refinement and integration of pcr-based...

REFINEMENT AND INTEGRATION OF PCR-BASED DETECTION AND CLASSIC VIRUS ISOLATION METHODS FOR IMPROVED AEROVIROLOGY,

ARBOVIROLOGY, AND INFECTION CONTROL VIROLOGY RISK ASSESSMENTS

By

TANIA S. BONNY

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

To almighty God. For creating me and taking care of me in every step of this eventful life. May I return to you as an enlightened soul.

4

ACKNOWLEDGMENTS

I would like to thank all who contributed to preparing this dissertation: my co-

authors, lab members, peers and officials at Environmental and Global Health

department. My profound gratitude to my respected committee members: Dr. John A.

Lednicky, Dr. Tara Sabo-Attwood, Dr. Song Liang, and Dr. Chang-Yu Wu, for their

constant support and guidance. Forever in debt to my wonderful mentor, Dr. John A.

Lednicky, I am blessed to have his guidance and inherit a tiny bit of his keen eye for

details, sense of humor, patience, kindness and an out of the box attitude to look at

everything.

I am grateful to my loving parents who always believed in my potential and let me

fly higher. I hope to make you proud in this life and hereafter. Hugs to my one and only

brother who has always been my best friend and lent his shoulder when I needed the

most. Finally, I must convey my sincere gratitude to almighty God for giving me a

privileged life with abundant love, care and strong support system.

This dissertation research was funded with multiple funding sources: (a) National

Science Foundation (Grant No. IDBR-1353423), (b) Aerosol Dynamics, Inc. and (c)

Internal funds from University of Florida to Dr. John A. Lednicky.

I declare an absence of competing interests with the information presented in this

dissertation. In addition, I also assume full responsibility for the collection and analysis

of all data.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 8

LIST OF FIGURES ........................................................................................................ 10

LIST OF ABBREVIATIONS ........................................................................................... 12

ABSTRACT ................................................................................................................... 16

CHAPTER

1 BACKGROUND ...................................................................................................... 18

2 COLLECTION OF VIABLE VIRUS AEROSOLS USING THE SKC BIOSAMPLER: EVALUATION OF REVISED COLLECTION PROCEDURES ....... 27

Introduction ............................................................................................................. 27 Materials and Methods............................................................................................ 28

Sampling Sites and Dates ................................................................................ 28 Aerosol Collection System................................................................................ 29

Preparation of Cell Lines .................................................................................. 31 Virus Isolation ................................................................................................... 31 Rapid Detection of Influenza A and B Viruses .................................................. 32

GenMark Respiratory Viral Panel ..................................................................... 32 Identification of Influenza Virus Types and Subtypes and Genomic

Sequencing ................................................................................................... 33 Identification of Miscellaneous Respiratory Viruses ......................................... 33

Results .................................................................................................................... 33 Isolation and Identification of Viable Viruses in Aerosols Collected in Spring

2016 (April 4- 20) .......................................................................................... 33

Isolation and Identification of Viable Viruses in Aerosols Collected in Early Fall (August- September) 2016 ..................................................................... 34

Isolation and Identification of Viable Viruses in Aerosols Collected after Thanksgiving (December) 2016 .................................................................... 34

Discussion .............................................................................................................. 35

3 EVALUATION OF THE COLLECTION EFFICIENCY OF THE VIABLE VIRUS AEROSOL SAMPLER IN A STUDENT HEALTH CARE CENTER ......................... 50

Introduction ............................................................................................................. 50 Materials and Methods............................................................................................ 53

Healthcare Facility ............................................................................................ 53 Sampling Dates ................................................................................................ 53

6

Aerosol Collection System................................................................................ 53

Air Sampler Placement ..................................................................................... 54 Virology Laboratory .......................................................................................... 55

Air Sampler Collection Media Volume Reduction and Adjustment ................... 55 Cell Lines .......................................................................................................... 55 Cell Culture Media Formulations for Virus Isolation .......................................... 57 Inoculation, Maintenance, and Observation of Cell Cultures ............................ 57 Identification of Human Respiratory Viruses ..................................................... 58

GenMark Respiratory Virus Panel .................................................................... 58 Rapid Detection of Influenza A and B Viruses in Cell Cultures ......................... 59 Identification of Influenza Virus Types and Subtypes and Genomic

Sequencing ................................................................................................... 59 Identification of Respiratory Syncytial Virus Subtype A (RSV-A) ...................... 59

Identification of Miscellaneous Respiratory Viruses ......................................... 61

Results .................................................................................................................... 61

Isolation and Identification of Viable Viruses in Aerosols Collected March 11, 2016 ........................................................................................................ 61

Isolation and Identification of Viable Viruses Collected in Aerosols on March 28, 2016 ........................................................................................................ 63

Isolation of Only One Type of Viable Virus from Aerosols on April 8, 2016. ..... 63 Discussion .............................................................................................................. 63

4 ISOLATION AND IDENTIFICATION OF HUMAN CORONAVIRUS 229E FROM FREQUENTLY TOUCHED ENVIRONMENTAL SURFACES IN A CLASSROOM ......................................................................................................... 92

Introduction ............................................................................................................. 92

Materials and Methods............................................................................................ 93

Study Period and Site ....................................................................................... 93 Ethics................................................................................................................ 93

Environmental Surfaces ................................................................................... 94 Sample Collection ............................................................................................ 94 Cell Cultures for Virus Isolation ........................................................................ 94

GenMark RVP Assay ....................................................................................... 96 Whole Genome Sequencing of CoV-229E ....................................................... 96 Assessment of CoV-229E Stability under Classroom Ambient Light,

Temperature and Humidity Conditions .......................................................... 96 Results .................................................................................................................... 98

Discussion .............................................................................................................. 99

5 COMPLETE GENOME SEQUENCE OF ENTEROVIRUS D68 DETECTED IN CLASSROOM AIR AND ON ENVIRONMENTAL SURFACES ............................. 107

Introduction ........................................................................................................... 107

Methods and Materials.......................................................................................... 108 Results and Discussions ....................................................................................... 108

7

6 DETECTION OF ALPHACORONAVIRUS vRNA IN THE FECES OF BRAZILIAN FREE-TAILED BATS (TADARIDA BRASILIENSIS) FROM A COLONY IN FLORIDA, USA ................................................................................ 110

Introduction ........................................................................................................... 110 Materials and Methods.......................................................................................... 112

Collection and Processing of Bat Feces Samples .......................................... 112 Virus Isolation Attempts in Cell culture ........................................................... 113 Screening of Viral Nucleic Acids for Coronavirus RNA ................................... 113

Phylogenetic Analyses of the CoV RdRp Sequences .................................... 114 Results .................................................................................................................. 115 Discussion ............................................................................................................ 116

7 ISOLATION AND DETECTION OF ARBOVIRUSES AND HUMAN CORONAVIRUS 229E IN BLOOD COLLECTED FROM CHILDREN IN RURAL HAITI IN 2016 ....................................................................................................... 120

Introduction ........................................................................................................... 120 Methods and Materials.......................................................................................... 121

Initial Screen of Plasma Samples for Zika-, Dengue- and Chikungunya Viruses ........................................................................................................ 122

Virus Isolation in Cell Cultures ........................................................................ 122

RT-PCR of vRNA Purified from Spent Cell Growth Media and Infected Cells 123 Sequencing .................................................................................................... 123

GenMark RVP Assay ..................................................................................... 124 Results .................................................................................................................. 124

Isolation and Identification of ZIKV in Plasma Sample Cell Culture ................ 124

Isolation and Identification of DENV-3 in Plasma Sample Cell Culture .......... 125 Co-infection of Plasma Cell Culture with ZIKV and DENV-4 .......................... 125 Isolation and Identification of Human coronavirus 229E (CoV-229E) ............. 125

Discussion ............................................................................................................ 126

8 CONCLUDING REMARKS ................................................................................... 138

LIST OF REFERENCES ............................................................................................. 144

BIOGRAPHICAL SKETCH .......................................................................................... 163

8

LIST OF TABLES

Table page 2-1 Air sample collection during 2016 using the BioSampler .................................... 39

2-2 Air sample cell culture ........................................................................................ 40

2-3 Primers for the detection of and subtyping of influenza A virus. ......................... 41

2-4 Primers for the detection of and subtyping of human metapneumovirus, human parainfluenza virus and human coronaviruses. ...................................... 42

2-5 GenBank accession numbers for Influenza A virus gene sequences ................. 43

2-6 Amino acid changes in the deduced HA of H1N1 isolated December 05, 2016. .................................................................................................................. 43

2-7 Amino acid changes in the deduced NA of H1N1 isolated December 05, 2016. .................................................................................................................. 46

2-8 Amino acid changes in the deduced M proteins of H1N1 isolated December 05, 2016. ............................................................................................................ 49

3-1 Viable viruses in aerosols collected on March 11, 2016. .................................... 77

3-2 Viable viruses in aerosols collected on March 28, 2016. .................................... 77

3-3 Cell lines used for the isolation of common culturable human respiratory viruses. ............................................................................................................... 79

3-4 Primers for the detection of and subtyping of influenza A and B viruses. ........... 80

3-5 GenBank accession numbers for Influenza A and B virus sequences, March 11, 2016. ............................................................................................................ 81

3-6 GenBank accession numbers for RSV-A NS2 and N gene partial cds sequences. ......................................................................................................... 81

3-7 Amino acid substitutions in the HA protein of H1N1 viruses from March 11, 2016. .................................................................................................................. 82

3-8 Amino acid changes in the deduced NA of H1N1 isolated March 11. ................. 85

3-9 Amino acid changes in the deduced M proteins of H1N1 from March 11, 2016. .................................................................................................................. 87

3-10 Amino acid sequences at HA major immunogenic epitopes A and B1 of influenza H3N2 viruses in Gainesville, Florida, March 11, 2016. ........................ 89

9

3-11 Amino acid sequence differences in the NA of influenza H3N2 viruses, in Gainesville, Florida, March 11, 2016. ................................................................. 91

4-1 Development of virus induced CPE in inoculated cell lines. ............................. 106

7-1 Haiti plasma sample cell culture report ............................................................. 136

10

LIST OF FIGURES

Figure page 1-1 The five major global respiratory conditions: Forum of International

Respiratory Societies, 2013 ................................................................................ 26

1-2 Disease Burden of Influenza, CDC ..................................................................... 26

2-1 Schematic diagram of the SKC BioSampler (left) [image adapted from ............. 38

3-1 Schematic diagram of viable virus aerosol sampler (VIVAS) .............................. 69

3-2 Schematic diagram of the testing system ........................................................... 70

3-3 Schematic layout of the student infirmary lobby. Top: first floor, bottom: second floor. ....................................................................................................... 71

3-4 MDCK cells in serum-free cell culture medium plus trypsin.. .............................. 72

3-5 Solid-phase ELISA tests.. ................................................................................... 73

3-6 Representative GenMark RVP report of MDCK cells inoculated with collection medium from VIVAS sampling interval # 2, March 28, 2016.. ............. 74

3-7 MRC-5 and A549 cells in serum-free cell culture medium plus trypsin.. ............. 75

3-8 VERO E6 and LLC-MK2 cells in serum-free cell culture medium plus trypsin. ... 76

4-1 Isolation of CoV-229E in VERO E6 and A549 cells at 33°C. ............................ 103

4-2 eSensor Respiratory Viral Panel currents report for desk top7 (collected on 23 November 2016) inoculated cell culture sample. ......................................... 104

4-3 Stability of CoV-229E on different hard surfaces over a 7-day observation period. .............................................................................................................. 105

6-1 Representative results of RT-PCR detection of alphacoronavirus vRNA in Brazilian free-tailed bat feces. .......................................................................... 118

6-2 Maximum likelihood tree based on the nucleotide sequences of partial RdRp gene of bat CoVs .............................................................................................. 119

7-1 Appearance of ZIKV-induced CPE in LLC-MK2 and VERO E6 cells. ............... 129

7-2 Appearance of DENV-induced CPE in VERO E6 and MRC-5 cells .................. 130

7-3 Appearance of CPE in LLC-MK2 cells induced by ZIKV-DENV co-infection .... 131

11

7-4 Appearance of CPE in VERO E6 cells induced by ZIKV-DENV co-infection .... 132

7-5 Representative results of RT-PCR detection of Zika virus in LLC-MK2 cells inoculated with patient plasma samples. .......................................................... 133

7-6 Appearance of VERO E6 and MRC-5 cells during cell culture. ........................ 134

7-7 Representative eSensor Respiratory Viral Panel currents report (RUO) .......... 135

12

LIST OF ABBREVIATIONS

A549 Human adenocarcinomic alveolar basal epithelial cells

aDMEM Advanced Dulbecco's modified Eagle's medium

AE Alcohol ethoxylates

AGI All-glass impinger

AMV Avian myeloblastosis virus

ARIs Acute respiratory illnesses

ATCC American Type Culture Collection

BLAST Basic local alignment search tool

BSA Bovine serum albumin

BSL2 Biosafety level 2

BtCoVs Bat coronaviruses

CDC Centers for Disease Control and Prevention, United States

CHIKV Chikungunya virus

CO2 Carbon dioxide

COPD Chronic obstructive pulmonary disease

CoV Coronavirus

CoV-229E Human coronavirus 229E

CPC Condensation particle counter

CPE Cytopathic effect

DALY Disability-adjusted life years

DENV Dengue virus

dpi Days post-infection

EGH Environmental and Global Health

ELISA Enzyme-linked immunosorbent assay

13

EMEM Eagle's minimal essential medium

EV-D68 Enterovirus D68

FASTA Fast alignment (program)

FBS Fetal bovine serum

FWC Florida Fish and Wildlife Conservation Commission

HA Influenza virus Hemagglutinin

HCoV-NL63 Human coronavirus NL63

HeLa Human cervical epithelial adenocarcinoma cell line (transformed with human papillomavirus)

HEPA High-efficiency particulate air

HIV Human immunodeficiency virus

hMPV Human metapneumovirus

HPIV Human parainfluenza virus

HPNP Health Professions/Nursing/Pharmacy complex

HVAC Heating, ventilation and air conditioning

IACUC Institutional Animal Care and Use Committee

IFV Influenza virus

IgG Immunoglobulin G

IRB Institutional Review Board

L/min Liters per min

LLC-MK2 Rhesus monkey (Macaca mulatta) kidney epithelial cell

LRT Lower respiratory tract

M1 & M2 Influenza virus Matrix proteins 1 & 2

MDCK NBL2 Madin-Darby canine (Canis familiaris) epithelial kidney cell line

MERS-CoV Middle East respiratory syndrome coronavirus

14

MHV Mouse hepatitis virus

MRC-5 Normal male human lung fibroblast cell line

nA Nanoampere

NA Influenza virus neuraminidase

NCBI The National Center for Biotechnology Information

NCI-H292 Human mucoepidermoid pulmonary carcinoma cell line

NEP Influenza virus nuclear export protein

NIOSH The National Institute for Occupational Safety and Health

NP Nucleocapsid

NS1 Influenza A virus Nonstructural protein 1

PBS Phosphate buffered saline

PCIS Personal cascade impactor sampler

PCR Polymerase chain reaction

pdm09 Influenza pandemic 2009

PSN Penicillin, streptomycin and neomycin

PVDF Polyvinylidene difluoride

RdRp RNA-dependent RNA polymerase

RFR Revised flow rate

RH Relative humidity

RSV Respiratory syncytial virus

RT Reverse transcriptase

RT-PCR Reverse transcription polymerase chain reaction

RUO Research use only

RVP Respiratory viral panel

15

SARS-CoV Severe acute respiratory syndrome coronavirus

SFR Manufacturer recommended standard flow rate

SRA Student reception area

TB Tuberculosis

Tb1 Lu Tadarida brasiliensis lung epithelium cell line

Temp Temperature

TGEV Transmissible gastroenteritis virus

TPCK L-1-tosylamido-2-phenylethyl chloromethyl ketone

URT Upper respiratory tract

UTM Universal transport medium

VERO E6 African green monkey (Chlorocebus sp.) kidney epithelial cell line

VIVAS Viable Virus Aerosol Sampler

vRNA Virus ribonucleic acid

VTM Virus transport medium

w/v Weight to volume

WHO World Health Organization

WI-38 Human normal lung diploid fibroblast cell line

ZIKV Zika virus

16

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

REFINEMENT AND INTEGRATION OF PCR-BASED DETECTION AND CLASSIC

VIRUS ISOLATION METHODS FOR IMPROVED AEROVIROLOGY, ARBOVIROLOGY, AND INFECTION CONTROL VIROLOGY RISK ASSESSMENTS

By

Tania S. Bonny

August 2017

Chair: John A. Lednicky Major: Public Health

In preparation for a career in public health virology in Bangladesh, work detailed

in this dissertation focused on the development of knowledge and expertise in two

aspects of virology: (a) The collection of virus aerosols, and (b) Identification of

pandemic arboviruses.

The significance of respiratory virus transmission through inhalation of

aerosolized viruses remains contentious because effective tools and methods are

lacking to adequately assess the occurrence and risks thereof. A major technical

hindrance is the lack of air samplers that can efficiently collect virus aerosols. In this

dissertation, the efficiencies of the SKC BioSampler and that of a newly developed

device, the Viable Virus Aerosol Sampler (VIVAS), for the collection of aerosols of

viable virus in indoor settings, were evaluated. Separately, for insights on the

importance of contact transmission of respiratory viruses, swab samples of frequently

touched surfaces were collected and virus isolation attempted in cell cultures, and a

pilot study was conducted to discover potential viral respiratory pathogens in local bats.

The VIVAS out-performed the BioSampler at collecting viable virus aerosols, and is

17

potentially the best air sampling device currently available for the collection of virus

aerosols. Surface sampling revealed viable Human coronavirus 229E and other viruses

on frequently touched indoor surfaces, reinforcing that contact transmission may also be

a route of respiratory virus transmission. An alphacoronavirus RNA-dependent RNA

polymerase gene sequence was detected in bat feces, reinforcing the notion that

Florida bats may indeed be a source of potential respiratory pathogens.

The explosive spread of arthropod-borne viruses (arboviruses) into new

geographical areas is alarming. A contemporary and ongoing series of arbovirus

outbreaks over the past years in Haiti served as a training and learning platform.

Multiple arboviruses [Zika virus (ZIKV), Dengue virus (DENV) types 3 & 4] were isolated

from plasma samples collected between March and May 2016, indicating active co-

circulation of arboviruses during that period in Haiti, whereas only one virus was thought

responsible for that outbreak. Surprisingly, Human coronavirus 229E was isolated from

the plasma of one patient thought to have an arbovirus infection. This is the world’s first

record of that virus in human plasma.

18

CHAPTER 1 BACKGROUND

This dissertation work focused on the development of knowledge and expertise

in preparation for a career in public health virology in Bangladesh. In particular, two

virology topics of significant importance to Bangladesh were emphasized: (a) The

dynamics of airborne respiratory virus transmission, and (b) Identification of arboviruses

in acute human infections.

Acute respiratory infections continue to be the leading cause of morbidity and

mortality worldwide, especially in developing countries [1; Figure 1-1]. Notable human

respiratory diseases of the upper respiratory tract (URT) include influenza (“flu”) and

acute viral nasopharyngitis (“common cold”), which affect people across all age groups.

In the Unites States, influenza alone places a substantial burden on human health each

year. According to CDC estimates, influenza has been implicated in 9.2 - 60.8 million

illnesses, 40,000 - 710,000 hospitalizations and 12,000 - 56,000 deaths in the US

annually since 2010 [2; Figure 1-2]. Taken together, it is safe to assume that the overall

disease burden caused by influenza virus (IFV) and other human respiratory viruses is

likely to be much higher than current CDC estimates for influenza.

Influenza A, B and C viruses (and possibly the recently discovered Influenza D

virus) are the causative agents of influenza in humans. Severe influenza in the USA is

typically caused by influenza A and B viruses. The symptoms of influenza may include

chills, fever, cough, sore throat, runny nose, sneezing, muscle or body aches,

headache, fatigue and others such as chest pain. Clinically similar but generally less

severe manifestations of URT infection occur during episodes of the common cold. The

respiratory viruses most often implicated in the common cold are human rhinoviruses,

19

though coronaviruses, respiratory syncytial viruses, parainfluenza viruses, influenza

viruses, adenoviruses, metapneumovirus, and enteroviruses other than rhinoviruses are

possible causative agents [3]. Apart from common cold, many of these human

respiratory viruses also cause severe, often potentially life-threatening conditions

involving the lower respiratory tract (LRT). Human rhinoviruses, once thought to cause

relatively mild URT illness, are now also linked to exacerbations of chronic pulmonary

disease and asthma; bronchiolitis in infants and children; and pneumonia in the elderly

and immunocompromised patients [4]. Respiratory syncytial virus (RSV), and to a lesser

extent, human metapneumovirus (hMPV) can cause a range of LRT infections like

bronchiolitis, pneumonia and croup (laryngotracheobronchitis), primarily infecting

children, but also causing significant morbidity and mortality in the elderly,

immunocompromised patients and those with chronic cardiopulmonary disease [5, 6].

Human coronavirus, parainfluenzavirus, adenovirus and various enteroviruses can also

affect the LRT and cause similar disease manifestations [7-10].

During the course of a respiratory disease, a patient may generate a cloud of

airborne particles through breathing, coughing, sneezing and talking. The exhaled

particles containing viruses can vary in size from few millimeter (large droplets) to

submicron (<1 𝜇m) [11]. The larger respiratory droplets travel a short distance in the air

and settle quickly. However, some of the particles are too small to settle. They include

“droplet nuclei” that result from evaporated larger particles and remain suspended in the

air [12]. These potentially virus containing droplet nuclei may vary in size, from “naked

virus” particles (20-300 nm) to micrometer sized (<5 𝜇m) particles that are aggregated

to fomites or encased in respiratory secretions [13].

20

To initiate a respiratory infection, a virus must (a) remain viable (“live”; infectious)

in the ambient breathing air or on environmental surfaces, and (b) be able to transmit to

the respiratory tract of a susceptible person. Human respiratory viruses can be

transmitted from one person to another through various routes of infection. Four have

been identified as the major routes for many of these viruses:

1. Droplet infection occurs when respiratory droplets deposit on the mucous membranes of the upper respiratory tract (URT), such as the mouth and nose.

Droplets that are 10 m remain in the URT and do not reach the lower respiratory tract (LRT) [14].

2. Inhalation of small aerosols and droplet nuclei: Small aerosol particles (≤5 m) including the droplet nuclei can reach the LRT. These particles can also deposit on the URT surface, but the infection risk and disease severity may increase when they reach the lungs in the LRT [14-17].

3. Contact transmission: occurs as a result of direct contact between susceptible host and infected individual(s). It can also occur indirectly when virus-containing fomites are transferred to the mucous membrane of the URT of a susceptible host [14].

4. Ocular infection: may occur when airborne respiratory viruses (presumably either droplets or aerosols) come into contact with ocular surfaces. For instance, studies using animal models have shown that ocular surface can serve both as a site for virus entry and replication for airborne influenza viruses [18].

The relative importance of each of these routes remains poorly understood, with

the aerosol route being the most contentious one [11].

Infection risk analyses lack accuracy when they are solely based on detection of

virus genome [19], as breathing air and environmental surfaces always contain viruses

that have been inactivated through exposure to ultraviolet light, desiccation (drying), or

other means, and thus pose no health hazards [19]. Therefore, proof of virus viability

(i.e. presence of “live” virus) is important in order to assess the risk posed by respiratory

viruses transmitted via any of the above-mentioned routes. Current recommendations

for protection against the human respiratory viruses are mostly directed at prevention of

21

droplet transmissions assuming that viable (“live”), infectious viruses are transferred

only in large droplets that travel very short distance from the emitting source [20].

However, it is important to note that deposition of IFV-laden small particles into the

lower respiratory tract (LRT) may pose a greater health hazard compared to large

particle droplets deposited onto the URT [15-16, 21-23] because infection of the

alveolar cells in the LRT may lead to more severe diseases like pneumonia. It is,

therefore, important to assess the true inhalation or ocular biohazard risks posed by

airborne virus particles, especially aerosols and droplet nuclei, for the transmission of

respiratory diseases. For improved risk analyses and to partly fill critical knowledge

gaps regarding the transmission of respiratory viruses, environmental sampling aimed

at the isolation and identification of viable respiratory viruses in breathing air and on the

surfaces of living spaces is crucial. The knowledge gained from such studies would

inform policy makers and lead to the adoption and implementation of more effective

infection control and prevention strategies than currently exist. Otherwise, the fact that

respiratory viruses still exert a significant public health and economic burden even in

developed countries indicates that current infection control policies and procedures are

only partly effective.

The two commonly used methods for assessing microbiological quality of air are

passive monitoring and active sampling [24]. Passive monitoring using settle plates

have been used for detecting bacteria and fungi in the air. In active sampling, a known

volume of air is mechanically drawn in using an air sampling device and airborne

particles are collected onto a solid collection surface or into liquid collection medium.

The collected particles are subsequently removed from the device and analyzed. In

22

addition to collection of bacteria and fungi, active air sampling has also been used to

collect airborne virus particles [25]. However, several limiting factors pertaining to active

air sampling have impeded the collection of airborne respiratory viruses, namely: (1)

relatively low concentration of viruses in the ambient air, (2) low volume of air sample

collected by the sampling devices, (3) most air samplers do not separate collected

particles by size, (4) inefficiency at collecting submicron particles, and (5)

inactivation/loss of viability of the virus particles during collection [26-33]. All these

environmental factors and shortcomings in the existing air samplers signify the need for

an improved system for the effective collection of viable virus in submicron particles.

Apart from respiratory viruses, arthropod-borne viruses (arboviruses) are a

substantial threat to human and animal health worldwide due to a variety of evolving

factors such as climate change, anthropological behavior, commercial transportation

and land-remediation [34, 35]. Arboviruses are transmitted between arthropod vectors

(e.g. mosquitoes, ticks, sandflies, midges etc.) and vertebrates during the life cycle of

the virus [36]. Clinical manifestations of arbovirus infections can range from mild to life

threatening conditions [34]. The explosive spread of mosquito-borne viruses to new

geographical areas in the recent years has alarmed the public health community

worldwide. The continued presence of Dengue virus (DENV), Chikungunya virus

(CHIKV), and Zika virus (ZIKV) in endemic areas and their expansion through the

Americas place an estimated 3.9 billion people living in 120 different countries at risk

[37]. This has prompted researchers around the world to investigate arbovirus disease

epidemiology, prevention and control [37]. As part of the worldwide response to study

and eradicate arboviruses, researchers at University of Florida (UF) has initiated

23

projects to determine the causative agents and incidence of arbovirus infections in Haiti

and elsewhere in the Caribbean and in the Americas.

Specific aims: To advance our understanding of respiratory virus transmission

and to generate new insights on the etiology and incidence of arbovirus disease in the

New World, the work undertaken in this proposal had five specific aims:

1. To improve air sampling methods typically used for collection of viable human respiratory viruses using the SKC BioSampler.

Hypothesis: Based on cumulative experience at the laboratories of Drs. Lednicky

and Wu [including unpublished data], and from the published literature [11, 38-45], I

hypothesize that the collection of virus aerosols using the industry-standard device (the

SKC BioSampler) is inefficient and ineffective when the device is used according to the

manufacturer's instructions, and that the methodology can be improved by refining the

operating procedures. This will be tested by using the SKC BioSampler according to the

manufacturer’s instructions and by revised operating procedures for collection of virus

aerosol in indoor settings. Such experiments will facilitate comparisons between the

methodologies and help explain why previous studies using the BioSampler were not

very successful in collecting viable human respiratory viruses from breathing air.

2. To evaluate the viable virus collection efficiency of a newly developed Viable Virus Aerosol Sampler (VIVAS) in a student health care center.

Hypothesis: Based on the previous work at laboratories of Drs. Lednicky and Wu,

the VIVAS was reported to have a viable collection efficiency of ~74% for laboratory-

generated influenza A H1N1 virus [46]. I hypothesize that VIVAS will out-perform the

industry standard SKC BioSampler for the collection of viable virus aerosols. To test the

hypothesis, air samples will be collected using both devices operating simultaneously in

24

a student health care center and using these samples, attempts will be made to isolate

and identify respiratory viruses.

