Scotty MerrellDepartment of Microbiology and Immunology

B4140dmerrell@usuhs.mil

Regulation of Gene Expression I

1.Why does the expression of genes need to be regulated?QUESTIONS3.How is the expression of genes regulated?2.Why is it important to study gene regulation?

4.How do we study gene regulation?

Pathogenic bacteria:External reservoirHost

Infection site #1Infection site #2Bacteria experience different conditions depending on environment

1.Why does the expression of genes need to be regulated?QUESTIONS3.How is the expression of genes regulated?2.Why is it important to study gene regulation?

4.How do we study gene regulation?

Pathogenic bacteria produce virulence factors whenthey sense they are inside of a hostVibrio cholerae, the cause of cholera, produces toxin insideof the host. Understanding regulation of expression of this toxin is a means of understanding ways to prevent its production. ICDDR,B

1.Why does the expression of genes need to be regulated?QUESTIONS3.How is the expression of genes regulated?2.Why is it important to study gene regulation?

4.How do we study gene regulation?

Regulation of Gene Expression

Regulation of Gene Expression

RNA polymerase-promoter interactionsSome promoters contain UP elements that stimulate transcriptionthrough direct interaction with the C-terminal domains of the subunits of the RNA polymerase

Promoter with a full UP element containing two consensus subsites.

Promoter with an UP element containing only a consensus proximal subsite.

Promoter with an UP element containing only a consensus distal subsite. Arrangement of asubunits on UP elements

Genes come in two main flavors:

Constitutively expressed (transcription initiationis not regulated by accessory proteins)

Regulated (transcription initiationis regulated by accessory proteins)

a. Negatively Regulated--Repressor Proteinb. Positively Regulated--Activator Protein

Mechanisms of Regulation of Transcription Initiation:Negative RegulationRNA Polymerase

Mechanisms of Regulation of Transcription Initiation:Negative RegulationRepressorRepressorCo-repressorRepressorInactivator

The lac operona model for negative regulation A bacterium's prime source of food is glucose, since it does not have to be modified to enter the respiratory pathway. So if both glucose and lactose are around, the bacterium wants to turn off lactose metabolism in favor of glucose metabolism. There are sites upstream of the lac genes that respond to glucose concentration.

This assortment of genes and their regulatory regions is called the lac operon.

The lac promoter and operator regions

Lac Repressor(monomer)(tetramer)The Lac Repressor is constitutively expressedRepressor binding prevents transcription

When lactose is present, it acts as an inducer of the operon. It enters the cell and binds to the Lac repressor, inducing a conformational change that allows the repressor to fall off the DNA. Now the RNA polymerase is free to move along the DNA and RNA can be made from the three genes. Lactose can now be metabolized.Remember, the repressor actsas a tetramer

When the inducer (lactose) is removed, the repressor returns to its original conformation and binds to the DNA, so that RNA polymerase can no longer get past the promoter to begin transcription. No RNA and no protein are made.Remember, the repressor actsas a tetramer

1. Mutation in the regulatory circuit may either abolish expression of the operon or cause it to occur without responding to regulation.2. Two classes of mutants: A. Uninducible mutants: mutants cannot be expressed at all. B. Constitutive mutants: mutants continuously express genes that do not respond to regulation.3. Operator (lacO): cis-acting element Repressor (lacI): trans-acting elementHow to identify the regulatory elements?

cis-configuration: description of two sites on the same DNA molecule (chromosome) or adjacent sites.

cis dominance: the ability of a gene to affect genes next to it on the same DNA molecule (chromosome), regardless of the natureof the trans copy. Such mutations exert their effect, not because of altered products they encode, but because of a physical blockage or inhibition of RNA transcription.

trans-configuration:description of two sites on different DNA molecules (chromosomes) or non-contiguous sites.

Definitions:

Constitutive mutants: do not respond to regulation.Would this be a cis-dominant or recessive mutation?

Constitutive mutants can be recessive

lacI+mRNAlacI-PiPOlacYlacZlacAmRNAmRNAXConstitutive mutants can also be dominant if the mutant allele produces a bad subunit, which is not only itself unable to bind to operator DNA, but is also able to act as part of a tetramer to prevent any good (wild type LacI) subunits from binding.et al.

