1

RATIONAL DESIGN OF LIVE ATTENUATED

VACCINE BY SITE-DIRECTED MUTAGENESIS

AND DELETION IN THE 5’-NON CODING REGION

OF THE ENTEROVIRUS 71 (EV-A71) GENOME

ISABEL YEE PINN TSIN

B.Sc (Honours) (Biochemistry), National University of

Singapore

A THESIS SUBMITTED FOR THE MASTERS OF

SCIENCE IN LIFE SCIENCES

FACULTY OF SCIENCE AND TECHNOLOGY

SUNWAY UNIVERSITY

AUG, 2015

2

ORIGINAL LITERARY WORK DECLARATION

Name of candidate: Isabel Yee Pinn Tsin (I.C No: 810918-14-5858)

Name of Degree: Masters of Science in Life Sciences

Title of Project Paper/Research Report/Dissertation/Thesis (“this Work”):

Rational design of live attenuated vaccine by site-directed mutagenesis and deletion

in the 5’-non coding region of the Enterovirus 71 (EV-A71) genome.

Field of Study: Molecular Virology

I do solemnly and sincerely declare that:

(1) I am the sole author/writer of this Work;

(2) This Work is original;

(3) Any use of any work in which copyright exists was done by way of fair dealing and

for permitted purposes and any excerpt or extract from, or reference to or reproduction

of any copyright work has been disclosed expressly and sufficiently and the title of the

Work and its authorship have been acknowledged in this Work;

(4) I do not have any actual knowledge nor ought I reasonably to know that the making

of this work constitutes an infringement of any copyright work;

(5) I hereby assign all and every rights in the copyright to this Work to Sunway

University (SU), who henceforth shall be owner of the copyright in this Work and that

any reproduction or use in any form or by any means whatsoever is prohibited without

the written consent of SU having been first had and obtained;

(6) I am fully aware that if in the course of making this Work I have infringed any

copyright whether intentionally or otherwise, I may be subject to legal action or any

other action as may be determined by SU.

Candidate’s signature Date

Subscribed and solemnly declared before,

Witness’s Signature Date

Name:

Designation:

3

ABSTRACT

The Hand, Foot and Mouth Disease is caused by a group of Enteroviruses such

as Enterovirus 71 (EV-A71) and Coxsackievirus CV-A6, CV-A10, and CV-A16. Mild

symptoms of EV-A71 infection in children range from high fever, vomiting, rashes and

ulcers in mouth, commonly affecting children and infants. EV-A71 can produce more

severe symptoms such as brainstem and cerebellar encephalitis, leading up to

cardiopulmonary failure and death. The lack of vaccines and antiviral drugs against EV-

A71 highlights the urgency of developing preventive and treatment agents against EV-

A71 to prevent further fatalities. The molecular basis of virulence in EV-A71 is still

uncertain. It remains to be investigated if there is a universal molecular determinant

present in every EV-A71 fatal strain or whether every fatal strain differs in virulence

determinant depending on their sub-genotype. In this study, genetically modified EV-

A71 virus was constructed by substituting nucleotides at positions 158, 475, 486, and

487 based on the neurovirulence of poliovirus Sabin strains 1, 2 and 3. The single

nucleotide difference between the fatal strain 41 (5865/Sin/000009) and the non-fatal

strain (strain 10) was investigated to see if it is responsible for neurovirulence by

introducing a nucleotide substitution (Guanine) at position 5262 in the EV-A71 strain 41

genome. Another mutant strain was also constructed through partial deletion of the 5’-

NTR region in the EV-A71 genome. The virulence of the mutated EV-A71 strains were

evaluated in Rhabdomyosarcoma cell culture by plaque assays, tissue culture infectious

dose (TCID50) determinations, real time Reverse-Transcriptase Polymerase Chain

Reaction (RT-PCR) and production of VP1. It was observed that mutants 475 and the

partial deletant (deletion from nt. 475-485 in the 5’NTR) had minimal cytopathic effects

as compared to mutants 158, 486, and 5262 when transfected with RD cells. This was

4

consistent with the RT-PCR results that showed the viral RNA copy number for mutants

475, 487 and partial deletant (5’NTR) to be of lowest amount when RNA was extracted

from transfected RD cells. The partial deletant (PD) may be the most stable mutant

genetically as it demonstrated high immunogenicity (neutralizing titre of 1:32) and low

pathogenicity and hence, could be a good potential LAV candidate for further studies. In

addition, intraperitoneal administration of the heat-inactivated EV-A71 mutants 158,

475, 486, 487, 5262 and PD and the homologous EV-A71 whole virion in the murine

model triggered both cellular and humoral immune response.