3. To collect, isolate and identify human respiratory viruses from frequently touched surfaces in classroom setting during influenza season.

Hypothesis: Frequently touched surfaces in classrooms harbor viable IFV and

other human respiratory viruses during outbreak of influenza viruses. This hypothesis

will be tested by collecting swab samples from surfaces in a classroom that is widely

used and frequently cleaned, and at a time when students are complaining of

respiratory infections.

4. To seek evidence of coronavirus shedding in the feces of Brazilian free-tailed bats in Florida.

Hypothesis: Bats are reservoirs of many emerging and reemerging zoonotic

viruses, some of which are highly pathogenic in humans. The probable origin of Severe

acute respiratory syndrome coronavirus (SARS-CoV) in bats [47, 48] and recent

findings of a bat coronavirus related to Middle East respiratory syndrome coronavirus

(MERS-CoV) in Mexican bats [49] suggest that the abundant, yet underexplored, bat

population in Florida could harbor coronaviruses, and it is possible they may be

pathogenic to humans. To test this hypothesis, feces samples of Brazilian free-tailed

bats will be obtained from a conservation site in Florida and tested if CoV can be

isolated after inoculation onto readily available cell lines and/or CoV vRNA detected in

the bat feces using molecular methods.

5. To identify the most probable causative agents and seek insights on the incidence of putative arbovirus infections in Haitians with undifferentiated febrile illnesses suspected to be due to arboviruses.

Hypothesis: The Haitian population continues to be vulnerable to arbovirus

diseases due to recurring natural disasters, poor infrastructures, and lack of resources

25

for disease diagnosis, prevention and control. Due to the abundance of mosquito

vectors in Haiti, and recent expansion of different arboviruses in the Americas, I

hypothesize that arboviruses are circulating in Haiti and can be detected in and isolated

from plasma and other proper specimens taken from Haitians with symptoms consistent

with those of arbovirus infections.

The subsequent chapters in this dissertation address the above-mentioned

research aims.

26

Figure 1-1. The five major global respiratory conditions: Forum of International Respiratory Societies, 2013 [1]

Figure 1-2. Disease Burden of Influenza, CDC [1]

27

CHAPTER 2 COLLECTION OF VIABLE VIRUS AEROSOLS USING THE SKC BIOSAMPLER:

EVALUATION OF REVISED COLLECTION PROCEDURES

Introduction

To assess the true risk of respiratory viruses in small airborne particles (5µm),

an air sampling device is required that can collect particles from nanometer to

supermicrometer size range [50]. The commonly used bioaerosol samplers are

optimized for the collection of micrometer-sized particles like bacteria and fungal spores

[50]. These devices are thus inefficient in collecting nano-sized virus aerosols [38, 39].

For instance, several research groups previously attempted to use devices like the SKC

BioSampler (the current industry standard device), the AGI-30, a frit bubbler, or a

NIOSH two-stage cyclone for collection of virus aerosols [40-42]. Hogan et al. reported

the physical collection efficiency (i.e. the ability of a sampler to aspirate airborne

particles into its inlet, followed by removal of the particles from the airstream and their

subsequent transfer to a collection medium [51]) of bacteriophages MS2 (virus particle

diameter, d=27.5 nm) and T3 (d=45 nm) particles in the size range of 20 -100 nm to be

below 10%, and the collection efficiency of viable viruses was lower yet [40]. One

notable study by Lednicky and Loeb (2013) employed two different active air samplers:

a Sioutas Personal Cascade Impactor Sampler (PCIS) and an SKC BioSampler, to

detect and isolate airborne IFV from an apartment with two influenza patients [11].

Viable IFV was collected by both the devices located up to 3.7m away from one of the

sick occupants. PCIS, when placed 1.2 m away from one sick individual, collected a

range of particle sizes containing viable IFV but when the device was placed at

distances 2.1 and 3.7 m away from the patient, only fine to ultrafine (≤2.5 𝜇m) particles

yielded viable IFV [8]. Using a NIOSH two-stage cyclone or a BioSampler, Lindsley et

28

al. (2010) were able to isolate IFV from only two of twenty samples collected from

influenza patients [41]. Lindsley et al. (2015), in another study were able to isolate

viable IFV from cough particles (0.3 - 8 μm) collected from seven of total sixty-four

symptomatic test subjects [42]. However, the reported low collection efficiency of viable

viruses could be also due to virus inactivation during the collection process, which

reduces the validity of the data acquired, making accurate risk assessment even more

difficult [52]. Therefore, an improved system for efficient collection of viable (“live”) virus

particles is critical to assess the risk of airborne disease transmission.

In this study, a comparison was made of the performance of two SKC

BioSampler units for collection of viable virus aerosol in indoor settings, one operating

according to the manufacturer’s instructions and the other following revised operating

procedures.

Materials and Methods

Approval by an institutional review board (IRB) was not necessary for this study

because human subjects were not studied and could not be identified, and the sources

of the viruses detected could not be tracked.

Sampling Sites and Dates

Prior to air sample collection, approvals were obtained from the respective

building managers at the UF. Based on the availability of the sampling sites, eight (n =

08) paired air samples were collected from Health Professions/Nursing/Pharmacy

Complex (HPNP) classrooms and the Reitz Union cafeteria. Both buildings have their

own heating, ventilation and air conditioning (HVAC) systems. Paired samples were

collected at different times in 2016, using two BioSampler units operating at two

different collection air flow rates. The sampling strategy and operating parameters are

29

summarized in Table 2-1. Air samples were collected in typically empty classrooms

between class sessions, with few students occasionally present. However, many

students were present at the Reitz Union cafeteria during air sample collections.

Aerosol Collection System

For this study, the SKC BioSampler (SKC, Inc., Eighty Four, PA, USA, catalog#

225-9597) was used for active air sampling. The BioSampler is a type of impinger: an

air sampling device that collects airborne particles into a liquid collection medium by

means of impaction and diffusion (Figure 2-1). Impaction occurs when particles in the

air, in response to a tight turn in the air streamlines, depart from the streamlines due to

their inertia, and impact onto a collection surface or into a collection media (as in the

case of the BioSampler). Diffusion is the Brownian motion of smaller particles. A swirling

motion (centrifugal motion) of the collection medium in the BioSampler is created by

passing air through three 0.630 mm tangential nozzles. The swirling flow generates

fewer bubbles and thus helps to minimize reaerosolization of already collected particles

and damage to the collected microbial agents [53]

Two BioSampler units operating at two different flow rates were used for air

sampling on each day. Based on previous field and laboratory tests [45, 54-55;

unpublished data], where lower sampling rates (6-8 L/min) have resulted in increased

collection of airborne viruses using the BioSampler, a revised flow rate of 8 L/min was

chosen for this study. Flow rates of 12.5 L/min (manufacturer recommended) for 30

minutes and 8 L/min (revised flow rate) for approximately 47 min were used to sample

approximately 375 liters (0.375 m3) of air/sampler. The sampling units were placed

beneath an intake air vent, in areas of active air flow and at a height of 1-1.5 m from the

floor. As operating two BioSampler units at close proximity using two different flow rates

30

may affect virus aerosol collection of individual device, the two devices were separately

run in short intervals (30-45 min). The samplers were sterilized by autoclaving and filled

with 15 mL collection medium containing sterile phosphate buffered saline (PBS) and

0.5% w/v purified bovine serum albumin (BSA) fraction V (Life Technologies, Grand

Island, NY, USA) [11, 17]. To achieve the desired air flow rate, the devices were

attached to GAST vacuum pumps (oil-less, rotary vane-type vacuum pump; GAST

Manufacturing, Inc., catalog# 1532-101-G557X). The pumps were turned on and

warmed up by running them for five minutes prior to use. In-line vapor traps (SKC Inc.,

catalog# 225-22-01) were connected between the SKC BioSamplers and GAST pumps

in order to protect the pump from moisture. Prior to air sampling, the operating air flow

rate for each BioSampler was calibrated using a rotameter (a single-ball portable air

flowmeter; SKC, Inc. catalog# 320-440). During calibration, the rotameter was attached

to the inlet of the BioSampler and GAST pump was attached to its outlet. The operating

pressure of the pump, read from a built-in manometer, was adjusted using the pump

valve lever, until the desired air flow rate was indicated in the rotameter. After

calibration, the rotameter was detached from the BioSampler inlet and the rest of the

assembled unit (BioSampler- vapor trap-GAST pump) was used for collection of air

sample (Figure 2-1).

After completion of air sampling at each flow rate, the collection medium from

each unit was aseptically transferred into sterile 50mL conical polypropylene tubes,

placed in an insulated ice box and transported immediately to the laboratory. Air sample

collection media were stored in pairs from each collection day: one medium labeled

“SFR” was collected from the BioSampler operating at 12.5 L/min (manufacturer

31

recommended standard flow rate), and other medium labeled “RFR” collected from the

other BioSampler unit operating at an air flow rate of 8 L/min (revised flow rate). As

summarized in Tables 2-1 and 2-2, paired samples# 1, 2 and 3 were collected during

spring season; samples# 4, 5 & 6 collected in early fall and samples# 7 & 8 collected

after the Thanksgiving holiday in 2016 (exact dates given in Table 2-1). All the collected

samples were stored at -80°C until virus isolation was attempted in cell cultures.

Preparation of Cell Lines

To favor isolation of different human respiratory viruses, a variety of readily

available cell lines were used for virus isolation attempts. A549 (CCL-185), HeLa (CCL-

2), LLC-MK2 (CCL-7), MDCK NBL2 (CCL-34), MRC-5 (CCL-171), NCI-H292 (CRL-

1848), Vero E6 (CCL-81), and WI-38 (CCL-75) cells were obtained from the American

Type Culture Collection (Manassas, VA, USA). The cell lines were grown as

monolayers at 37°C and 5% CO2 in advanced Dulbecco's Modified Eagle's Medium

(aDMEM) (Invitrogen Corp., Carlsbad, CA, USA), supplemented with 2 mM L-Alanyl-L-

Glutamine (GlutaMAX, Invitrogen Corp.), 10% (v/v) low IgG, heat-inactivated gamma-

irradiated fetal bovine serum (HyClone, Logan, UT) and antibiotics [PSN; 50 μg/mL

penicillin, 50 μg/mL streptomycin, 100 μg/mL neomycin (Invitrogen Corp.) to inhibit

bacterial growth [56]. Prior to use, every cell line was treated with plasmocin for three

weeks to reduce the chance of mycoplasma contamination and verified free from

mycoplasma DNA by PCR [56].

Virus Isolation

Upon thawing on ice, aliquots of (~50 𝜇L) air sample collection medium (SFR and

RFR) were inoculated onto newly confluent monolayer of cells in 6-well plates.

Fungizone® Antimycotic (final concentration 0.125𝜇g/mL; Gibco, Catalog# 15290-018)

32

was incorporated into the cell growth medium, as needed, to inhibit fungal growth.

Serum free aDMEM supplemented with L-1-tosylamido-2-phenylethyl trypsin (final

concentration as appropriate for each cell line) was used to facilitate the isolation of IFV

and many other viruses. The inoculated cell lines in addition to negative controls were

incubated at 35°C with 5% CO2 and observed daily for virus-induced cytopathic effects

(CPE) for 26 days. Based on observation of characteristic CPE, spent cell growth media

and infected cells were collected at various time intervals, and tested for virus isolation

by antigen and genome based detection methods described below.

Rapid Detection of Influenza A and B Viruses

Cell cultures in serum-free media containing TPCK-trypsin that exhibited IFV-

induced CPE (IFV-induced CPE in MDCK cells includes granulation of the cytoplasm,

enlarged nuclei, round and refractile floating cells, followed by destruction of the cell

monolayer) typically were tested using a commercial solid phase ELISA (QuickVue

influenza A and B kit, Quidel Corp., San Diego, CA, USA) for rapid detection of

influenza A and B viruses.

GenMark Respiratory Viral Panel

A GenMark multiplex PCR eSensor XT-8 Respiratory Viral Panel (GenMark

Diagnostics, Inc., Carlsbad, CA) was used for respiratory virus detection and IFV

subtyping. This panel includes tests for common human respiratory viruses including

influenza A virus (with subtype determination); influenza B virus; respiratory syncytial

virus types A and B; parainfluenza virus types 1, 2, 3 and 4; human metapneumovirus,

human rhinovirus; adenovirus groups B, C and E; coronavirus types 229E, NL63, HKU1

and OC43. The panel does not include tests for bacterial or fungal pathogens. As

previously described, extracted nucleic acids from the spent cell-growth media were

33

used to perform a multiplex PCR/RT-PCR assay and the amplified DNA targets

analyzed by electrochemical detection [57]. After data acquisition and analysis, the

instrument generated an output: eSensor Respiratory Viral Panel Currents Report

(RUO). A current output of 3 nA (nanoamps) and above was considered positive

identification of a respiratory virus’ genomic nucleic acids.

Identification of Influenza Virus Types and Subtypes and Genomic Sequencing

After IFV were detected using the rapid ELISA test and RVP assay, RT-PCR

targeting specific gene sequences of IFV were performed for further confirmation. Viral

RNA (vRNA) was purified from spent cell growth media and RT-PCR performed using

primers as described in Table 2-3. Influenza virus A genomic segments [polymerase

genes PA, PB1 & PB2; hemagglutinin (HA); nucloecapsid (NP); neuraminidase (NA);

matrix proteins (M1 & M2); nuclear export protein (NEP) and nonstructural protein

1(NS1)] were sequenced following previously published methods [58-61].

Identification of Miscellaneous Respiratory Viruses

Human metapneumovirus, human parainfluenza virus types 1 and 4a, and

human coronavirus NL63 were identified by RT-PCR and sequencing of virus-specific

genes using previously published methods (Table 2-4; 62-65)

Results

Isolation and Identification of Viable Viruses in Aerosols Collected in Spring 2016 (April 4- 20)

Cell cultures were maintained for 26 days before being considered negative for

virus isolation. During this time, no CPE were observed in MDCK cells characteristic of

influenza virus infection. However, mixed cytopathic effects were observed after 21

days post infection (dpi) in LLC-MK2 and A549 cells inoculated with RFR air samples

34

but not in those inoculated with SFR air samples. Spent cell growth media and infected

cells from RFR inoculated cultures tested negative in GenMark RVP assays. However,

virus group/species specific RT-PCR and sequencing performed using vRNA extracted

from the same samples confirmed the presence of human metapneumovirus and

human parainfluenza virus 4a (collected April 8, 2016); human metapneumovirus and

human parainfluenza virus 1 (collected April 15, 2016) and human metapneumovirus,

human parainfluenza 4a and human coronavirus NL63 (collected April 20, 2016) (Table

2-2). The fact that GenMark RVP assays tested negative while sequencing results

identified viruses in the same samples may be due to one or more factors like: (a)

choice of primers used for PCR/RT-PCR step, (b) presence of sequence variants in the

viral targets, and/or (c) levels of virus in the specimen below the limit of detection for the

RVP assay. Probable failure of virus genome extraction and PCR/RT-PCR inhibition

may be ruled out since the internal control included in these samples (bacteriophage

MS2) was detected in the RVP assays.

Isolation and Identification of Viable Viruses in Aerosols Collected in Early Fall (August- September) 2016

No virus was isolated and detected from air samples collected from both

sampling sites (HPNP and the Reitz Union cafeteria) during early fall.

Isolation and Identification of Viable Viruses in Aerosols Collected after Thanksgiving (December) 2016

MDCK cells inoculated with any of the SFR and RFR air samples collected after

the Thanksgiving holiday did not show any IFV-induced CPE. However, VERO E6 and

LLC-MK2 cells inoculated with one of the air samples (RFR air sample collected

December 5, 2016) showed non-specific CPE 12 dpi, characterized by few floating dead

cells while the cells in the intact monolayer were darker and granular in appearance.

35

Cell spent growth media and cells from LLC-MK2 cultures tested positive for influenza

virus A using the GenMark RVP. Subsequent type and subtype specific RT-PCR

confirmed it to be influenza virus A subtype H1N1.

Sequence analyses of the influenza A H1N1 isolate revealed that it belonged to

HA subclade 6B.1 based on the criteria mentioned by the European Center for Disease

Prevention and Control [66]. GenBank accession numbers for the influenza

[A/Environment/Gainesville/12/2016(H1N1)] virus gene sequences are listed in Table

2-5. Deduced amino acid substitutions in the hemagglutinin (HA), neuraminidase (NA)

and matrix (M) proteins of our environmental isolate have been compared to those of

the 2015-16 northern hemisphere influenza A H1N1 vaccine strain, and available gene

sequences of clinical and environmental influenza A H1N1 strains detected in

Gainesville since 2013. As shown in Tables 2-6 to 2-8, when compared to the reference

vaccine H1N1 strain [A/California/07/2009(pdmH1N1)], there were changes in key

amino acid positions of the HA, NA and M proteins of our H1N1 isolate and other recent

isolates (clinical and environmental) from Gainesville.

Discussion

In this study, the performance of the SKC BioSampler operated using revised

operating procedures in collecting viable virus aerosols from various indoor locations at

UF was evaluated. Convenience samples were collected in 2016 during spring, early fall

and post-Thanksgiving period. Respiratory viruses were isolated from spring and post-

Thanksgiving air samples collected using a revised air flow rate but no virus was

isolated from samples collected following the manufacturer recommended air flow rate.

Influenza A H1N1 virus was isolated from only one air sample collected on

December 5, 2016. Viral genomic sequence analyses were performed using available

36

GenBank sequences of influenza A H1N1 strains detected in Gainesville from 2013 to

date. The reference strain used was influenza virus A/California/07/2009 (pdmH1N1),

which is defined as the pdm09 HA clade 1 and was used in the 2015-2016 northern

hemisphere flu vaccine. The influenza A virus isolated in this study

(A/Environment/Gainesville/12/2016(H1N1)] belonged to pandemic H1N1 2009 clade

6B.1. A shown in Tables 2-6 to 2-8, several amino acid substitutions over time became

fixed in the virus population possibly conferring some selective advantage to their

survival in human population. These include some of the signature amino acid

substitutions defining subgroup 6B (D97N, S185T and A256T in HA1; and E47K and

S124N in HA2) but also additional ones (P83S, K163Q, S203T, K283E and I321V in

HA1; E172K in HA2). The influenza A H1N1 strains detected in 2016 had few more

substitutions in HA1 (S84N, S162N and I216T) that might get fixed in the coming years.

Similar trends were also observed in NA and M amino acid sequences as shown in

Tables 2-7 & 2-8.

Sampling time and location play important roles in successful collection of virus

aerosols using any air sampler. Using the same revised air sampling flow rate for the

BioSampler, viable viruses were isolated during an influenza outbreak in April 2016 but

not during early fall season in 2016 when there was no ongoing influenza outbreak in

Gainesville. Influenza virus was again collected during a December sampling. Most of

the collections took place in empty classrooms, though two samples were also collected

in a crowded cafeteria at the Reitz Union. However, at the cafeteria, there were no

persons observed with obvious signs of respiratory ailments (i.e., no persons were seen

that were coughing or sneezing). More samplings during outbreaks of IFV and other

37

respiratory viruses at various locations and in the presence of sick individuals could

shed some more light as to the importance of emitting sources for viable virus aerosol

collection.

This study suggests that the revised collection procedures may work better for

collection of viable viruses in indoor settings. However, more studies need to be

performed to verify our findings and identify potential limiting factors for viable virus

collection using the BioSampler.

38

Figure 2-1. Schematic diagram of the SKC BioSampler (left) [image adapted from www.skcinc.com]; and the testing system installed at a sampling site (right).

39

Table 2-1. Air sample collection during 2016 using the BioSampler

Air sample# (in pairs)

Date & Location

RH & Temp. Flow rate (L/min)

Duration (min)

Volume of air sampled (m

3)

Sp

ring 1 4.8.16,

HPNP G101 42%, 22C 8a 30 240

43%, 20C 12.5b 30 375

2 4.15.16, HPNP SRA

44%, 24C 8 47 375

46%, 22C 12.5 30 375

3 04.20.16, HPNP G1404

42%, 21C 8 47 375

41%, 20C 12.5 30 375

Ea

rly F

all 4 08.29.16,

Reitz union cafeteria

43%, 22C 8 47 375

43%, 22C 12.5 30 375

5 08.31.16, HPNP G1404

48%, 24C 8 47 375

48%, 24C 12.5 30 375

6 09.06.16, Reitz union cafeteria

41%, 23C 8 47 375

41%, 23C 12.5 30 375

Po

st-

Tha

nksg

ivin

g 7 12.05.16,

HPNP G101 49%, 22C 30 47 375

49%, 22C 8 30 375

8 12.07.16, HPNP G114

48%, 23C 12.5 47 375

48%, 23C 8 30 375

a Revised air flow rate (RFR)

b Manufacturer recommended standard air flow rate (12.5 L/min) (SFR)

RH: Relative humidity Temp.: Temperature HPNP: Health Professions/Nursing/Pharmacy Complex; University of Florida G101, G114 and G1404: Ground floor room numbers; SRA: Student reception area

40

Table 2-2. Air sample cell culture

Sample#

Flow rate (L/min)

Cell lines Virus isolated & detected

MDCK (NBL2)

A549 MRC-5 LLC-MK2

VERO E6

HeLa NCI-H292

1 8a _ + _ + _ * _ hMPV, HPIV-4a 12.5b _ _ _ _ _ * _

2 8 _ + _ + _ * _ hMPV, HPIV-1 12.5 _ _ _ _ _ * _

3 8 _ + _ + _ * _ hMPV, HPIV-4a, HCoV-NL63

12.5 _ _ _ _ _ * _ 4 8 _ _ _ _ _ _ _

12.5 _ _ _ _ _ _ _ 5 8 _ _ _ _ _ _ _

12.5 _ _ _ _ _ _ _ 6 8 _ _ _ _ _ _ _

12.5 _ _ _ _ _ _ _ 7 8 _ _ _ + + _ _ Flu A H1N1

12.5 _ _ _ _ _ _ _ 8 8 _ _ _ _ _ _ _

12.5 _ _ _ _ _ _ _ a Revised air flow rate (RFR);

b Manufacturer recommended standard air flow rate (12.5 L/min) (SFR)

* Cell line not used hMPV, Human metapneumovirus; HPIV-1, Human parainfluenza virus type 1; HPIV-4a, Human parainfluenza virus type 4a; HCoV-NL63, Human coronavirus NL63; Flu A H1N1, Influenza A subtype H1N1

41

Table 2-3. Primers for the detection of and subtyping of influenza A virus.

Influenza virus Type/subtype

Gene fragment

Primer Sequence (5’ – 3’) Amplicon size (bp)

Reference

Influenza A All genes Uni12W AGCRAAAGCAGG [58]

A(H1N1)2009 HA-5’(H1) HKU-SWF GAGCTCAGTGTCATCATTTGAA 173 [59]

HKU-SWR TGCTGAGCTTTGGGTATGAA [59]

UFH1-JLR GGTTGAGCTTTGGGTATGAA J. Lednickya

NA-3’(N1) N1F401 GGAATGCAGAACCTTCTTCTTGAC 1073 [59]

NARUc ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT

[59]

All genes Uni R AGTAGAAACAAGG [58]

A(H3N2) HA-3’(H3) H3A1F3 TGCATCACTCCAAATGGAAGCATT 863 [59]

HARUc ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT

[59]

NA-3’(N2) N2F387 CATGCGATCCTGACAAGTGTTATC 1082 [59]


[59]

aJ. Lednicky, unpublished.

42

Table 2-4. Primers for the detection of and subtyping of human metapneumovirus, human parainfluenza virus and human coronaviruses.

Pathogen Gene fragment Primer Sequence (5’ – 3’) Amplicon size (bp)

Ref.c

Meta -pneumovirus

Type A

Nucleoprotein (N) Fa: MPV01.2 AACCGTGTACTAAGTGATGCACTC 213 bp [62]

Ra: MPV02.2 CATTGTTTGACCGGCCCCATAA

Type B

Nucleoprotein (N) F: MV-Can-U918 AAGTCCAAAGGCAGGRCTGTTATC 75 bp

R: MV-Can-L992 CCTGAAGCATTRCCAAGAACAACAC

Parainfluenza virus

Type 1

Nucleoprotein (N) F: HPIV1-U82 TACTTTTGACACATTTAGTTCCAGGAG 86 bp [62]

R: HPIV1-L167 CGGTACTTCTTTGACCAGGTATAATTG

Type 2

Nucleoprotein (N) F: HPIV2-U908 GGACTTGGAACAAGATGGCCT 77 bp [62]

R: HPIV2-L984 AGCATGAGAGCYTTTAATTTCTGGA

Type 3

Nucleoprotein (N) F: HPIV3-U590 GCTTTCAGACAAGATGGAACAGTG 79 bp [62]

R: HPIV3-L668 GCATKATTGACCCAATCTGATCC

Type 4a

Fusion (F) F: Para4-F CATGGGTGTCAAAGGTTTATC 376 bp [63]

R: Para4-R TGCTGCTGTAACTTGTGCAGC

Type 4b

Fusion (F) F: Para4-F CATGGGTGTCAAAGGTTTATC 376 bp [63-64] R: Para4-R TGCTGCTGTAACTTGTGCAGC

Coronaviruses 229E, HKU1, NL63, and OC43

Polymerase Forward: Cor-FW ACWCARHTVAAYYTNAARTAYGC 251 bp [65]

Reverse: Cor-RV TCRCAYTTDGGRTARTCCCA

a F, forward

b R, reverse

c Ref, reference

43

Table 2-5. GenBank accession numbers for Influenza A virus gene sequences

A/environment/Gainesville/12/2016(H1N1) genome segment# GenBank#

1 Polymerase PB2 (PB2) gene KY681470.1 2 Polymerase PB1 (PB1) gene and nonfunctional PB1-F2 protein

(PB1-F2) gene KY681471.1

3 Polymerase PA (PA) and PA-X protein (PA-X) genes KY681472.1 4 Hemagglutinin (HA) gene KY681473.1 5 Nucleocapsid protein (NP) gene KY681474.1 6 Neuraminidase (NA) gene KY681475.1 7 Matrix protein 2 (M2) and matrix protein 1 (M1) genes KY681476.1 8 Nuclear export protein (NEP) and nonstructural protein 1 (NS1)

genes KY681477.1

Table 2-6. Amino acid changes in the deduced HA of H1N1 isolated December 05,

2016.

H1N1 strain Amino acid positions in HA1

36 83 84 97 137 149 162 163 185 203

California/07/2009a K P S D P I S K S S

Gainesville/10/2013 . S N N . . . Q T T



Gainesville/07/2014 . S . N S . . Q T T



Gainesville/03/2014 . S . N S . . Q T T

Gainesville/05/2014 . S . N . . . Q T T

ENV/Gainesville/01/2014e N S N N . . . Q T T

Gainesville/01/2015 . S . N . V . Q T T

ENV/Gainesville/08/2015e . S . N . V . Q T T

Gainesville/04/2016 . S N N . . N Q T T




ENV/Gainesville/04/2016e . S N N . . N Q T T





44

Table 2-6. continued


216 225 226 256 266 273 283 317 321

California/07/2009a I G R A I H K G I

Gainesville/10/2013 . . . T . . E R V

Gainesville/09/2013 . . . T . R E . V


Gainesville/07/2014 . . . T . . E . V



Gainesville/03/2014 . . . T . . E . V


ENV/Gainesville/01/2014e . . . T . . E R V

Gainesville/01/2015 . . . T . . E . V

ENV/Gainesville/08/2015e . . . T . . E . V

Gainesville/04/2016 T . . T . . E . V




ENV/Gainesville/04/2016e T . . T V . E . V



ENV/Gainesville/01/2016e T . . T . . E . V

ENV/Gainesville/12/2016e T . . T . . E . V

45



4 47 124 172

California/07/2009a G E S E

Gainesville/10/2013 R K N K

Gainesville/09/2013 . K N K







ENV/Gainesville/01/2014e R K N K


ENV/Gainesville/08/2015e . K N K









ENV/Gainesville/12/2016e . K N K a 2015-2016 vaccine strain, dot (.) in each column represents the same amino acid as in the vaccine

strain. All strains were isolated from humans unless otherwise specified. e Environmental isolate.