Think about how you could determinewhether a mutation was dominant orrecessive.

Questions about negativeRegulation of lac ?

Mechanisms of Regulation of Transcription Initiation:Positive RegulationRNA Polymerase

Mechanisms of Regulation of Transcription Initiation:Positive RegulationRNA PolymeraseActivator

The lac operona model for positive regulation When levels of glucose (a catabolite) in the cell are high, a molecule called cyclic AMP is inhibited from forming. So when glucose levels drop, more cAMP forms. cAMP binds to a protein called CAP (catabolite activator protein), which is then activated to bind to the CAP binding site. This activates transcription, perhaps by increasing the affinity of the site for RNA polymerase. This phenomenon is called catabolite repression, a misnomer since it involves activation, but understandable since when it was named, it seemed that the presence of glucose repressed all the other sugar metabolism operons.

CAP --- a positive regulator1. Catabolite repression: the decreased expression of many bacterial operons that results from addition of glucose. Also known as glucose effect or glucose repression.2. E. coli catabolite gene activator protein (CAP; also known as CRP, the cAMP receptor protein).3. CAP-cAMP activates more than 100 different promoters, including promoters required for utilization of alternative carbohydrate carbon sources such as lactose, galactose, arabinose, and maltose.

How does glucose reduce cAMP level?1. IIAGlc-P activates adenylate cyclase.2. Glucose decreases IIAGlc-P level, thus reducing cAMP production.3. Glucose also reduces CAP level: crp gene is auto-regulated by CAP-cAMP.

PTS - phosphoenolpyruvate-dependent carbohydrate phosphotransferase systemIIAGlc - glucose-specific IIA protein, one of the enzymes involved in glucose transport.

Activation of expression of the lac operon

E. coli CAP (CRP) --- 209 amino acidsNH2--COOH140-209DNA-bindingHelix-turn-helixAR1156-164His19His21Glu96Lys101AR2Dimerization and cAMP-binding1-139

Transcription activation by CAP at class I CAP-dependent promoters(-62)Transcription activation:Interaction between the AR1 of the downstream CAP subunit and one copy of aCTD.The AR1-aCTD interaction facilitates the binding of aCTD to the DNA downstream of CAP.Possibly, interaction between same copy of aCTD and the s70 bound at the 35 element.4. The interaction between the second aCTD and CAP is unclear.

The result: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant KB, for the formation of the RNAP-promoter closed complex

Transcription activation by CAP at class I CAP-dependent promoters (cont.)(-103, -93, -83, or 72)Transcription activation: Possibly, the second copy of aCTD may interact with the DNA downstream of CAP, and may interact with the s70 bound at the 35 element.

Results: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant KB, for the formation of the RNAP-promoter closed complex

Transcription activation by CAP at class II CAP-dependent promoters (cont.) (-42)Transcription activation:Interaction between the AR1 of the upstream CAP subunit and one copy of aCTD (either aCTDI or aCTDII, but preferentially aCTDI). The AR1-aCTD interaction facilitates the binding of aCTD to the DNA upstream of CAP.

Results: increase in the binding constant KB, for the formation of the RNAP-promoter closed complex

Interaction between the AR2 of the downstream CAP subunit and aNTDI.

Result: increase the rate constant, kf, for isomerization of closed complex to open complex.

Transcription activation by CAP at class III CAP-dependent promoters (-103 or 93)(-62)Transcription activation:Each CAP dimer functions through a class I mechanism with AR1 of the downstream subunit of each CAP dimer interacting with one copy of aCTDResults: synergistic transcription activation

Transcription activation by CAP at class III CAP-dependent promoters (cont.) (-103, -93, or -83)(-42)Transcription activation:The upstream CAP dimer functions by a class I mechanism, with AR1 of the downstream subunit interacting with one copy of aCTD; the downstream CAP dimer functions by a class II mechanism, with AR1 and AR2 interacting with the other copy of aCTD and aNTD, respectively.Results: synergistic transcription activation

(a) Glucose present (cAMP low); no lactose; (b) Glucose present (cAMP low); lactose presentGlucose effect on the E. coli lac operonNo lactose inside the cells!(inducer exclusion)!

