat elements consist of genomic DNA containing short (150-300 bp) interspersed

repeating elements. No two copies of these intemediate repeats are identical and they

are usually found in promoter regions of genes. In addition to these repeating elements.

this region of the PRL gene contains another repetitive element called LINE which is

usually much larger than dlu 1 elements (approximately 1 - 5 kb in size) and occur less

frequently throughout the genorne (dark hatched box. figure 4.1 ). These repetitive

elements had to be eliminated from potential DNase 1 hypersensitivity probes so that

individual restriction fragments could be resolved.

4.3.2 Characterization of DNase L Hypersensitivity Parent Fragments

Southem Mots were performed to determine the presence of repetitive DNA in the

rrenomic probes and the size of the parent fragments for DNase 1 hypersensitivity *

analysis using restriction enzyme sites as shown in Figure 4.1 of the DNase 1 HS

strategy. Genomic DNA isolated from cell lines BlOT1. MI. IM-9-P33 and IM-9-P6

were tested to check for polymorphisms that could also complicate the DNase I

hypenensitivity results. In the superdistal region of the PRL gene. that is the far 5' end

of the hPRL genomic clone 7D. the parent fragment generated using the 1.4 kb Sril 1/Spe 1

fragment as a probe and the enzyme Spe 1 was approximately 9.5 kb (Figure 4.2. A).

This extended the DNase 1 hypersensitivity analysis an additional 6.5 kb beyond the 5'

end of the hPRL genomic clone 7D and therefore -22 kb upstrearn of the

decidual/lymphoid transcription start site. To analyze the distal region of 5' flanking

DNA. as denoted by genomic clone 7D. the 1.4 kb Srul/Spe 1 probe was used to detect a

Figure 4.2 Characterization of DNase I Hypersensitivity assay-parent

fragments in the superdistal and distal region of dPRL 5'

flanking DNA

Genomic DNA was isolated from BlOTI. M4. IM-9-P3S and IM-

9-P6 cells. DN.4 was digested with 3 U/pg of SpeI and probed

with a "P-labelled 1.4 kb 9uIlSprI fragment to asses the

superdistal region of the human PRL gene region (A) and 3 U/pg

SUCI and probed with a 1.4 kb StiiI/SpeI fragment to analyze the

adjacent distal region (B). Parent fragment sizes are given on the

right-hand side of the figure: 1 kb ladder was used to determine

hybridizing fragment size and is indicated on the lefi-hand side of

each autoradiogram.

Figure 4.3 Characterization of DNase 1 Hypersensitivity assay-parent

fragments generated in the proximal and intronic region of

hPRL gene.

Genomic DNA was isolated fiom B 1OT1. M4. IM-9-P33

and IM-9-P6 celIs. DNA was digested with 3 U/pg of Sac1 and

probed with 520 bp BsrEIIIBgDI fragment labeled wiih "P to

examine the proximal region of the human PRL gene (A). Three

unitdpg HincII digestion of B lOT1 and IM-9-PX DNA and

probed with 483 bp EcoNIi.4.1 to assess the intronic region (B).

Parent Fngrnent sizes are given on the right-hand side of the

figure: 1 kb ladder was used to determine hybridizing fragment

size is indicated on the left-hand side of each autoradiogram.

B l O T l M4 P33 Pb

5.2 kb Sac1 parent fragment which was expected based on restriction mapping of clone

7D (Figure 4.3. B). At -8.0 kb. a 522 bp Bgi'iIIBsfEII probe was used to analyze the

proximal promoter region of the decidual/Iymphoid PRL start site. also using Sacl as the

restriction enzyme. Southem analysis revealed a fragment of 10 kb. encompassing

approximately 8 kb of Y flanking DNA as well as 2 kb of intron A-1 (Figure 4.3, A).

Finally. a 483 bp EcoNl/.-lfnII probe and HincII digestion was used to examine the

intronic region separating the two tissue- specific promoters. This probe. located

approxirnately 4 3 5 9 from the pituitary specific start site. çenerated a 5.7 kb HincII

Fragment. as seen in Figure 4.3. B. This fragment incorporates the proximal prornoter of

pituitary prolactin. exon 1 and extends into intron 1.

4.3.3 Analysis of the Superdistal Region of the Prolactin Gene

The region extending approximately 6.5 kb upstrearn of clone 7D beginning at

-1 3kb of hPRL genomic clone 7D represents the superdistal region (Figure 4.4 depicts

the map of the superdistal region). DNA was isolated from DNase 1 treated (increasing

concentrations of DNase 1 ) IM-9-PX and IM-9-P6 nuclei and digested with 3 U i p g of

Spel. transferred to nitrocellulose and hybridized with 1.4 kb SflrllSpe 1 probe to

indirectly label fragments resulting from Sprl digestion at the 3' end and DNase 1 at the

Y end. The hybridizing fragments obtained afier autoradiography is shown in Figure 4.5.

A for IM-<)-PX. As expected. the parent fragment generated was approximately 9.5 kb

in size. however. no other fragments were detected indicating a lack of hypersensitive

sites in the superdistal region of the PRL gene. Identical results were obtained using the

IM-9-P6 lymphoid ce11 Iine where the endogenous PRL gene is inactive (Figure 4.5. B)

4.3.4 Distal Analysis of the Prolactin Gene

The next downstrearn region to be analyzed extended from the Sac I site at -1 3 kb

to the next downstrearn Sac1 site at -8 kb relative to the decidual transcription start site.

as seen in Figure 4.6. In this case. we utilized the same 1.4 kb Sful/ Spe l probe used to

examine the superdistal region of the PRL gene. Nuclei from both IM-9-PX and IM-9-

P6 were treated with DNase 1 and the DNA was digested with 3 U/ jqg of Sacl. the 5 '

Figure 4.5 DNase 1 sensitivity of hPRL superdistal region in IM-9-P33

and [M-9-P6 cells analyzed by SpeI digestion.

Isolated nuclei were treated with the indicated amounts of DNase 1

for 15 minutes at 37OC. DNA was purified from nuclei and

digested with SpeI (A-IM-9-PU and B- IM-9-P6). These digests

(30 pg) were separated by electrophoresis on a 0.8% agarose gel

and blotted ont0 nitrocellulose filters. Blots were hybridized with

1.4 kb StuIISprI genomic fragment. Restriction fragment size

(given in kb) was detemined by reference to the1 kb ladder.

Parent fragment size (9.5 kb) is indicated (arrow). Concentrations

of DNase 1 are given (U/pg).

DNase 1 U/pg

O 2 4 6 10 16

IM-9-P33 DNA

DNase 7 U/ pg

IM-9-Pb DNA

Figure 4.7 DNase 1 sensitivity of hPRL distal region in IM-9-P33 and [NI-

9-P6 cells analyzed by Sac1 digestion.

Isolated nucIei were treated with the indicated arnounts of DNase 1

for 15 minutes at 37°C. DNA were purified from nuclei and

digested with Sac1 (A- IM-9-P33 and B-IM-9-P6 ). These digests


and blotted onto nitrocellulose fi Iters. Blots were hybridized with

1.4 kb StuIISprl genomic fragment. Restriction fragment size

(given in kb) was determined by reference to the 1 kb Iadder.

Parent Fragment size (5.2 kb) is indicated (arrow). Concentrations

of DNase 1 are given (U/pg).

DNase 1 U/pg

O 2 4 6 10 16 25

6 k b b

IM-9-P6 DNA

anchoring restriction e q I m e . As c m be seen in the autoradiograms of Southern biots in

Figures 4.7 A and B (IM-9-P33 and IM-9-P6 DNA respectively) both experiments

generated the expected parent fragment size of -5.1 kb. However. as seen with the above

experiments. no hypersensitive sites were detected in this region of the hPRL gene.

1.3.5 Proximal Analysis of the Prolactin Gene

The most common location of transcription factor binding sites is the proximal

promoter of genes and this region was encompassed in the next DNase 1 hypersensitivity

experiment. The proximal promoter of the prolactin gene was exarnined in the lymphoid

ce11 Iines. by DNase 1 treatment of DNA digested with 3 U/pg of Sncl. The probe was a

522 bp BstEIIIBgAI Fragment of DNA located just immediately downstream of the S d

site at -8 kb which was used as the 5' anchorhg restriction enzyme (Figure 4.8). The

rxpected parent fiagrnent based on sequence and restriction enzyme analysis was

approximately 10 kb in size. This fragment encompassed 8 kb of 5' flanking DNA as

well as 2 kb of intron A- 1. just downstrearn of eron la. Figure 4.9. A shows the presence

of this 10 kb parent fragment but as c m be seen. no hypersensitive sites were detected

using the IM-9-P33 ce11 lines. Similar results were obtained using the IM-9-P6 ce11 line

(Figure 4.9. B).

1.3.5 Analysis of Prolactin Gene Intron A-1

It has been well documented that gene regulatory regions can Function at great

distances from the proximal promoters of genes and can be located at the 5 ' end of a gene

or in introns. We therefore wanted to ascertain the existence of hypersensitive sites in the

intron (A- 1 ) separating the two tissue-specific start sites of the prolactin gene. Using

HincII as Our unique restriction enzyme. we utilized a 483 bp EcoNl/AflII probe

positioned just downstrearn of the HincII restriction enzyme site at -4359 bp of intron

A- 1 (Figure 4.10). In the IM-9-P33 cells. the expected parent fragment kvas obtained at

5.7 kb. In addition. three hypersensitive sites. roughly located at -3858 bp. -3 359 bp and

-7 1 59 bp were found in intron A- 1 as seen in Figure 4.1 1 . Interestingly. the last site

located at -21 59 bp coincides with the distal enhancer of the pituitary PRL promoter.

deciAiaVlym#wid PRL start site 5663bp ntmn A-l p'iibry PRL

shrt site

Figure 4.9 DNase 1 sensitivity of hPRL proximal region in IM-9-P33 and

IM-9-P6 cells analyzed by Sac1 digestion.