46

Table 2-7. Amino acid changes in the deduced NA of H1N1 isolated December 05, 2016.

H1N1 strain Amino acid positions in NA

13 20 34 40 44 48 82 86 117 200

California/07/2009a V A I L N T S A I N

Gainesville/08/2013 . T . . S . P . . S



Gainesville/07/2014 . . V . S . . . . S

Gainesville/06/2014 . . V . S . P . . S

Gainesville/04/2014 . . V . S . . . . S

Gainesville/03/2014 . . V . S . P . . S


ENV/Gainesville/01/2014e . . V . S . P . . S

Gainesville/01/2015 . . V I S . . V M S

ENV/Gainesville/08/2015e . . V I S . . V M S

Gainesville/04/2016 I . V I S . . . . S




ENV/Gainesville/04/2016e I . V I S A . . . S



ENV/Gainesville/01/2016e I . V I S . . . . S

ENV/Gainesville/12/2016e I . V I S . . . . S

47



241 248 264 265 270 314

California/07/2009a V N V K N I

Gainesville/08/2013 I D . . . .








ENV/Gainesville/01/2014e I D . . . .


ENV/Gainesville/08/2015e I D . . . .

Gainesville/04/2016 I D I . K M



Gainesville/01/2016 I D I R K M

ENV/Gainesville/04/2016e I D I . K M





48



321 351 369 386 397 432 469

California/07/2009a I Y N N N K K

Gainesville/08/2013 V F K . K . .








ENV/Gainesville/01/2014e V F K . K . .

Gainesville/01/2015 V F K K . E .

ENV/Gainesville/08/2015e V F K K . E .









ENV/Gainesville/12/2016e V F K K . E N a 2015-2016 vaccine strain, dot (.) in each column represents the same amino acid as in the vaccine


49

Table 2-8. Amino acid changes in the deduced M proteins of H1N1 isolated December 05, 2016.

H1N1 strain M1 protein M2 protein

80 85 167 192 208 230 21 61

California/07/2009a V N T M Q K D R

Gainesville/10/2013 I N . V . R G .









ENV/Gainesville/08/2015e I N A V . R V .

Gainesville/04/2016 I N A V . R V .

Gainesville/03/2016 I N . V K R G .



ENV/Gainesville/04/2016e I N . V K R G .




ENV/Gainesville/12/2016e I N . V K R G K a 2015-2016 vaccine strain, dot (.) in each column represents the same amino acid as in the vaccine


50

CHAPTER 3 EVALUATION OF THE COLLECTION EFFICIENCY OF THE VIABLE VIRUS

AEROSOL SAMPLER IN A STUDENT HEALTH CARE CENTER

Introduction

The work detailed in this chapter was performed in collaboration with Maohua

Pan and C. Y. Wu. The virology aspects of the work were performed by Tania Bonny.

Airborne infectious agents in healthcare facilities pose risks to both patients and

employees. Nosocomial transmission of human influenza viruses is a major concern in

these healthcare facilities especially because immune-compromised patients that may

be present in those settings are at greater risk of getting infected and are more

vulnerable to the development of severe disease. As previously mentioned (Chapter 3),

transmission of influenza viruses from one person to another can occur in three routes:

direct contact of infectious secretions with mucus membranes of the upper respiratory

tract (URT), contact of virus-containing large droplet sprays with surfaces of the URT,

and inhalation of small aerosols and droplet nulcei [14, 23, 67]. A fourth route has been

shown in animal models: ocular infection, wherein airborne influenza viruses come into

contact with ocular surfaces [18]. The relative importance of each transmission route is

unknown and probably varies depending on virus strain, environmental conditions, etc.

[23]. Among them, the aerosol transmission mode is the most contentious one

especially with regard to: (a) economic reasons: expensive precautions would be

needed for implementation of appropriate infection control processes in health-care

settings, and (b) the fact that no clear evidence exists from which one can deduce from

lab experiment to real life and from animals to human beings [68]. If people can get

infected via aerosol transmission, N95 respirators rather than surgical masks will be

needed in addition to other interventions like increased air ventilation, isolation of

51

infected patients, and filtration system used for large droplets. Therefore, many efforts

are being expended to better understand the importance of the aerosol transmission

route of human influenza viruses. The same holds true for other human respiratory

viruses.

Previous air sampling studies for viruses were hindered by limitations in the air

sampling and detection methods available for airborne viruses (this dissertation,

Chapter 2). Samplers commonly used for virus sampling are designed for collecting

larger particles (those > 5 μm), such as fungal spores and bacteria, and are inefficient in

collecting nanoparticles (nanoparticles or nanomaterials are defined as substances with

at least one dimension that falls within 1-100 nm [69-70]). Furthermore, these samplers

were not designed to preserve the infectivity of the collected viruses. For example, the

commonly used SKC BioSampler has been shown to have less than 10% physical

collection efficiency for lab generated aerosols of MS2 bacteriophage [40] and less than

8.6% infectious collection efficiency for influenza H1N1 virus (2009) [46]. Polymerase

chain reaction (PCR) methods, which have been widely used for virus quantification,

provide a total count of the viral genomes (‘genome equivalents’), but do not

discriminate between genomes corresponding to viable vs non-viable viruses [71, 72].

These difficulties might account for the results of Lindsley et al. [41], wherein influenza

virus RNA was detected in 14 of the 30 test subjects yet infectious virus was isolated

from only 2. Therefore, it is hard to conclude whether the low infectious virus recovery

reported in the literature is meaningful or due to poor collection methodologies for

airborne viruses and/or inactivation of the viruses during the sampling process.

52

A recent study by Pan et al. introduced the “Viable virus aerosol sampler”

(VIVAS) [50]. The VIVAS uses a water-based condensation growth system [73], which

mimics what happens in human lungs on a cold day, targeting aerosolized particles

from 5 nm to more than 10 µm [73, 74]. Briefly, the system consists of eight parallel,

wet-walled growth tubes with four major components (Figure 3-1): the aerosol inlet,

conditioner, initiator and collector. The growth tubes operate on the same principle used

for the original water-based condensation particle counter (CPC) [74]. The conditioner

of each tube is held at 6C and serves to normalize the temperature and relative

humidity of the entering airflow [74]. The initiator is warmed to 45C to allow

condensation of the particles. Under these operating conditions, wettable particles enter

the conditioner at a total sample flow rate of 7-8 L/min. Through condensational growth,

particles as small as 5 nm amplify into droplets greater than 2µm in diameter [75]. The

outgoing flow is distributed among a set of 32 nozzles (0.66 mm diameter, 4

nozzles/growth tube, Figure 3-1) to minimize impaction stress and surface disruption.

The particles exit through the nozzles and gently impinge onto 1.5 mL of collection

medium contained in a 25 mm Petri dish.

In a previous study, VIVAS was used for the successful collection of laboratory-

generated virus aerosol, wherein the collection efficiency was more than 74% for viable

influenza H1N1 virus [46]. This high collection efficiency was attributed to the inherently

gentler impaction of the VIVAS, which preserves infectivity, as well as the high physical

collection efficiency due to the wide size range of airborne particles. For the work

described here, the efficiency of the VIVAS was evaluated for the collection of airborne

53

influenza and other respiratory viruses in a student health care center during the course

of a late onset influenza virus outbreak.


All procedures were reviewed and approved by the director of the student health

center. Approval by an institutional review board (IRB) was not necessary because

human subjects were not studied and could not be identified, and the sources of the

viruses detected could not be tracked.

Healthcare Facility

The healthcare facility of this work is the Student Health Care Center at UF

(Gainesville, Florida, USA). It is free-standing building that has its own heating,

ventilation, and air conditioning (HVAC) system. During the study, temperatures of the

indoor air were maintained at around 71°F (21.7°C) on the 1st floor and 73 °F (22.8°C)

on the 2nd floor, whereas the relative humidity ranged from 44% to 46% in both floors.

There were 4 – 6 air exchanges per hour.

Sampling Dates

Air samplings at the student health center were performed March 11, March 28

and April 8, 2016. During that time period, there was an outbreak of influenza in

Gainesville [76].

Aerosol Collection System

Ambient virus aerosol particles were collected using the VIVAS and an SKC

BioSampler. The collection system is schematically depicted in Figure 3-2. The VIVAS’

collection mechanism was previously described [77]; briefly, after passage through a

cool temperature condenser, the initiator (Figure 3-1) activates wettable particles as

small as 5 nm to form droplets greater than 2 µm in diameter. The enlarged particles are

54

subsequently directed through a set of 32 nozzles of 0.66-mm diameter for gentle

collection onto 1.5 mL of collection medium consisting of phosphate-buffered saline

(PBS) plus 0.5% (w/v) bovine serum albumin (BSA) fraction V in a 25 mm Petri dish in

the collector. The BioSampler is presently considered the reference air sampler for the

collection of aerosolized bacteria and fungi, and has been used in attempts to collect

virus aerosols, such as those described in [11, 78]. During its use, intake air is diverted

through three 0.63mm tangential nozzles above the collection medium, resulting in a

swirling airflow; this reduces impaction forces on particles that are deposited onto the

collection medium. The same collection medium for the VIVAS was used, but by

necessity the volume thereof in the BioSampler was 20mL. To avoid discrepancies of

virus concentration due to sampling location, the inlets of the VIVAS and the

BioSampler were bound together. Both the VIVAS and the BioSampler were operated at

a flow rate of 8 L/min, as this sampling rate was more effective for both air samplers for

the collection of virus aerosols and maintenance of the virus infectivity compared with

the standard flow rate of 12.5 L/min [43, 44]. To reduce noise, a Welch model 2014-B01

pump was used, and for further noise dampening, the pump was placed within a

covered box.

Air Sampler Placement

The layout of the study areas and their ceiling vents, and the air sampler

positions, are shown in Figure 3-3. The first sampling (March 11) was conducted in the

first floor lobby, near the student health care center receptionist’s desk. As the air was

sampled, it was observed that few people sat near the receptionist’s desk but many took

a drink at the fountain. During the second and third air samplings (March 28 and April

8), the air samplers were positioned within a waiting room on the second floor (Figure 3-

55

3). On both days, many patients exhibited signs of respiratory infection such as

coughing and sneezing. At both air sampling sites, the inlets of the air samplers were

set at a height of 1.2 m, oriented horizontal to the ground and facing the patients.

Negative control runs were also performed with a high-efficiency particulate air filter

installed at the inlet of the samplers. For each air sampler, a collection time of 60 min

was used to sample about 480 liters of air. Upon completion of air samplings, collection

medium in each sampler was aseptically transferred into sterile 50 mL conical

polypropylene tubes, transported in insulated ice box to the laboratory and stored at

-80C until further processing.

Virology Laboratory

Virology work was performed in the Lednicky biosafety level 2-enhanced

laboratory at the UF.

Air Sampler Collection Media Volume Reduction and Adjustment

To standardize volumes and obviate the need for large-scale cell cultures for

virus isolation attempts, air sampler collection media samples were concentrated using

Amicon Ultra-15 Centrifugal Filter Units with Ultracel-100 membranes with a molecular

weight cut-off of 100 kD (Millipore, Bedford, MA, USA) at 4000 × g for 20 minutes to a

volume of approximately 400m, the volumes adjusted to of 500 µm by addition of

collection medium, and the concentrate stored at −80°C until virus isolation in cell

cultures was attempted.

Cell Lines

For this pilot project, emphasis was on the isolation of influenza viruses and

genetic analyses thereof, but lesser efforts were nevertheless exerted to isolate other

56

common “culturable” human respiratory viruses to gain insights on the general utility of

the VIVAS for virus aerosols.

The term “culturable” refers to those viruses that can be isolated and propagated

using standard cell-lines/methods. In contrast, “non-culturable” respiratory viruses such

as Human coronavirus HKU1 can only be isolated and propagated in primary human

ciliated airway epithelial or similar complex and expensive cell systems. To favor

isolation of a wide variety of respiratory viruses, concentrated air sample collection

media was inoculated onto a variety of readily available (“standard”) cells lines. The

following cell lines, obtained from the American Type Culture Collection (ATCC), were

used for virus isolation attempts: A549 (CCL-185), HeLa (CCL-2), LLC-MK2 (CCL-7),

MDCK (CCL-34), MRC-5 (CCL-171), NCI-H292, and Vero E6 (CRL-1586). Common

human respiratory viruses that can be isolated using these cells are mentioned in Table

3-3. All the cell lines were propagated as monolayers at 37°C and 5% CO2 in Advanced

Dulbecco's Modified Eagle's Medium (aDMEM) or Eagle's Minimal Essential Medium

(EMEM) (Invitrogen, Carlsbad, CA, USA), as appropriate per cell line. Both aDMEM and

EMEM were supplemented with 2 mM L-Alanyl-L-Glutamine (GlutaMAX, Invitrogen,

Carlsbad, CA, USA.), antibiotics [PSN; 50 µg/ml penicillin, 50 µg/ml streptomycin, 100

µg/ml neomycin (Invitrogen, Carlsbad, CA, USA)], and 10% (v/v) low IgG, heat-

inactivated gamma-irradiated fetal bovine serum (HyClone, Logan, UT, USA). In

addition, EMEM was also supplemented with sodium pyruvate (Invitrogen Corp.) and

non-essential amino acids (Hyclone, Logan, UT, USA). Prior to the preparation of seed

stocks, each cell line was treated for 3 weeks with plasmocin and verified free of

mycoplasma DNA by PCR [79].

57

Cell Culture Media Formulations for Virus Isolation

Some respiratory viruses such as Influenza A viruses and various

paramyxoviruses are easiest to propagate in the presence of trypsin or similar protease

in the cell culture medium. However, FBS has a trypsin inhibitor, and cell lines vary in

their susceptibility to trypsin levels. Therefore, for the isolation and propagation of

viruses that require trypsin, FBS is typically omitted when possible and the

concentration of trypsin adjusted as needed per cell line. For this work, ten

combinations of cells and culture condition were used: Six cell lines in complete cell

growth medium plus serum (A549, HeLa, LLC-MK2, MDCK, MRC-5, NCI-H292, and

Vero E6), and four cell lines in serum-free media plus L-1-tosylamido-2-phenylethyl

chloromethyl ketone (TPCK)-treated mycoplasma- and extraneous virus-free trypsin

(Worthington Biochemical Company, Lakewood, NJ). TPCK-treated trypsin

concentrations were: 0.1 µg/ml for A549, LLC-MK2, and Vero cells, and 2.0 µg/ml for

MDCK cells.

Inoculation, Maintenance, and Observation of Cell Cultures

After thawing on ice, equal aliquots (~ 50 µl) of the archived concentrated air

sampler collection media were inoculated directly without pre-filtration onto newly

confluent cells in 6-well plates. Importantly, pre-filtration through a 0.45 µm pore-size, as

practiced by many to remove bacterial and fungal contaminants and particulates, was

not performed. This is because some human respiratory viruses are pleomorphic and/or

filamentous (such as wild-type human influenza A viruses), with lengths that exceed

0.45 µm, and these can be trapped by the filters. The inoculated cells were incubated

at 35°C, and observed daily for signs of virus-induced cytopathic effects (CPE), with re-

feeds performed every 3 days. Non-infected cells were maintained and re-fed in parallel

58

for comparison. Cells were maintained and observed for a total of 30 days before being

considered negative for virus isolation. In the event the virus that any of the cultures

were contaminated by yeast or filamentous fungi, amphotericin B (Fungizone,

Invitrogen) was available as a cell culture medium supplement, as needed.

Identification of Human Respiratory Viruses

Viruses were identified by cell tropism (Table 3-3), type of CPE they induced, use

of the GenMark Respiratory Virus Panel, solid phase ELISA for influenza A and B

viruses, group and/or virus species-specific PCR/RT-PCR, and sequencing of virus-

specific PCR amplicons or complete virus genomes.

GenMark Respiratory Virus Panel

The GenMark Dx multiplex PCR eSensor XT-8 Respiratory Viral Panel (eSensor

RVP; GenMark Diagnostics, Inc., Carlsbad, CA, USA) was used to screen spent cell

growth media for the genomic DNA or RNA of respiratory viruses according to the

manufacturer’s instructions. This detects the genomic material of influenza A virus

(including subtypes H1 and H3), influenza A virus 2009 H1N1, influenza B virus,

respiratory syncytial viruses A and B, parainfluenza viruses 1, 2, 3, and 4, human

metapneumovirus, adenoviruses B/E and C, coronaviruses (229E, -NL63, -HKU1,

-OC43), and human rhinoviruses A and B. Briefly, in the case of viral genomic RNA

(vRNA), the extracted nucleic acid is reverse transcribed and amplified using viral

specific primers with an RT‐PCR enzyme mix. The amplified DNA is converted to single‐

stranded DNA via exonuclease digestion and is combined with a signal buffer

containing ferrocene‐labeled signal probes that are specific for the different viral targets.

59

A signal in nanoAmperes (nA) is provided; signals higher than a threshold value is

considered positive.

Rapid Detection of Influenza A and B Viruses in Cell Cultures

A commercial solid phase ELISA test (QuickVue influenza A and B kit, Quidel

Corp., San Diego, CA, USA) was used following the manufacturer’s instructions to

quickly detect influenza virus in the spent media of cell cultures that exhibited typical

influenza virus-induced CPE (i.e., formation of visible changes in the appearance of the

nuclei of infected cells together with the formation of focal enlarged granular cells or

non-specific cell deterioration, followed by detachment of the swollen cells from the

growth surface) The ELISA test did not distinguish between influenza A virus types H1

and H3.

Identification of Influenza Virus Types and Subtypes and Genomic Sequencing

After detection of virus using the QuickVue influenza A and B kit and the

GenMark system, vRNA was purified from the virus particles in spent MDCK cell growth

media, and preliminary analyses performed by RT-PCR using the primers given in

Table 3-4 to establish virus type and subtype. Sequencing of influenza A virus genomic

segments 4 [hemagglutinin (HA) gene], 6 [neuraminidase (NA) gene], and 7 [matrix (M2

and M1) genes], and influenza B virus segments 4 [HA gene], 6 [NB glycoprotein (NB)

and NA genes], and 7 [matrix protein 1 (M1) and 2 (M2) genes] was accomplished

following previously [80, 81] described methods.

Identification of Respiratory Syncytial Virus Subtype A (RSV-A)

Both RSV subtypes A and B induce the formation of syncytia in LLC-MK2 and

Vero E6 cells, and to a lesser extent, in A549 cells. In general, the RSV-induced CPE

are first detected in LLC-MK2 cells, then in Vero E6, and lastly in A549 cells, regardless

60

of the presence or absence of trypsin. However, syncytia are generally observed earlier

in RSV-infected cell cultures in the presence of trypsin. Since many viruses induce the

formation of syncytia, confirmation through additional tests is required. The syncytium-

forming viruses were identified as RSV-A by analyses of vRNA purified 12 days post-

infection from virus particles in the spent-cell growth media of TPCK-containing LLC-

MK2 cells using the GenMark system, and by RT-PCR followed by sequencing of the

PCR amplicons. Weak 80-bp amplicons specific for RSV-A resulted when RT-PCR was

performed using forward primer RSA-U1137; 5’-AGATCAACTTCTGTCATCCAGCAA-3’

and reverse primer RSB-L1192 5’-GCACATCATAATTAGGAGTATCAAT-3’ [62], which

target the RSV-A nucleoprotein (N) gene but were optimized for older RSV-A strains,

suggesting these primers were not necessarily ideal for contemporary RSV-A strains in

the USA. To compensate for nucleotide changes in contemporary RSV-A strains in the

USA, the primers were slightly modified as: RSA-U1137-mod; 5’-

AGATCAACTTCTATCATCCAGCAA-3’ and RSB-L1192-mod: 5’-

AGCACATCATAATTAGGAGTGTCAAT-3’, and this improved RT-PCR detection,

resulting in the formation of robust 81-bp amplicons. The entire 81-bp amplicon

sequence was obtained by first re-amplifying a longer version (129 bp) with flanking

primers RSV-81 Forward: 5’-CAAGTTGAATGATACACTCAACAA-3’, and RSV-81

Reverse: 5’- AGAAACACATTAATAAGTTATGTG-3’, followed by sequencing to obtain

non-ambiguous reads of the internal 81-bp target sequence. In contrast, primers for the

detection of RSV-B [62] did not amplify a specific amplicon. Since short viral genomic

sequences are not very informative, a longer (660-bp) RSV-A genomic sequence

surrounding the 81-bp amplicon was therefore amplified and sequenced using primers

61

RSV-A NS2-N For: 5’-. CATGATGGGTTCTTAGAATGC-3’ and RSV-A NS2-N Rev: 5’-

CTGGAGCCACCTCTCCCATTTC-3’, and the 617-bp internal sequence thereof

determined.

Identification of Miscellaneous Respiratory Viruses

Adenovirus C (type 5), human parainfluenza viruses -2, -3, and -4a, and human

coronaviruses 229E and NL63, and human metapneumovirus were identified using the

GenMark system and by published PCR-based methods (Table 2-4; 62-65).

Results

Isolation and Identification of Viable Viruses in Aerosols Collected March 11, 2016

Viable human respiratory viruses were recovered by the VIVAS and the

BioSampler in each of three separate air sampling intervals performed on March 11, but

not in control runs performed with HEPA-filtered VIVAS and BioSampler air intakes

(Table 3-1). Cytopathic effects consistent with those caused by influenza viruses were

observed in MDCK cells beginning 6 days post-inoculation (p.i.), suggesting the

possibility that influenza A or B virus (or both) had been isolated (Figure 3-4).

Moreover, syncytia consistent with those expected for human respiratory syncytial virus

(RSV) were also observed in A549, LLC-MK2, and Vero cells regardless of trypsin

content but were much more pronounced and easiest to detect in the cells in serum-free

cell growth medium with added TPCK-trypsin. The syncytia became evident beginning 8

days post-inoculation of the LLC-MK2 cells with trypsin, and 10 days later in trypsin-free

LLC-MK2 cells. In contrast, no CPE were observed in mock-inoculated cells or in control

runs with HEPA-filtered samplers. Though the onset varied according to sampling

interval, in each case, the CPE were observed first in cells inoculated with collection

media from the VIVAS.

62

Solid-phase ELISA tests indicated that both influenza A and B viruses had been

isolated (Figure 3-5). Remarkably, RT-PCR indicated that influenza A subtypes H1 and

H3 had been isolated, as well as Victoria-lineage influenza B virus. Similarly, RSV-A

was identified in some of the cell cultures. The viruses detected per sampling interval

are listed in Table 3-1; GenBank accession #s for the influenza virus sequences are

listed in Table 3-5 and those of RSV-A in Table 3-6.

Whereas rare nucleotide sequence differences were noted between the influenza

H1N1 virus isolates, the genetic changes were silent, and the deduced HA, NA, and M1

and M2 amino acid sequences were conserved. These analyses revealed the H1N1

viruses belonged to HA subclade 6B.1 based on criteria mentioned in reference [82];

the results are presented in Table 3-7 relative to those of reference strains and other

recent local H1N1 viruses we isolated from humans or from other air samplings in other

studies. Amino acid substitutions were also evident in the NA protein (Table 3-8), and M

proteins (Table 3-9). Similar analyses performed as outlined in ref. [81] indicated that

the influenza H3N2 viruses belonged to HA clade subclade 3C.2a. These viruses have

amino acid changes at major immunogenic epitopes of the HA protein (Table 3-10) and

NA proteins (Table 3-11) relative to the vaccine strain. Finally, the influenza virus B

strains were all Victoria lineage (clade 1A) viruses, and as discussed in ref. [83], contain

amino acid substitutions N129D, V146I, and I117V.

The RSV-A sequences were alike for the four isolates, and were identical to

those reported for contemporary RSV-A in circulation in the USA.

63

Isolation and Identification of Viable Viruses Collected in Aerosols on March 28, 2016

A larger assortment of human respiratory viruses was isolated in air samplings

performed March 28, 2016 (Table 3-2). A GenMark read-out for one of the mixed

influenza A and B virus samples is shown in Figure 3-6. Examples of cell cultures

depicting virus-induced CPE are given in Figures 3-7 & 3-8. Sequencing of the

influenza viruses revealed that once again, H1N1 clade 6B.1, H3N2 clade 3C.2a, and

Victoria-lineage influenza B viruses had been isolated, as had been isolated during the

March 11, 2016 air samplings. The RSV-A sequences were identical to those of the

RSV-A sequences from March 11. As this project was originally designed to answer

whether influenza virus aerosols could be detected in the student healthcare center, the

other viruses were not sequenced after they were identified based on a combination of

diagnostic PCR or RT-PCR and GenMark analyses.

Isolation of Only One Type of Viable Virus from Aerosols on April 8, 2016.

Unlike the results of the first two air sampling studies, neither influenza viruses

nor RSV-A were isolated during the final air sampling studies at the student health care

center. Instead, only one cell culture was positive for human metapneumovirus subtype

A. Moreover, the virus was isolated from only one sample collected using the VIVAS

that had been inoculated onto LLC-MK2 cells in serum-free media with trypsin, and

required > 10 days incubation before CPE were formed in the infected cells.

Discussion

We evaluated the virus aerosol collection capabilities of a novel air sampler

(VIVAS) and a standard air sampler (BioSampler) in a student infirmary center during a

late onset influenza outbreak that spanned mid-February to early April, 2016. The

64

experiments were performed three times a day on three separate days. In the first

experiment (March 11, 2016), infectious influenza A H1N1 and H3N2 and influenza B

viruses and RSV were present in the collection media of the VIVAS in 3/3 air sampling

intervals, but not in all of the BioSampler samples (Table 3-1). In the second

experiment (March 28, 2016), influenza A and B viruses and RSV were collected by

both air samplers at each air sampling interval (Table 3-2), though it was noted that

influenza virus specific CPE were detected earlier in MDCK cells inoculated with VIVAS

collection media. No influenza viruses and RSV were collected in the third experiment

(April 8, 2016). Other human respiratory viruses were also collected in the second

experiment (Table 3-2), whereas human metapneumovirus was detected in one sample

collected using the VIVAS in the third experiment.

In previous studies, the VIVAS and similar devices were compared to the

BioSampler for the collection of virus-containing particles from below 100 nm to larger

than 10m [77, 84]. In those studies, the VIVAS outperformed the BioSampler at the

collection of lab-generated influenza virus and bacteriophage MS2 aerosols due to

gentle impaction and the amplification results [46, 76, 77]. Results from this study

indicates that the VIVAS is better than the BioSampler for the collection of virus

aerosols and preservation of virus viability than the BioSampler in the ambient

environment. Possible reasons might be: (1) the gentler impaction of the VIVAS is less

damaging to viruses during the collection process, and (2) the VIVAS has a higher

physical collection efficiency than the BioSampler for particles as small as 10 nm due to

the amplification results.

65

Apart from choice of a proper sampling location, the presence of an “emitting

source” favors successful detection of an agent being tested for. In our experiments, the

location chosen was a student infirmary, the agent was influenza A or B virus, and the

emitting source would be a person with an active respiratory infection who was

coughing and/or sneezing. Our findings were consistent with the previously mentioned

items, and information regarding the late onset influenza season of 2016 provided by

the State of Florida Department of Health [76] and reinforces the notion that successful

detection of virus aerosols favors location (i.e., virus aerosols should be highest at

enclosed sites with numerous sick persons) and timing of tests (i.e., the likelihood of

finding virus aerosols is higher during outbreaks of respiratory infection). For example,

in three sets of air samplings performed on three different days after the influenza

outbreak (Aug 19. and 26, and Sept. 9, 2016) at a small classroom one of the UF

engineering buildings (Black Hall), no viable respiratory viruses were isolated.

Various studies indicate that in temperate countries, influenza outbreaks typically

occur in the late fall or early winter, when it is cold and the humidity low [85, 86]. The

late onset influenza outbreak of 2016 occurred spanned February to about the

beginning of April. It is thus likely that influenza viruses were not collected April 8, as the

outbreak had been declared over, and few students sought medical treatment for

respiratory infections that day. In contrast, the influenza season was near peak levels

from March 6 – 12 [87], and influenza viruses were isolated in our air samplings on

March 11 and 28.