(a) Glucose present (cAMP low); no lactose; (b) Glucose present (cAMP low); lactose presentGlucose effect on the E. coli lac operonNo lactose inside the cells!(inducer exclusion)!

Inducer exclusion: How does it work?Uptake of glucose dephosphorylates enzyme IIglc.Dephosphorylated enzyme IIglc binds to and inhibits lactose permease.Inhibition of lactose permease prevents lactose from entering the cell.Hence, the term inducer exclusion.

Questions about positive regulationof the lac operon?

Dual positive and negative control of transcription initiation:

the E. coli ara operon

The E. coli L-arabinose operon++

AraC exists in two statesP1P2ArabinoseArabinoseActivatorAntiactivator

AraC acts as a positive or negative regulator based on its conformational state and binding affinity for various sites in the two promoter regions.AraC encodes the regulatorAraO1 and AraO2 encode operatorsCAP is a CAP binding siteAraI is an additional regulatory regionAraBAD are the structural genes

If AraC concentration becomes too high, AraC will also bind to AraO1 and repress its own expression.No arabinose+ arabinoseIn the absence of arabinose, the P1 form of AraC binds AraO2 and AraI to prevent any P2 form from binding and activating expression--this is anti-activation, not repression!In the presence of arabinsose, AraC shifts to the P2 form and bindsAraI and acts to activate transcription.Therefore AraC is an Activator, Repressor and Anti-activator!!

The regulatory regions of the PC and PBAD promotersThe domain structure of one subunit of the dimeric AraC protein

The PC and PBAD Regions in the presence or absence of arabinose+ L-arabinose

Hypothetical model of the activation of the PBAD promoterPBAD class II promoterPossible interactions: between the aCTD of RNAP and the CAP protein and AraC protein and DNA

1. Find mutations that render the regulation uninducible or constitutive.

2. Decide by performing a complementation test if the mutants are dominant or recessive.

3. If they are recessive, decide if the system is regulated by repression or by activation. A recessive mutated activator has most likely lost function: the system will become uninducible. A recessive mutated repressor has also lost function, but now the system will show constitutive expression.

4. Decide if the elements of the system act in cis or in trans to each other: are they proteins or DNA binding sites?

5. Construct a model.Strategies for Understanding Regulation

Questions about ara regulation?

A. Transcriptional control1. Transcription initiation a) Positive b) Negative2. Transcription termination AttenuationB. Translational control1. Positive2. NegativeC. Post-translational control--ProteolysisRegulatory mechanisms used to control gene expression

RNAPTranscription termination players:Termination sequenceRNA polymeraseand sometimes the Rho (r) factorABCDPromoterOperon of 4 genesTerminatorX

Rho-independentterminatorRho-independentterminatorRho-dependentterminatorTwo major types of Terminator Sequences1. Rho-independent2. Rho-dependent

Attenuation: Premature termination of transcription of operons for amino acid biosynthesis(trp, his, leu, etc.)Relies on coupled transcription and translation and RNA secondary structure

1234The trp leader mRNA encodes the LEADER PEPTIDE MetLysAlaIlePheValLeuLysGlyTrpTrpArgThrSer5-AUGAAAGCAAUUUUCGUACUGAAAGGUUGGUGGCGCACUUCC U CCCAUAGACUAACGAAAUGCGUACCACUUAUGUGACGGGCAAAGA GCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGA-3Organization of Tryptophane Biosynthesis GenesEnd product of the pathway

mRNA forms secondary structuresAdapted from http://www.andrew.cmu.edu/user/berget/Education/attenuation/atten.html3 and 4 form a Rho-independent terminatorTwo possible alternative structures can form2 is complementary to 1 and 33 is complementary to 2 and 42 and 3 form the Pre-emptor, which preventsTerminator formationPre-emptor

Tryptophan absentTryptophan present

Attenuation can also occur at the level of Protein-RNA interaction:

Regulation of the trp operon in Bacillus

Model of trp transcriptional controlBinding of activated TRAPin the leaderpeptide results in the formation of a terminatorstructure

Take home message:

Transcription of genes to produce mRNAcan be controlled at the level of initiation and/or termination

STOP