The data collectively indicated that every fatal EV-A71 strain differs in virulence

determinant depending on their sub-genotype. Differences in nucleotide substitutions in

the various mutants were reflected in the differences observed in immunogenicity based

on the neutralizing titres of mice antisera. Hence, vaccines can be rationally designed to

treat different EV-A71 genotypes and sub-genotypes.

5

ACKNOWLEDGMENTS

I am extremely grateful to God for His strength and guidance amidst trials and

obstacles. I thank Him for helping me handle stressful situations and for multiplying my

time. He is always there beside me even when I am alone in the lab at nights, weekends

or public holidays.

I am truly indebted and express my most heartfelt gratitude to my honourable

supervisor, Prof Poh Chit Laa. Had it not been for her, I would never have embarked

on a Masters by Research. I am extremely appreciative of her wise advice, guidance and

most importantly, for granting me the privilege to be one of her postgraduate students.

She has truly inspired me to greater heights.

My grateful thanks to Dr. Jeff Tan who never fails to ask me about my progress

and imparting more challenging ideas about designing of the vaccine. He has assisted

me with his wise words during difficult times and for that, I am extremely grateful to

him. I have learnt a lot from his valuable constructive feedback and advice.

Special thanks goes to my wonderful husband and kids for their kind

understanding of my long hours spent in the lab, for not being able to spend as much

time at home with them, and for being supportive of my Masters endeavour. I am

grateful to a very hands-on husband who takes such good care of our children when I am

at work.

I am very appreciative of all research assistants and the post-doc for patiently

guiding and teaching me in my experimental work. Without them, I would be finding it

very difficult to complete my project. With their camaraderie and assistance in different

parts of my project, my postgraduate years in the lab have been made more memorable.

6

TABLE OF CONTENTS

Title page i

Original Literary Work Declaration ii

Abstract iii

Acknowledgements v

Table of Contents vi

List of Tables 10

List of Figures 11

Abbreviations 13

CHAPTER 1 LITERATURE REVIEW

1.1 INTRODUCTION

1.1.1 Development of vaccines against viral pathogens 15

1.2 Polio virus vaccines

1.2.1 Inactivated polio vaccine (IPV) 16

1.2.2 Oral polio virus vaccine (OPV) 18

1.2.3 Molecular Determinants of Neurovirulence 19

7

1.3 Enterovirus 71 as an etiological agent of hand, foot, mouth disease

1.3.1 Enterovirus 71 23

1.3.2 Distribution of Enterovirus 71 genotypes and sub-genotypes 30

1.3.3 Development of experimental EV-A71 Vaccines 35

1.3.4 Potential candidates for EV-A71 Vaccine 35

1.3.5 Inactivated EV-A71 Vaccines 49

1.3.6 Immunogenicity of vaccines 54

1.4 Aims of Study 55

CHAPTER 2 MATERIALS AND METHODS

2.1 Cell Culture 60

2.2 Viral infection 60

2.3 RNA Extraction and Reverse Transcription 60

2.4 Cloning of EV-A71 cDNA into pCR-XL-TOPO vector 61

2.5 Site-directed mutagenesis 61

2.6 Storage of transformed E. coli cells containing desired mutations 66

2.7 Partial-deletion in the 5’-NTR of EV-A71 genome 66

8

2.8 Plasmid isolation and purification 67

2.9 Restriction endonuclease digestion of DNA 67

2.10 Phenol-chloroform purification of DNA 67

2.11 Production of infectious EV-A71 RNA from cloned cDNA 68

2.12 Transfection of RD cells with in vitro RNA transcripts 69

2.13 Plaque Assay 69

2.14 Tissue Culture Infectious Dose 50 (TCID50) Assay 70

2.15 Real-Time RT-PCR 70

2.16 EV-A71 VPl Immunoblot 71

2.17 Immunization of mice 72

2.18 EV-A71 neutralization assay 72

2.19 IgG-subtying 73

2.20 Bioinformatics Analysis 73

2.21 Statistical Analysis 74

CHAPTER 3 RESULTS

3.1 Molecular Basis of Pathogenicity 75

3.2 Quantification of Viral RNA Copy Number 85

3.3 Quantitation of virus by tissue culture infectious dose (TCID50) 88

9

3.4 Quantification of virus by the plaque assay 92

3.5 Western Blotting 96

3.6 Neutralization Assay 99

3.7 IgG isotyping 108

CHAPTER 4 DISCUSSION 113

CHAPTER 5 CONCLUSION 122

REFERENCES 124

APPENDICES 137

PUBLICATIONS 148

10

LIST OF TABLES

TABLE 1.1 Clinical manifestations of enteroviruses.