Viral genomic sequence analyses indicated that influenza H1N1 viruses were

from the pandemic H1N1 year 2009 lineage [A(H1N1)pdm09]. However, unlike

66

Influenza virus A/California/07/2009(pdmH1N1), which is defined as pdm09 HA clade 1,

and was used in the northern hemisphere influenza virus vaccines of 2015-2016, the

viruses isolated in this work were from pdm09 HA clade 6B.1. The signature amino acid

substitutions that define subgroup 6B viruses are D97N, S185T, and A256T in HA1, and

E47K S124N in HA2. Additional variations that had been observed in year 2016 include

S162K, D168N, K170E, R205K, A215G, E235D. As of February 2016, the

pdmH1N1(09) viruses in all European Union/European Economic Area countries had

additional substitutions K163Q, A256T and K283E in HA1 and E172K in HA2, and

newer strains also had P83S and I321V substitutions as well in HA1[88]. The situation

in North America was similar. Whereas various virus clusters emerged within clade 6B,

two dominant subclades, 6B.1 and 6B.2, were in wide circulation. Viruses in subclade

6B.1 have HA1 amino acid substitutions S84N, S162N (which results in the formation of

a new potential glycosylation motif at residues 162-164 of HA1), and I216T. Subclade

6B.2 viruses have HA1 amino acid substitutions V152T and V173I [88-90]. As shown in

Table 3-7, there were changes at key amino acid positions of the HA protein of the

H1N1 viruses of this work relative to the vaccine strain, and the same changes were

observed in H1N1 strains from the same time period that had been isolated from

humans. Importantly, changes also occurred in the amino acid sequence of the NA

protein (Table 3-8) and M protein (Table 3-9). Similarly, seven genetic groups based on

the HA gene have been defined for A(H3N2) viruses since 2009, and contemporary

H3N2 viruses belong to clade 3C, which has three subdivisions: 3C.1, 3C.2, and 3C.3.

The virus strain of the 2015-2016 northern hemisphere vaccine was

A/Texas/50/2012(H3N2), which is an HA subclade 3C.1 virus. Subclade 3C.2a viruses

67

have been dominant worldwide as of May 2016. The HA protein of 3C.2 contain amino

acid substitutions N145S in HA1 and D160N in HA2, whereas subclade 3C.2a contain

the following amino acid substitutions at the major antigenic epitopes of HA1: N144S

(resulting in loss of a potential glycosylation site), N145S, F159Y, K160T (in the majority

of viruses, resulting in the gain of a potential glycosylation site), N225D. Subclade

3C.2a viruses also contain (at other epitopes) L3I and Q311H in HA1, and D160N in

HA2 [81, 88]. The H3N2 viruses of this work were HA subclade 3C.2a (Table 3-10), and

also had amino acid changes in their NA protein (Table 3-11). Finally, the influenza B

viruses were Victoria-lineage, whereas the commonly used influenza trivalent vaccine of

2015 – 2016 had a Yamagata-lineage strain. Given that the UF has a highly-vaccinated

student and worker population, these findings raise the question whether some/most of

the influenza virus vaccines that had been used for the 2015-2016 season were not a

good match for the influenza viruses in circulation in early 2016 in Florida.

There are some limitations to this pilot study. First, the VIVAS and the

BioSampler were used to collect virus aerosols, but particle sizes were not determined.

It is well-known that respiratory viruses can be present in different-sized airborne

particles, and in particular, that influenza A virus can be detected in coughs and

exhalations. Some of the influenza viruses are found in particle sizes termed “fine”

particles, which stay airborne much longer than larger particles and can travel much

longer distances, though the importance of these in virus transmission remains

controversial [11, 71, 91, 92]. In this study, the VIVAS and the BioSampler were located

at least 2.0 m from seated patients, and viable (infectious) influenza A and B viruses

were isolated. Other respiratory viruses were also isolated, suggesting that patients

68

with other types of respiratory viruses also produce small particle aerosols that contain

infectious viruses. Future studies should consider particle size characterization for

better identification of the possible effects of exposure to virus and their deposition in

the respiratory tract. Second, only two locations at the healthcare facility were tested for

this study and the sample size is small. Further studies sampling more locations and

more times would be useful in quantifying the ability of the VIVAS in sampling different

kinds of infectious viruses compared with the BioSampler.

This study suggests that the VIVAS performs well for the collection of virus

aerosols and the preservation of virus viability. An additional benefit is that virus

aerosols are collected onto a small volume of collection medium, and that simplifies

downstream operations, including storage, transport, and virus isolation.

69

Figure 3-1. Schematic diagram of viable virus aerosol sampler (VIVAS): a) The entire VIVAS system with its individual components, b) A set of 32 distribution nozzles and c) impingement of droplets onto a collection medium in a Petri dish. [Figure adapted from Pan et al. (77)]

70

Figure 3-2. Schematic diagram of the testing system

71

Figure 3-3. Schematic layout of the student infirmary lobby. Top: first floor, bottom: second floor.

72

Figure 3-4. MDCK cells in serum-free cell culture medium plus trypsin. A) Non-infected (“mock-infected”) MDCK cells, 8 days post-seed; the cell monolayer is intact and crowded. B) MDCK cells inoculated with collection media from the VIVAS, sampling interval # 1, March 11, 2016. Numerous rounded floating dead cells and large emptied areas of the growing surface are visible. Images were taken at a magnification of 400X.

73

Figure 3-5. Solid-phase ELISA tests. A negative control reaction is shown in the left

panel, whereas influenza A and B antigens have been detected in cell culture media taken from MDCK cells inoculated with collection medium from VIVAS sampling interval # 2, March 11, 2016.

74

Figure 3-6. Representative GenMark RVP report of MDCK cells inoculated with collection medium from VIVAS sampling interval # 2, March 28, 2016. Positive detection of the genomic RNA of influenza pandemic 2009 H1, H3, and B viruses is shown. Other respiratory viruses were either not isolated, or were inhibited by influenza viruses (or out-competed by the influenza viruses) in these cells.

75

Figure 3-7. MRC-5 and A549 cells in serum-free cell culture medium plus trypsin. A)

Non-infected (“mock-infected”) MRC-5, 12 days post-seed; the cell monolayer is intact and crowded. MRC-5 cells inoculated with collection media from the B) BioSampler and C) VIVAS, sampling interval #3, March 28, 2016; 12 days post infection (pi). D) Non-infected (“mock-infected”) A549, 12 days post-seed. A549 cells inoculated with collection media from the E) BioSampler and F) VIVAS, sampling interval #3, March 28, 2016; 12 days pi. Images were taken at a magnification of 400X.

76

Figure 3-8. VERO E6 and LLC-MK2 cells in serum-free cell culture medium plus trypsin. A) Non-infected (“mock-infected”) VERO E6, 12 days post-seed; the cell monolayer is intact and crowded. VERO E6 cells inoculated with collection media from the B) BioSampler and C) VIVAS, sampling interval #1, March 28, 2016; 12 days post infection (pi). D) Non-infected (“mock-infected”) LLC-MK2, 12 days post-seed. LLC-MK2 cells inoculated with collection media from the E) BioSampler and F) VIVAS, sampling interval #2, March 28, 2016; 12 days pi. Images were taken at a magnification of 400X.

77

Table 3-1. Viable viruses in aerosols collected on March 11, 2016.

Virus isolated Sampling interval

HEPA filter

Air sampler Influenza A H1N1

Influenza A H3N2

Influenza B Victoria

RSV-A

1 - BioSampler +

- VIVAS + + + + 2 + BioSampler

+ VIVAS 3 - BioSampler +


+ VIVAS 5 - BioSampler +


+ VIVAS

Table 3-2. Viable viruses in aerosols collected on March 28, 2016.


HEPA filter

Air sampler AdV CoV-229E CoV- NL63

IFV A H1N1

IFV A H3N2

1 - BioSampler + + + + - VIVAS + + + + 2 + BioSampler + VIVAS 3 - BioSampler + + + + + - VIVAS + + + + + 4 + BioSampler + VIVAS 5 - BioSampler + + + + - VIVAS + + + + + 6 + BioSampler + VIVAS

78



HEPA filter

Air sampler IFV B HPIV-2 HPIV-3 HPIV-4a RSV-A

1 - BioSampler + + + +

- VIVAS + + + + +

2 + BioSampler

+ VIVAS


- VIVAS + + + +

4 + BioSampler

+ VIVAS


- VIVAS + + + +

6 + BioSampler

+ VIVAS

aAdV, adenovirus; CoV, coronavirus; IFV, Influenza virus; HPIV, human parainfluenza virus; RSV,

respiratory syncytial virus.

79

Table 3-3. Cell lines used for the isolation of common culturable human respiratory viruses.

Human Respiratory Virus

Cell lines MDCK (NBL2)

HeLa A549 MRC-5 VERO E6

LLC-MK2

Adenoviruses Some + ++a + + Coronavirus 229E ++ ++ ++ + Coronavirus NL63 +/-a + ++ Coronavirus OC43 ++ Influenza A and B viruses ++b Some + + Metapneumovirus + ++ Parainfluenzavirus 1 +/- + ++ Parainfluenzavirus 2 + +/- + ++ Parainfluenzavirus 3 + + + ++ Parainfluenzavirus 4a +/- +/- + ++ Parainfluenzavirus 4b + ++ Respiratory syncytial virus A + + +/- ++ ++ Respiratory syncytial virus B +/- ++ ++

Pic

orn

aviru

s g

roup Coxsackievirus A + +

Coxsackievirus B +/- ++ ++ + ++ ++

Echovirus + +/- ++ + ++ Enterovirus (most) ++ ++ + ++ Enterovirus 71 + ++ + ++ Enterovirus D68 ++ + +/- + Parechovirus ++ + Rhinovirus A, B + + ++ + +

a+/-; cell line supports replication of some virus strains.

b++; cell line supports virus replication.

80

Table 3-4. Primers for the detection of and subtyping of influenza A and B viruses. Influenza virus Type/subtype

Gene fragment

Primer Sequence (5’ – 3’) Amplicon size (bp)

Reference

Influenza A All genes Uni12W AGCRAAAGCAGG [58]

A(H1N1)2009

HA-5’(H1) HKU-SWF GAGCTCAGTGTCATC

ATTTGAA

173

[59]

HKU-SWR

TGCTGAGCTTTGGGTATGAA

[59]

UFH1-JLR GGTTGAGCTTTGGGTATGAA

J. Lednickya

NA-3’(N1) N1F401 GGAATGCAGAACCTT

CTTCTTGAC 1073

[59]


[59]

All genes Uni R AGTAGAAACAAGG [58]

A(H3N2)

HA-3’(H3) H3A1F3 TGCATCACTCCAAATG

GAAGCATT 863

[59]

HARUc ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT

[59]

NA-3’(N2) N2F387 CATGCGATCCTGACA

AGTGTTATC 1082

[59]


[59]

B Victoria lineage

HA Bvf224 ACATACCCTCGGCAA

GAGTTTC 284

[59]

Bvr507 TGCTGTTTTGTTGTTGTCGTTTT

[59]

B Yamagata lineage

HA Byf226 ACACCTTCTGCGAAA

GCTTCA 388

[59]

Byr613 CATAGAGGTTCTTCATTTGGGTTT

[59]

aJ. Lednicky, unpublished.

81

Table 3-5. GenBank accession numbers for Influenza A and B virus sequences, March 11, 2016.

Virus GenBank accession numbers

Hemagglutinin gene

NB and/or Neuraminidase genes

Matrix genes

A/envr/GNVL/01/2016(H3N2) KX398081.1 KX398084.1 KX398087.1 A/envr/GNVL/02/2016(H3N2) KX398082.1 KX398085.1 KX398088.1 A/envr/GNVL/03/2016(H3N2) KX398083.1 KX398086.1 KX398089.1 A/envr/GNVL/01/2016(H1N1) KX398060.1 KX398064.1 KX398068.1 A/envr/GNVL/02/2016(H1N1) KX398061.1 KX398065.1 KX398069.1 A/envr/GNVL/03/2016(H1N1) KX398062.1 KX398066.1 KX398070.1 A/envr/GNVL/04/2016(H1N1) KX398063.1 KX398067.1 KX398071.1 B/envr/GNVL/01/2016 KX398072.1 KX398075.1 KX398078.1 B/envr/GNVL/02/2016 KX398073.1 KX398076.1 KX398079.1 B/envr/GNVL/03/2016 KX398074.1 KX398077.1 KX398080.1

Table 3-6. GenBank accession numbers for RSV-A NS2 and N gene partial cds

sequences.

Virus GenBank accession numbers

RSVA/Environmental Air/Gainesville/UF-1/2016 KX431988.1 RSVA/Environmental Air/Gainesville/UF-2/2016 KX431989.1 RSVA/Environmental Air/Gainesville/UF-3/2016 KX431990.1 RSVA/Environmental Air/Gainesville/UF-4/2016 KX431991.1

82

Table 3-7. Amino acid substitutions in the HA protein of H1N1 viruses from March 11, 2016.

H1N1 Clade Strain Isolation Source

Key amino acid positions in HA1

83 84 97 162

1 California/07/2009 Human P S D S 6 St. Petersburg/27/2011 Human S S D S 6A (subclade) HongKong/5659/2012 Human S S N S 6C (subclade) Massachusetts/10/2013 Human S S N S 6B (subclade) South Africa/3626/2013 Human S S S S 6B GNVL/08/2013 Human S S N S 6B GNVL/07/2014 Human S S N S 6B ENVR/GNVL/08/2015 Environment S S N S 6B ENVR/GNVL/12/2015 Environment S S N S 6B GNVL/01/2015 Human S S N S 6B.1 GNVL/01/2016 Human S N N N 6B.1 GNVL/02/2016 Human S N N N 6B.1 GNVL/03/2016 Human S N N N 6B.1 GNVL/04/2016 Human S N N N 6B.1 ENVR/GNVL/1/2016 Environment S N N N 6B.1 ENVR/GNVL/2/2016 Environment S N N N 6B.1 ENVR/GNVL/3/2016 Environment S N N N 6B.1 ENVR/GNVL/4/2016 Environment S N N N

83




163 185 203 216

1 California/07/2009 Human K S S I 6 St. Petersburg/27/2011 Human K S T I 6A (subclade) HongKong/5659/2012 Human K T T I 6C (subclade) Massachusetts/10/2013 Human N S T I 6B (subclade) South Africa/3626/2013 Human Q T T I 6B GNVL/08/2013 Human Q T T I 6B GNVL/07/2014 Human Q T T I 6B ENVR/GNVL/08/2015 Environment Q T T I 6B ENVR/GNVL/12/2015 Environment Q T T I 6B GNVL/01/2015 Human Q T T I 6B.1 GNVL/01/2016 Human Q T T T 6B.1 GNVL/02/2016 Human Q T T T 6B.1 GNVL/03/2016 Human Q T T T 6B.1 GNVL/04/2016 Human Q T T T 6B.1 ENVR/GNVL/1/2016 Environment Q T T T 6B.1 ENVR/GNVL/2/2016 Environment Q T T T 6B.1 ENVR/GNVL/3/2016 Environment Q T T T 6B.1 ENVR/GNVL/4/2016 Environment Q T T T

84




225 226 256 283

1 California/07/2009 Human G R A K 6 St. Petersburg/27/2011 Human G R A K 6A (subclade) HongKong/5659/2012 Human G R A K 6C (subclade) Massachusetts/10/2013 Human G R A E 6B (subclade) South Africa/3626/2013 Human G R T E 6B GNVL/08/2013 Human G R T E 6B GNVL/07/2014 Human G R T E 6B ENVR/GNVL/08/2015 Environment G R T E 6B ENVR/GNVL/12/2015 Environment G R T E 6B GNVL/01/2015 Human G R T E 6B.1 GNVL/01/2016 Human G R T E 6B.1 GNVL/02/2016 Human G R T E 6B.1 GNVL/03/2016 Human G R T E 6B.1 GNVL/04/2016 Human G R T E 6B.1 ENVR/GNVL/1/2016 Environment G R T E 6B.1 ENVR/GNVL/2/2016 Environment G R T E 6B.1 ENVR/GNVL/3/2016 Environment G R T E 6B.1 ENVR/GNVL/4/2016 Environment G R T E




47 124 172

1 California/07/2009 Human E S E 6 St. Petersburg/27/2011 Human K S E 6A (subclade) HongKong/5659/2012 Human K N E 6C (subclade) Massachusetts/10/2013 Human K N K 6B (subclade) South Africa/3626/2013 Human K N K 6B GNVL/08/2013 Human K N K 6B GNVL/07/2014 Human K N K 6B ENVR/GNVL/08/2015 Environment K N K 6B ENVR/GNVL/12/2015 Environment K N K 6B GNVL/01/2015 Human K N K 6B.1 GNVL/01/2016 Human K N K 6B.1 GNVL/02/2016 Human K N K 6B.1 GNVL/03/2016 Human K N K 6B.1 GNVL/04/2016 Human K N K 6B.1 ENVR/GNVL/1/2016 Environment K N K 6B.1 ENVR/GNVL/2/2016 Environment K N K 6B.1 ENVR/GNVL/3/2016 Environment K N K 6B.1 ENVR/GNVL/4/2016 Environment K N K

85

Table 3-8. Amino acid changes in the deduced NA of H1N1 isolated March 11.

Strain Key amino acid positions in NA

13 19 20 34 40 44 82 86

California/07/2009 V M A I L N S A St. Petersburg/27/2011 V M A I L N S A HongKong/5659/2012 V A A I L N S A Massachusetts/10/2013 V M A I L S S A South Africa/3626/2013 V M A V L N S A GNVL/08/2013 V M T I L S P A GNVL/07/2014 V M A V L S S A ENVR/GNVL/08/2015 V M A V I S S V ENVR/GNVL/12/2015 V M A V I S S V GNVL/01/2015 V M A V I S S V GNVL/01/2016 I M A V I S S A GNVL/02/2016 I M A V I S S A GNVL/03/2016 I M A V I S S A GNVL/04/2016 I M A V I S S A ENVR/GNVL/1/2016 I M A V I S S A ENVR/GNVL/2/2016 I M A V I S S A ENVR/GNVL/3/2016 I M A V I S S A ENVR/GNVL/4/2016 I M A V I S S A


Strain Key amino acid positions in NA 106 117 126 200 241 248 264 265

California/07/2009 V I P N V N V K St. Petersburg/27/2011 I I P N I D V K HongKong/5659/2012 I I P N I D V K Massachusetts/10/2013 V I L S I D V K South Africa/3626/2013 V I P S I D V K GNVL/08/2013 V I P S I D V K GNVL/07/2014 V I P S I D V K ENVR/GNVL/08/2015 V M P S I D V K ENVR/GNVL/12/2015 V M P S I D V K GNVL/01/2015 V M P S I D V K GNVL/01/2016 V I P S I D I R GNVL/02/2016 V I P S I D I R GNVL/03/2016 V I P S I D I R GNVL/04/2016 V I P S I D I R ENVR/GNVL/1/2016 V I P S I D I R ENVR/GNVL/2/2016 V I P S I D I R ENVR/GNVL/3/2016 V I P S I D I R ENVR/GNVL/4/2016 V I P S I D I R

86


Strain Key amino acid positions in NA

270 314 321 369 386 397 432 451

California/07/2009 N I I N N N K D St. Petersburg/27/2011 N I I K N N K D HongKong/5659/2012 N I I K S N K G Massachusetts/10/2013 N I I K N N K D South Africa/3626/2013 N I V K N N K D GNVL/08/2013 N I V K N K K D GNVL/07/2014 N I V K K N K D ENVR/GNVL/08/2015 N I V K K N E D ENVR/GNVL/12/2015 N I V K K N E D GNVL/01/2015 N I V K K N E D GNVL/01/2016 K M V K K N E D GNVL/02/2016 K M V K K N E D GNVL/03/2016 K M V K K N E D GNVL/04/2016 K M V K K N E D ENVR/GNVL/1/2016 K M V K K N E D ENVR/GNVL/2/2016 K M V K K N E D ENVR/GNVL/3/2016 K M V K K N E D ENVR/GNVL/4/2016 K M V K K N E D

87

Table 3-9. Amino acid changes in the deduced M proteins of H1N1 from March 11,

2016.


M1 protein

80 85 167 192

1 California/07/2009 Human V N T M 6* St. Petersburg/27/2011 Human 6A (subclade) HongKong/5659/2012 Human I N T M 6C (subclade) Massachusetts/10/2013 Human I S T V 6B (subclade) South Africa/3626/2013 Human I N T V 6B GNVL/08/2013 Human I N T V 6B GNVL/07/2014 Human I N T V 6B ENVR/GNVL/08/2015 Environment I N A V 6B ENVR/GNVL/12/2015 Environment I N A V 6B GNVL/01/2015 Human I N A V 6B.1 GNVL/01/2016 Human I N T V 6B.1 GNVL/02/2016 Human I N T V 6B.1 GNVL/03/2016 Human I N T V 6B.1 GNVL/04/2016 Human I N T V 6B.1 ENVR/GNVL/1/2016 Environment I N T V 6B.1 ENVR/GNVL/2/2016 Environment I N T V 6B.1 ENVR/GNVL/3/2016 Environment I N T V 6B.1 ENVR/GNVL/4/2016 Environment I N T V

88



M1 protein M2 protein

208 230 21

1 California/07/2009 Human Q K D 6* St. Petersburg/27/2011 Human 6A (subclade)

HongKong/5659/2012 Human Q K D

6C (subclade)

Massachusetts/10/2013 Human Q R G

6B (subclade)

South Africa/3626/2013 Human Q R G

6B GNVL/08/2013 Human Q R G 6B GNVL/07/2014 Human Q R V 6B ENVR/GNVL/08/2015 Environment Q R V 6B ENVR/GNVL/12/2015 Environment Q R V 6B GNVL/01/2015 Human Q R V 6B.1 GNVL/01/2016 Human K R G 6B.1 GNVL/02/2016 Human K R G 6B.1 GNVL/03/2016 Human K R G 6B.1 GNVL/04/2016 Human K R G 6B.1 ENVR/GNVL/1/2016 Environment K R G 6B.1 ENVR/GNVL/2/2016 Environment K R G 6B.1 ENVR/GNVL/3/2016 Environment K R G 6B.1 ENVR/GNVL/4/2016 Environment K R G

89

Table 3-10. Amino acid sequences at HA major immunogenic epitopes A and B1 of influenza H3N2 viruses in Gainesville, Florida, March 11, 2016.

H3N2 Virus Strain Amino Acid Sequence of Epitope A (aa 121 – 132)

H3N2 Consensus sequencea

N N E S F N W T G V T Q

A/Texas/50/2012b N A/GNVL/01/2014C A A/GNVL/05/2014d A/GNVL/06/2014d A/GNVL/07/2014d A/GNVL/08/2014d A/GNVL/09/2014e A/CH/9715293/2013f A A/GNVL/01/2016g A/GNVL/02/2016g A/ENVR/GNVL/01/2016 A/ENVR/GNVL/02/2016 A/ENVR/GNVL/03/2016


H3N2 Virus Strain Amino Acid Sequence of Epitope A (aa 133 – 146)


N G T S A C K R R S N N S

A/Texas/50/2012b I A/GNVL/01/2014C I G S A/GNVL/05/2014d I S S A/GNVL/06/2014d I S S A/GNVL/07/2014d I S S A/GNVL/08/2014d I S S A/GNVL/09/2014e I S S A/CH/9715293/2013f S R G S A/GNVL/01/2016g I S S A/GNVL/02/2016g I S S A/ENVR/GNVL/01/2016 I S S A/ENVR/GNVL/02/2016 I S S

A/ENVR/GNVL/03/2016 I S S

90


H3N2 Virus Strain Amino Acid Sequence of Epitope B1 (aa 155 – 163)


T H L K F K Y P A

A/Texas/50/2012b N A/GNVL/01/2014C N A/GNVL/05/2014d N Y T A/GNVL/06/2014d N Y T A/GNVL/07/2014d N Y T A/GNVL/08/2014d N Y T A/GNVL/09/2014e N Y T A/CH/9715293/2013f N S A/GNVL/01/2016g N Y T A/GNVL/02/2016g N Y T A/ENVR/GNVL/01/2016 N Y T A/ENVR/GNVL/02/2016 N Y T

A/ENVR/GNVL/03/2016 N Y T aYamashita et al. [92]

bVirus in 2013 – 2014 and 2014 – 2015 vaccines, Northern Hemisphere; GenBank accession number

KC892952.1. cGenBank Accession number KJ439217.

dViruses in nasopharyngeal swabs collected November 2014.

eVirus in sputum collected in November 2014.

fVirus (A/Switzerland/9715293/2013) in 2015 -2016 vaccine, Northern Hemisphere; EPI_ISL_165829. gViruses in nasopharyngeal swabs collected March 2016 (identical sequences; A/GNVL/01/2016

deposited as GenBank # KX133410.1).

91

Table 3-11. Amino acid sequence differences in the NA of influenza H3N2 viruses, in Gainesville, Florida, March 11, 2016.

H3N2 Virus Strain Amino acid position in NA protein


58 65 79 150 197 221 245

A/Texas/50/2012b I I P H D E S A/GNVL/01/2014C M R A/GNVL/05/2014d V S R D A/GNVL/06/2014d V S R D A/GNVL/07/2014d V S R D A/GNVL/08/2014d V S R D A/GNVL/09/2014e V S R D A/CH/9715293/2013f R D A/GNVL/01/2016g R N D N A/GNVL/02/2016g R N D N A/ENVR/GNVL/01/2016 R N D N A/ENVR/GNVL/02/2016 R N D N A/ENVR/GNVL/03/2016 R N D N


H3N2 Virus Strain Amino acid position in NA protein


247 267 339 380 392 468

A/Texas/50/2012b S T D I I P A/GNVL/01/2014C G A/GNVL/05/2014d T A/GNVL/06/2014d T A/GNVL/07/2014d T A/GNVL/08/2014d T A/GNVL/09/2014e T A/CH/9715293/2013f T A/GNVL/01/2016g T K N V H A/GNVL/02/2016g T K N V H A/ENVR/GNVL/01/2016 T K N V H A/ENVR/GNVL/02/2016 T K N V H

A/ENVR/GNVL/03/2016 T K N V H aYamashita et al. [92].

bVirus in 2013 – 2014 and 2014 – 2015 vaccines, Northern Hemisphere; GenBank accession number

KC892952.1. cGenBank Accession number KJ439217.

dViruses in nasopharyngeal swabs collected November 2014.

eVirus in sputum collected in November 2014.

fVirus (A/Switzerland/9715293/2013) in 2015 -2016 vaccine, Northern Hemisphere; EPI_ISL_165829. gViruses in nasopharyngeal swabs collected March 2016 (GenBank# KX133410.1).

hNA amino acid sequence identical to that of A/GNVL/01/2016(H3N2).

92

CHAPTER 4 ISOLATION AND IDENTIFICATION OF HUMAN CORONAVIRUS 229E FROM FREQUENTLY TOUCHED ENVIRONMENTAL SURFACES IN A CLASSROOM

Introduction

Acute respiratory illnesses (ARIs) comprise the most common illnesses affecting

humans, a significant proportion of which are caused by viruses [93]. The clinical

presentation can range from mild upper respiratory tract (URT) illness to severe lower

respiratory tract (LRT) involvement, manifested as pneumonia, bronchiolitis, croup and

exacerbations of asthma or wheezing [94]. According to the World Health Organization

(WHO), there are an estimated 450 million cases of pneumonia per year resulting in 4

million deaths, and approximately 200 million of these cases are caused by viruses [95].

The viruses most commonly implicated in ARIs are adenovirus, coronaviruses, human

metapneumovirus (hMPV), influenza A and B viruses, parainfluenza viruses types 1, 2,

3 and 4, rhinovirus and respiratory syncytial virus (RSV) [94, 96].

Human respiratory viruses can be transmitted from one person to another

through various routes of infection, as previously mentioned (Chapters 2 and 3). Indirect

contact transmission from fomites on contaminated surface has been reported to be

more significant in the spread of respiratory and other viral diseases than previously

thought [97, 98]. Most of the evidence investigating the role of contaminated

environmental surface in disease transmission comes from acute-care facilities [99].