Isolated nuclei were treated with the indicated arnounts of DNase 1

for 15 minutes at 37°C. DNA was purified from nuclei and

digested with Suc1 (A- IM-9-PX and B-[M-94%). These digests


and bloned ont0 nitrocellulose filters. Blots were hybridized with

520 bp BstEIIIBgfI genomic fragment. Restriction fragment size

(given in kb) was determined by reference to the 1 kb ladder.

Parent Fragment size (10 kb) is indicated ( m o w ) Concentrations of

DNase 1 are given (Ulpg).

DNase 1 U/pg

O 2 4 6 10 16 25

IM-9-P33 DNA

DNase 1 U/pg

O 2 4 6 10 16 25

IM-9-Pb DNA

Figure 4.11 DNase 1 sensitivity of hPRL intronic A-1 region in IM-94'33

cells analyzed by HincII digestion.

Isolated nuclei were treated with the indicated arnounts of DNase 1


digested with HincII. These digests (3Opg) were separated by

electrophoresis on a 0.8% agarose gel and blotted ont0

nitrocellulose filten. Blots were hybridized with 483 bp

EcoNII/.fnII genomic fragment. Restriction fragment size ( given

in kb) was determined by reference to the 1 kb Iadder. Three

hypersensitive fragments are labeled. Parent fragment size (5.7

kb) is indicated. Concentrations of DNase 1 are given (U/pg).

! L

IM-9-P33 DNA

Figure 4.12 DNase 1 sensitivity of hPRL intronic A-1 region in IM-9-P6

cells analyzed by HincII digestion.

Isolated nuclei were treated wiîh the indicated arnounts of DNase 1


digested with HincII. These digests (3Opg) were separated bp

electrophoresis on a 0.8% agarose gel and blotted onto

nitrocellulose filters. Blots were hybridized with 483 bp

EcoNIIlAfnII genomic fragment. Restriction fragment size (given

in kb) was determined by reference to the 1 kb ladder. Parent

fragment size (5.7 kb) is indicated. Concentrations of DNase 1 are

given (Ulpg).

DNase 1 u/pg

0 2 4 6 10 16 25

IM-9-P6 DNA

Conversely. there were no hypersensitive sites found when studying the IM-9-F6 cells in

the intronic region (Figure 4.12).

4.4 DISCUSSION

Chromatin hypersensitivity analysis of the human PRL gene most closrly

approaches an in vivo experiment because it allows examination of the endogenous Bene

in its native state. These studies possibly represent the first indication of chromatin

involvement in regulating vanscription as the binding of potential transcription factors

ofien involve chromatin rearrangement. In the analysis of the hPRL gene in the iM-9-

P H cells for potential transcription factor binding sites. surprisingly. hypersensitive sites

in over 16 kb of 5' flanking dPRL DNA were not detected. The Iack of DNase 1

hypersensitive sites in the 5' flanking region of a gene is not unusual. In the

hypersensitive analysis of the c-sis proto-oncogene encoding the B chain of platelet-

derived growth factor. no sites were detected in cells expressing this transcript up to -3.7

kb of the promoter region (Dirks et rd.. 1993). In addition. in transient transfection

analysis. equal activity was seen with fusion constructs containinp promoter sis -

1 13/+4ICAT and -1 758/+43 CAT. The authors therefore concluded that the entire c-sis

promoter is confined within the first 90 bp. It is therefore possible that the entire

lymphoid PRL promoter is contained within the very proximal DNA sequence to the

transcription start site and finer hypersensitivity analysis would be needed in this area to

possibly uncover more HS sites. Furthemore. while the IM-9-P33 cells were tested

using the PRL-specific IRMA kit (see Section 2.2.3) and were found to be secreting PRL.

the number of cells actually secreting PRL [nay have been highly variable and so

hypeeensitive sites may not be detectable by Southern blot analysis. That is. a relatively

small propoi-tion of IM-9-P33 cells in a given culture may express PRL at a high Ievel but

DNase 1 hypersensitivity is not sufficiently sensitive to detect the HS present in this

small percentage of cells.

Previous DNase 1 hypersensitive studies in cells expressing UCP. the uncoupling

protein found in brown fat in hibemating anirnals. uncovered seven hypersensitive sites

5. of the first exon. These sites were found in brown fat using the restriction enzyme

BamHI. Interestinglv b - enough. three of these sites are present in white fat when the

DNase 1-treated DNA was cut with the enzyme PvtrII. Al1 sites are present in brown fat

with PvuII. When using BamHI. these three sites were not detected in white fat. Usage

of PvtrII generated much shoner restriction fngments which were beneficial for finer

mapping studies. The authors offer no explanation as to why three hypersensitive sites

appear to be brown fat-specific only when cut with BamHI (Boyer rr al.. 1991 ). In

analyzing the hPRL gene. it rnay be necessary to use unique restriction enzymes that

pnerate smaller fragments. The negative results seen in the 5' flanking region may

therefore represent the inability of this method to detect HS sites over large regions of

DNA. To completely ensure that the hPRL 5' flanking region is devoid of HS sites. it

rnay be necessary to increase the concentrations of DNasel. however. as a test of the

functionality of DNase 1. digestion studies were performed on naked DNA. both genomic

and plasmid was cornpletely digested. Concentrations of DNase 1 used ranged from O to

75 U/pg and at the higher DNase I concentrations (35 Ulpg. 50 Ulpg and 75 Ulpg). the

genomic DNA was completely digested (data not shown). This strongly suggested that

the enzyme was functioning properly and that amounts used were at a high enough level.

Interestingly. hypersensitive sites were detected in the PRL-producing IM-9-P33

cells in the intron separating the hPRL tissue-speci fic promoters (Figure 4.1 1 ). Three

sites mapped to approximately -3800. -3300 and - 2200 relative to the p i t u i t q

transcription start site. These sites were not found in the non-PRL secreting IM-9-P6

ce11 line. The presence of HS sites in an intron is not uncornmon and in this case possibly

represents the only îùnctional difference between the IM-9-P33 and IM-9-P6 cell lines

which correlates with expression of the endogenous PRL gene. Many genes have

regulatory eiements located 3' of their transcription start sites. For example. enhancers

have been found in the second and third introns of the opoB gene in regions containing

strong DNase 1 HS sites. The apoB gene codes for a protein responsible for clearing

low-density lipoproteins (LDL) by the LDL receptor. Furthemore. these enhancers have

been found to behave in a tissue specific manner (Brooks et al.. 1994). The hPRL intron

A- 1 hypersensitive sites may represent inhibitory or stimulatory transcriptional regulatory

regions. One of these sites. located at -22000. maps very closely to the distal enhancer

region of the pituitary PRL- specific promoter. Eight functional Pit-1 binding sites have

been mapped to this distal enhancer region that coordinates pituitary-specific expression

(Peen et al.. 1990). It is not known how this hypersensitive site interacts. if at dl . with

the proteins Functioning at this distal enhancer region.

The absence of the three intronic HS sites in the IM-9-P6 ce11 line could imply

that these sites represent stimulatory elements in IM-9-P33 cells. Conseyuently. one

could conclude that unlike human endometrial stroma1 cells. lymphoblast-specific

expression of the hPRL gene is regulated by ci-y-active elements in intron -4-1. The

presence of DNase 1 hypersensitive sites ofien is an indicator of chromaiin rearrangement

due to transcription factor binding. Finer chromatin studies such as in vivo footprinting

will need to be completed in order to definitively determine the involvement. if any. of

chrornatin structure. in the PRL gene. The fact that these sites are absent in the IM-9-P6

cell line suggests that the chromatin in this region of the PRL gene is not comple~ed with

non-nucleosomal proteins and therefore the gene is inactive. Functional analysis of these

putative intronic transcriptional regdatory elements is essential to ven@ their

contribution to tissue-specific PRL gene expression. Transient transfection analysis with

reporter constructs containing the DNase 1 hypersensitive sites of intron A-! is one

approach.

CHAPTER 5

TRANSIENT TRANSFECTION ANALYSIS

5.1 INTRODUCTION

Transient transfection analysis is a conventional method for localizing

transcriptional regulatory regions. Ideally. these studies should be performed in

conjunction with analysis of the endogenous gene (i.e. DNase I hypersensitivity) because

the reporter constnicts used in transfection assays remain episomal in the cell and a native

chromatin structure is not attained. As mentioned earlier. transient transfection

rxpenments using 3000 bp of decidual/lymphoid PRL 5' Banking DNA and deletions

therein. in both lyrnphoblast ce11 lines and p r i r n q human endornetrial ce11 lines gave

quite different results. While a minimal promoter of 330 bp was sufficient to activate

reporter gene expression in both ceil types. the transcriptional activity correlated with

endogenous PRL gene expression in endometnal stromal cells (undifierentiated versus

differentiated) only. Transient transfection analysis showed no difference in reporter

uene activity between the non PRL-secreting IM-9-P6 cells and the PU-secreting IM-9- e

P33 cells. It was therefore hypothesized that these differences in reporter gene

expression could be due to cell-specific regulation of the PRL gene between the

lymphoblasts and stromal cells. In addition. lymphoblast-specific regulatory elements

rnay be present in more distal upstream regions of the hPRL gene therefore beyond 3000

bp of deciduaVlymphoid PEU 5' Hanking DNA. Therefore. transient transfection

analysis with constructs containing more than 3000 bp of 5' flanking DNA rnay reveal

regions responsible for and unique to human lymphoblast PRL gene expression.

Moreover. analysis of the three DNase 1 HS sites located in intron A-1 discussed in the

previous chapter rnay lend insight into the ceil-specific differences in hPRL genc

expression. Such experiments w-ould allow us to compare and contrat PRL gene

expression in lymphoblast cells and decidual cells. In this chapter the results of transient

transfection experiments testing the functionality of various regions of the PRL gene in

different ce11 types are presented.