TABLE 1.2 Distribution of EV-A71 genotypes throughout the world from 1997 to

2010.

TABLE 1.3 Five EV-A71 inactivated vaccines at different clinical phases of

development.

TABLE 1.4 Common genetic determinants between EV-A71 and Sabin polio strains.

TABLE 2.1 Primers used for site-directed mutagenesis.

TABLE 3.1 Tissue Culture Infectious Dose 50 (TCID50) Assay.

TABLE 3.2 Neutralizing antibody titers elicited by EV-A71 Mutants and heat

inactivated EV-A71 strain 41 in mice.

11

LIST OF FIGURES

FIG 1.1 Process overview for preparation of trivalent IPV

FIG 1.2 Structure and genome of Poliovirus

FIG 1.3 Three genotypes of Poliovirus Sabin vaccine strains

FIG 1.4 Structure and genome of Enterovirus 71

FIG 1.5 Vesicles on the foot, mouth and palm area of children infected with

hand, foot and mouth disease (HFMD).

FIG 1.6 Phylogenetic tree of the VP1 region of EV-A71 strains detected in

various countries, showing different genotypes and sub-genotypes of EV-

A71.

FIG 1.7 Differences of nucleotide between the B4 genotype fatal strain and the

non-fatal strain 10.

FIG 1.8 A single nucleotide change from Cytosine to Uridine at position 158 in

Stem Loop II of 5’-NTR contributes to virulence of EV-A71 in mice.

FIG 1.9 Predicted RNA secondary structure of EV-A71 strain 41 from nt. 474 to

541.

FIG 2.1 Schematic illustration of EV-A71 cDNA clone in pCR-XL-TOPO.

FIG 2.2 Schematic representation of the Site-Directed Mutagenesis (SDM) steps.

FIG 3.1 Cytopathic effects (CPE) caused by the mutant EV-A71 (A158T) in

Rhabdomyosarcoma (RD) cells in comparison with uninfected RD cells

(negative control using Opti-MEM) and EV-A71 strain 41 infected RD

cells (positive control).

FIG 3.2 Infection of RD cells by the mutant EV-A71 (C475T) in RD cells in

comparison with uninfected RD cells (negative control using Opti-MEM)

and EV-A71 strain 41 infected RD cells (positive control).

FIG 3.3 CPE caused by the mutant EV-A71 (A486G) in RD cells in comparison

with uninfected RD cells (negative control using Opti-MEM) and EV-

A71 strain 41 infected RD cells (positive control).

FIG 3.4 CPE caused by the mutant EV-A71 (G487A) in RD cells in comparison

with uninfected RD cells (negative control using Opti-MEM) and EV-

A71 strain 41 infected RD cells (positive control).

12

FIG 3.5 Infection of RD cells by the mutant EV-A71 (A5262G) in RD cells in

comparison with uninfected RD cells (negative control using Opti-MEM)

and EV-A71 strain 41 infected RD cells (positive control).

FIG 3.6 Infection of RD cells by the mutant EV-A71 (Partial Deletant 5’-NTR) in

RD cells in comparison with uninfected RD cells (negative control using

Opti-MEM) and EV-A71 strain 41 infected RD cells (positive control).

FIG 3.7 Quantification of Viral RNA Copy Number.

FIG 3.8 Schematic diagram of the TCID50 assay for enumerating EV-A71 viruses.

FIG 3.9 Quantification of plaque forming units by EV-A71 mutants and the wild

type EV-A71 strain 41

FIG 3.10 Plaque Forming Units by EV-A71 mutants and the wild type EV-A71

strain 41.

FIG 3.11 Western blot analysis using monoclonal antibody against VP1 as the

primary antibody.

FIG 3.12 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with heat-inactivated EV-A71 strain 41.