“High-touch surfaces,” which are defined as surfaces frequently touched by healthcare

workers and patients, have a higher frequency of contamination than other sites [100-

103]. However, contact transmission through virus-containing fomites is not limited to

health care settings; it occurs in indoor and outdoor locations where both healthy and

diseased individuals share common space and facilities [45, 104]. At all these locales,

93

symptomatic or asymptomatic individuals release virus particles through expiration and

respiratory maneuvers such as coughing and sneezing. The emitted virus particles

present in aerosols or attached to small particles can settle or are manually deposited

onto “high touch surfaces” and create opportunity for disease transmission. Moreover,

residual virus left behind on the surfaces by ineffective cleaning procedures can initiate

infection [105]. Thus, failure to comply with the cleaning regimen and use of suboptimal

concentrations of disinfectants has resulted in the survival of pathogens in health care

environmental surfaces [106, 107].

This study was designed to test whether viable respiratory viruses could be

isolated from high contact surfaces in a University classroom over several days during

the start of “influenza season” in November 2016, when students were observed

coughing and sneezing during classroom sessions.


Study Period and Site

Environmental surfaces were convenience-sampled once a day in the same

highly-utilized medium-sized classroom at a major university in Florida, USA, from 12-

26 November 2016. Samplings were performed between classroom sessions or on

week-ends, when students were not present in the classroom, and were typically taken

between 6-7 PM, as the classroom was cleaned Monday through Friday between 6:00

and 7:00 AM. The study period occurred during influenza season in Gainesville, Florida;

classes were in session during the testing period.

Ethics

The study was IRB exempt because (a) human subjects were not involved, (b)

environmental samples were taken at irregular times between classroom sessions, (c)

94

students are not assigned seats at the classroom, and so therefore samples could not

be traced back to students.

Environmental Surfaces

High-touch environmental surfaces within a classroom were randomly selected

for sampling, except for the door handle, as there was only one door. The surfaces

chosen were: (a) seat backs made of hard polyvinylchloride, (b) formica desk tops, (c) a

wooden podium, and (d) a stainless-steel door handle. The daily cleaning regimen of

the classroom was provided by the cleaning staff upon inquiry. The desk tops, podium

and door handle were cleaned once in the morning, between 6–7 AM, using a

commercially available cleaning solution consisting of non-ionic surfactant (alcohol

ethoxylates) and an anionic surfactant (sodium xylene sulfonate).

Sample Collection

Swab samples were collected using flocked nylon swabs paired with Universal

Transport Medium (UTM) (Copan Diagnostics, Inc., Murrieta, CA, Cat#360C) as

previously described [45]. The UTM served as “virus transport medium” (VTM). Briefly,

for flat surfaces, flocked swabs, pre-moistened with sterile phosphate-buffered saline

and held at an angle of approximately 30 to the sampling surface, were moved across

a 25 cm2 area in 3 directions (horizontal, vertical and cross section) to ensure maximum

contact of the swab with the sampled surface. The door-knob handle was completely

swabbed. The swabs were then immediately inserted into the VTM and stored at -80C

until further processing.

Cell Cultures for Virus Isolation

Isolation of viruses was attempted in six different cell lines. These were:

American Type Culture Collection (ATCC, Manassas, VA) cell lines A549 (human lung

95

adenocarcinoma epithelium; CCL-185), MDCK (NBL-2) (Madin Darby canine kidney

[Canis familiaris kidney epithelium], CCL-34), HeLa (human cervical adenocarcinoma

epithelium, CCL-2), LLC-MK2 (rhesus monkey kidney epithelium, CCL-7), VERO E6

(African green monkey kidney; CRL-1586) and MRC-5 (human lung fibroblast, CCL-

171). Cultures were propagated as monolayers in Gibco™ advanced Dulbecco's

Modified Eagle Medium (aDMEM) (Fisher Scientific, Cat#12491015) supplemented with

0.2 mM stabilized L-glutamine (L-alanyl-L-glutamine) (Gibco™ GlutaMAX, Fisher

Scientific, Cat# 35050-061), antibiotics [50 𝜇g/mL penicillin, 50 𝜇g/mL streptomycin, 100

𝜇g/mL neomycin (PSN, Fisher Scientific, Cat #15640055)] as previously described [11].

Based on prior tests performed by myself and the cumulative experience of the

Lednicky laboratory, the cell lines chosen support the isolation and propagation of many

common respiratory viruses (Table 3-3). Replicate sets of sub-confluent cell lines were

inoculated with aliquots of the collected material and one set incubated at 33˚C, the

other at 37°C, in humidified CO2 incubators. Two different incubation temperatures were

chosen to facilitate isolation of human respiratory viruses that preferentially grows better

at 37˚C than at 33˚C or vice versa. The inoculated cells were refed at three day intervals

with maintenance media and observed daily for formation virus-specific cytopathic

effects (CPE). The cells were observed for 21 days before being considered negative

for virus isolation. As some respiratory virus strains replicate and produce progeny in

the cells without causing easily observed CPE, the spent cell-growth media was

periodically tested using the GenMark RVP assay.

96

GenMark RVP Assay

Respiratory virus detection and subtyping was performed using a GenMark

multiplex PCR eSensor XT-8 Respiratory Viral Panel (GenMark Diagnostics, Inc.,

Carlsbad, CA) following the manufacturer’s instructions. This panel includes tests for

influenza A virus (including subtype determination); influenza B virus; respiratory

syncytial virus types A and B; parainfluenza virus types 1, 2, 3 and 4; human

metapneumovirus, human rhinovirus; adenovirus groups B, C and E; human

coronavirus types 229E, NL63, HKU1 and OC43. As previously described, extracted

nucleic acids from the spent cell-growth media were used to perform a multiplex

PCR/RT-PCR assay and the amplified DNA targets analyzed by electrochemical

detection [57]. After data acquisition and analysis, the instrument generates an output:

eSensor Respiratory Viral Panel Currents Report (RUO).

Whole Genome Sequencing of CoV-229E

After all the cell-culture positive samples were confirmed to contain CoV-229E,

one isolate from (desk top on 23 November 2016) was sequenced using a gene walking

procedure as described [108]. The complete virus genome FASTA sequence from the

environmental CoV-229E isolate [deposited in GenBank under accession # KY996417]

was aligned and compared to whole genome CoV-229E sequences available at

GenBank using the NCBI BLAST program.

Assessment of CoV-229E Stability under Classroom Ambient Light, Temperature and Humidity Conditions

In a separate set of experiments that were prompted by our finding of Human

coronavirus 229E (CoV-229E) on classroom surfaces in this study, the survival of a

well-studied CoV-229E laboratory strain was assessed after its deposition onto three

97

different coupons (stainless steel, hard plastic and glass) that were held under

controlled settings that simulated classroom ambient light cycle, temperature and

humidity conditions. A CoV-229E strain was obtained from the ATCC (catalog # VR-

740), propagated in MRC-5 cells, and the titer of the resulting virus stock preparation

obtained by plaque assay. As classrooms at the university are maintained at a

temperature of about 24°C and a relative humidity (RH) of 45 – 49% and a fluorescent

light cycle of 10 hrs off, 14 hrs on, the stability of CoV-229E VR-740 was assessed on

three different hard surfaces held at 24°C and approximately 50% RH with fluorescent

lights on for 14 hrs per day. Briefly, working in a biosafety cabinet, 20 µL aliquots (three

replicates/day, over a 7-day testing period) of tittered virus (2 x 104 plaque forming

units) were spotted and spread over the surface of sterile 1 cm2 hard plastic, glass, and

stainless steel coupons held in a sterile baking dish, and the coupons allowed to dry for

one hour. A controlled 50% RH environment was produced by placing each virus-

overlaid coupon into a sterile glass container with a saturated solution of magnesium

nitrate held in a separate compartment [109], and the glass container sealed with a

glass top. Virus survival was monitored for 7-days. Thus, there were 3 replicates for

each type of coupon for each test day [9 coupons/day] tested over 7 days, plus one

negative control for each coupon for each day [total = 12 coupons/day for days 0, 1 -7,

for a total of 96 coupons tested]. Briefly, virus was extruded off the different surfaces

and viable counts determined by plaque assay as: coupons were individually aseptically

immersed into separate sterile 50-mL polypropylene tubes containing 5 mL of aDMEM

without FBS. After an initial rehydration period of 15 minutes, three sterile 2-mm-

diameter glass beads were added to the tubes, and the tubes pulse-vortexed for 30

98

seconds. Serial dilutions were prepared in cell growth medium and 1-ml aliquots

inoculated onto newly confluent monolayers of MRC-5 cells in 6-well plates. The

inoculum was removed after 3 hr and replaced with agarose overlays, and the plates

incubated at 37°C and 5% CO2 for 5 days. The monolayers were subsequently overlaid

with an agarose overlay containing vital stain, and incubated for 1 day. Plaques in the

monolayer were enumerated the following day (7 days post-infection). Triplicate

samples were processed for each time point.

Results

Six cell cultures inoculated with samples collected on four different days over an

11-day period displayed virus-induced cytopathic effects (CPE) consisting of cell

rounding, followed by clumping and detachment of the cells within 3-11 days post-

infection, whereas non-inoculated cells maintained in parallel retained a normal

phenotype (Figure 4-1). The CPE first appeared in cells incubated at 33˚C.

Viral genomic RNA extracted from cell lysates and virions in spent culture media

from the infected cells was identified as that of CoV-229E by the GenMark RVP system.

An example of a GenMark report for vRNA extracted from one of the isolates is given in

Figure 4-2. Of the 13 surfaces sampled over a 11-day period, 6 were positive for CoV-

229E (Table 4-1). Desk tops and the door knob were the most commonly contaminated

surfaces. Of note, the CoV-229E isolates formed lytic CPE in several cell lines and yet

replicated to high levels in LLC-MK2 cells without causing obvious CPE (Table 4-1).

Whole genome sequence comparison to available CoV-229E sequences at

GenBank revealed that an environmental CoV-229E isolate from our study was closely

related to a CoV-229E clinical isolate from the Netherlands (NL) in 2010 (GenBank

accession: JX503060.1). Deduced amino acid sequences of our environmental CoV-

99

229E isolate’s: replicase 1ab, accessory, spike, envelope, membrane and nucleocapsid

proteins were almost identical to those of the 2010 NL isolates except for few

substitutions in the replicase 1ab (S686G, G763C, F992S, L1456V, T1623X, I3813T,

G4082R); spike (D213N, V603X); nucelocapsid (V46I) and accessory (V81X) proteins.

The complete genome sequence of CoV-229E/environment/Gainesville/1/2016 has

been deposited in the GenBank database (accession# KY996417).

In vitro tests indicated that after deposition onto glass, hard plastic, or stainless

steel for 7 days, there was an approximate reduction of the viable virus count by about

2.5 logs, yet a significant quantity of virus nevertheless remained infectious (Figure 4-3).

Discussion

Microbial contamination of ‘high-touch surfaces’ is common in both health care

and community settings [45, 111]. Some pathogens can survive for prolonged periods

on such surfaces and be transmitted to susceptible hosts [110-113]. Coronaviruses are

common causes of upper respiratory tract and enteric infections in healthy individuals

and often cause severe infections of the lower respiratory tract in patients with co-

morbidities [7, 97, 114]. CoV-229E, one of the four circulating strains of human

coronaviruses, has been implicated in lower respiratory tract involvement in young

infants [115-118], elderly individuals [119] and in immunocompromised patients [7, 114,

120, 121]. It is reported to be an important cause of nosocomial respiratory viral

infection in high-risk infants, with lower respiratory tract infections progressing to more

severe disease manifestations e.g. bronchitis, croup, bronchiolitis and pneumonia [122-

125]. In elderly individuals, CoV-229E infections are also frequent, including those with

underlying conditions [119]. Lower respiratory tract infections are a major cause of

hospitalizations and mortality in hematopoietic stem cell transplant patients and CoV-

100

229E has been detected in increasing frequency in these patients [7, 120, 121]. It has

also been suggested as an autoimmune trigger in multiple sclerosis [114].

In this study, it was determined that infectious CoV-229E could be isolated from

“high touch surfaces” in a classroom where students were seen coughing and sneezing.

Others have reported detection of coronavirus genomic RNA on various inanimate

surfaces (e.g., telephones, doorknobs, computer mice, telephone handles, latex gloves

and sponges) in hospitals and apartment buildings [110, 126]. Taken together, these

findings seem counter-intuitive, as enveloped viruses are in general more susceptible to

various environmental stresses such as radiation, temperature, relative humidity than

non-enveloped viruses, mostly due to lipidic nature of their envelopes [127]. Upon

drying, virus infectivity is also reported to be affected by various environmental

conditions such as heat, moisture, pH, the type of surface, media composition and

component concentrations [128, 129]. The study of CoV-229E VR-740 survival

suggests that the virus can remain viable on different environmental surfaces (hard

plastic, glass and stainless steel) at ambient temperature (24ºC) and low relative

humidity condition (~50%) typical of an indoor environment, like a classroom, for at least

seven days at high titers. This is significant given that the minimum infective dose of

respiratory viruses can be very low [130]. Similar findings were made in studies of

transmissible gastroenteritis virus (TGEV) and mouse hepatitis virus (MHV) used as

surrogates to determine the effects of air temperature and relative humidity on the

survival of severe acute respiratory syndrome coronavirus (SARS-CoV) on stainless

steel [109], suggesting that other coronaviruses can remain infectious on environmental

surfaces for many days, and this may be a general property of CoVs.

101

Of all the surfaces tested in the classroom, the isolation of infectious CoV-229E

from the door knob is probably of greatest significance: since it is constantly used, and

was thoroughly swabbed at each sampling, our finding suggests that there was frequent

deposition of the virus on the knob. From a public health perspective, a better choice

might be brass instead of stainless steel door handles, as brass has been reported to

be deleterious for CoV-229E, though quick inactivation on brass may not occur for other

viruses [131].

Given that the frequently touched surfaces in the classroom were cleaned every

morning, isolation of CoV-229E on several days during the sampling period could mean

frequent re-deposition of the virus on those surfaces and/or an ineffective daily cleaning

regimen. Alcohol ethoxylates (AE), the principal component of the cleaning solution

used on classroom surfaces, have previously been shown to have a bacteriostatic effect

on E. coli [132]. Another study assessed the efficacy of AE in reducing genomic loads of

common respiratory viruses on toys in daycare nurseries, though the effect on virus

viability was not investigated: in that study, a decrease in genomic loads of adeno-,

rhino- and respiratory syncytial viruses have been reported but the load of coronavirus,

the most prevalent virus group detected on toys, remained unchanged before and after

AE intervention [133]. Without investigating their effect on virus viability, it is hard to

conclude from our study whether use of AE with a short contact time was sufficient to

inactivate human respiratory viruses like CoV-229E or required more vigorous cleaning

of classroom surfaces involving frequent cleaning and longer contact time, especially

during respiratory infection outbreak periods.

102

The study was limited to sampling few indoor surfaces from one classroom over

an 11-day period and was focused only on common human respiratory viruses. Using

RT-PCR, rhinovirus RNA was detected on the same surfaces, but viruses could not be

isolated in cell culture. Whole genome sequence analyses of the environmental CoV-

229E isolate in this study indicate it is genetically closely related to human CoV-229E

strains that are spatiotemporally widespread. Though one strain was identified by

sequencing of one isolate (only), and it is tempting to infer one person was the source, it

is possible that the same virus strain was circulating among the students and that the

virus detected over many days emanated from various sources (persons). A broader

study might include linking the virus to the person(s) shedding the virus. Also, further

study on the effects of commonly used cleaning and disinfecting solutions on CoV-229E

viability will help guide better cleaning and disinfection practices. Finally, air sampling

studies to detect virus aerosols performed together with surface environmental

samplings would be of interest.

As viable virus was isolated from high-contact surfaces, this study supports the

notion that contact transmission may be one route of infection for CoV-229E.

103

Figure 4-1. Isolation of CoV-229E in VERO E6 and A549 cells at 33°C. A) Mock-infected VERO E6 cells, maintained in parallel with inoculated cells for 6 days. B) Advanced CPE in VERO E6, 6 days post infection (pi). C) Mock-infected A549 cells D) Advanced CPE in A549 cells, 6 days pi. Original images taken at a magnification of 400X.

104

Figure 4-2. eSensor Respiratory Viral Panel currents report for desk top7 (collected on 23 November 2016) inoculated cell culture sample. A signal value of 206 nA over a threshold value of 3 nA is significant and indicates that coronavirus 229E is the virus present in the sample.

105

Figure 4-3. Stability of CoV-229E on different hard surfaces over a 7-day observation period.

106

Table 4-1. Development of virus induced CPE in inoculated cell lines.

Sampling date

Surface tested Day Cell lines Respiratory virus identified by eSensor RVP

A549 MRC-5 LLC-MK2

VERO E6

11/12/16 Desk top1 Saturday -a - - - 11/13/16 Desk top2 Sunday - - - - 11/14/16 Desk top3 Monday - - - - 11/18/16 Desk top4 Friday +b + ?c + CoV-229E 11/19/16 Door knob Saturday - - - - 11/20/16 Desk top5 Sunday + + ? + CoV-229E 11/22/16 Podium Tuesday - - - - 11/22/16 Desk top6 Tuesday + + ? + CoV-229E 11/22/16 Door knob Tuesday + + ? + CoV-229E 11/22/16 Chair back Tuesday - - - - 11/23/16 Desk top7 Wednesday + + ? + CoV-229E 11/23/16 Door knob Wednesday + + ? + CoV-229E 11/23/16 Chair back Wednesday - - - - 11/24/16 Desk top8 Thursday - - - - 11/25/16 Door knob Friday - - - - 11/26/16 Chair back Friday - - - - a-, No CPE observed. b+, CPE observed. c?, No obvious CPE observed

107

CHAPTER 5 COMPLETE GENOME SEQUENCE OF ENTEROVIRUS D68 DETECTED IN

CLASSROOM AIR AND ON ENVIRONMENTAL SURFACES1

Introduction

Enterovirus D68 (EV-D68) (genus Enterovirus, family Picornaviridae) has

reemerged globally as an important human respiratory pathogen [134-136]. First

identified in 1962 [137], respiratory diseases due to EV-D68 were rarely reported until

the early 2000s [136, 138]. In 2014, EV-D68 caused an outbreak in the United States

that extended to early 2015 [136]. During the recent U.S. outbreaks, EV-68 mostly

affected children, causing clinical manifestations that ranged from mild respiratory

illness to severe respiratory distress requiring hospitalization [136, 139]. Alarmingly,

sporadic cases of nonpolio paralysis/acute flaccid myelitis associated with residual limb

weakness or other neurological deficits occurred during the recent American EV-D68

outbreaks [140-142]. At least three EV-D68 clades exist [136, 139, 142]; most recent

outbreak strains in the United States, including those that caused acute flaccid myelitis,

are from clade B1 [136, 139, 142]. Relatively few EV-D68 genomes have been fully

sequenced.

In this study, we amplified and sequenced the complete genome of enterovirus

D68 (EV-D68) that had been collected from classroom air using a filter-based air

sampling method and by swab sampling of environmental surfaces. Relatively high

Reprinted with permission from Lednicky JA, Bonny TS, Morris JG, Loeb JC. Complete genome sequence of enterovirus D68 detected in classroom air and on environmental surfaces. Genome Announcements. 2016 Jun 30;4(3]:e00579-16.

108

levels of EV-D68 genome equivalents were found per cubic meter of air by quantitative

real-time reverse transcription-PCR (RT-PCR).

Methods and Materials

The virus described here was detected in 4 of 6 air sampler filters and 12 of 16

desktops of a classroom in a university, on 8 September 2015, a few weeks after fall

season classes had started. To favor the detection of airborne virus, tests were

performed immediately after the day’s last classroom session, before airborne virus

would be removed in exhaust air by normal ventilation air exchanges. Active air

sampling was performed at 9 liters/min for 1 h to sample 0.540 m3 of breathing air using

a Sioutas Personal Cascade Impactor Sampler (PCIS) with polytetrafluoroethylene

filters, as described previously [11], and desktop swab samples immersed in UTM viral

transport medium (Copan Diagnostics, USA) [45]. cDNA synthesis from viral nucleic

acids extracted from filters [11] or swabs [45] was performed with avian myeloblastosis

virus (AMV) reverse transcriptase and random hexamers, and PCR was performed

using a panel of respiratory virus primers. Following identification of a specific virus,

quantitative real-time reverse transcription-PCR (RT- PCR) tests [143] was performed to

determine genomic equivalents of the identified virus/m3 in the air samples.

Results and Discussions

Quantitative real-time reverse transcription-PCR (RT- PCR) tests indicated

presence of 400 to 5,000 genomic equivalents of EV-D68/m3 in the air samples. Viral

RNA from the air sample with the highest concentration of virus was used for

sequencing [144], and the complete viral genome was designated EV-

D68/environment/Gainesville/1/2015. Phylogenetics indicate that the virus conforms to

109

EV-D68 clade B1. Attempts to isolate the virus in cell cultures [144] from material

extruded from filters or swab samples were unsuccessful due to rapid overgrowth of the

cells by reovirus and/or adenovirus also present in the samples.

The EV-D68/environment/Gainesville/1/2015 genome has 3 nucleotide (nt)

polymorphisms (C1817T, C3277A, and A4020G) that are present in the majority of EV-

D68 strains of the 2014 U.S. outbreak [139], and in EV-D68/Haiti/1/2014 (GenBank

accession no. KT266905.1) and EV-D68 MEX/DF/2014-InDRE2351 (GenBank

accession no. KT825142.1). For these, the resulting amino acid substitutions T860N

and S1108G at the cleavage sites of viral proteases P2A and P3C may affect their

cleavage efficiency and lead to increased virus replication [139]. As with our findings,

high levels of airborne enteroviruses were detected in a pediatric clinic [145], and this

may be a common finding in indoor settings with enterovirus-infected individuals. Our

work also suggests that young adults can produce airborne EV-D68 and raises the

question of whether airborne transmission is important for spreading the virus. The

complete genome sequence of EV-D68/environment/Gainesville/1/2015 has been

deposited in the GenBank database under the accession number KU509997.

110

CHAPTER 6 DETECTION OF ALPHACORONAVIRUS vRNA IN THE FECES OF BRAZILIAN FREE-

TAILED BATS (TADARIDA BRASILIENSIS) FROM A COLONY IN FLORIDA, USA2

Introduction

Bats (order Chiroptera, suborders Megachiroptera and Microchiroptera) are a

widely distributed group of mammals that comprise ~20% of all known mammalian

species [146]. They are reservoirs of many emerging and reemerging zoonotic viruses,

some of which are highly pathogenic in humans. The emerging viruses exert a

significant public health threat [147, 148] and include ebolaviruses, henipaviruses,

lyssaviruses and coronaviruses [149-154]. These are all viruses that can cause

infections through inhalation routes of exposure, and viruses such as Hendra, Nipah,

and SARS viruses cause severe respiratory infections in humans.

Coronaviruses, order Nidovirales, family Coronaviridae, subfamily Coronavirinae,

are enveloped positive-sense single-stranded RNA viruses. There are four CoV genera:

Alphacoronavirus, Betacoronavirus, Gammacoronavirus and Deltacoronavirus [155].

After it was found that SARS-CoV probably originated in bats [156, 157], a flurry of

investigations uncovered many more novel bat CoVs [158-171]. The recent description

of a bat CoV related to MERS-CoV in Mexican bats [172] emphasized the relevance of

investigating neotropical bats for CoVs.

Thirteen different species of insectivorous bats are found in Florida [173].

Brazilian free-tailed bats (Tadarida brasiliensis), also known as Mexican free-tailed bats,

are one of the most abundant species of bats found throughout Florida, except the

Reprinted with permission from Bonny TS, Driver JP, Paisie T, Salemi M, Morris JG, Shender LA, Smith L, Enloe C, Oxenrider K, Gore JA, Loeb JC, Wu C-Y, Lednicky JA. Detection of Alphacoronavirus vRNA in the Feces of Brazilian Free-Tailed Bats (Tadarida brasiliensis) from a Colony in Florida, USA. Diseases. 2017 Feb 27;5(1):7.

111

Florida Keys [173]. They roost in large colonies and, in Florida, they roost mostly in

man-made structures, including buildings and bridges [173]. Despite the abundance and

potential role of bats in disease transmission, viruses harbored by Florida bats remain

mostly underexplored. With human activity increasingly overlapping the habitats of bats,

the possibility of disease outbreaks resulting from spillover of bat CoVs cannot be ruled

out [174]. Although no human diseases caused by a bat CoV have been identified in

Florida, surveillance of CoVs in bat species is necessary to better predict and prevent

the next emergence of a CoV disease outbreak [174]. In this study, we investigated

whether CoV vRNA could be detected in the feces of Brazilian free-tailed bats in

Florida.

This study reports the detection of an alphacoronavirus RNA-dependent RNA

polymerase (RdRp) gene sequence in the feces of two of 19 different T. brasiliensis that

were capture/release bats that had been evaluated for overall health. The RdRp

sequence is similar but not identical to previously detected sequences in the feces of

two different species of bats (T. brasiliensis and Molossus molossus) in Brazil. In

common with the experience of others doing similar work, attempts to isolate the virus in

cell cultures were unsuccessful. We surmise that this and highly related

alphacoronavirus are carried by Brazilian free-tailed bats living in a wide eco-spatial

region. As various coronaviruses (CoVs) that affect humans emerged from bats, our

study raises the question whether CoVs such as the one detected in our work are yet-

to-be-detected pathogens of humans and animals other than bats.

112


Collection and Processing of Bat Feces Samples

For this study, free-tailed bats were chosen for two reasons: (a) opportunity; the

bats were from a conservation site wherein the animals’ well-being is periodically

evaluated and bat fecal samples were available for evaluation; and (b) they are among

the most abundant bats often found roosting in buildings in Florida, and hence are most

likely to interact with humans. These bat species were identified and evaluated for

overall health by expert bat biologists of the Florida Fish and Wildlife Conservation

Commission (FWC). The FWC has no designated or required IACUC protocol; however

they follow the guidelines of American Society of Mammalogists for the capture and

handling bats [175]. Nineteen (n = 19) fecal samples were collected from

capture/release bats in Gilchrist County, 8 km southwest of Ft. White, Florida in May

2016. Following collection, the samples were immediately sent to a BSL2-enhanced

laboratory and stored at −80°C. Bat fecal pellets were homogenized to 10% (w/v)

suspensions in Gibco™ advanced Dulbecco’s Modified Eagle Medium (aDMEM) (Fisher

Scientific, Pittsburgh, PA, USA, Cat#12491015) supplemented with 0.2 mM L-alanyl-L-

glutamine (Gibco™ GlutaMAX, Fisher Scientific, Cat# 35050-061), antibiotics (50 μg/mL

penicillin, 50 μg/mL streptomycin, 100 μg/mL neomycin (PSN, Fisher Scientific, Cat

#15640055)) using Covidien Precision™ disposable tissue grinders (Fisher Scientific,

Cat# 06-434-1). The homogenates were cleared of debris by low-speed centrifugation

(5 min at 1500× g), and the supernatants filtered through 0.45 μm PVDF, sterile filters

(Fisher Scientific, Cat# 09-720-4) to remove bacteria and other particulates, and the

filtrates stored at −80°C until further use.

113

Virus Isolation Attempts in Cell culture

American Type Culture Collection (ATCC, Manassas, VA, USA) cell lines VERO

E6 (African green monkey kidney; CRL-1586), A549 (human lung adenocarcinoma

epithelium; CCL-185), and Tb1 Lu (Tadarida brasiliensis lung epithelium; CCL-88) were

propagated as monolayers as previously described [11], and a newly confluent

monolayer of each of these three cell lines was inoculated with aliquots (75 μL) of the

filtered homogenates. The inoculated cells were incubated in a humidified 5% CO2

atmosphere at 35°C, and observed daily for virus-specific cytopathic effects (CPE).