5.2

5.2.1

variety

>'lATERIALS AND METHODS

PRL Promoter Deletion Constructs

To test for the presence of hPRL gene regulatory elements that may fùnction in a

of ce11 lines. various fragments from the 5' flanking region were ligated into the

promoterless pGLZ-Basic vector containing the firefly luciferase reporter gene. This was

important to facilitate the identification of putative transcnptional regulatory elernents

when compared to the luciferase activity generated by the promoterless pGL2-Basic

vector. To generate a reporter containing greater than 5000 bp of decidualllymphoid PRL

Y flanking DNA a B~imHIISacl 5323 bp fragment was transferred from pGL3-Basic to

pGL2-Basic reporter vector. This fragment contains 63 bp of the untranslated exon la at

its 3- end. The generation of dPRL 3000/luc and other 5' nested deletions of the

decidual/lymphoid PRL promoter region are descnbed elsewhere (Gellersen et OZ.. 1994)

and are identical to the above construct at the 3' end. Figure 5.1 is a graphical

representation of the hPRL promoter deletion constructs and intronic chimsric constructs.

aligned with the hPRL gene. To generate the constructs containing the three

hypersensitive sites located in intron A-1. a 7.1 kb fragment was isolated from hPRL

5700 with !VsiI. The genomic fragment. hPRL 8700 was subcloned into pGEM and

contains the entire Y flanking DNA of the dPRL promoter. and exon 1 a. intron A- l with

the pituitary PRL promoter. and exon 1 to position +l5 relative to the pituitary

transcription start site (Gellersen et al.. 1994). The 2.4 kb NsiI fragment was blunt-ended

using T4 DNA polymerase and ligated into pBKS II vector. This was done in order to

obtain suitable restriction enzyme sites to ligate the 2.4 kb fiagrnent into a vector

containing -36 bp of rat PRL minimal prornoter linked to the firefly luciferase gene.

Figure 5.1 details the constructs in both the antisense and sense orientations. pGL2/-36

rPRL has been used extensively as a neutral promoter and was used in this context to

ascertain the activity of the intron A-1 hypersensitive sites (in the 2.4 kb :Vsi 1 fragment)

when transfected into the IM-9-P33 and IM-9-P6 cells. Figure 5.2 shows the sequence of

-36 rat minimal promoter linked upstream of the pGL2-basic vector. In addition. the

pituitary PRL promoter constnict containing approximately 3400 bp of DNA upstrearn of

the pituitary start site (pitPRL3400) was constmcted previously and served as a negative

control in these expenments (Gellersen et al.. 1994).

5.2.2 Transient Transfection Assay

IM-9-PX and IM-9-P6 suspension cells were maintained under optimal

conditions in RPMI- 1640 medium. These cells were transfected using liposome reagent

DMRIE-C (1.2-dimyristyioxypropyl-3-dimethyl-hydrox ethyl ammonium bromide.

Gibco. MD). In 6-well plates 0.5 ml Opti-MEM media devoid of antibiotics and FBS

containing 8 pl DMRIE-C was added. along with molar equivalent quantities of reporter

construct DNAs (smnllest construct being 2 pg) in another 0.5 ml Opti-MEM medium.

Al1 DNAs used were p u d k d using the CsCl method as outlined in Section 3.2.3. Lipid-

DNA complexes were allowed to form in the wells for 45 minutes at room temperature.

Following incubation. 2 x l oh cells were added and placed in 37°C incubator for a total of

5 hours where upon 2 ml of growth medium containing 15% FBS was added. Cells were

assayed for luciferase activity using the Promega Luciferase kit as per supplier's

instructions 24 hours following transfection. To determine transfection eficiency. a

construct containing the Lac2 gene cloned into the Bgfll site of the pCMV-1 was co-

transfected into the cells. The ONPG colourmetric assay for beta-galactosidase activity

(Current Protocols) was used on each transfected cell lysate and the arnount of enzyme

present determined using a standard curve generated with purifisd beta-galactosidase

(Boehringer-Mannheim. Que). Luciferase light units were corrected for transfection

efficiency and plotted as normalized light units.

Both HeLa and B 10T1 ce11 lines were transfected using the LIPOFECTAMINE

(Gibco. MD) reagent. Cells were plated at 250 000 cells (HeLa. in 6-well plates) or 500

000 cells (BLOTI. in 60 mm plates) one day pnor to transfection under optimal

conditions. The following day in 1.5-ml stenle centrifuge tubes. 5-10 pl of

LIPOFECTAMINE \vas added to 100-300 pl of Opti-MEM media (devoid of FBS and

antibiotics). In another set of tubes. 1.2-1.4 pg of CsCl punfied DNA in molar equivalent

values was added to 100-300 pg Opti-MEM media. In addition. CO-transfection of

pCMV-Lac2 was done to correct for tmnsfectional efficiency. The contents of these two

1466bp dPf3L 6 + ilenklng DNA

-2061 Nd I

pGL2-hPRL-AS 2180bp hPRL Inbon A - l Nd I frag.

3430bp hPAL ptuitary promoter 1 55bp hPRL

exon 1

Figure 5.2 Sequence of the rat PRL -36 minimal promoter in pGL2-Basic

Sequence showing the rat -36 minimal promoter with important

restriction sites shown. In addition. pGL2-Basic multiple cloning

sequence is shown. The luciferase translational start site is shown

at position 154.

R a t PRL -36 minimal ~romoter in n ~ ~ 2 - ~ a s i c

Mn1 1 S c r F 1 N c i 1 pGL2-basic MCS &P 1 Hpa II Dsa V B s t K 1 s%LL B c n 1 HgiA 1 Sau3A 1

Xma 1 E c 1 1 3 6 1 Mbo 1 Sma 1 B s p 1 2 8 6 1 Dpn II S c r F 1 B a n II Taq 1 Xho 1 N c i 1 N l a IV Xho 1 PaeR7 1 Dsa V PaeR7 I A v a 1 B s t K 1 Rsa 1 Nhe 1 B s t Y 1 - 3 6 r i t PRL minimal BsaJ 1 Csp6 1 B s t U I A v a I - 1 1 promotor Bcn I Ban 1 Alu 1 Mlu 1 Eùna 1 Bgl II M n l 1 S f e 1 A v a 1 Asp718 A f l III Alu 1 Dpn 1 Taq 1 Pst 1

I I 1 I I I I I I I I I I l I I I I I 1 I cccgggaggtaccgagctct tacgcgtgctagctcgAGATCTtctcgaggcgaaggt tcaatgcgcaga 80 gggccctccatggctcgagaatgcgcacgatcgagcTCTAGAagagctccgcttccaaa~atttcagttacagacgtcta

I I I I I * I I 1 1 1 l b 1 1 1 I I I I I I l I 1 8 22 3 1 38 4 5 7 3 1 8 1 5 22 29 37 4 7 73 1 9 23 33 4 0 1 9 28 37

Rsa 1 B s m I C s p 6 I

Alu 1 Msp 1 Luciferasa Dde 1 aind III Hpa II translation start

I I I I I I fi gagaaagCAGn;GTTCTCTTAGGACTTCT?Y;GGGAAGTG~TCAAGCTTGGCATTCCGGTACTG~TAAAbTG 1 5 6 c t c t t t CGTCACCAAGAG~~ATCC?~;AAGAACCC~CA~CC,~G~CGAACCGTAAGGCCATGACAACCA~AC

I I I * I I I 98 1 2 5 1 3 7

126 1 3 7 132 1 4 0

1 4 0

sets of tubes were mixed and allowed to f o m DNA-lipid complexes for 45 minutes at

room temperature. During this time the cells were rinsed with 2 mls of Opti-MEM

medium. Medium at 0.8-2.4 mls was added to these complexes and gently placed on the

rinsed cells. Cells were incubated for a period of 5 hours afier which 2 mls of 20%

FBS/Opti-MEM was added. The following day the cells were rinsed and fiesh. complete

medium was added. Twenty-four hours later. the cells were assayed using Promega

Luciferase kit. Corrected luciferase units were determined as above.

5.3 RESULTS

5.3.1 Transfection of IM-9-P33 and IM-9-P6 Cells

For Functional analysis five hPRL gene fragments containing different reeions

decidual/lymphoid PRL 5' flanking DNA. intron .4-1 and 3400 bp of pituitary PRL

tlanking DNA were transiently transfected into the IM-9-P33 and IM-9-P6 ce11 lines.

The experiments were perfomed in triplicate and were conducted in order to identie

possible cis-acting elements conferring transcriptional regulation of the PRL promoter in

Iyrnphoblast cells. Initially a series of five decidual!lymphoid PRL reporter genes were

constructed in the newest generation of luciferase reporter gene. pGL3-Basic. These

constructs contained 5259 bp. 4700 bp. 3900 bp. 2239 bp. and 652 bp of

decidual/Iymphoid 5' tlanking DNA. Initial transient transfection experiments with these

constructs showed high background luci ferase activity . Therefore an older luci fense

reporter construct. pGLZ-Basic. with a lower background activity was used for al1

subsequent experirnents. Luci ferase activities of these constructs were determined as

described in Materials and Methods. As can be seen in Figure 5.3. transient tnnsfection

of dPRL jOOO/luc showed an approximately 14-f'old induction in both IM-9-P33 and IM-

9-P6 ce11 lines when cornpared with the promoterless pGL2-Basic plasmid. Comparable

activity was seen in both ce11 lines when the construct was deleted down to 330 bp of the

dPRL promoter. Lucifense activities from the deletion constnicts varied from 5-fold to

12- fold over pGLZ-Basic. No differences were seen between the two iymphoblast ceil

lines with regard to the transcriptional activity of the PRL promoter deletion constructs

suggesting the regulation of the PRL gene is not contained in the first 5000 bp of 5'

tlanking DNA.

5.3.2 Transfection of Treated and Non-Treated BlOTI Cells

Even though B 1 OTl cells do not appear to undergo a robust decidualization

reaction. they were found to produce a small amount of PRL mRNA %om the upstrearn

decidual/lymphoid mRNA start site. B 1 OTl were originally established from pnmary

endometrial stroma1 cells. a natural source of PRL. therefore. these cells were transfected

with the sarne constructs described above. Experirnents were done in triplicate at both

the restrictive and permissive growth temperatures to be compared with results obtained

in the lymphoblast cells and therein potentially identiQ cell-specific differences.