FIG 3.13 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant A158T.

FIG 3.14 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant C475T.

FIG 3.15 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant A486G.

FIG 3.16 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant G487A.

FIG 3.17 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant A5262G

FIG 3.18 In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with EV-A71 mutant PD

FIG 3.19 IgG1 and igG2 responses elicited by EV-A71 Mutants and Controls.

FIG 3.20 IgG3, IgA and IgM responses elicited by EV-A71 Mutants and Controls.

13

ABBREVIATIONS

3D three-dimensional

Bp base pair

BSA bovine serum albumin

CVB Coxsackievirus B

cDNA complementary DNA

CV-A16 Coxsackie type A16

CPE cytopathic effect

DNA deoxyribonucleic acid

dNTP deoxynucleotide triphosphate

HFMD hand, foot, mouth disease

HIV Human Immunodeficiency virus

kb kilobase

kDa kilodaltons

Km kanamycin

LB Luria broth

NCBI National Center for Biotechnology Information

Nt nucleotide

NtAb neutralizing antibodies

NTR Non translated region

ORF open reading frame

14

OPV oral poliovirus vaccine

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PFU plaque forming unit

PV1 Poliovirus type 1

PSGL-1 P-selectin glycoprotein ligand-1

RNA ribonucleic acid

RDDP RNA-dependent DNA polymerase

RDRP RNA-dependent RNA polymerase

RNase ribonuclease

Rpm revolutions per minute

RT reverse transcription

SCARB2 scavenger receptor class B subfamily

SDM site-directed mutagenesis

SDS sodium dodecyl sulfate

TCID50 50% tissue culture infectious dose

UV ultraviolet

VDPVs vaccine-derived polioviruses

VLP virus-like particle

wt wild type

3DPol 3D Polymerase

15

CHAPTER 1

LITERATURE REVIEW

1.1 Introduction

1.1.1 Development of vaccines against viral pathogens

Vaccination for various viral diseases has markedly reduced mortality and

morbidity worldwide for more than 200 years. Indeed, the greatest public health success

can be attributed to vaccination. Nevertheless, the future is abound with challenges as

there remains many diseases that do not yet have effective vaccines such as HIV/AIDS,

Ebola, Hepatitis C, and the Hand, Foot, Mouth (HFMD) disease. Every year, two new

species of viruses are added into the list of approximately 200 different infectious

viruses (Small and Hildegund, 2012). In addition, some viruses particularly RNA viruses

can emerge as new pathogens as they have high mutation rates due to their error-prone

RNA dependent RNA polymerase. The existing viruses can evolve to become more

virulent through recombinations or mutations and the mutated strains also do not have

any effective vaccines against them.

Currently, there are only an estimated 15 vaccines to combat the 200 viruses

known to infect man (Small and Hildegund, 2012). Although there are more vaccines

undergoing clinical trials, it is worrying to note that humans remain vulnerable to the

existing 180 or so viruses that have no effective vaccines. Therefore, increased studies

are required in the development of new and better vaccines, whereby high efficacy,

long-lasting immunity, minimal risk in vaccinees, safe and easy production, low cost,

16

dispensing the need for refrigeration and convenient delivery are the major goals in their

design.

1.2 Polio virus vaccines

1.2.1 Inactivated polio vaccine

Poliovirus (PV) is the etiological agent of poliomyelitis and belongs to

Enterovirus species C within the Picornaviridae family. Poliomyelitis was a public

health scare in the 1950s, even in countries with the best health systems and hygiene

practises in place. This thereby led to the raising of funds to support research in the

development of a polio vaccine. The Inactivated Polio Vaccine (IPV) was the first

poliovirus vaccine to be licensed in 1955. IPV was developed in 1952 by Dr Jonas Salk

and was prepared by formalin-inactivation of three wild-type virulent strains which are

the Mahoney (type 1), MEF-1 (type 2) and Saukett (type 3) (Salk et al., 1954). The

United States started using the IPV that had such high efficacy that other countries

around the world started to follow suit. This initiated the global polio eradication

worldwide (Chumakov and Ehrenfeld, 2008).