Screening of Viral Nucleic Acids for Coronavirus RNA

Viral nucleic acids were extracted from both filtered homogenates and spent cell

media using the QIAamp viral RNA minikit (Qiagen, Germantown, MD, USA,

Cat#52904). CoV RNA screening was performed by reverse transcription-polymerase

chain reaction (RT-PCR) targeting conserved region of the RNA-dependent RNA

polymerase (RdRp) gene. Briefly, viral RNA was denatured at 65 °C for 5 min in the

presence of SUPERase-In RNase inhibitor (Invitrogen Corp., Carlsbad, CA, USA,

Cat#AM2694), cooled rapidly on ice and cDNA synthesis performed with Omniscript

Reverse Transcriptase (RT) (Qiagen, Cat# 205111) for 1 h at 37 °C using primer

CorTheoNL63R1 (5′-CCRTCATCAGANAGAATCATCAT-3′). PCR was performed using

One Taq DNA polymerase (New England BioLabs, Ipswich, MA, USA, Cat# M0480)

with primer pair CorTheoNL63F1 (5′-GGTTGGGAYTATCCYAANTGTGA-3′) and

CorTheoNL63R1. With an expected product size of 440 bp, PCR was performed as:

initial denaturation step (94°C for 2 min); followed by 40 cycles of 94°C (60 s), 48°C (60

s), 68°C (60 s), and a final extension step at 68°C for 5 min. PCR products were

visualized by gel electrophoresis in a 1.5% ethidium bromide-stained agarose gel.

114

In preparation for sequencing, samples wherein a 440 bp PCR amplicon were

initially observed were re-amplified using high-fidelity polymerases. Briefly, cDNA was

produced using AccuScript High Fidelity Reverse Transcriptase (Agilent Technologies,

Inc., Santa Clara, CA, USA, Cat# 200820) in the presence of SUPERase-In RNase

inhibitor, and PCR was performed using Phusion Polymerase (New England BioLabs,

Cat# M0530S) with denaturation steps performed at 98°C. The re-amplified samples

were individually electrophoresed in a 1.5% ethidium bromide-stained agarose gel and

the 440 bp amplicon excised and purified using a Qiagen MinElute Gel Extraction kit

(Qiagen, Cat# 28604). The purified 440 bp PCR amplicons were then subjected to

Sanger Sequencing. Preliminary sequence analyses were performed with the NCBI

BLAST software.

Phylogenetic Analyses of the CoV RdRp Sequences

For phylogenetic analyses, all available RdRp CoV sequences were downloaded

from NCBI (http://www.ncbi.nlm.nih.gov/). The sequences were aligned using Clustal

Omega [176] and manually edited in Bioedit [177]. Phylogenetic signal was investigated

by likelihood mapping in the program TREE-PUZZLE [178] in order to assess the

phylogenetic signal in the sequence alignment and to remove the appropriate identical

sequences. The maximum likelihood tree was estimated using the best nucleotide

substitution model (TPM3 + I + G4) according to the results from IQ-TREE [179].

Bootstrapping (1000 replicates) was also performed using the IQ-TREE software. This

was done in order to statistically analyze branch support in the maximum likelihood tree.

The maximum likelihood tree was then manually edited in FigTree

(http://tree.bio.ed.ac.uk/software/figtree/) to display geographical locations of the

115

sequences and to show branches with strong statistical support (bootstrap values

greater than 95%).

Results

Virus-induced CPE were not observed in cell cultures during a four-week

observation period, suggesting a virus(es) had not been isolated. However, CoVs do not

always cause easily discernable CPE in the cell lines used for this study, so for

additional evidence of virus isolation, RT-PCR tests were performed. Coronavirus RNAs

were also not detected by RT-PCR of spent cell culture media collected and tested by

RT-PCR every five days, and in RNA purified from the infected cells at the terminal

observation time-point (30 days post-infection). Attempts to isolate CoVs from the

inoculated cell lines were thus considered unsuccessful.

Out of 19 bat fecal samples, 440 bp amplicons corresponding to a conserved

region of the CoV RdRp gene were generated by RT-PCR from two filtered

homogenates (Figure 6-1). The sequence for both amplicons was identical and

submitted to GenBank (Accession: KX663833.1). Following BLAST analyses, the

consensus RdRp sequence was found to be highly similar but not identical to

alphacoronavirus RdRp sequences identified in Brazilian free-tailed bats and velvety

free-tailed bats (Molossus molossus) from southern Brazil [180]. The percentage of

nucleotide and amino acid sequence identity ranged from 94% to 96%.

Phylogenetic analyses suggest that the RdRp gene sequence that had been RT-

PCR-amplified from the feces of free-tailed bats in Florida clusters with RdRp gene

sequences that were from two different types of bats in Brazil (Figure 6-2).

116

Discussion

Bats have been recognized as the natural reservoirs of a wide variety of viruses,

many of which are important human and animal pathogens. Special attention has been

paid to bat coronaviruses (BtCoVs) as the two emerging CoVs (SARS-CoV and MERS-

CoV) causing human disease outbreaks in recent years are suggested to have emerged

from bats [174]. It is plausible that other emerging BtCoVs may be able to cross the

species barrier and cause human disease [174].

In Florida, 13 different species of insectivorous bats reside, 12 of which are year-

round and only one species is seasonal [173]. Brazilian free-tailed bats are one of the

permanent residents. Considering the potential public health implications of bat species

living in close proximity to human inhabitants, the viruses harbored by these wide

varieties of bat species in Florida have largely been underexplored. To our knowledge,

this is the first report of alphacoronavirus vRNA detection in feces from presumably

healthy insectivorous bats in Florida. The high degree of sequence similarity of the

Florida BtCoV with that of a Brazilian BtCoV from two different bat species (T.

brasiliensis and M. molossus) [180] suggests that similar CoVs may be present in

different bat species and across geographically distant regions. Unlike the clade

containing the Brazilian and Florida free-tailed bat CoVs, most of the other RdRp

sequences cluster according to bat species, indicating that the viruses evolve according

to bat species (Figure 6-2). In the other bat coronavirus clades, geographical location

also appears to have an influence on the evolution of the viruses, but the clade with our

sequence of interest from Florida contains bat species from the families Molossidae and

Phyllostomidae. The similarity between our Florida BtCoV sequence and those of the

Brazilian BtCoVs could be an indicator of how bat BtCoVs in Florida will evolve. The

117

branch length in the maximum likelihood tree implies that the Florida BtCoV is diverging

away from the Brazilian BtCoVs (Figure 6-2). The divergence of the Florida BtCoV could

indicate the beginning of a new clade based on geographical location and not bat

species. It is too early to infer other conclusions: Brazilian free-tailed bats are also found

in Mexico and in Texas, where they are called Mexican free-tailed bats. Unfortunately,

we were unable to find RdRp sequences for the BtCoVs of those bats in public

databases, and it is plausible that those bat populations found geographically closer to

Florida will harbor CoVs more similar to the one detected in this work.

Although restricted in sample number, location and the single bat species

investigated, this study suggests that surveillance and identification of CoVs in Florida

bats is worthy.

118

Figure 6-1. Representative results of RT-PCR detection of alphacoronavirus vRNA in

Brazilian free-tailed bat feces (BF). Lane 1 (M), 100 bp MW markers; Lane 2 (+), HCoV-NL63 vRNA, positive control; Lane 3 (−), negative control; Lane 4, BF#1; Lane 5, BF#2; Lane 6, BF#3; Lane 7, BF#5; Lane 8, BF#6; Lane 9, BF#7; Lane 10, BF#17; Lane 11, BF# 18; Lane 12, BF#19. Virus-specific 440-bp PCR products amplified by PCR primers CorTheoNL63F1 and CorTheoNL63R1 are present in lanes 2, 6 (asterisk), and 10.

119

Figure 6-2. Maximum likelihood tree based on the nucleotide sequences of partial RdRp gene of bat CoVs. In parenthesis are the bat species that make up the clade. Abbreviations: BtCoV, bat coronavirus; Rm-BtCoV, Rocky Mountain bat coronavirus. Red circle indicates strong statistical support (bootstrap >95%)

120

CHAPTER 7 ISOLATION AND DETECTION OF ARBOVIRUSES AND HUMAN CORONAVIRUS

229E IN BLOOD COLLECTED FROM CHILDREN IN RURAL HAITI IN 2016

Introduction

Arthropod-borne viruses (arboviruses) are viruses that are transmitted to humans

by hematophagous arthropods such as mosquitoes, sandflies, biting midges and ticks

[181]. These viruses are maintained in transmission cycles between vertebrate hosts

and arthropod vectors [34]. Arboviral infections in humans can vary, ranging from

asymptomatic to fulminant fatal diseases. Clinical symptoms, when present, can be

categorized as systemic febrile illness, hemorrhagic fever and invasive neurological

disease [34]. At least 135 arboviruses have been implicated in human disease, the vast

majority of which are RNA viruses belonging to genera: Alphavirus, Flavivirus,

Orthobunyavirus, Nairovirus, Phlebovirus, Orbivirus, Vesiculovirus and Thogotovirus

[182, 183].

Mosquito-borne viruses are an emerging threat to human health and well-being

throughout the world [37]. The explosive spread of mosquito-borne viruses to new

geographical areas in the recent years has alarmed the public health community

worldwide. The continued presence of DENV, CHIKV, and ZIKV in endemic areas and

their expansion through the Americas place an estimated 3.9 billion people living in 120

different countries at risk [37]. DENV has been spreading across countries over the past

30 years and today an estimated 390 million people are infected annually [37]. In 2015-

2016, ZIKV infections swept across the Americas, resulting in more than 360,000

suspected cases [37]. CHIKV first emerged in the Americas in 2013 [184], with numbers

rising to 1.8 million suspected cases from 44 different countries and territories to date

[185]. With many more cases of these arboviral infections likely going undetected and/or

121

unreported, these numbers may just represent the tip of the iceberg. This escalating

burden of infections and potential spread of arboviruses to new geographic areas have

alarmed the public health community, resulting in a flurry of research to understand

arbovirus disease epidemiology, prevention and control [37]. As part of this ongoing

endeavor, researchers at UF have initiated projects to determine the causative agents

and incidence of arbovirus infections in Haiti and elsewhere in the Caribbean and in the

Americas.

Methods and Materials

Since July 2014, researchers at UF have been monitoring arboviral transmission

in rural Haiti, through collaboration with the school clinic associated with the

Christianville Foundation School, in the Gressier/Leogane region of Haiti, about 20

miles west of Port-au-Prince. The clinic serves four schools with approximately 1,250

students, from pre-kindergarten to grade 12 [186]. Following a protocol approved by the

University of Florida Institutional Review Board (IRB) and the Haitian National IRB,

diagnostic blood samples were routinely collected from children presenting with acute

undifferentiated febrile illness at the clinic. Written consent was obtained from

parents/guardians of all study participants. Between March and May 2016, blood

samples were obtained at the school clinic from a total of 111 school children who met

the criteria of acute undifferentiated febrile illness (i.e. febrile illness with no localizing

signs, as observed in patients with pneumonia, upper respiratory infections, urinary tract

infections) [187]. In this study, virus isolation and identification were attempted on

plasma derived from twenty-seven (n= 27) blood samples.

122

Initial Screen of Plasma Samples for Zika-, Dengue- and Chikungunya Viruses

An initial screen for the presence of ZIKV, DENV and CHIKV vRNA in patient

plasma samples was performed by molecular methods. As previously described [13],

viral nucleic acids were first extracted from virions in the plasma samples using the

QIAamp viral RNA minikit (Qiagen, Cat#52904), then tested for the presence of ZIKV,

CHIKV and DENV types 1-4 using primers described by Faye et al. [188], Lanciotti et al.

[189], and Santiago et al. [190], respectively. Viral RNA that tested negative for the

vRNAs of ZIKV, CHIKV and DENV types 1-4 were further tested by RT-PCR using a

universal primer system for flaviviruses [191]. Virus isolation was concomitantly

attempted from all plasma samples that were found negative or borderline in these initial

RT-PCR tests. A variety of mammalian cell lines were used to cast a wide net and favor

the isolation of different viruses.

Virus Isolation in Cell Cultures

American Type Culture Collection (ATCC, Manassas, VA) cell lines A549 (human

lung adenocarcinoma epithelium; CCL-185), LLC-MK2 (rhesus monkey kidney

epithelium, CCL-7), VERO E6 (African green monkey kidney; CRL-1586) and MRC-5

(human lung fibroblast, CCL-171), WI-38 (human lung fibroblast, CCL-75), SK-N-BE(2)

(human neuroblastoma, CRL-2271) were propagated as monolayers in Gibco™

advanced Dulbecco's Modified Eagle Medium (aDMEM) (Fisher Scientific,

Cat#12491015) supplemented with 0.2 mM L-alanyl-L-glutamine (Gibco™ GlutaMAX,

Fisher Scientific, Cat# 35050-061), antibiotics [50 𝜇g/mL penicillin, 50 𝜇g/mL

streptomycin, 100 𝜇g/mL neomycin (PSN, Fisher Scientific, Cat #15640055)] and 10%

(v/v) low IgG, heat-inactivated gamma-irradiated fetal bovine serum (FBS) (HyClone,

Logan, UT) as previously described [13]. Aliquots of plasma samples (50 μL) from each

123

patient were inoculated onto sub-confluent cell lines and non-inoculated cells were

incubated in parallel with the inoculated ones at 37°C in a humidified CO2 incubator.

The cells were refed every 3 days with maintenance media and observed daily for

formation of virus-specific cytopathic effects (CPEs). The cells were observed for 26

days before being considered negative for virus isolation.

RT-PCR of vRNA Purified from Spent Cell Growth Media and Infected Cells

Viral nucleic acids were extracted from both spent cell growth media and infected

cells using QIAamp viral RNA minikit (Qiagen, Cat#52904). Standard RT-PCR for the

detection of ZIKV vRNA was performed as described by Balm et al. [192]. RT-PCR

using primers targeting specific regions of the CoV-229E matrix (M) and nucleocapsid

(N) genes were performed as previously described [193-195]. cDNA synthesis was

performed with Omniscript Reverse Transcriptase (RT) (Qiagen, Cat# 205111) in the

presence of SUPERase-In RNase inhibitor (Invitrogen Corp., Cat#AM2694) and One

Taq DNA polymerase (New England BioLabs, Cat# M0480) was used for PCR

amplification of cDNA. PCR amplicons were visualized by UV irradiation after size

separation through gel electrophoresis in a 1.5% ethidium bromide-stained agarose gel.

Purified vRNA samples extracted at various time intervals during cell culture

were also tested for the presence of DENV and ZIKV by real-time RT-PCR (rtRT-PCR)

using primers and probes described by Santiago et al. [190] and Faye et al. [188],

respectively.

Sequencing

Sequencing of ZIKV, DENV, CoV-229E genomes were performed using a

primer-walking approach and Sanger sequencing.

124

GenMark RVP Assay

Respiratory virus detection and influenza virus subtyping were performed using a

GenMark multiplex PCR eSensor XT-8 Respiratory Viral Panel (GenMark Diagnostics,

Inc., Carlsbad, CA) following the manufacturer’s instructions. This panel includes tests

for influenza A virus (including subtype determination); influenza B virus; respiratory

syncytial virus types A and B; parainfluenza virus types 1, 2, 3 and 4; human

metapneumovirus, human rhinovirus; adenovirus groups B, C and E; human

coronavirus types 229E, NL63, HKU1 and OC43. As previously described, extracted

nucleic acids from the spent cell-growth media were used to perform a multiplex

PCR/RT-PCR assay and the amplified DNA targets analyzed by electrochemical

detection [57]. After data acquisition and analysis, the instrument generates an output:

eSensor Respiratory Viral Panel Currents Report (RUO).

Results

Twenty-seven (n= 27) plasma samples collected between March 3 and May 12,

2016 were inoculated onto several cell lines and few arboviruses and a human

respiratory virus were isolated and identified from the cell culture samples. The results

are summarized in Table 7-1.

Isolation and Identification of ZIKV in Plasma Sample Cell Culture

Some of the plasma sample inoculated LLC-MK2 and VERO E6 cells showed

CPE 17dpi, which were characteristic of ZIKV infection: prominent perinuclear vacuoles

in LLC-MK2 and VERO E6 cells, cell rounding and death with overall destruction of the

cell monolayer (Figure 7-1). CPE appeared earlier in inoculated LLC-MK2 than in VERO

E6 cells. Viral RNA extracted from the cell spent growth media and infected cells tested

positive for ZIKV by both conventional (Figure 7-5) and real-time RT-PCR.

125

Isolation and Identification of DENV-3 in Plasma Sample Cell Culture

MRC-5 and VERO E6 cells inoculated with some plasma samples exhibited CPE

consistent with DENV infection. Diffuse cytopathic effects were observed in some of the

VERO E6 cell lines 26dpi and MRC-5 cells showing blebbing, cell rounding, followed by

destruction of the monolayer within 8dpi-13dpi. CPE in MRC-5 cells appeared earlier

than in VERO cells and were suggestive of DENV infection. Real-time RT-PCR using

extracted viral RNA from cell culture samples confirmed the presence of DENV type 3 in

the plasma samples (Fig 7-2; Table 7-1).

Co-infection of Plasma Cell Culture with ZIKV and DENV-4

A more intriguing pattern of CPE was observed in LLC-MK2 and VERO E6 cells

inoculated with plasma sample collected between April and May 2016. Within 4 days

post-inoculation, LLC-MK2 cells exhibited perinuclear vacuoles which appeared in

distinct clusters throughout the cell monolayer. As the CPE progression was followed

over the next few days, a diffuse cytopathic effect began to emerge and take over the

cell monolayer with the vacuoles gradually starting to diminish (Fig 7-3). By 8dpi, the

LLC-MK2 monolayer was almost destroyed. Similar pattern of CPE was also observed

in the inoculated VERO E6 cells (Fig 7-4). Real-time RT-PCR and sequencing results

confirmed that the cells were co-infected with two arboviruses: ZIKV and DENV-4.

Isolation and Identification of Human coronavirus 229E (CoV-229E)

Some cell cultures inoculated with one plasma sample (collected on March 8)

displayed CPEs that were distinct from what would be expected in cells infected with

alpha- and flaviviruses (Fig 7-6). The CPE observed were suggestive of those caused

usually by human respiratory viruses: vacuolation of cells, formation of syncytia,

followed by clumping and detachment of cells from the monolayer. The CPE were most

126

obvious in MRC-5 and VERO E6 cells and less apparent in LLC-MK2 cells. As some

respiratory virus strains replicate and produce progeny in the cells without causing

easily observed CPE, the spent cell-growth media from the inoculated cells was

periodically tested using molecular assay for the detection of possible viral agents. Viral

genomic RNA extracted from cell lysates and virions in spent culture media from three

inoculated cell lines (LLC-MK2, VERO E6 and MRC-5) were identified as CoV-229E by

the GenMark RVP system (Fig 7-7). GenMark RVP detection of CoV-229E was further

confirmed by RT-PCR assays using primers targeting specific regions of the CoV-229E

matrix (M) and nucleocapsid (N) genes and by sequencing of CoV-229E whole genome.

Discussion

Arboviral infections are believed to be prevalent in Haiti for many years. DENV,

first reported in 1976, is now considered endemic in Haiti [196]. ZIKV, an emerging

pathogen apparently introduced from French Polynesia and Easter Island in 2013-2014,

have reached Haiti and different parts of the Americas [197]. A previous study by the UF

researchers reported isolation of ZIKV from 3 children who were seen at a school clinic

in the Gressier region of Haiti in December 2014 [198]. Since DENV and ZIKV,

members of the Flaviviridae family, are both transmitted by Aedes mosquito vectors, co-

infection in human with ZIKV and DENV may not be surprising [199]. In fact,

researchers at UF have previously reported co-infection of ZIKV and DENV-2 in a

traveler returning from Haiti [200]. In the present study, ZIKV and DENV-3 were isolated

from different patient plasma cell cultures while many of the cell cultures (15 out of 27

samples tested) were co-infected with ZIKV and DENV-4. It is intriguing to observe the

diversity of arboviruses isolated from plasma samples collected just over a period of 3

months, suggesting more than one type of DENV and ZIKV may have been circulating

127

among Haitian population during that period. The CPE induced by ZIKV-DENV type 4

co-infection and its progression over time was also worth observing, where an earlier

appearance of ZIKV CPE was followed by DENV-4 CPE gradually taking over the cell

monolayer as time progressed. However, the dynamics of these two co-infecting viruses

in the patients remains unknown. In vitro studies have suggested that DENV antibodies

can enhance ZIKV infection [201]. Also, infections caused by these two flaviviruses are

often asymptomatic [197, 202]. When symptoms do occur, they tend to be quite similar.

Therefore, the impacts of co-infection of ZIKV-DENV type 4 in these patients remain to

be determined.

Except for one sample (Accession# 16-1-1480, collected May 11, 2016; positive

for DENV-3), all other plasma samples came out negative for ZIKV and DENV in the

initial RT-PCR based screening. As these viruses are most likely to be detected in blood

samples approximately 1 week after symptom onset [203], a low-level viremia at any

point during infection could lead to false negative RT-PCR results. For better diagnosis

and risk assessment, suspected arbovirus-containing human samples can be inoculated

onto susceptible cell lines which may allow for virus replication and subsequent

detection of viral RNA by RT-PCR [204].

In this study, CoV-229E was isolated from a single plasma sample cell culture.

The sample was obtained on March 8, from one of the 27 children with febrile illness but

with no apparent respiratory symptoms. No ZIKV or DENV was detected in this specific

plasma sample or in the inoculated cell cultures. Since the study was focused mainly on

arbovirus detection, blood samples were not collected from children exhibiting

respiratory symptoms. Isolation of CoV-229E from blood in one of these children was

128

rather unexpected, and to our knowledge, has not been reported previously from Haiti.

CoV-229E is usually associated with respiratory diseases of varying severity ranging

from common cold to pneumonia [7]. Besides respiratory ailments, it has also been

implicated in neurological diseases in humans [205]. It is unclear if there were more

children infected with coronaviruses during that period and the impact of viremia in this

child with only febrile illness also remains unknown. A thorough investigation focusing

on respiratory infections among these children could shed some more light on the

dynamics of respiratory infections in a place where arboviral infections are also

prevalent.

This study was conducted on a limited number of plasma samples. It,

nevertheless, provided a learning opportunity to investigate the diversity of arboviruses

and concomitant presence of respiratory virus in rural Haiti. The findings reiterate the

importance of virus isolation using the appropriate cell lines and proper cell culture

techniques in diagnostic virology.

129

Figure 7-1. Appearance of ZIKV-induced CPE in LLC-MK2 and VERO E6 cells. A) Normal LLC-MK2 cells. B) Perinuclear vacuolation of LLC-MK2 cells 17 days post infection (pi) at 37˚C. C) Normal VERO E6 cells. D) Vacuolation of VERO E6 cells and destruction of the monolayer 17 days post infection (pi) at 37˚C. All original images are at 400X magnification.

130

Figure 7-2. Appearance of DENV-induced CPE in VERO E6 and MRC-5 cells A) Normal VERO E6 cells. B) Diffuse cytopathic effects in VERO E6 cells 26 days post infection (pi) at 37˚C. C) Normal MRC-5 cells. D) Blebbing, cell rounding and destruction of MRC-5 monolayer 8 days post infection (pi) at 37˚C. All original images are at 400X magnification.

131

Figure 7-3. Appearance of CPE in LLC-MK2 cells induced by ZIKV-DENV co-infection. A) Normal LLC-MK2 cells; B), & C) Perinuclear vacuolation of LLC-MK2 cells 4 days post infection (pi) followed by; D) & E) diffuse cytopathic effects and destruction of monolayer 6 days pi and F) 8 days pi at 37˚C. All original images are at 400X magnification.

132

Figure 7-4. Appearance of CPE in VERO E6 cells induced by ZIKV-DENV co-infection. A) Normal VERO E6 cells. B) Vacuolation of VERO E6 cells 6 days post infection (pi) at 37˚C; followed by C) & D) diffuse cytopathic effects throughout the monolayer 8 days pi at 37˚C. All original images are at 400X magnification.

133

Figure 7-5. Representative results of RT-PCR detection of Zika virus in LLC-MK2 cells inoculated with patient plasma samples. From left to right: Lane 1, 100 bp MW markers; Lane 2, Zika virus positive control; Lane 3, negative control; Lane 4, Plasma sample#11 inoculated cells and Lane 5, Plasma sample#12 inoculated cells, both 17 days post infection (pi) at 37˚C. Virus-specific 192-bp PCR products amplified by Balm primers are present in lanes 2, 4 and 5.

134

Figure 7-6. Appearance of VERO E6 and MRC-5 cells during cell culture. A) Normal VERO E6 cells. B) Cell clumps and destruction of VERO E6 monolayer 14 days post infection (pi) at 37˚C. C) Normal MRC-5 cells. D) Vacuolation and rounding of MRC-5 cells and destruction of the monolayer 14 days post infection (pi) at 37˚C. All original images are at 400X magnification.

135

Figure 7-7. Representative eSensor Respiratory Viral Panel currents report (RUO)

136

Table 7-1. Haiti plasma sample cell culture report

Sample accession#

Collection date

Cell lines Virus isolated & detected A549 MRC-5 WI-38 LLC-

MK2 VERO E6

SK-N-BE(2)

16-1-1582 03.03.16 * + * - + * DENV-3 16-1-1583 03.03.16 * + * - + * DENV-3 16-1-1584 03.04.16 * + * - + * DENV-3 16-1-1585 03.08.16 * + * + + * CoV-229E 16-1-1586 03.10.16 * + * - + * DENV-3 16-1-1587 03.10.16 * - * + + * ZIKV 16-1-1588 03.11.16 * - * + + * ZIKV 16-1-1580 04.04.16 * + * - + * DENV-3 16-1-1581 04.05.16 * + * - + * DENV-3 16-1-1543 04.06.16 - * - + + - ZIKV, DENV-4

16-1-1544 04.06.16 - * - + + - ZIKV, DENV-4

16-1-1545 04.06.16 - * - + + - ZIKV, DENV-4

16-1-1533 04.14.16 - * - + + - ZIKV, DENV-4

16-1-1534 04.15.16 - * - - - -

16-1-1537 04.15.16 - * - + + - ZIKV, DENV-4 16-1-1540 04.18.16 - * - + + - ZIKV, DENV-4 16-1-1542 04.20.16 - * - + + - ZIKV, DENV-4 16-1-1529 04.22.16 - * - + + - ZIKV, DENV-4 16-1-1530 04.25.16 - * - + + - ZIKV, DENV-4

137


Sample accession#

Collection date

Cell lines Virus isolated & detected A549 MRC-5 WI-38 LLC-

MK2 VERO E6

SK-N-BE(2)

16-1-1663 05.09.16 - * - + + - ZIKV, DENV-4 16-1-1487 05.10.16 - * - + + - ZIKV, DENV-4

16-1-1488 05.10.16 - * - + + - ZIKV, DENV-4 16-1-1489 05.10.16 - * - + + - ZIKV, DENV-4 16-1-1492 05.10.16 - * - + + - ZIKV, DENV-4 16-1-1479 05.11.16 * + * - + * DENV-3 16-1-1480 05.11.16 * + * - + * DENV-3 16-1-1483 05.12.16 - * - + + - ZIKV, DENV-4 * Cell line not used + CPE observed - CPE not observed DENV-3, Dengue virus type 3; CoV-229E, Coronavirus 229E; ZIKV, Zika virus; DENV-4, Dengue virus type 4

138

CHAPTER 8 CONCLUDING REMARKS

In this dissertation, attempts were made to detect, isolate and identify various

viruses, including human respiratory viruses, and arboviruses, from a variety of human

specimens and environmental samples. A combination of virus isolation in cell-culture

and PCR-based techniques were used to accomplish the tasks. This work was

performed in partial fulfillment of the requirements for the degree of doctor of philosophy

in public health, and to gain theoretical and practical knowledge in diagnostic and

applied virology for a career in public health microbiology. As shown in the body of work

presented here, the mating of cell-culture isolation of viruses with antigen and/or virus-

genome based detection methods can prove effective for virology-related health risk

assessments and surveillance. However, success depends on fine-tuning these

techniques relative to the virus in question. Starting from specimen/sample to virus

identification, every step requires careful consideration and planning regarding: (a)

choice of specimen/sample and manner of collection, (b) sample transport and storage,

(c) sample processing, (d) choice of appropriate cell-lines or primary cells for virus

isolation, and their maintenance, (e) use of proper optics for microscopy of virus-

infected cell cultures, and (f) antigenic and genome-based detection methods. Some

takeaway points and ideas for future research based on the findings of the body of work

presented in this dissertation are as follows:

As described in Chapter 1, the work undertaken in this dissertation had five

specific aims focusing on two broad categories of viruses: human respiratory viruses

and arboviruses. To advance our understanding of respiratory virus transmission and

investigate Florida bats as reservoirs of coronaviruses that might be potentially

139

pathogenic to humans, attempts were made to detect, isolate and identify these viruses

from aerosols, environmental surfaces and bat feces. For collection of viable virus

aerosols, three different air sampling devices were evaluated: a Sioutas Personal

Cascade Impactor Sampler (PCIS) with polytetrafluoroethylene filters, an SKC

BioSampler, and the VIVAS. Airborne viruses were successfully collected by all three

samplers, though their collection efficiencies and their abilities to retain virus infectivity

varied. For example, EV-D68 genome equivalents were detected from classroom air but

no viable EV-D68 was isolated in cell culture. It may be the case that the collected EV-

D68 genomes were inactivated by impaction onto the filters, though the collected

viruses may have been inactivated by drying as the sampled air was pulled through the

PCIS. When modified parameters (developed by our research group) were used instead

of standard operating procedures, the collection efficiency of the SKC BioSampler for

virus aerosols was improved but still considered sub-optimal. Nevertheless, viable

viruses were collected during air samplings performed during a late influenza outbreak

in spring and post-Thanksgiving 2016. Of the three different air sampling devices that

were tested under field conditions, the VIVAS out-performed the SKC BioSampler and

PCIS. To reduce the chances of collecting large expired/coughed/sneezed droplets, the

VIVAS was positioned at least 2 m away from seated patients during air sampling. And

indeed, viable (infectious) IFV and other respiratory viruses were isolated and identified

from these samples, suggesting that the patients’ respiratory actions produced small

aerosols containing infectious viruses.