Treatment of these cells consisted of 0.5 M 8-Br-CAMP and 1 x 1 o4 M MPA for 5 days

as descnbed in Materials and Methods. Interestingly enough. comparable luciferase

reporter activities were obtained under al1 three culture conditions (33°C non-treated and

treated. Figure 5.4 and treated BlOTl at 39°C. Figure 5.5) and these results were similar

to those obtained with the 1 ymphoblasts cells. There was approximately 6-fold to 1 5-fold

increase in activity relative to pGL2-Basic with al1 constmcts. Taken together. these

results imply that the BlOTl ce11 line does not contain the transcriptional regulatory

factors which confer decidual-specific PRL gene expression.

5.3.3 Transfection of HeLa Cells

Human PRL promoter/luciferase constructs were also tested in a heterologous ce11

line. HeLa, which was originally derived fiom tissue (cervical carcinoma) which does not

normally possess the potential to express the PRL gene. Again in these cells. as seen

above. luciferase activities vaned between Cfold and 1 5-fold activity over pGLZ-Basic

(Figure 5.5). This implied that this region of the hPRL gene contains possible regulatory

sites for ubiquitous transcription factors.

Figure 5.4 Transient transfcction of dPHL promoter deletion constructs

into non-hormone trratcd and trelited BIOT1 eells at 3 3 O ~ .

13 10'f 1 cells were ciiltured uiider optiiiiül coiiditioiis. 1-ioririoiic-

treated B10'1'1 cetls werc cultiired witli 0.5 iiiM 8-Br-CAMP aiid 1

x IO-'' M MPA. Cells were traiisieiitly transl'txted witli iiiolür

equivüleiit values ofdeletioii coiistructs cisiiig LipolèctAMINE üiid

wsayed for 1 uci ferase activi ty. Ce1 ls were CO-trünsfected witli

pCMV-LacZ to coiiirol l'or trriiisfection efficieiicy. Euch coiistr~ict

was traiisfected i i i triplicate üiid eücli bar represeiiis a separate

rxpcriiiieiit ( 1 - Iiatclied bars, 2- blacck bar, 3- clear bar).

Lucikrasc activity was iiorinalized to beta-galüctosiduse uiiits.

Eacli bar represeiiis a separate experiiiitriit i i i wliich tlirec plates of'

cclls were traiisl'ected with eacli coiistruct. pG1.2-330, 9 16, 149 1,

3000 aiid 5000 rrpieseiit dPKL proiiioter deletioii coiistructs.

Figure 5.5 Trarisicnt transfection of dPHL promoter dclction constriicts

iiito bornionc treated BIOT1 cclls at 39°C and HcLu cclls.

13 10'1'1 cells were cultured witli 0.5 mM 8-Br-CAMI' niid I x IO-"

M MIIA. 1-le1.a cclls \wre culiiircd uiidcr opiiinal coiiditioiis. Cells

were transieiitly traiisfected witli molar eqiiivaleiit values 01'

deletioii coiistructs usiiig 1.ipofectAMINE niid assuycd Ior

luci feruse activity. C'ells were CO-transfected wit li pCMV-LacZ to

control Ibr trüiisfectioii dlicieiicy. Each constriict \vas truiislèçted

i i i triplicntc and eacli bar reprcsents a sepamte experinient ( I -

Iiatclied baios, 2- black bai., 3- clear bar). 1,ucifkriise activity \vas

noriiiulized to bria-yül iiiiits. Each bar rcprcseiits a separate

expcriiiiriit in wliicli tlirce plates of cells were translècted witli

eacli coiistruct. p(i 1.2-330, O 16, 149 1 , 3000 aiid 5000 rcprcseiit

d lW. proiiiotcr dcletioii coiistructs.

5.3.4 Transfection of Intron A-1 Sequences of hPRL Gene

In order to assess whether the differences in chromatin structure seen in intron A-

l correlate with the activity of the sites in a transient expression assay. a Fragment

encompassing these sites \vas cloned into pGL2-Basic already containing a neutral

promoter of -36 bp rat PEU. In addition. 3400 bp of pituitary hPRL promoter was also

transfected into these cells because it contains the three DNase 1 hypersensitive regions

specific to the IM-9-P33 cells but in the context of the pituitary PRL transcription start

site. A s seen in Figures 5.6. comparable activity (Le 9-fold induction over pGL?-Basic)

\vas seen when the 2.4 kb region of intron A-l was placed in the sense orientation

upstrearn of the neutral promoter (pGLI-S). In addition. pitPRL-3400 was seen to have

a 3-5- fold induction over pGLZ-Basic. Similar activity of pitPRL-3400 has been

reported previously (Gellersen et al.. 1994). When placed in the anti-sense orientation.

also upstrearn of the neutral promoter. both ce11 lines exhibited a dramatic increase in

activity. approximately 40-55-fold over pGL2-Basic. However. relative activities of the

neutral promoter -36 rPRL were shown to be 2-7- fold over pGL2-Basic. It can not be

concluded whether the 2.4 kb .VsiI fragments containing the three hypenensitive sites are

the contributing factor to this induction or the -36 rPRL neutral promoter is active in

these cells. Based upon the activity of the endogenous PRL gene and the lack of the

intron A-1 hypersensitive sites in the negative PRL-secreting IM-9-P6 ce11 line. these

results suggest that the in vivo hPRL gene chromatin structure may disallow the binding

of positive tram-acting factors to the hPRL gene in the IM-9-P6 ce11 line.

Furthemore. transfection of pGLZ-S and pGL2-AS. containing the three DNase 1

HS sites in BIOT1 cells under the sarne conditions as described in Section 5 - 3 2 ,

produced reporter gene activity similar to that observed with the human lymphoblast ce11

lines. A 4-6-fold induction of pGLZ-S was obtained under al1 culture conditions whereas.

an increase to 25-28-fold activity using pGL2-AS were seen (Figure 5.7. non-treated and

treated BlOTl cells at 33°C. Figure 5.7. treated BlOTl cells at 39OC ). In addition.

transfection of pitPRL-3400 resulted in a 10-fold increase over pGL2-Basic (Figure 5.7.

and Figure 5.8). These results suggest a possible ubiquitous role for these HS sites that

hnction regardless of the activity of the endogenous PRL gene.

As seen with the above ce11 lines. when pGL2-S was transfected into HeLa cells.

activity rernained at approximately 5-fold over baseline. However. when placed in the

antisense orientation (pGLL4S). a significant nse in activity was seen as previously

reported for al1 other ce11 lines tested (Figure 5.8. a 40-fold induction). In addition.

pitPRL-3400 and -36 rPRL neutral promoter resulted in comparable activities:

approximately 3-6-fold increases.

Figure 5.6 Transient transfection of lntronic A-1 Chimeriç Reporter

constructs into IM-9-P33 and IM-9-Y6 cçlls

IM-9-1'33 aiid IM-9-1'6 cells were cultund uiider optiiiial

coiidit ions. Cells were traiisielit ly transfected \vit li iiiolür

eyuivaleiit values of deletioii coiistructs usiiig DMRIEC üiid

assayed for luciferase activity. Cells were co-transbcted witti

pCM V-l .acZ to coiitrol for traiiskctioii efficirncy . Asssys werc

perforined i i i triplicate ( 1 - Iiatchrd bars, 2- black bar, 3- clear bar).

1.ucilkrüse activity was iioriiialized to beta-galalactosidasc uiiils.

Eacli bar reprrsents a separate experinieiit in wliich 11irre plates 01'

cclls were trarisfected wi th eacli coiistruct, pGL2-S aiid pGL2-AS

represeiit seiise aiid aiitisanse orientations respective1 y of' t lie 2.4

kh Nsi I Iiagiiieiii contaiiiiiig tlie tliree DNasa I liyperseiisitive

sitcs located i i i iiitroii A-1 . pG1.2-pi13400 represeiits the coiistriict

coiitaiiiiiig the tliree liyperseiisitive sites i i i the coiitest of the

pituitiiry proirioier.

Figure 5.8 Transient transfcctian of Intronic A-1 Chimeric Reporter

constructs into hornionc trcated BlOTl cells ut 3YC and HcLa

cclls.

i3 10'1'1 cells wrre cultiired witli 0.5 inM 8-Br-CAMP and 1 x 10" M MPA. tlcl,a cells were ciilturcci under optiinal coiiditiutis. C'ells

werc traiisieiitly trüiislècted witli iiiolar rquivalent values ol'

delctioii coiistructs iising LipofectAMINE aiid üssayed for

Iiicil'crase activity. C'ells \wre CO-iraiislèctrd witli pCMV-Lac% to

coiitrol Soi traiisfeçtioii efficieiicy. Assays werc prrforined i i i

triplicûtc ( 1 - Iiatclied bars, 2- black bar, 3- çlear bar) aiid lucilèrase

aciiviiy w a s norinslized to beta-gal uiiits. Eacli bw rctpreseiits u

sepiirate experimeiit i n \vliich tlircc plates of cells werr traiislécted

witli eacli coiistriict, pGL2-S uiid pGL2-AS rcprcsenc sense and

antiseiise orieiitatioiis respectively of the 2.4 k b Nsi I liagiiieiit

coiitaiiiiiig the tliree DNase 1 Iiyperseiisitive sites loçntcd iii iiitroti

A-1. pG1.2-pi13400 rcpreseiits the ço~istruct coniaiiiirig ilic tlirec

Iiyperseiisitive sites i i i the coiitext.