Although IPV is considered safe, there is a risk of exposure to the wild type

strain during the manufacturing process. Figure 1.1 shows the manufacturing process for

the IPV. During monovalent bulk preparation, Vero cells were expanded using two pre-

culture steps and cell culture followed by virus culture. The PV was purified using

normal flow filtration for clarification, tangential flow filtration for concentration and

followed by two chromatography steps, involving size exclusion and ion exchange

chromatography. Purified virus was inactivated using formaldehyde.

17

Figure 1.1: Process overview for preparation of trivalent IPV. Monovalent bulks are

prepared for each poliovirus (type 1, 2 and 3) separately (Thomassen et al., 2013).

18

Subsequently, the IPVs were mixed to obtain trivalent bulk prior to formulation and

filling (Thomassen et al., 2013). Due to the need to cultivate large amounts of the live

polio virus which involved complex manufacturing and purification processes, exposure

of workers to the live virus must be safely guarded. At the Cutter Laboratories,

insufficient inactivation of the IPV led to paralysis in almost 200 vacinees and their

contacts (Offit, 2005).

This incident resulted in the temporary halt of the use of IPV and encouraged

research groups worldwide to produce a live attenuated polio vaccine. Although IPV has

an excellent track record on efficacy, it had poor induction of intestinal immunity,

required cold-chain, booster injections and had expensive and potentially dangerous

manufacturing processes with the wild type virulent virus. As such, large-scale clinical

trials were evaluated using several live attenuated PV strains (Melnick and Brennan,

1959).

1.2.2 Oral polio virus vaccine

The Oral Polio Vaccine (OPV) is an attenuated vaccine which has reduced

worldwide poliomyelitis caused by PV infection. The IPV was the only poliovirus

vaccine available until licensure of the Oral Poliovirus Vaccine (OPV) in 1961-1962

(Kew et al., 2005). There was a need for an OPV then as it is a live attenuated vaccine

which has long-lasting immune response and regular boosters are not needed. One time

oral administration of the OPV was found to provide lifelong protection against

poliomyelitis. Elimination of poliomyelitis in the developing world was achieved mainly

19

through mass vaccination with the OPV despite its ability to revert to the wild type in 1

out of 750,000 vacinees (Kowane et al., 1987).

The OPV was produced by micro-carrier technology and passaging the virus in

primary monkey kidney cells at sub-physiological temperatures generated spontaneous

mutations in the viral genome (Van Wezel, 1967). The mutated strains with low

virulence were selected and used as vaccines. The process was later scaled up by using

750-L bioreactors and replacing tertiary monkey kidney cells with Vero cells

(Thomassen et al., 2013). This has led to successful production of oral polio vaccines

(OPV) which have reduced worldwide poliomyelitis by the mid-1980s.

As such, the World Health Assembly declared in 1988 that polio should be

eradicated by the year 2000, aligned with the success of the small pox eradication

program. However, the eradication deadline was repeatedly postponed and has not been

met till today. This was because there were several countries where polio persistently

remained endemic such as Afghanistan and Pakistan whereby the population remained

resistant to polio immunization or India where OPV had low efficacies due to

overcrowding and poor sanitation (Grassly et al., 2006). Therefore, there is a need to

have a greater understanding of the molecular determinants of neurovirulence in PV to

develop new and better vaccines based on genetic manipulations to render the virus non-

pathogenic, yet containing similar antigenic structures to the wild type polio virus.

1.2.3 Molecular Determinants of Neurovirulence

The molecular determinants of neurovirulence in PV have been determined. The

poliovirus is an enterovirus from the Picornaviridae family. The PV has a 5’ non-

20

translated (NTR) cloverleaf structure and a 3’-poly (A) tail. Domain I is important for

virus replication and domains II-VI encompass the internal ribosome entry site (IRES)

that directs translation of mRNA by internal ribosome binding (Figure 1.2). If there are

mutations in the 5’-NTR, this decreases multiplication efficiency, alters cell tropism and

attenuates virulence (Kew et al., 2005).

There are three attenuated strains being used as OPV: Sabin 1 was derived from

the Mahoney strain, Sabin 2 was derived from the P172 strain and Sabin 3 was derived

from the Leon strain. Identification of the genetic determinants of attenuation of the

Sabin OPV strains has been comprehensively reviewed (Kew et al., 2005). The complete

sequences of the three poliovirus genomes and the development of infectious poliovirus

complementary Deoxyribonucleic Acid (cDNA) clones have led to the systematic

investigations of the critical mutations responsible for the attenuated phenotypes of the

Sabin OPV strains.