However, as the VIVAS enlarges the size of the aerosol particles during

collection, the actual size of the collected particles in which viable viruses were present

140

was not determined. Future research could employ a particle sizer to characterize the

size distribution of the particles being collected prior to size amplification. This would

provide insights on the potential risk posed by the aerosols, especially with regard to

small particle aerosols that are breathed deep into the LRT, as deposition of respiratory

viruses therein can lead to pneumonia.

Viruses differ in their dimension and biophysical and external biochemical

properties. For example, non-enveloped viruses are usually hydrophilic, and enveloped

viruses hydrophobic. Apart from MS2 (a non-enveloped bacteriophage) and influenza A

H1N1 viruses (which are enveloped viruses), the collection efficiencies of the VIVAS for

other laboratory- generated aerosolized viruses are not known. It is important to find out

if the device works equally well for collecting hydrophilic (e.g. human adenovirus) and

other hydrophobic human respiratory viruses, and whether the collection media should

be adjusted so it is polar for hydrophilic and non-polar for hydrophobic viruses. As the

concentration of airborne viruses in ambient air is typically low, it would be informative

to test the collection efficiency of the VIVAS for different concentrations of various types

of aerosolized viruses.

Infections caused by many respiratory viruses can lead to severe disease

manifestations and complications, especially in children, elderly and the

immunocompromised. For instance, complications of the flu can include infections of the

ear (otitis media) and sinuses (sinusitis), pneumonia (caused by viral or secondary

bacterial infection), bronchitis, inflammation of the heart (myocarditis), brain

(encephalitis), muscle tissues (myositis, rhabdomyolysis), multi-organ failure (e.g.

respiratory and kidney failure), and exacerbation of chronic medical conditions like

141

asthma, congestive heart disease, or diabetes [206]. Since many of these complications

are life-threatening, it would be interesting to test the air facilities housing pediatric and

immunocompromised patients or in assisted living facilities for the elderly using the

VIVAS. If viable viruses are found in the ambient air using the VIVAS, and on high-touch

surfaces by surface sampling, additional infection control and prevention strategies

could be devised to help protect these groups of vulnerable populations from

preventable infections.

Detection of viable CoV-229E and the genomes of rhinovirus and EV-D68 on

classroom surfaces reinforces the notion that contact transmission may be a route of

transmission for these respiratory viruses in a classroom or similar setting. The high

degree of nucleotide sequence similarities of the environmental strains of CoV-229E

and EV-D68 to the clinical isolates suggests these viruses may have similar emitting

source(s). A broader study might include linking the virus to the person (s) shedding the

virus by simultaneous collection of clinical specimens from symptomatic individuals in

indoor settings and environmental samples from the same settings, followed by

attempts to isolate and identify human respiratory viruses from these specimens and

samples. The efficacy against common human respiratory viruses of alcohol ethoxylates

(AE), which had been used for cleaning of the classroom surfaces, was not investigated

in the studies presented in this dissertation. Given that the minimum infective dose of a

respiratory virus can be very low [130], it is worth performing independent evaluations of

commonly used cleaning and disinfecting agents against these common human

respiratory viruses.

142

The thirteen different bat species found in Florida, 12 of which are year-round

residents, may harbor viruses that can infect and cause illnesses in humans. In

particular, bats have been identified as natural hosts of coronaviruses that cause

severe/fatal infections in humans, and they are known to harbor other viruses such as

Rabies virus and paramyxoviruses that can also cause lethal infections in humans.

From a public health standpoint, a proactive approach should be taken with regards to

surveillance of Florida bats for potential human pathogens. In the study presented in

Chapter 6, alphacoronavirus RdRp gene sequence was detected in 2 out of 19 feces

specimens from presumably healthy Brazilian free-tailed bats in Florida. The high

degree of sequence similarity of the Florida BtCoV with that of a Brazilian BtCoV from

two different bat species (T. brasiliensis and M. molossus) [180] suggests that similar

CoVs may be present in different bat species and across geographically distant regions.

Future efforts at the identification/isolation of known or novel bat viruses should include

testing of different types of bat specimens and the use of primary bat cells (e.g. cells

from bat trachea, lungs, kidney, intestine etc.) for virus isolation.

Due to abundance of mosquito vectors, mosquito-borne infections are endemic in

Haiti. In the study described in Chapter 7, virus isolation and identification were

attempted on plasma derived from twenty-seven (n= 27) blood specimens collected

from children with undifferentiated febrile illnesses. Cell-cultures inoculated with 15 out

of 27 plasma specimens were co-infected with two arboviruses: ZIKV and DENV type 4.

Some other cell culture samples were positive only for ZIKV or DENV type 3.

Remarkably, CoV-229E was also isolated from a single plasma sample. The findings

suggest co-circulation of multiple arboviruses in Haiti during March-May 2016. In

143

addition, the isolation of CoV-229E from plasma serves as a reminder that multiple viral

agents cause febrile illnesses, and during an outbreak, undifferentiated fevers cannot

be assumed to have a common cause. Further investigations will shed more light on the

diversity of arboviral and respiratory virus infections among Haitians and also improve

understanding on the impacts of arbovirus co-infections in patients.

144

LIST OF REFERENCES

1. Ferkol T, Schraufnagel D. 2014. The global burden of respiratory disease. Ann Am Thorac Soc 11(3):404-6.

2. Centers for Disease Control and Prevention. 2017. Disease burden of influenza. Centers for Disease Control and Prevention, Atlanta, GA. https://www.cdc.gov/flu/about/disease/burden.htm

3. Mäkelä MJ, Puhakka T, Ruuskanen O, Leinonen M, Saikku P, Kimpimäki M, Blomqvist S, Hyypiä T, Arstila P. 1998. Viruses and bacteria in the etiology of the common cold. J Clin Microbiol 36(2):539-42.

4. Jacobs SE, Lamson DM, George KS, Walsh TJ. 2013. Human rhinoviruses. Clin

Microbiol Rev 26(1):135-62. 5. Borchers AT, Chang C, Gershwin ME, Gershwin LJ. 2013. Respiratory syncytial

virus—a comprehensive review. Clin Rev Allergy Immunol 45(3):331-79. 6. Panda S, Mohakud NK, Pena L, Kumar S. 2014. Human metapneumovirus:

review of an important respiratory pathogen. Int J Infect Dis 25:45-52. 7. Pene F, Merlat A, Vabret A, Rozenberg F, Buzyn A, Dreyfus F, Cariou A,

Freymuth F, Lebon P. 2003. Coronavirus 229E-related pneumonia in immunocompromised patients. Clin Infect Dis 37(7):929-32.

8. Henrickson KJ. 2003. Parainfluenza viruses. Clin Microbiol Rev 16(2):242-64.

9. Lenaerts L, De Clercq E, Naesens L. 2008. Clinical features and treatment of

adenovirus infections. Rev Med Virol 18(6):357-74.

10. Stalkup JR, Chilukuri S. 2002. Enterovirus infections: a review of clinical presentation, diagnosis, and treatment. Dermatol Clin 20(2):217-23.

11. Lednicky JA, Loeb JC. 2013. Detection and isolation of airborne influenza A

H3N2 virus using a Sioutas Personal Cascade Impactor Sampler. Influenza Res Treat 2013: 8 pages.

12. Musher DM. 2003. How contagious are common respiratory tract infections? N

Engl J Med 348(13):1256-66.

13. Pillai SD, Ricke SC. 2002. Review/Synthèse Bioaerosols from municipal and animal wastes: background and contemporary issues. Can J Microbiol 48(8):681-96.

14. Killingley B, Nguyen‐Van‐Tam J. 2013. Routes of influenza transmission.

Influenza Other Respir Viruses 7(s2):42-51.

https://www.cdc.gov/flu/about/disease/burden.htm

145

15. Tellier R. 2009. Aerosol transmission of influenza A virus: a review of new studies. J R Soc Interface 6:S783–S790.

16. Teunis PF, Brienen N, Kretzschmar ME. 2010. High infectivity and pathogenicity

of influenza A virus via aerosol and droplet transmission. Epidemics 2(4):215–222.

17. Fennelly KP, Tribby MD, Wu CY, Heil GL, Radonovich LJ, Loeb JC, Lednicky JA.

2015. Collection and measurement of aerosols of viable influenza virus in liquid media in an Andersen cascade impactor. Virus Adapt Treat 7:1-9.

18. Belser JA, Gustin KM, Katz JM, Maines TR, Tumpey TM. 2014. Influenza virus

infectivity and virulence following ocular-only aerosol inoculation of ferrets. J Virol 88(17):9647-54.

19. Bonny TS, Pan M, Loeb JC, Jiang X, Eiguren-Fernandez A, Hering S, Fan ZH,

Wu CY, Lednicky JA. 2017. Drifted Influenza A and B Viruses Collected by a Water-Based Condensation Growth Air Sampler in a Student Health Care Center during an Influenza Outbreak. Genome Announc 5(15):e00178-17.

20. Stelzer‐Braid S, Oliver BG, Blazey AJ, Argent E, Newsome TP, Rawlinson WD,

Tovey ER. 2009. Exhalation of respiratory viruses by breathing, coughing, and talking. J Med Virol 81(9):1674-9.

21. Lednicky JA, Hamilton SB, Tuttle RS, Sosna WA, Daniels DE, Swayne DE. 2010.

Ferrets develop fatal influenza after inhaling small particle aerosols of highly pathogenic avian influenza virus A/Vietnam/1203/2004 (H5N1). Virol J 7(1):231.

22. Alford RH, Kasel JA, Gerone PJ, Knight V. 1966. Human influenza resulting from

aerosol inhalation. Proc Soc Exp Biol Med 122(3):800-4.

23. Tellier R. 2006. Review of Aerosol Transmission of Influenza A Virus. Emerg Infect Dis 12(11).

24. Kowalski W. 2011. Hospital airborne infection control. CRC Press, Taylor &

Francis group, Boca Raton, FL 33487.

25. Verreault D, Moineau S, Duchaine C. 2008. Methods for sampling of airborne viruses. Microbiol Mol Biol Rev 72(3):413-44.

26. Fabian P, McDevitt JJ, Houseman EA, Milton DK. 2009. Airborne influenza virus

detection with four aerosol samplers using molecular and infectivity assays: considerations for a new infectious virus aerosol sampler. Indoor Air 19(5):433–441.

146

27. Fabian P, McDevitt JJ, Lee WM, Houseman EA, Milton DK. 2009. An optimized method to detect influenza virus and human rhinovirus from exhaled breath and the airborne environment. J Environ Monit 11(2):314–317.

28. Sattar SA, Bhardwaj N, Ijaz MK. 2016. Airborne viruses, p 3-2. In Manual of

Environmental Microbiology,4th ed, American Society of Microbiology.

29. Oh S, Anwar D, Theodore A, Lee JH, Wu CY, Wander J. 2010. Development and evaluation of a novel bioaerosol amplification unit (BAU) for improved viral aerosol collection. J Aerosol Sci 41(9): 889–894.

30. Tseng CC, Li CS. 2005. Collection efficiencies of aerosol samplers for virus-

containing aerosols. J Aerosol Sci 36(5–6):593–607.

31. Reponen T, Willeke K, Ulevicius V, Grinshpun SA, Donnelly J. 1997. Techniques for dispersion of microorganisms into air. Aerosol Sci Technol 27(3):405–421.

32. Woo MH, Grippin A, Anwar D, Smith T, Wu CY, Wander JD. 2012. Effects of

relative humidity and spraying medium on UV decontamination of filters loaded

with viral aerosols. Appl Environ Microbiol 78(16): 5781–5787.

33. Woo MH, Hsu YM, Wu CY, Heimbuch B, Wander J. 2010. Method for contamination of filtering facepiece respirators by deposition of MS2 viral

aerosols. J Aerosol Sci 41(10):944–952.

34. Mayer SV, Tesh RB, Vasilakis N. 2017. The emergence of arthropod-borne viral diseases: A global prospective on dengue, chikungunya and zika fevers. Acta Tropica 166:155-63.

35. Liang G, Gao X, Gould EA. 2015. Factors responsible for the emergence of

arboviruses; strategies, challenges and limitations for their control. Emerg Microbes Infect 4(3):e18.

36. Calisher CH. 1994. Medically important arboviruses of the United States and

Canada. Clin Microbiol Rev 7(1):89-116.

37. Shragai T, Tesla B, Murdock C, Harrington LC. 2017. Zika and chikungunya:

mosquito‐borne viruses in a changing world. Ann N Y Acad Sci, in press. DOI:

10.1111/nyas.13306

38. Grinshpun SA, Willeke K, Ulevicius V, Juozaitis A, Terzieva S, Donnelly J, Stelma GN, Brenner KP. 1997. Effect of impaction, bounce and reaerosolization on the collection efficiency of impingers. Aerosol Sci Technol 26(4):326-42.

39. Willeke K, Lin X, Grinshpun SA. 1998. Improved aerosol collection by combined

impaction and centrifugal motion. Aerosol Sci Technol 28(5):439-56.

147

40. Hogan CJ, Kettleson EM, Lee MH, Ramaswami B, Angenent LT, Biswas P. 2005. Sampling methodologies and dosage assessment techniques for submicrometre and ultrafine virus aerosol particles. J Appl Microbiol 99(6):1422-34.

41. Lindsley WG, Blachere FM, Thewlis RE, Vishnu A, Davis KA, Cao G, Palmer JE, Clark KE, Fisher MA, Khakoo R, Beezhold DH. 2010. Measurements of airborne influenza virus in aerosol particles from human coughs. PloS one 5(11):e15100.

42. Lindsley WG, Noti JD, Blachere FM, Thewlis RE, Martin SB, Othumpangat S,

Noorbakhsh B, Goldsmith WT, Vishnu A, Palmer JE, Clark KE. 2015. Viable influenza A virus in airborne particles from human coughs. J Occup Environ Hyg 12(2):107-13.

43. Riemenschneider L, Woo MH, Wu CY, Lundgren D, Wander J, Lee JH, Li HW,

Heimbuch B. 2010. Characterization of reaerosolization from impingers in an effort to improve airborne virus sampling. J Appl Microbiol 108(1):315-24.

44. Anwar D, Oh S, Wu CY. 2010. Senior thesis. Virus collection efficiency of

biosampler versus impinger with variable time and flow rate. University of Florida, Gainesville, FL.

45. Memish ZA, Almasri M, Assirri A, Al-Shangiti AM, Gray GC, Lednicky JA, Yezli S.

2014. Environmental sampling for respiratory pathogens in Jeddah airport during the 2013 Hajj season. Am J Infect Control 42(12):1266-9.

46. Lednicky J, Pan M, Loeb J, Hsieh H, Eiguren-Fernandez A, Hering S, Fan ZH,

Wu CY. 2016. Highly efficient collection of infectious pandemic influenza H1N1 virus (2009) through laminar-flow water based condensation. Aerosol Sci Technol 50(7):i-v.

47. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, Wang H, Crameri G, Hu Z,

Zhang H, Zhang J. 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310(5748):676-9.

48. Lau SK, Woo PC, Li KS, Huang Y, Tsoi HW, Wong BH, Wong SS, Leung SY,

Chan KH, Yuen KY. 2005. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci USA 102(39):14040-5.

49. Anthony SJ, Ojeda-Flores R, Rico-Chavez O, Navarrete-Macias I, Zambrana-

Torrelio CM, Rostal MK, Epstein JH, Tipps T, Liang E, Sanchez-Leon M, Sotomayor-Bonilla J. 2013. Coronaviruses in bats from Mexico. J Gen Virol 94(5):1028-38.

148

50. Pan M, Eiguren‐Fernandez A, Hsieh H, Afshar‐Mohajer N, Hering SV, Lednicky

J, Hugh Fan Z, Wu CY. 2016. Efficient collection of viable virus aerosol through

laminar‐flow, water‐based condensational particle growth. J Appl Microbiol

120(3):805-15.

51. Lin X, Willeke K, Ulevicius V, Grinshpun SA. 1997. Effect of sampling time on the collection efficiency of all-glass impingers. AIHA J 58(7):480-8.

52. Agranovski IE, Safatov AS, Borodulin AI, Pyankov OV, Petrishchenko VA,

Sergeev AN, Agafonov AP, Ignatiev GM, Sergeev AA, Agranovski V. 2004. Inactivation of viruses in bubbling processes utilized for personal bioaerosol monitoring. Appl Environ Microbiol 70(12):6963-7.

53. Lin X, Reponen T, Willeke K, Wang Z, Grinshpun SA, Trunov M. 2000. Survival

of airborne microorganisms during swirling aerosol collection. Aerosol Sci Technol 32(3):184–196.

54. Fennelly KP, Tribby MD, Wu CY, Heil GL, Radonovich LJ, Loeb JC, Lednicky JA.

2015. Collection and measurement of aerosols of viable influenza virus in liquid media in an Andersen cascade impactor. Virus Adapt Treat 7:1-9.

55. Anderson BD, Ma M, Xia Y, Wang T, Shu B, Lednicky JA, Ma MJ, Lu J, Gray

GC. 2016. Bioaerosol sampling in modern agriculture: a novel approach for emerging pathogen surveillance? J Infect Dis 214(4):537-45.

56. Lednicky JA, Waltzek TB, McGeehan E, Loeb JC, Hamilton SB, Luetke MC.

2013. Isolation and genetic characterization of human coronavirus NL63 in primary human renal proximal tubular epithelial cells obtained from a commercial supplier, and confirmation of its replication in two different types of human primary kidney cells. Virol J 10(1):213.

57. Pierce VM, Hodinka RL. 2012. Comparison of the GenMark Diagnostics eSensor

respiratory viral panel to real-time PCR for detection of respiratory viruses in children. J. Clin Microbiol 50(11):3458-65.

58. Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR. 2001. Universal primer

set for the full-length amplification of all influenza A viruses. Arch Virol 146(12):2275-89.

59. WHO. WHO information for molecular diagnosis of influenza virus

(http://www.who.int/influenza/gisrs_laboratory/molecular_diagnosis_influenza_virus_humans_update_201403rev201505.pdf?ua=1)

http://www.who.int/influenza/gisrs_laboratory/molecular_diagnosis_influenza_virus_humans_update_201403rev201505.pdf?ua=1)

http://www.who.int/influenza/gisrs_laboratory/molecular_diagnosis_influenza_virus_humans_update_201403rev201505.pdf?ua=1)

149

60. Iovine NM, Morris Jr JG, Fredenburg K, Rand K, Alnuaimat H, Lipori G, Brew J, Lednicky JA. 2015. Severity of Influenza A (H1N1) Illness and Emergence of D225G Variant, 2013–14 Influenza Season, Florida, USA. Emerg Infect Dis 21(4):664.

61. Lednicky JA, Iovine NM, Brew J, Loeb JC, Sugimoto JD, Rand KH, Morris Jr JG.

2016. Hemagglutinin Gene Clade 3C. 2a Influenza A (H3N2) Viruses, Alachua County, Florida, USA, 2014–15. Emerg Infect Dis 22(1):121.

62. Briese T, Palacios G, Kokoris M, Jabado O, Liu Z, Renwick N, Kapoor V, Casas

I, Pozo F, Limberger R, Perez-Brena P, Ju J, Lipkin WI. 2005. Diagnostic system for rapid and sensitive differential detection of pathogens. Emerg Infect Dis 11:310-313.

63. Rubinas TC, Carey RB, Kampert MC, Alkan S, Lednicky JA. 2004. Fatal

hemorrhagic pneumonia concomitant with Chlamydia pneumoniae and parainfluenza virus 4 infection. Arch Pathol Lab Med 128:640-644

64. Lednicky JA, Waltzek TB, Halpern MD, Hamilton SB. 2012. Comparative

Analysis of the Full-Length Genome Sequence of a Clinical Isolate of Human Parainfluenza Virus 4B. Scientifica (Cairo) 2012

65. Moës E, Vijgen L, Keyaerts E, Zlateva K, Li S, Maes P, Pyrc K, Berkhout B, van

der Hoek L, Van Ranst M. 2005. A novel pancoronavirus RT-PCR assay: frequent detection of human coronavirus NL63 in children hospitalized with respiratory tract infections in Belgium. BMC Infect Dis 1:6.

66. European Centre for Disease Prevention and Control. September 2015.

Influenza virus characterization, summary Europe. European Centre for Disease Prevention and Control, Solna, Sweden. http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-september-2015.pdf.

67. Bridges CB, Kuehnert MJ, Hall CB. 2003. Transmission of influenza: Implications

for control in health care settings. Clin Infect Dis 37 (8):1094-1101.

68. Seto WH. 2015. Airborne transmission and precautions: facts and myths. J Hosp Infect 89(4):225-228.

69. Singh N, Manshian B, Jenkins GJ, Griffiths SM, Williams PM, Maffeis TG, Wright

CJ, Doak SH. 2009. NanoGenotoxicology: the DNA damaging potential of engineered nanomaterials. Biomaterials 30(23):3891-914.

70. Rao CNR, Müller A, Cheetham AK. 2006.The chemistry of nanomaterials:

synthesis, properties and applications: John Wiley & Sons, Hoboken, NJ.

http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-september-2015.pdf

http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-september-2015.pdf

150

71. Blachere FM, Lindsley WG, Pearce TA, Anderson SE, Fisher M, Khakoo R, Meade BJ, Lander O, Davis S, Thewlis RE, Celik I, Chen BT, Beezhold DH. 2009. Measurement of Airborne Influenza Virus in a Hospital Emergency Department. Clin Infect Dis 48(4):438-440.

72. Milton DK, Fabian MP, Cowling BJ, Grantham ML, McDevitt JJ. 2013. Influenza

virus aerosols in human exhaled breath: particle size, culturability, and effect of surgical masks. PLoS Pathog 9(3):e1003205.

73. Hering SV, Stolzenburg MR. 2005. A method for particle size amplification by

water condensation in a laminar, thermally diffusive flow. Aerosol Sci Technol 39(5):428-436.

74. Hering SV, Stolzenburg MR, Quant FR, Oberreit DR, Keady PB. 2005. A laminar-

flow, water-based condensation particle counter (WCPC). Aerosol Sci Technol 39(7):659-672.

75. Lewis GS, Hering SV. 2013. Minimizing concentration effects in water-based,

laminar-flow condensation particle counters. Aerosol Sci Technol 47(6):645-54.

76. Florida Health. 2016. Florida Influenza Surveillance Reports. Florida Department of Health, Tallahassee, Florida 32399 http://www.floridahealth.gov/diseases-and-conditions/influenza/index.html.

77. Pan M, Eiguren-Fernandez A, Hsieh H, Afshar-Mohajer N, Hering SV, Lednicky

J, Fan ZH, Wu CY. 2016. Efficient collection of viable virus aerosol through laminar-flow, water-based condensational particle growth. J Appl Microbiol 120(3):805-815.

78. Dybwad M, Skogan G, Blatny JM. 2014. Comparative Testing and Evaluation of

Nine Different Air Samplers: End-to-End Sampling Efficiencies as Specific Performance Measurements for Bioaerosol Applications. Aerosol Sci Technol 48(3):282-295.

79. Lednicky JA and Wyatt DE. 2012. The Art of Animal Cell Culture for Virus

Isolation. In Ceccherini-Nelli L (ed), Biomedical Tissue Culture. InTech, DOI: 10.5772/51215.

80. Iovine NM, Morris JG, Fredenburg K, Rand K, Alnuaimat H, Lipori G, Brew J,

Lednicky JA. 2015. Severity of Influenza A(H1N1) Illness and Emergence of D225G Variant, 2013-14 Influenza Season, Florida, USA. Emerg Infect Dis 21(4):664-667.

81. Lednicky JA, Lovine NM, Brew J, Loeb JC, Sugimoto JD, Rand KH, Morris JG.

2016. Hemagglutinin Gene Clade 3C.2a Influenza A(H3N2) Viruses, Alachua County, Florida, USA, 2014-15. Emerg Infect Dis 22(1):121-123.

http://www.floridahealth.gov/diseases-and-conditions/influenza/index.html

http://www.floridahealth.gov/diseases-and-conditions/influenza/index.html

151

82. European Centre for Disease Prevention and Control. June 2013. Influenza Virus Characterisation, Summary Europe. European Centre for Disease Prevention and Control, Solna, Sweden. http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-june-2013.pdf.

83. Walls HJ, Ensor DS, Harvey LA, Kim JH, Chartier RT, Hering SV, Spielman SR,

Lewis GS. 2016. Generation and sampling of nanoscale infectious viral aerosols. Aerosol Sci Technol 50(8):802-11.

84. Hering SV, Spielman SR, Lewis GS. 2014. Moderated, water-based,

condensational particle growth in a laminar flow Aerosol Sci Technol 48(4):401-8.

85. Noti JD, Blachere FM, McMillen CM, Lindsley WG, Kashon ML, Slaughter DR, Beezhold DH. 2013. High humidity leads to loss of infectious influenza virus from simulated coughs. PLoS One 8(2):e57485.

86. Olsen CW, Carey S, Hinshaw L, Karasin AI. 2000. Virologic and serologic

surveillance for human, swine and avian influenza virus infections among pigs in the north-central United States. Arch Virol 145(7):1399-419.

87. European Centre for Disease Prevention and Control. March 2016. Influenza virus characterisation, summary Europe. European Centre for Disease Prevention and Control, Solna, Sweden. http://ecdc.europa.eu/en/publications/Publications/Influenza-Virus-Characterisation-March-2016.pdf.

88. Parida M, Dash PK, Kumar JS, Joshi G, Tandel K, Sharma S, Srivastava A,

Agarwal A, Saha A, Saraswat S, Karothia D. 2016. Emergence of influenza A (H1N1) pdm09 genogroup 6B and drug resistant virus, India, January to May 2015. Euro Surveill 21(5):6-11.

89. Broberg E, Melidou A, Prosenc K, Bragstad K, Hungnes O. 2016. Predominance

of influenza A (H1N1) pdm09 virus genetic subclade 6B. 1 and influenza B/Victoria lineage viruses at the start of the 2015/16 influenza season in Europe. Euro Surveill 21(13):8-21.

90. Lindsley WG, Blachere FM, Davis KA, Pearce TA, Fisher MA, Khakoo R, Davis

SM, Rogers ME, Thewlis RE, Posada JA, Redrow JB, Celik IB, Chen BT, Beezhold, DH. 2010. Distribution of airborne influenza virus and respiratory syncytial virus in an urgent care medical clinic. Clin Infect Dis 50(5):693-8.