5.3 DISCUSSION

Transient tmsfection analysis allows for identification of possible regulatory

elements controlling gene expression. The results presented here suggest a complex

replation of PRL gene expression. As seen previously (Gellersen et al.. 1994).

transfection of dPRL3000 and deletion constructs therein into a variety of ce11 lines did

not result in detection of cell-specific transcriptional activity and could thcrefore be

defined as ubiquitous basal transcriptional activity. However. it was reported that

transfection of dPRL-3000-fragment into the IM-9-P farnily of clonal ce11 lines resulted

in a 10- to i 5- fold increase in luciferase activity relative to pGL2-Basic whilst constmcts

carrving - + 5' Flanking - DNA between -2700 and -330 did not show any considerable

differences in activity (Gellersen et 01.. 1994). Approximately 330 bp immediately

upstream of the decidual/lymphoid start site was shown to be sufficient for PRL gene

expression. This suggested that the region between -3000 and -2700 acted as a putative

enhancer in these ce11 lines (Gellersen et al.. 1994). Similar activity was seen in this

study: in addition. transfections of constructs containing 5000 bp of 5' flanking DNA

produced comparable results (Le. 14-fold increase in luciferase activity). The regions

between -5259 bp and -3000 bp and between -3000 bp and -2700 bp appeared to

generally enhance dPRL promoter activity in the lymphoid ce11 lines IM-9-P33 and IM-9-

P6. However. no significant changes in reporter construct activity were seen over

deletions of the 5000 bp of decidual/lymphoid PRL 5' flanking DNA suggesting that

DNA regulatory elements lie upstream of 5000 bp of 5' flanking DNA or 3' of rson la.

Furthemore. luciferase activity of PRL promoter delstion constnicts was independent of

the activity of the endogenous PRL gene in these cells. This implies that the similar

luciferase activities from the transiently transfected templates in the two ce11 lines

regardless of the activity of the endogenous PRL gene may rest in differences in

chromatin structure. It is possible that the arrangement of nucleosomal proteins in the

IM-9-P6 ceIl line function in preventing activation of the PRL gene from the upstream

transcriptional start site.

It is important to note that in the non-hormone-treated and hormone-treated

BlOTl ceIl line at 33°C and 39OC similar luciferase reporter gene activities were

obtained. These results are opposite to those obtained using pnmary endometrial stroma1

cells. When dPRL3000-fiagment was transfected into non-PRL-secreting endometrial

stromal cells. no expression of this PRL promoter construct or deletion constructs therein

was detected. However. in the presence of MPA and relauin. the primary endometrial

stromal cells conferred strong activation of the transiently transfected templates in

addition to endogenous PRL production (Gellersen et al.. 1 994). These results implied

that there are cis-acting regulatory elements controlling differentiation-specific

expression of this promoter. In normal differentiating endometrial stroma1 cells. PRL

production is detected within tluee days afier serum levels of progesterone are reached.

As these results were not duplicated usine the immortalized endornetrial stromal ce11 line

BIOTI. these cells do not represent a useful mode1 with which to study decidualization

and cell-specific PRL gene expression. The results presented here suggest that B lOTl

cells do not contain necessary cell-specific transcription factors for decidual PRL

production. HeLa cells do not secrete PRL: however. when dPRL 5000 and deletion

constnicts within the 5' flanking region of the decidual/lymphoid PRL promoter region

were transiently transfected into this ce11 Iine. induced reporter gene activities were

obtained. This is concordant with the notion that decidual/lyrnphoid PRL 5000 5'

flanking region contains DNA reguiatory elements conferring ubiquitous transcriptional

activation in non-PEU secreting ce11 lines.

The three hypersensitive sites Iocated in intron A- 1 identified in the IM-9-PM cell

line were cloned in both orientations into pGL2-Basic in front of -36 bp of the rat PRL

promoter in order to test the activity of these sites. The activity of pGL2-Basic

containing -36 minimal rat PRL promoter was observed to be approximately 3-5-fold

over the promoterless pGL7-Basic. When the fmgment encompassing the three HS sites

kas placed in the sense orientation. the activity increased 4-6-fold over pGL2-Basic in

IM-9-P33 and IM-9-P6. non-treated and hormone-treated BlOTl and HeLa cells.

However. when the Fragment was placed in the antisense orientation. fold increases of

60-80 were obtained in al1 above listed ce11 lines. In cornparing luciferase activities of

the antisense construct over those obtained fcr pGL2/-36 rPRL vector. 2-4 fold increases

were seen with pGL2-S while fold increases fiom 6-8 were seen with pGL2-AS. It can

not be discounted that the pGLZ/-36 rPRL vector is contributing to the luciferase activity

seen with these 2.4 kb fragments containing the DNase 1 hypersensitive sites in the

antisense orientation. Experiments using different neutral promoters may be required to

ascertain the contribution that the rat minimal promoter is making. In addition. the

subcloning of the 1.4 kb NsiI fiagment in front of the -36 rPRL minimal promoter may

have introduced aiternative transcriptional start si tes thereby producing more than one

luciferase mRNAs and contributing to the overall luciferase activity

However. taken together. region(s) in the 1.4 kb iVsiI fragment appear to be acting

as putative enhancer(s) in the variety of ce11 lines tested. There may be multiple

enhancers in this region contributing to the increased activity. Regulatory elements are

known to function in either orientation; the high activity seen here with the antisense

constnict is unusual but not unprecedented. For example. HS sites located at + 1 -2. + 1 -5

and +1.9 kb downstrearn of the c-sis promoter encoding the B chain of the platelet

denved growth factor were found to have inhibitory activity in HeLa. and JEG-3 (a

choriocarcinoma-derived cell line) ce11 lines. However. inhibition was only seen when

the constnict was placed in the antisense orientation (Dirks et al.. 1993). The activity of

the 2.4 kb Msi 1 intron A-l fragment in non-PRL-producing ce11 lines may be due to the

presence of a binding site on non-nucleosomal DNA for ubiquitous transcription factors.

Expression of the endogenous PRL gene may require the presence of cell-specific

transcription factors. in combination with ubiquitous factors for expression. B 1 OT 1 and

HeLa cells may not contain the cell-specific transcription factors nccessary for

endogenous PRL gene expression. Furthemore. the location of the three hypersensitive

sites in the sense orientation may not have been conducive to its activation. The position

of these sites 3' of the transcriptional start site in the endogenous gene may be important

for activation. Which site (or combination of sites) is confemng this activation in the

studies described here remains to be determined. The positioning of the 2.4 kb fragment

in the vector could also influence the results seen here. It is not known what region of

this 2.4 kb Fragment is contnbuting to the enhanced activity. the region could be quite

small relative to 2.4 kb. Further studies need to be completed using deletions of this

fragment to determine the minimal regions contnbuting to the activity. Conversely. the

presence of these hypersensitive sites in the PRL-secreting IM-9-P33 ce11 line and their

absence in the negative-secreting IM-9-P6 ce11 line may speak to the influence of

chromatin structure. It is possible that the nucleosomal proteins in the IM-9-P6 ce11 line

in the intronic region are not conducive to utilization of the putative regulatory elements

located there. which is not a îàctor on the transiently transfected template.

CHAPTER 6

SUMMARY AND FUTURE DIRECTTONS

In order to study the transcriptional regulation of the human decidual PRL gene.

an in vitro ce11 culture system is essential for transient transfection assays and as a source

of nuclear extracts for the biochemicd analysis of transcriptional regulatory proteins. In

addition to the lymphoblast ceIl lines IM-9-PX and IM-9-P6 (positive and negative PRL

secreting ce11 lines respectively) we have tested the only available endometnal stromal

ce11 lines. M4. and BlOT1. for their ability to decidualize and produce PRL. Using

known inducers of PRL production. MPA and CAMP. PRL secretion was not detectable

as rneasured using the hPRL-specific immunoradiometric assay. By RT-PCR the B 1 OTl

ce11 line was fomd to contain PRL mRNA but the level of expression appears to be too

low to be considered a decidualization mode1 system for credible functional studies by

transient transfection assay. The lack of PRL expression in the M4 and BlOTl human

endometrial stromal ce11 lines c m be due to a variety of factors including the process of

neoplastic transformation which commonly causes a loss of differentiated ceII function.

This in tum is dificult to regain even in the presence of a temperature sensitive

transforming agent such as T-antigen. Cells that have been immortalized often become

aneuploid and could therefore lose regulatory factors responsible for dPRL production.

However. as progesterone is known to increase PRL secretion. stable ce11 lines of BIOT1

containing PR have been created in hopes of bolstenng the reaction seen here.

Due to the fact that the BlOTl cells did produce a low level of PRL under

differentiating conditions. characterized these cells in tenns of their steroid hormone

receptor content as well as hPRL promoter utilization. Using northem analysis. receptors

for progesterone. androgen. and estrogen receptors were not detectable. Glucocorticoid

receptor mRNA was found in both the treated and non-treated M4 and B lOTl ce11 lines.

Usine CT the more sensitive method of RT-PCR. progesterone receptor mRNA was

demonstrated in both M4 and E3 lOT1 cells under hormone treated and non-treated

conditions. It is not known whether or not the glucocorticoid or progesterone receptors

are fully functional in these cells. Further characterization in terms of other possible

genes induced during decidualization under the influence of progesterone could also be t

performed.

Despite the lack of a human endometrial stromai ce11 line capable of robust

decidualization. study of the transcriptional regulation of non-pituitary PRL could be

undertaken using the hurnan lymphoblastoid ce11 lines IM-9-P33 and IM-9-P6. To

facilitate these studies a new hPRL genornic clone was isolated containing -16 kb of 5'

flanking DNA. Extensive characterization of this genomic clone was performed to

design an expenmental strategy for DNase 1 hypersensitivity analysis of -22 kb of the

hPRL gene locus and to generate DNA fragments for transient transfection experirnents.

These two expenmental approaches are cornplimentary in that DNase 1 hypersensitivity

examines the endogenous gene whilst the transient transfection assay focuses on the

transcriptional activity of specific gene fragments.