91. Bischoff WE, Swett K, Leng I, Peters TR. 2013. Exposure to influenza virus

aerosols during routine patient care. J Infect Dis 207(7):1037-46.

http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-june-2013.pdf

http://ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-june-2013.pdf

http://ecdc.europa.eu/en/publications/Publications/Influenza-Virus-Characterisation-March-2016.pdf

http://ecdc.europa.eu/en/publications/Publications/Influenza-Virus-Characterisation-March-2016.pdf

152

92. Yamashita A, Kawashita N, Kubota-Koketsu R, Inoue Y, Watanabe Y, Ibrahim MS, Ideno S, Yunoki M, Okuno Y, Takagi T. 2010. Highly conserved sequences for human neutralization epitope on hemagglutinin of influenza A viruses H3N2, H1N1 and H5N1: Implication for human monoclonal antibody recognition. Biochem Biophys Res Commun 393(4):614-618.

93. Monto AS. 2002. Epidemiology of viral respiratory infections. Am J Med 112(6):4-

12.

94. Pavia AT. 2011. Viral infections of the lower respiratory tract: old viruses, new viruses, and the role of diagnosis. Clin Infect Dis 52:S284e9.

95. Ruuskanen O, Lahti E, Jennings LC, Murdoch DR. 2011. Viral pneumonia.

Lancet 377:1264 –1275.

96. Debiaggi M, Canducci F, Ceresola ER, Clementi M. 2012. The role of infections and coinfections with newly identified and emerging respiratory viruses in children. Virol J 9:247.

97. Warnes SL, Little ZR, Keevil CW. 2015. Human coronavirus 229E remains

infectious on common touch surface materials. MBio 6(6):e01697-15.

98. Otter JA, Yezli S, Salkeld JAG, French GL. 2013. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am J Infect Control 41:S6–S11.

99. Otter JA, Yezli S, French GL. 2014. The role of contaminated surfaces in the

transmission of nosocomial pathogens, p 27-58. In Borkow G (ed), Use of Biocidal surfaces for reduction of healthcare acquired infections, Springer International Publishing.

100. Boyce JM, Potter-Bynoe G, Chenevert C, King T. 1997. Environmental contamination due to methicillin-resistant Staphylococcus aureus: possible

infection control implications. Infect Control Hosp Epidemiol 18:622–627.

101. Hayden MK, Blom DW, Lyle EA, Moore CG, Weinstein RA. 2008. Risk of hand or

glove contamination after contact with patients colonized with vancomycin-resistant enterococcus or the colonized patients’ environment. Infect Control Hosp Epidemiol 29:149–154.

102. Huslage K, Rutala WA, Sickbert-Bennett E, Weber DJ. 2010. A quantitative

approach to defining “high-touch” surfaces in hospitals. Infect Control Hosp Epidemiol 31:850–853.

153

103. Duckro AN, Blom DW, Lyle EA, Weinstein RA, Hayden MK. 2005. Transfer of vancomycin-resistant enterococci via health care worker hands. Arch Intern Med 165:302–307.

104. Oxford J, Berezin EN, Courvalin P, Dwyer DE, Exner M, Jana LA, Kaku M, Lee

C, Letlape K, Low DE, Madani TA. 2014. The survival of influenza A (H1N1) pdm09 virus on 4 household surfaces. Am J Infect Control 42(4):423-5.

105. Bean B, Moore BM, Sterner B, Peterson LR, Gerding DN, Balfour HH, Jr. 1982.

Survival of influenza viruses on environmental surfaces. J Infect Dis 146:47–51.

106. Xu H, Jin H, Zhao L, Wei X, Hu L, Shen L, Wei L, Xie L, Kong Q, Wang Y, Ni X. 2015. A randomized, double-blind comparison of the effectiveness of environmental cleaning between infection control professionals and environmental service workers. Am J Infect Control 43(3):292-4.

107. Howie R, Alfa MJ, Coombs K. 2008. Survival of enveloped and non-enveloped

viruses on surfaces compared with other micro-organisms and impact of suboptimal disinfectant exposure. J Hosp Infect 69(4):368-76.

108. Farsani SM, Dijkman R, Jebbink MF, Goossens H, Ieven M, Deijs M, Molenkamp

R, van der Hoek L. 2012. The first complete genome sequences of clinical isolates of human coronavirus 229E. Virus genes 45(3):433-9.

109. Casanova LM, Jeon S, Rutala WA, Weber DJ, Sobsey MD. 2010. Effects of air

temperature and relative humidity on coronavirus survival on surfaces. Appl Environ Microbiol 76(9):2712-7.

110. Boone SA, Gerba CP. 2007. Significance of fomites in the spread of respiratory

and enteric viral disease. Appl Environ Microbiol 73:1687-96.

111. Otter JA, Yezli S, French GL. 2011. The role played by contaminated surfaces in the transmission of nosocomial pathogens. Infect Control Hosp Epidemiol 32:687-99.

112. Chairmain K, Mathew EK, Padmalatha C, Ranjit Singh AJ. 2011. Beware of

pathogenic microbes in public utility devices. J Microbiol Biotech Res 1:85-90.

113. Barker J, Stevens D, Bloomfield SF. 2001. Spread and prevention of some common viral infections in community facilities and domestic homes. J Appl Microbiol 91(1):7-21.

114. Boucher A, Desforges M, Duquette P, Talbot PJ. 2007. Long-term human

coronavirus-myelin cross-reactive T-cell clones derived from multiple sclerosis patients. Clin Immunol 123:258 –267.

154

115. Sizun J, Gagneur A, Legrand MC, Baron R. 2001. Respiratory Coronavirus infections in children. Pediatr Infect Dis J 20:555 – 6.

116. Gagneur A, Legrand MC, Picard B, Baron R, Talbot PJ, De Parscau L, Sizun J.

2002. Nosocomial infections due to human Coronaviruses in the newborn. Arch Pediatr 9:61 – 9.

117. Vallet S, Gagneur A, Talbot PJ, Legrand MC, Sizun J, Picard B. 2004. Detection

of human coronavirus 229E in nasal specimens in large scale studies using an RT-PCR hybridization assay. Mol Cell Probes 18(2):75-80.

118. Taylor S, Lopez P, Weckx L, Borja-Tabora C, Ulloa-Gutierrez R, Lazcano-Ponce

E, Kerdpanich A, Weber MA, de Los Santos AM, Tinoco JC, Safadi MA. 2017. Respiratory viruses and influenza-like illness: Epidemiology and outcomes in children aged 6 months to 10 years in a multi-country population sample. J Infect 74(1):29-41.

119. Walsh EE, Shin JH, Falsey AR. 2013. Clinical impact of human coronaviruses

229E and OC43 infection in diverse adult populations. J Infect Dis 2013:jit393.

120. Greninger A, Pepper G, Shean RC, Cent A, Palileo I, Kuypers JM, Schiffer JT, Jerome KR. 2017. Myeloablation-associated deletion of ORF4 in a human coronavirus 229E infection. bioRxiv 2017:113423.

121. Langelier C, Zinter MS, Kalantar K, Yank GA, Christenson S, Odonovan B, White

C, Wilson MR, Sapru A, Dvorak CC, Miller S. 2017. Metagenomic Next-Generation Sequencing Detects Pulmonary Pathogens in Hematopoietic Cellular Transplant Patients with Acute Respiratory Illnesses. bioRxiv. 2017:102798.

122. van der Hoek L. 2006. Human coronaviruses: what do they cause? Antivir Ther

12:651-8.

123. Bradburne AF, Bynoe ML, Tyrrell DA. 1967. Effects of a “new” human respiratory virus in volunteers. Br Med J 3:767–769.

124. McIntosh K, Chao RK, Krause HE, Wasil R, Mocega HE, Mufson MA. 1974.

Coronavirus infection in acute lower respiratory tract disease of infants. J Infect Dis 130:502–507.

125. van Elden LJ, Anton M, Anton M, van Alphen F, Hendriksen KA, Hoepelman AI, van Kraaij MG, Oosterheert JJ, Schipper P, Schuurman R, Nijhuis M. 2004. Frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction. J Infect Dis 15:652-7.

155

126. Dowell SF, Simmerman JM, Erdman DD, Wu JS, Chaovavanich A, Javadi M, Yang JY, Anderson LJ, Tong S, Ho MS. 2004. Severe acute respiratory syndrome coronavirus on hospital surfaces. Clin Infect Dis 39(5):652-7.

127. Fraise AP, Lambert PA, Maillard J. 2004. Russell, Hugo and Ayliffe's Principles

and Practices of Disinfection, Preservation, and Sterilization, 5th ed. Blackwell Publishing, Massachusetts.

128. Firquet S, Beaujard S, Lobert PE, Sané F, Caloone D, Izard D, Hober D. 2015.

Survival of enveloped and non-enveloped viruses on inanimate surfaces. Microbes Environ 30(2):140-4.

129. Rzezutka A and Cook N. 2004. Survival of human enteric viruses in the

environment and food. FEMS Microbiol Rev 28:441–453.

130. Yezli S, Otter JA. 2011. Minimum infective dose of the major human respiratory and enteric viruses transmitted through food and the environment. Food Environ Virol 3(1):1-30.

131. Warnes SL, Keevil CW. 2013. Inactivation of norovirus on dry copper alloy

surfaces. PloS one 8(9):e75017.

132. Moore SL, Denyer SP, Hanlon GW, Olliff CJ, Lansley AB, Rabone K, Jones M. 2006. Alcohol ethoxylates mediate their bacteriostatic effect by altering the cell membrane of Escherichia coli NCTC 8196. Int J Antimicrob Agents 28(6):503-13.

133. Ibfelt T, Engelund EH, Schultz AC, Andersen LP. 2015. Effect of cleaning and

disinfection of toys on infectious diseases and micro-organisms in daycare nurseries. J Hosp Infect 89(2):109-15.

134. Centers for Disease Control and Prevention. 2011. Clusters of acute respiratory

illness associated with human enterovirus 68 —Asia, Europe, and U.S., 2008 –2010. Morb Mortal Wkly Rep 60:1301–1304.

135. Centers for Disease Control and Prevention. 2014. Enterovirus D68. Centers for

Disease Control and Prevention, Atlanta, GA. http://www.cdc .gov/non-polio-enterovirus/outbreaks/EV-D68-outbreaks.html.

136. Imamura T, Oshitani H. 2015.Global reemergence of enterovirus D68 as an

important pathogen for acute respiratory infections. Rev Med Virol 25:102–114.

137. Schieble JH, Fox VL, Lennette EH. 1967. A probable new human picornavirus associated with respiratory disease. Am J Epidemiol 85:297–310.

138. Tokarz R, Firth C, Madhi SA, Howie SR, Wu W, Haq S, Briese T, Lipkin WI. 2012. Worldwide emergence of multiple clades of enterovirus 68. J Gen Virol 93:1952–1958.

156

139. Huang W, Wang G, Zhuge J, Nolan SM, Dimitrova N, Fallon JT. 2015. Whole-genome sequence analysis reveals the enterovirus D68 isolates during the United States 2014 outbreak mainly belong to a novel clade. Sci Rep 5:15223.

140. Crone M, Tellier R, Wei XC, Kuhn S, Vanderkooi OG, Kim J, Mah JK, Mineyko A.

2016. Polio-like illness associated with outbreak of upper respiratory tract infection in children. J Child Neurol 31:409 – 414.

141. Messacar K, Schreiner TL, Maloney JA, Wallace A, Ludke J, Oberste MS, Nix

WA, Robinson CC, Glodé MP, Abzug MJ, Dominguez SR. 2015. A cluster of acute flaccid paralysis and cranial nerve dysfunction temporally associated with an outbreak of enterovirus D68 in children in Colorado. Lancet 385:1662–1671.

142. Greninger AL, Naccache SN, Messacar K, Clayton A, Yu G, Somasekar S,

Federman S, Stryke D, Anderson C, Yagi S, Messenger S, Wadford D, Xia D, Watt JP, Van Haren K, Dominguez SR, Glaser C, Aldrovandi G, Chiu CY. 2015. A novel outbreak enterovirus D68 strain associated with acute flaccid myelitis cases in the USA (2012–14): a retrospective cohort study. Lancet Infect Dis 15: 671–682.

143. Piralla A, Girello A, Premoli M, Baldanti F. 2015. A new real-time reverse

transcription-PCR assay for detection of human enterovirus 68 in respiratory samples. J Clin Microbiol 53:1725–1726.

144. Badry ME, Lednicky JA, Cella E, Telisma T, Chavannes S, Loeb JC, Ciccozzi M,

Okech B, Beau De Rochars VM, Salemi M, Morris JG, Jr. 2016. Isolation of an enterovirus D68 from blood from a child with pneumonia in rural Haiti: close phylogenetic linkage with New York strain. Pediatr Infect Dis J 35(9):1048-50.

145. Tseng C-C, Chang L-Y, Li C-S. 2010. Detection of airborne viruses in a

pediatrics department measured using real-time qPCR coupled to an air- sampling filter method. J Environ Health 73:22–28.

146. Simmons NB. 2005. Order Chiroptera, p. 312-529. In Wilson DE and Reeder DM

(ed), Mammal species of the World: a taxonomic and geographic reference, 3rd ed, vol 1. Johns Hopkins University Press.

147. Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, Daszak P.

2008. Global trends in emerging infectious diseases. Nature 451:990–993.

148. Taylor LH, Latham SM, Mark EJ. 2001. Risk factors for human disease emergence. Philos Trans R Soc B Biol Sci 356:983–989.

149. Smith I, Wang LF. 2013. Bats and their virome: an important source of emerging viruses capable of infecting humans. Curr Opin Virol 3:84–91.

157

150. Leroy EM, Kumulungui B, Pourrut X, Rouquet P, Hassanin A, Yaba P, Délicat A, Paweska JT, Gonzalez JP, Swanepoel R. 2005. Fruit bats as reservoirs of Ebola virus. Nature 438:575–576.

151. Mendez DH, Judd J, Speare R. 2012. Unexpected result of Hendra virus

outbreaks for veterinarians, Queensland, Australia. Emerg Infect Dis 18:83–85.

152. Rahman MA, Hossain MJ, Sultana S, Homaira N, Khan SU, Rahman M, Gurley ES, Rollin PE, Lo MK, Comer JA, Lowe L. 2012. Date palm sap linked to Nipah virus outbreak in Bangladesh, 2008. Vector Borne Zoonotic Dis 12:65–72.

153. Lumio J, Hillbom M, Roine R, Ketonen L, Haltia M, Valle M, Neuvonen E,

Lahdevirta J. 1986. Human rabies of bat origin in Europe. Lancet 327(8477):378.

154. Da Rosa ES, Kotait I, Barbosa TF, Carrieri ML, Brandão PE, Pinheiro AS, Begot AL, Wada MY, De Oliveira RC, Grisard EC, Ferreira M. 2006. Bat-transmitted human rabies outbreaks, Brazilian Amazon. Emerg Infect Dis 12:1197–1202.

155. Adams MJ, Carstens EB. 2012. Ratification vote on taxonomic proposals to the

International Committee on Taxonomy of Viruses (2012). Arch Virol 157:1411–1422.

156. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, Wang H, Crameri G, Hu Z,

Zhang H, Zhang J. 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310:676–679.

157. Lau SK, Woo PC, Li KS, Huang Y, Tsoi HW, Wong BH, Wong SS, Leung SY,

Chan KH, Yuen KY. 2005. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci USA 102:14040–14045.

158. Poon LL, Chu DK, Chan KH, Wong OK, Ellis TM, Leung YH, Lau SK, Woo PC,

Suen KY, Yuen KY, Guan Y. 2005. Identification of a novel coronavirus in bats. J Virol 79:2001–2009.

159. Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. 2006. Bats: important

reservoir hosts of emerging viruses. Clin Microbiol Rev 19:531–545.

160. Dominguez SR, O’Shea TJ, Oko LM, Holmes KV. 2007. Detection of group 1 coronaviruses in bats in North America. Emerg Infect Dis 13:1295–1300.

161. Carrington CV, Foster JE, Zhu HC, Zhang JX, Smith GJ, Thompson N, Auguste

AJ, Ramkissoon V, Adesiyun AA, Guan Y. 2008. Detection and phylogenetic analysis of group 1 coronaviruses in South American bats. Emerg Infect Dis 14:1890–1893.

158

162. Gloza-Rausch F, Ipsen A, Seebens A, Göttsche M, Panning M, Drexler JF, Petersen N, Annan A, Grywna K, Müller M, Pfefferle S. 2008. Detection and prevalence patterns of group I coronaviruses in bats, northern Germany. Emerg Infect Dis 14:626–623.

163. Misra V, Dumonceaux T, Dubois J, Willis C, Nadin-Davis S, Severini A, Wandeler

A, Lindsay R, Artsob H. 2009. Detection of polyoma and corona viruses in bats of Canada. J Gen Virol 90:2015–2022.

164. Li L, Victoria JG, Wang C, Jones M, Fellers GM, Kunz TH, Delwart E. 2010. Bat

guano virome: predominance of dietary viruses from insects and plants plus novel mammalian viruses. J Virol 84:6955–6965.

165. Watanabe S, Masangkay JS, Nagata N, Morikawa S, Mizutani T, Fukushi S,

Alviola P, Omatsu T, Ueda N, Iha K, Taniguchi S. 2010. Bat coronaviruses and experimental infection of bats, the Philippines. Emerging infectious diseases. Emerg Infect Dis 16:1217–1223.

166. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, Choi GK, Xu H, Lam CS,

Guo R, Chan KH. 2010. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol 84:2808–2819.

167. Lelli D, Papetti A, Sabelli C, Rosti E, Moreno A, Boniotti MB. 2013. Detection of

coronaviruses in bats of various species in Italy. Viruses 5: 2679–2689.

168. Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, Mazet JK, Hu B, Zhang W, Peng C, Zhang YJ. 2013. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 503:535–538.

169. Menachery VD, Yount Jr BL, Debbink K, Agnihothram S, Gralinski LE, Plante JA,

Graham RL, Scobey T, Ge XY, Donaldson EF, Randell SH. 2015. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med 21:1508–1513.

170. Yang XL, Hu B, Wang B, Wang MN, Zhang Q, Zhang W, Wu LJ, Ge XY, Zhang

YZ, Daszak P, Wang LF. 2016. Isolation and characterization of a novel bat coronavirus closely related to the direct progenitor of severe acute respiratory syndrome coronavirus J Virol 90:3253–3256.

171. Kim HK, Yoon SW, Kim DJ, Koo BS, Noh JY, Kim JH, Choi YG, Na W, Chang

KT, Song D, Jeong DG. 2016. Detection of Severe Acute Respiratory Syndrome‐Like, Middle East Respiratory Syndrome‐Like Bat Coronaviruses and Group H

Rotavirus in Faeces of Korean Bats. Transbound Emerg Dis 63:365–327.

159

172. Anthony SJ, Ojeda-Flores R, Rico-Chavez O, Navarrete-Macias I, Zambrana-Torrelio CM, Rostal MK, Epstein JH, Tipps T, Liang E, Sanchez-Leon M, Sotomayor-Bonilla J. 2013. Coronaviruses in bats from Mexico. J Gen Virol 94:1028–1038.

173. Marks CS, Marks GE. 2006. Bats of Florida, p 176. University Press of Florida,

Gainesville, Florida.

174. Hu B, Ge X, Wang LF, Shi Z. 2015. Bat origin of human coronaviruses Virol J 12:221.

175. Sikes RS, Gannon WL. 2011. Guidelines of the American Society of

Mammalogists for the use of wild mammals in research. J Mammal 92:235–253.

176. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H,

Remmert M, Söding J, Thompson JD. 2011. Fast, scalable generation of high‐quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539.

177. Hall TA. 1999. BioEdit: A user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98. 178. Schmidt HA, Strimmer K, Vingron M, von Haeseler A. 2002. TREE-PUZZLE:

maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18(3):502-4.

179. Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and

effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32:268–274.

180. de Sales Lima FE, Campos FS, Kunert Filho HC, Batista HB, Júnior PC, Cibulski

SP, Spilki FR, Roehe PM, Franco AC. 2013. Detection of Alphacoronavirus in velvety free-tailed bats (Molossus molossus) and Brazilian free-tailed bats (Tadarida brasiliensis) from urban area of Southern Brazil. Virus genes 47(1):164-7.

181. Higgs ST, Beaty BJ. 2005. Natural cycles of vector-borne pathogens. Biology of

disease vectors 2:167-85. 182. Calisher CH, Karabatsos N. 1988. Arbovirus serogroups: definition and

geographic distribution. The arboviruses: epidemiology and ecology 1:19-57.

183. King AM, Lefkowitz E, Adams MJ, Carstens EB (ed). 2011. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier.

160

184. Leparc-Goffart I, Nougairede A, Cassadou S, Prat C, De Lamballerie X. 2014. Chikungunya in the Americas. Lancet 383(9916):514.

185. Pan American Health Organization. 2016. Chikungunya: statistic data. Pan

American Health Organization, Washington, DC. http://www2.paho.org/hq/index.php?option=com_topics&view=readall&cid=5927&Itemid=40931&lang=en

186. Beau De Rochars VEM, Alam MT, Telisma T, Masse R, Chavannes S, Anilis

MG, Guillaume JH, Gelin G, Kirkpatrick EL, Desormeaux A-M, Okech BA, Weppelmann TA, Rashid M, Karst S, Johnson JA, Ali A, Morris JG Jr. 2015. Spectrum of outpatient illness in a school-based cohort in Haiti, with a focus on diarrheal pathogens. Am J Trop Med Hyg 92: 752–757.

187. De Rochars VM, Lednicky J, White S, Loeb J, Elbadry MA, Telisma T,

Chavannes S, Anilis MG, Cella E, Ciccozzi M, Okech BA. 2016. Isolation of Coronavirus NL63 from Blood from Children in Rural Haiti: Phylogenetic Similarities with Recent Isolates from Malaysia. Am J Trop Med Hyg 31:16-0585.

188. Faye O, Faye O, Diallo D, Diallo M, Weidmann M. 2013. Quantitative real-time

PCR detection of Zika virus and evaluation with field-caught mosquitoes. Virol J 10(1):311.

189. Lanciotti RS, Kosoy OL, Laven JJ, Panella AJ, Velez JO, Lambert AJ, Campbell

GL. 2007. Chikungunya virus in US travelers returning from India, 2006. Emerg Infect Dis 13:764–767.

190. Santiago GA, Vergne E, Quiles Y, Cosme J, Vazquez J, Medina JF, Medina F,

Colón C, Margolis H, Muñoz-Jordán JL. 2013. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus. PLoS Negl Trop Dis 7(7):e2311.

191. Maher-Sturgess SL, Forrester NL, Wayper PJ, Gould EA, Hall RA, Barnard RT,

Gibbs MJ. 2008. Universal primers that amplify RNA from all three flavivirus subgroups. Virol J 5:16–10.

192. Balm MN, Lee CK, Lee HK, Chiu L, Koay ES, Tang JW. 2012. A diagnostic

polymerase chain reaction assay for Zika virus. J Med Virol 84(9):1501-5.

193. Vabret A, Mouthon F, Mourez T, Gouarin S, Petitjean J, Freymuth F. 2001. Direct diagnosis of human respiratory coronaviruses 229E and OC43 by the polymerase chain reaction. J Virol Methods 97(1):59-66.

194. Myint S, Johnston S, Sanderson G, Simpson H. 1994. Evaluation of nested

polymerase chain methods for the detection of human coronaviruses 229E and OC43. Mol Cell Probes 8(5):357-64.

http://www2.paho.org/hq/index.php?option=com_topics&view=readall&cid=5927&Itemid=40931&lang=en

http://www2.paho.org/hq/index.php?option=com_topics&view=readall&cid=5927&Itemid=40931&lang=en

161

195. Stewart JN, Mounir S, Talbot PJ. 1992. Detection of coronaviruses by the polymerase chain reaction, p 316-327. In Diagnosis of human viruses by polymerase chain reaction technology. Springer Berlin Heidelberg.

196. Ventura AK, Ehrenkranz NJ. 1976. Endemic dengue virus infection in Hispaniola.

I. Haiti. J Infect Dis 134:436–41.

197. World Health Organization. 2015. Weekly Epidemiological Record. Zika virus outbreaks in the Americas. http://www.who.int/wer/2015/wer9045.pdf?ua=1

198. Lednicky J, De Rochars VM, El Badry M, Loeb J, Telisma T, Chavannes S, Anilis

G, Cella E, Ciccozzi M, Rashid M, Okech B. 2016. Zika virus outbreak in Haiti in 2014: molecular and clinical data. PLoS Negl Trop Dis 10(4):e0004687.

199. Dupont-Rouzeyrol M, O’Connor O, Calvez E, Daures M, John M, Grangeon JP,

Gourinat AC. 2015. Co-infection with Zika and dengue viruses in 2 patients, New Caledonia, 2014. Emerg Infect Dis 21(2):381.

200. Iovine NM, Lednicky J, Cherabuddi K, Crooke H, White SK, Loeb JC, Cella E,

Ciccozzi M, Salemi M, Morris JG. 2017. Coinfection with Zika and Dengue-2 viruses in a traveler returning from Haiti, 2016: clinical presentation and Genetic analysis. Clin Infect Dis 64(1):72-5.

201. Paul LM, Carlin ER, Jenkins MM, Tan AL, Barcellona CM, Nicholson CO,

Michael SF, Isern S. 2016. Dengue virus antibodies enhance Zika virus infection. Clin Exp Immunol 5(12):e117.

202. Duong V, Lambrechts L, Paul RE, Ly S, Lay RS, Long KC, Huy R, Tarantola A,

Scott TW, Sakuntabhai A, Buchy P. 2015. Asymptomatic humans transmit dengue virus to mosquitoes. Proc Natl Acad Sci U S A 112(47):14688-93.

203. Mizuno Y, Kotaki A, Harada F, Tajima S, Kurane I, Takasaki T. 2007.

Confirmation of dengue virus infection by detection of dengue virus type 1 genome in urine and saliva but not in plasma. Trans R Soc Trop Med Hyg 101(7):738-9.

204. Cherabuddi K, Iovine NM, Shah K, White SK, Paisie T, Salemi M, Morris Jr JG,

Lednicky JA. 2016. Zika and Chikungunya virus co-infection in a traveller returning from Colombia, 2016: virus isolation and genetic analysis. JMM Case Rep 3(6).

205. Arbour N, Ekandé S, Côté G, Lachance C, Chagnon F, Tardieu M, Cashman NR,

Talbot PJ. 1999. Persistent infection of human oligodendrocytic and neuroglial cell lines by human coronavirus 229E. J Virol 73(4):3326-37.

http://www.who.int/wer/2015/wer9045.pdf?ua=1

162

206. Centers for Disease Control and Prevention. 2016. Flu Symptoms & Complications. Centers for Disease Control and Prevention, Atlanta, GA. https://www.cdc.gov/flu/about/disease/complications.htm

https://www.cdc.gov/flu/about/disease/complications.htm

163

BIOGRAPHICAL SKETCH

Tania was born in Bangladesh, grew up all over the country and spent several

years of her childhood in the Middle East. Travel had an enormous impact in her life and

continues to be so. Despite her strong desire to serve her country’s armed forces and

continue the family tradition, she gave that up for a more intellectually driven pursuit: to

become a microbiologist. She attended University of Dhaka, the oldest and renowned

institution of Bangladesh, and received her bachelor’s and master’s degrees in

microbiology. Right after post-graduation in 2010, she was appointed at her parent

department, Department of Microbiology, University of Dhaka, as a junior faculty

member. She had been involved in teaching and research back home until August

2013, when she got accepted into the One Health PhD Program at Environmental and

Global Health (EGH), University of Florida with Graduate School Preeminence Award.

At EGH, she was fortunate to receive training in virology under the mentorship of Dr.

John A. Lednicky. During her stay in “Lednicky Lab”, she was actively involved in

research on human respiratory viruses and arboviruses. She has presented several

posters on her research findings, authored or co-authored 3 published research articles

in peer reviewed journals and few more are in the pipeline for publication. She has

isolated and identified several human respiratory- and arboviruses from environmental

and clinical samples and forty-seven (47) viral genomic sequences identified through

her research have been published in GenBank.

During her stay at EGH, she was showered with love, affection and accolades

from her peers and faculty members. Tania received her PhD in Public Health from the

University of Florida in summer of 2017 and returned to Bangladesh to continue serving

at University Dhaka.

refinement and integration of pcr-based...

Documents