DNase 1 hy persensitivity experiments were performed in I M-9-P3 3 and IM-9-P6

hurnan lyrnphoblast ce11 lines. Hypersensitive sites were not detected in PRL-producing

or non-producing cells within -22 kb upstrearn of exon 1 a. Surprisingly. the intron

separating the two tissue-specific PRL promoters was found to contain threr

hypenensitive sites unique to the IM-9-P33 ce11 line. These sites presumably represent

reçions containing DNA elernents to which potential regulatory proteins are bound

thereby replacing nucleosomes and allowing DNase 1 digestion. The îàct that they were

found in the positive PRL secreting ce11 line and not the negative. suggested a possible

enhancer role for this region. Conversely. the location of these sites in the distal repion of

the pituitary-specific promoter could possibly fùnction in an inhibito. capacity. These

sites were therefore cloned into a luciferase fusion vector and transfected into the human

Iyrnphoblast ce11 lines as well as hormone treated and non-treated B lOTl ceIIs and the

HeLa ce11 line to determine functionality of this region. In addition. 5000 bp of dPRL 5'

flanking DNA and deletions therein were cloned into luciferase vectors to be used in

transient transfection assay S.

Transient transfection of the dPRL promoter deletion constructs resulted in

luciferase activity significantly greater than the promoterless control vector. However.

no signifiant changes in reporter gene activity were detected either with progressive

deletions of the 5' flanking DNA (5259 bp to 330 bp) or between different human ce11

lines with differential PRL expression. This implies that within - 5.0 kb of

deciduaVlymphoid PRL transcription start site there are DNA elements for ubiquitous

transcription factors and therefore the activity observed in these experiments could be

considered basal. Moreover. there was no correlation between the transcriptional activity

of these constructs and expression of the endogenous PRL gene in the IM-9-P series of

clonal lines. This suggests that the cis-active regdatory elements responsible for PRL

gene activation in the [M-9-P33 are Iocated beyond 5 kb of 5' DNA or 3' of exon la. In C

the case of hormone-treated and non-treated cultures of the B l OTl ce11 line, the basal

transcnptional activity of the transiently transfected constructs appears to confirm that

this ce11 line is not a usehi in vitro mode1 of decidualization. In addition. the ce11 Iine

appears to be Iacking decidual-specific transcription factors necessary for PRL expression

for the possible reasons outlined above.

In contrast to the deciduaVlymphoid PRL 5' flanking DNA constructs. transient

transfection with chimenc reporter genes carrying a 2.4 kb region of hPRL intron A-1

produced significantly greater reporter gene activity than the constructs carrying 5' DNA

regions. This region of DNA contains the three DNase I hypersensitive sites unique to

the PRL-producing IM-9-P33 ce11 line. It is unclear what segment of DNA is

contnbuting to the enhanced activity. One would have expected this region or portions of

this region of DNA to exhibit mscriptional activity in a cell-specific manner Le.. in the

IM-9-P33 line only. However. significantly greater than basal reporter gene activity was

observed in a11 ce11 lines tested. It may be that once removed tiom a chromosomal

context this region of DNA loses its cell-specific property of gene control and becomrs

tùlly functional in a transiently transfected template. This necessarily irnplies that the

transcription factors which bind to parts of this region of DNA are present in al1 of the

ce11 lines tested and that unique chromatin conformation of the hPRL gene in the IM-9-

P X ce11 line allows these factors to bind and activate PRL gene expression.

Consequently. one might conclude that epigenetic mechanisms may be the ovemding

process by which the PRL gene is active in human lymphoblast cells. a mechanism which

appears quite distinct from that operating in the human decidual cell. It is puvling to

note that the -60-fold increase in transcriptional activity above the promoterless control

construct was observed only with the intronic fragment in the antisense orientation. In

the 5.4. orientation. this fngment exhibit transcriptional activity of no greater than any

of the other 5' deletion constructs of the hPRL gene. This could indicate a technical

anomaly where a cryptic transcription start may have been introduced such that two

luciferase mRNAs are produced frorn the same transient template. which could increase

the overall production of luciferase. Primer extension experiments could clari- this

possibility. Technically. a transcnptional enhancer should operate in a distance and

orientation independent fashion. The 2.4 kb intron A-1 fragment does not completely

adhere to these criteria in the sense that the level of transcnptional activity generated by

this fragment should have been similar in both orientations relative to the -36 rPRL

neutral promoter. While this is difficult to explain. it may speak ro the influence of

chromatin structure. Further studies with this region of intron A-1 would involve

transient transfection of subfragments upstream of different neutral promoters as well as

3-. and the generation of stable ce11 transfectants carrying various regions of intron A-l

fused to a reporter gene to test the effect of chromatin stmcture. Ultimately. fine

mapping studies must be carried out to precisely delineate the location of each of the

three hypersensitive sites in intron A- 1 to facilitate biochemical analysis of the cognate

DNA binding proteins. The position of the 2.4 kb fragment in the vector could also be a

contributing factor to the enhanced activity. Because we do not know what region(s) of

the construct is active. it is difficult to reason these results. When placed in the sense

orientation. the active region sits close to the transcriptional start site and it is possible

that this positioning does not allow for activation. However. when placed in the antisense

orientation. the distance from the start site jumps significantly. The results seen here

therefore may be a positional and distance effect of the active region in the construct.

These questions need to be addressed through finer mapping studies.

REFERENCES

.4brahamsohn. PA.. and Zorn. T.M.T. (1993). Implantation and decidualization in

rodents. The Journal of Expsrimental Zoology . 226.603-628.

Aubert. M.L.. Gnunbach. M.M.. and Kaplan. S.L. (1 975). The ontogenesis of human

fetd hormones. III . Prolactin. J. Clin Invest. 56. 155-1 65.

Bell. S.C. ( 1983). Decidualization: Regional differentiation and associated function.

Oxford Rev. Reprod. Biol. j. 220-271.

Bonhoff. A.. and Gellersen. B. (1994). Modulation of prolactin secretion in human

myometrium by cytokines. Eur. J Obstet Gynecol. 54. 55-62.

Boyer. B.B.. and Kozak. L.P. ( 1 99 1 ). The mitochondrial uncoupling protein gene in

brown fat: correlation between DNase 1 hypersensitivity and expression in transgenic

mice. Mol CeIl Biol. 11. 3 147-41 56.

Brooks. AR.. Nagy. B.P.. Taylor. S.. Simonet. W.S.. Taylor. J.M.. and Lew-Wilson. B.

( 1994). Sequences containing the second-intron enhancer are essential for transcription

of the human apolipoprotein B gene in the livers of transgenic mice. Mol Ce11 Biol. 14.

2243-2256.

Cartwright. I.L.. and Elgin. S.C.R. ( 1986). Nucleosomal instability and induction of new

upstrearn protein-DNA associations accompany activation of 4 small heat shock protein

genrs in Drosophiia rnelanogaster. Mol Ce11 Biol. 6. 779-791.

Clapp. C.. and Weirner. R.I. (1992). A specific. high affinity. saturable binding site for

the 16-kilodalton fragment of prolactin on capil lary endothelial cells. Endocnnology .

130, 1380-1386.

Clevenger. C.V.. Sillman. A.L.. Hanley-Hyde. J.. and Prystowsky. M.B. ( 1 991).

Requirement for prolactin during ce11 cycle regulated gene expression in cloned T-

lymphocytes. Endocnnology 130. 32 1 6-3222.

Cornillie. F.J.. Lauweryns. 1.M.. and Brosens. I.A. (1985). Normal hurnan endometrium.

Gyn. Obst. Invest. 70. 1 13- 129.

Cullen. K.E.. Kladde. M.P.. and Seyfred. M.A. ( 1 993). Interaction between transcription

regulatory regions of prolactin chromatin. Science. 761. 303-206.

Current Protocols in Molecular Biology. ( 1994). Greene Publication Association

Incorporated and John Wiley and Sons Inc.

Day. R.N.. and Maurer. R.A. (1989). The distal enhancer region of the rat prolactin gene

contains elements conferring response to multiple hormones. Mol Endocnnol. 3. 3-9.

Di Camili. P.. Macconi. D.. and Spada. A. (1970). Dopamine inhibits adenylate cyclase

in human pro lactin-secreting pituitary adenornas. Nature. 2 78. 252-254

Dillon. N.. and Grosveld. F. ( 1 994). Chromatin domains as potential units of eukaryotic

eene function. Current Opinions in Gen and Dev. 4. 360-264. C

DiMattia. G.E.. Gellersen. B. Bohnet. H.G.. and Friesen. HG. 1988. A human B-

lymphoblastoid ce11 line produces prolactin. Endocnnology 1 X:XO8.

DiMattia. G.E.. Gellersen. B.. Duckworth. M.L.. and Friesen. H.G. (1990). Human

prolactin Bene expression. J Bi01 Chem. 765, 164 12- 1642 1.

Dirks. R.P.H., Jansen. H.J., Gemtsma. J.. Omekink. C and Bloemers. H.P.J. ( 1993).

Localization and functional analysis of DNase 1 hypersensitive sites in the hurnan c-

sÏsRDGF-B gene transcription unit and its flanking regions. FEBS. 7 I I . 509-5 19.

EmanueIe. N.V.. Metcalfe, L.. Lubrano. T.. Rubinstein. H.. Kirsteins. L.. and Lawrence.

A.M. (1 987). Subcellular distribution of hypothalarnic prolactin-like immunoreactivitp.

Brain Res. 407, 323-329.

Emanuele. N.V.. Jurgens. J.K.. Halloran. M.M.. Tentler. J.J.. Lawrence. A.M.. and

Kelly. M.R. (1992). The rat prolactin gene is expressed in brain tissue:detection of

normal and alternative1 y spliced prolactin messenger RNA. Mol. Endocnnol. 6. 3 542.

FelsenfeId. G.. and McGhee, J.D. (1986). Structure of the 30 nrn fibre. Cell. 44. 375-

Felsenfeld. G. (1992). Chromatin as an essential part of the transcriptional mechanism.

Nature. 355. 2 19-224.

Gagnerault. M-C.. Touraine. P.. Savino. W.. Kelly. P.A.. and Dardenne. M. (1993).

Expression of prolactin receptors in murine lymphoid cells in normal and autoimmune

situations. J Immunoi. 150. 5673-568 1.

Gellersen B. DiMattia G.E.. Friesen. H.G.. and Bohnet HG. (1989). Regulation of

prolactin secretion in the human b-lymphoblastoid cell line IM-9-PX by dexamethasone

but not other regulators of pituitary secretion. Endocrinology . I Z j . 285 3-286 1 .

Gellersen. B.. Bonhoff. '4.. Hunt. N.. and Bohnet. H.G. (1991). Decidual-type prolactin

expression by the hurnan myometrium. Endocrinology. 129. 158- 168.

Gellersen. B.. Kempc R.. Hamuig. S.. Bonhoff. A.. and DiMattia G.E. ( 1993).

Posttranslational regulation of the human prolactin gene in IM-9-PX cells by retinoic

acid. Endocrinology. 13 1. 10 1 7- 1025.

Gellersen. B.. Kempf. R.. Telgrnann. R.. and DiMattiê G.E. ( 1 994). Nonpituitary human

prolactin gene transcription is independent of Pit-1 and differentially controlled in

lymphocytes and in endometrial stroma. Mol. Endo. 8. 356-373.

Gellersen. B.. Kempf. R.. Telgmann. R.. and DiMattia G.E. ( 1 995) Pituitary-type

transcription of the hurnan prolactin gene in the absence of Pit-1 . Mol. Endocrinol. Y.

887-90 1.

Giudice. L.K.. Milkowski. D.A.. Larnson. G.. Rosenfeld. R.G.. and Irwin. K. ( 1 991).

Insulin-like growth factor binding proteins in human endometrium: steroid-dependent

rnessenger ribonucleic acid expression and protein synthesis. Endocrinology. T. 779-

787.

Golander. A.. Barret. :.. Hurley. T.. Barry- S.. and Handcverger. S. (1979). Failure o f

bromocriptine. dopamine. and thyrotropin-releasing hormone to affect prolactin secretion

by hurnan decidual tissue in r9itro. J Clin Endocrinol Metab. 49. 787-789.

Gothard. L.Q.. Hibbard. J-C.. and Seyfied. M.A. (1996). Estrogen-mediated induction of

rat prolactin gene transcription requires the formation of a chromatin loop between the

distal enhancer and proximal promoter regions. Mol. Endo. 10. 1 85- 195.

Gourdji. D.. and Lavemere. J.N. (1994). The rat prolactin gene: a target for tissue-

specific and hormone-dependent transcription factors. Mol. Cell Endocrinol. 100. 1 33-

142.

Green. S.. Walter. P.. Kumar. V.. Kmst. A.. Bomert. J.M.. Argos. P.. and Chambon. P.

( 1986). Human oestrogen receptor cDNA: sequence. expression and homology to v-erb-

A. Nature. 320. 134- 139.

Gross. D.S.. and Garrard, W.T. (1988). Nuclease hypersensitive sites in chrornatin.

Annu Rev Biochem. 57 1 59- 197.

Gubbins. E.J.. Maurer. R.A.. Lagrimini. M.. Erwin. CR.. and Donelson. J.E. (1980).

Structure of the rat prolactin gene. J. Biol. Chem. 255, 8655-8662.

Gurpide. E.. Tabanelli. S.. and Tang. B. (1992). Human endometrial stroma1 cells. In

Hormones in Gynecological Endocnnology. A.R. Genazzani and F. Petraglia Eds. 71 7-

724. Partenon Press. Casterton Hall. Caniforth. Lancs. UK.

Hamosh. iM.. and Hamosh. P. (1977). The effect of prolactin on the lecithin content of

fetal rabbit lung. J Clin Invest. j 9 . 1002-1 005.

Handwerger. S.. Richards. R.G.. and Markoff. E. ( 1 992). The physiology of decidual

prolactin and other decidual protein hormones. Trends Endocrinol Metab. 3. 91 -95.

Hatayama. H.. Kanzaki. H.. Iwai. M.. Kariya. M.. Fujimoto. M.. Higucji. T.. Nakayama.

H.. Mon. T.. and Fujits. J. ( 1994) Progesterone enhances macrophage colony-stimulating

factor production in human endometrial stroma1 cells in vitro. Endocrinology . 135. 1 92 1 -

1927.

Hayes. J.J.. Clark. D.J.. and Wolffe. A.P. (1991 ). Histone contributions to the structure

of DNA in the nucleosome. Proc Nat1 Acad Sci USA. 88, 6829-6833.

Hollenberg. S.M.. Weinberger. C.. Ong. E.S.. Cerelli. G.. Oro. A.. Lebo. R.. Thompson.

E.B.. Rosenfeld. M.G.. and Evans. R.M. (1985). Primary structure and expression of a

functional human glucocorticoid receptor cDNA. Nature. 3 18, 63 5-64 1.

Horseman. N.D.. and Yu-Lee. L.Y. ( 1994). Transcriptional regulation by the helix

bundle peptide hormones: growth hormone. prolactin. and hematopoietic cytokines.

Endocr. Rev. 15. 627-649.

Houwert-Dejong. M.H.. Bruinse. H. W.. and Termijteleh. A. ( 1990) The immunology of

normal pregnancy and recurrent abortion. In Early Pregnancy Failwe. Ed. H.J. Huisjes

and T. Lind. pp 27-3 8. Churchill Livingstone. Edinburgh.

Ingarnells. S.. Campbell. I.G.. Anthony. F.W. and Thomas. E.J. ( 1996) Endometrial

progesterone receptor expression d u h g the human menstrual cycle. J. of Reproduction

and Fertility. 106. 33-38.

Ingraham. H.A.. Chen. R.. Mangalam. H.J.. Elsholtz. H.P.. Flynn. S.E.. Lin. C.R..

Simmons. D.M.. Swanson. L.. and Rosenfeld. M.G. (1988). -4 tissue-specific

transcription factor containing a homeodomain specifies a pituitary phenotype. CeIl. jj.

5 19-529.

Invin. J.C.. Kirk. D.. King. R.J.B.. Quigley. M.M.. and Gawtkin. R.B.L. (1989)

Hormonal regulation of human endometrial stromal cells in culture: and in vitro mode1

for decidualization. Fertility and S terility. 52. 76 1 -768.

Irwin. I.C.. Fuentes. D.. Dsupin. B.A.. and Giudice. L.C. (1993). Insulin-like growth

factor regulation of human endometnal stromal ce11 Function: coordinate effects on

insulin-like growth factor binding protein-1. ce11 proliferation and prolactin secretion.

Regulat Pept. 48. 163- 1 77.

Jackson. S.M.. Keech. C.A.. Williamson. D.J.. and Gutierrez-Hartmann. A. (1992).

Interaction of basal positive and negative transcription elements controls repression of the

proximal rat prolactin promoter in nonpituitary cells. Mol Ce11 Biol. 12. 2708-27 19.

Johannisson. E. ( 1 985). Cyclical changes in endcmetrial morphology . In Clinicai

Reproductive Endocrinology . pp. 1 28- 1 64. Ed. R. P Shearman. Churchill Livingstone.

Edinburgh.

Josirnovich. J.B.. Mensko. K.. and Boccella L. ( 1977). Amniotic prolactin control over

arnniotic and fetal extracellular fluid water and electrolytes in the rhesus monkey.

Endocrinology. /OU, 564-570.

Kamei. Y.. Xu. L.. Heinzel. T.. Torchia. J.. Kurokawa R.. Gloss. B.. Lin. SC.. Heyman.

RA.. Rose. DW.. Glass. CK.. and Rosenfeld. MG. (1996). A CBP integrator complex

mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell. KX

403-414.

Kastner. P.. Krust. A.. Turcotte. B.. Stroppe. U.. Tora. L.. Gronemeyer. H.. and

Chambon. P. (1990). I w o distinct estropen-regulated promoters generate transcripts

encoding the two Functionally different human progesterone receptor foms A and B.

EMBO J. 5. 1603-1624.

Katzenellenbogen. B.S. ( 1980). Dynarnics of steroid hormone receptor. Annual Review

of Physiology. 4-7. 17-35.

Kearns. M.. Lala. P.K. (1983) Life history of decidual cells: a review. Am. J. Reprod

Immun01 Microbiol. 3. 78.

Kelly. P.A.. Djiane. J.. Postel-Vinay. M.C.. and Edery. M. (1991). The prolactidgrowth

hormone receptor family. Endocr Rev. 12. 235-25 1 .

Kim. U-J.. Han. M.. Kayne. P.. and Grunstein. M. (1988). Effects of histone H4 -

depletion on the cell cycle and transcription of Sncchnromyces crrevisine. EMBO J. ,

321 1-2319.

Kislaus. L.L.. Herr. J-C.. and Little. C.D. ( 1987). trnmmolocalization of extracellular

matrix proteins and collagen synthesis in first tnmester human decidua. .4nat Rec. 2 18.

303-4 15.

Kooijman. R.. Hooghe-Peten. E.L.. and Hooghe R. (1996). Prolactin. growth hormone

and insulin-like growth factor-1 in the immune system. Adv Immunol. 63. 377454.

Kraus. W.L.. and Katzenellenbogen. B.S. (1993). Regulation of progesterone receptor

eene expression and growth in the rat uterus: modulation of estrogen actions by C

progesterone and sex steroid hormone antagonists. Endocrinology . 132. 23 7 1-23 79.

Kreitmann. B.. Bugat. R.. and Bayard. F. (1979) Estrogen and progestin regulation of the

progesterone receptor concentration in human endometrium. J of Clinical Endocrinology

and Metabolism. 49. 17-35.

Lavemere. J.N.. Tixier-Vidal. A.. Buisson. N.. Morin. A.. Martial. I.A.. and Gouridji. D.

( 1988). Preferential role of calcium in the region of the prolactin gene transcription by

thyrotropin-releasing hormone in GH; pituitary cells. Endocrinology. 122 333-340

Lebrun. J.J.. Ali. S.. Goffin. V.. Ullrich. A.. and Kelly. P.A. (1995). A single

phosphotyrosine residue of the prolactin receptor is responsible for activation of gene

transcription. Proc Nat1 Acad Sci. USA. 92 403 1-4035.

Liang. I.. Kim. K.E.. Schroderbek. W.E.. and Maurer. R.A. ( 1992). Characterization of a

nontissue-specific.X-cyclic adenosine monophosphate-responsive element in the

proximal region of the rat prolactin gene. Mol. Endocrinol. 6. 885-893.

L~M. C.. Lim. S-C.. Chang. C.P.. and Rosenfeld. M.G. (1992). Pit-1 dependent

expression of the receptor for growth hormone releasing factor mediates pituitary ceil

growth. Nature. 360. 765-768.

Lockwood, CIL-. Memerson. Y.. Krikun. G.. Hausknecht. V.. Markiewicz. L.. Alvarez.

M., Guller, S.. and Schatz. F. (1993). Steroid-modulated stroma1 ce11 tissue factor

expression: a mode1 for the regulation of endometriai hemostasis and menstruation. J Clin

Endocrinol Metab. 77, 1 û i 4- 1 O 1 9.

Lubahn. D.B.. Joseph. D.R.. Sullivan. P.M.. Willard. H.F.. French. F.S.. and Wilson.

E.M. ( 1988). Cloning of human androgen receptor complirnentary DNA and localization

to the X chromosome. Science. 240. 327-330.

Maniatis. R.. Fritsch. L.F.. and Sambrook. J. (1982) Molecular cloning: a Iaboratory

manual. Cold Spring Harbour Laboratory. Cold Spring Harbour. N.Y.

Markoff. E.. Barry. S.. and Handwerger. S. ( 1982). Influence of osmolality and ionic

environment on the secretion of prolactin by human decidua in vitro. J. Endocrinol. 92.

103-1 10.

Maurer. R.A. (1980). Doparninergic inhibition of prolactin synthesis and prolactin

rnessenger RNA accumulation in cuitured p i tu i tq celis. J Bi01 Chem. 255. 8092-8097.

Moore. I.A.R.. Armstrong. E.M.. McSeveney. D.. and Chatfield. W.R. ( 1974). The

morphogenesis and fate of the nucleolar channel system in the human endomrtrial

glandular cell. J. of Ultrastructural Research. 47, 74-85.

Murdoch. G.H.. Potter. E.. Nicholaissen. A.K.. Evans. R.M.. and RosenfeId. M.G. ( 1982).

Epidermal growth factor npidly stimulates prolactin gene transcription. Nature.300. 192-

194.

Murdoch. G.H., Rosenfeld. M.G.. and Evans. R.M. ( 1983). Eukaryotic translational

regulation and chrornatin-associated protein phosphorylation by cyclic AMP. Science.

218. 1315-1317.

Nowakowski. B.E.. Maurer. R.A. ( 1994). Multiple Pit- 1 binding sites facilitate estrogen

responsiveness of the prolactin gene. Mol. Endocrinol. 8. 1724- 1749.

Ogryzko. V.V.. Schiltz R.L.. Russanova. V.. Howard. B.. and Nakatani. Y. (1996). The

transcriptionai coactivators p3OO and CBP are histone acetyltransferases. Cell. 8'. 953-

959.

O'Neal. K.D.. Montgomery. D.W.. Truong. T.M.. and Yu-Lee. L.Y. ( 1993). Prolactin

gene expression in human thymocytes. Mol. Ce11 Endocrinol. 87 R19-R23.

Pavlik. E.J.. and Coulson. P.B. (1976). Modulation of estrogen receptors in four different

target tissues: differential effects of estrogen vs progesterone. J Steroid Biochem. -,

369-376.

Peers. B., Voz. M.L.. Monget, P.. Mathy-Hartert. M.. Benvaer. M.. Belayew. A.. and

Martial. J.A. ( 1990) Regulatory elements controlhg pituitary-specific expression of the

human prolactin gene. Mol Cell Biol. 10. 46904700.

Peers. B.. Monget, P.. Nalda. M.A.. VOL M.L.. Benvaer. M.. Belayew. A.. and iMartial.

I.A. ( 1 99 1). Transcnptional induction of the human prolactin gene by CAMP requires

two cis-acting elements and at least the pituitary-specific factor Pit-1. J. Biol. Chem. 766.

18127-18134.

Rao, Y.P.. Olson. MD.. Buckiey. D.J.. and Buckley. A.R. (1993). Nuclear CO-

localization of prolactin and the prolactin receptor in rat Nb2 node lyrnphoma cells.

Endocrinology. 133. 3062-3065.

Rhodes. S.J.. DiMattia. G.E.. and Rosenfeld. M.G. (1994). Transcnptional mechanisms

in anterior pituitary ce11 differentiation. Curr Opin Genet Dev. 4. 709-7 17.

Richards. R.G.. Brar. A.K.. Frank. G.R.. Hartman. S.M.. and jikihara. H. ( 1995).

Fibroblast cells fiom term decidua closely resemble endometrial stromal cells: induction

of prolactin and insulin-like growth factor binding protein- l expression. Bio Reprod. j Z .

609-6 1 5.

Riddick. D.H.. and Daly. D.C. (1982). Decidual prolactin production in hurnan gestation.

Semin Perinatol. 6. 229-237.

Rinehart. C.A.. Haskill. J.S.. Moms. J.S.. Butler. T.D.. and Kaufman. D.G. ( 1991).

Extended life span of hurnan endometrial stromal cells transfected with cloned origin-

defective. temperature-sensitive simian virus 40. J of Virology. 65. 1458- 1465.

Rinehart. C.A.. Mayben. J.P.. Haskill. M.. and Kautinan. D.G. (1992) Alterations of

DNA content in human endometrial stromal cells transfected with a temperature-sensitive

SV40: tetraploidization and physiological consequences. Carcinogenesis. 13. 63-68.

Rinehart. C.A.. Laundon. CH.. Mayben. J.P.. Lyn-Cook. B.D.. and Kaufman. DG.

( 1 993). Conditional immortalization of human endometrial stromal cells with a

temperature-sensitive simian virus 40. Carcinogenesis 14. 993-999.

Roberts. D.K.. Walker. N.J.. and Lavia. L.A. ( 1988). Ultrastructural evidence of stroma1

epithelial interactions in the human endometrial cycle. Arnerican J of Obstetrics and

Gynecology . 158. 854-86 1.

Saki. D.D.. Helms. S.. Carlstedt-Duke. J.. Gustafsson. J.A.. Ronman. F.M.. and

Yamamoto. KR. ( 1 988) Hormone-mediated repression: a negative glucocorticoid

response element from the bovine prolactin gene. Genes and Dev. 2. 1 144- 1 1 54.

Schatz. F.. Papp. C.. Toth-Pal. E.. and Lockwood. C.J. (1 992). Plasminogen activator

activity during decidualization of hurnan endornetrial stromal cells is regulated by PAI-1.

L Clin. Endocrinol Metab. 80. 2504-2509.

Shupnik. M.A.. Gordon. M.S.. and Chin W.W. ( 1989). Tissue-specific replation of rat

rstrogen receptor mRNAs. Mol Endocrinol. 3. 660-665.

Sinha. Y.N.. Gilligan. T.A.. Lee. D.W.. Hollingsworth. D.. and Markoff. E. (1983).

Cleaved prolactin: evidence for its occurrence in hurnan pituitary gland and plasma. J.

Clin Endocrinol Metab. 60. 239-343.

Sinha. Y.N. ( 1992). Prolactin variants. Trends in Endocrinol. Metab 3. 100- 106.

Suminda C.. Lecerf. F.. and Pasqualini. I.R. ( 1988) Control of progesterone receptors in

fetal uterine cells in culture: effects of estradiol. progestins. antiprogestins. and growth

factors. Endocrinology. 122. 3- 1 1.

Tabanelli. S.. Tang.. B.. and Gurpide. E. (1993). In vitro decidualization of human

endometrial stromal cells. J Steroid Biochem Mol Biol. -12. 337-344.

Tseng. L.. Gao. J.G.. Chen. R.. Zhu. H.H.. Mazella. J.. and Powell. D.R. (1992). Effect

of progestin. antiprogestin. and relêuin on the accumulation of prolactin and insulin-li ke

erowth factor-binding protein- 1 messenger ribonucleic acid in human endometrial C

stromal cells. Biol Reprod. 47. 441 - 6 0 .

Ventor. U.. Svaren. J.. Schmidt. A.. and Hortz. W. (1994). A nucleosome precludes

binding of the transcription factor Ph04 in vivo to a cntical target site in the PH05

promoter. EMBO J. 13. 4848-4835.

Wang. J.D.. Zhu. J.B.. Shi. W.L.. and Zhu. P.D. (1994). Immunocytochemical

colocalization of progesterone receptor and proiactin in individual stromal cells of human

decidua. J. Clin Endocrinol. 7'9, 293-297.

Weitlauf. H.M. 1988. Biology of implantation. In the Physiology of Reproduction.

Edited by E. KnobiI. J Neill. LL. Ewing, GS Greenwald. CL. Market. DW Pfaff. New

York, Raven Press Ltd.. 23 1.

Wewer. U.M.. Faber. M.. Liotta, LA. . and AIbrechtsen, R. (1985). Immunochernical

and u~trastnictural assessrnent of the nature of the pericelIular basement membrane of

human decidual cells. Lab. Invest. 53. 634-633.

WiIIis. S.D.. and Seyfied. M.A. ( 1 996). Pituitary-specific chromatin structure of the rat

prolactin distal enhancer element. Nucleic Acids Res. 24. 1065- 1073.

Wolffe. A.P. (1994). The transcription of chromatin templates. Current Opinions in Gen

and Dev. 4, 245-254.

IMAGE EVALUATION TEST TARGET (QA-3)

APPLIED - IMAGE. lnc 1- 1653 East Main Street - -. - Rochester. NY 14609 USA -- --.= Phone: 71 61462-0300 -- -- - - Fax: 71 6/288-5989

O t993. Wied Image. inc. Ali Rights R e s e W

regulation of non-pituitary prolacttn gene expression · rvork on this interesting and challenging...

Documents