From the analysis of nucleotide (nt) sequences present in the three poliovirus

Sabin strains, nucleotide substitutions which were critical in attenuating mutations in the

virulent strains isolated from cerebrospinal fluid were identified. There are 57 nucleotide

substitutions distinguishing the Sabin 1 strain from its parent strain (Nomoto et al.,

1982). Among these nucleotide substitutions, the A480G in the IRES is the most

important determinant of the attenuated phenotype of Sabin 1 (Fig. 1.3). Their study

strongly suggested that nt. 480 influences the formation of a highly ordered structure in

the 5’-NTR that is responsible for neurovirulence (Kawamura et al., 1989). Four other

nucleotide substitutions contributing to the attenuated phenotype were mapped to the

capsid region. There was one in VP4, one in VP3 and two in VP1.

21

Figure 1.2: Structure and genome of Poliovirus. All structural proteins: VP1-VP4 are encoded by the P1 region of the

genome. The P2 and P3 genes encode for seven non-structural proteins: 2A-2C and 3A-3D (Kew, et al., 2005).

22

Figure 1.3: Three genotypes of Poliovirus Sabin vaccine strains. All contain a

determinant of attenuation in the 5’-NTR of ssRNA mutation that reduces viral

replication. They are nt. 480 in Sabin 1, nt. 481 in Sabin 2 and nt. 472 in Sabin 3

(Kawamura et al., 1989).

23

In addition, there was also one substitution that contributed to the temperature-sensitive

phenotype mapped to the 3DPol region (Bouchard & Lam, 1995; Paul et al., 2000).

However, there were only 2 nt. substitutions found in the Sabin 2 strain that

appeared at position 481 within the IRES region and position 2909 within VP1 (Figure

1.3). For Sabin 3, a total of 10 nt. substitutions were found to differ from its parent

strain, but only 3 substitutions appeared to be the main determinants for the attenuated

phenotype (C274U in IRES, C2034U in VP3, and U2493C in VP1) (Westrop et al.,

1989). Sabin 3 strain was also found to be the most genetically unstable of the three

Sabin strains. As a result of the analysis of the molecular determinants of attenuation, in

vitro construction of piconaviruses with reduced-virulence could be performed via the

introduction of mutations in the 5’-NTR to reduce the efficiency of viral replication.

1.3 Enterovirus 71 as an etiological agent of hand, foot, mouth disease

1.3.1 Enterovirus 71

The World Health Organization (WHO) and the scientific community have been

addressing challenges unprecedented in public health posed by Enteroviruses in the post-

poliovirus era. Enteroviruses such as Enterovirus 71 (EV-A71), Coxsackie type A16

(CV-A16) and other enteroviruses causing hand, foot and mouth disease (HFMD) have

led to over 7 million infections, including 2457 fatalities in China from 2008 to 2012

(Xing et al., 2014). However, due to increasing travels and rapid globalization,

outbreaks in other parts of the world have also appeared in other regions in cyclical

epidemics (Bible et al., 2007).

24

Within the family Picornaviridae, the genus Enterovirus comprises 12 species.

The species Enterovirus A consists of 25 serotypes and includes the enteroviruses that

can cause the HFMD are the EV-A71, CV-A16, CV-A5, CV-A6, CV-A8 and CV-A10

(Pallansch and Roos, 2001). Serotypes such as CV-A4 and CV-A5 are more often

associated with herpangina. Five years of virological surveillance in China (2008-2014)

showed that 43.73%, 22.04%, and 34.22% of HFMD cases were due to EV-A71, CV-

A16 and other enteroviruses, respectively (Liu et al., 2015). However, Coxsackie viruses

which are common etiological agents of HMFD do not generally cause neurological or

cardiopulmonary disease but EV-A71 is the main causative of fatal HFMD infections

(Ooi et al., 2010). Of particular interest in this study is EV-A71 as approximately 80-

85% of pathogens isolated from HFMD-related deaths were EV-A71 based on clinical

etiological data (Ho et al., 1999). Table 1.1 summarizes the various clinical symptoms

associated with enteroviral infections.

The EV-A71 virus is classified as Human enterovirus A (HEV-A) species,

belonging to the genus Enterovirus in the family Picornaviridae, together with some

Coxsackie A viruses (Brown, 1995). Surveillance data indicated that EV-A71 and CV-

A16 can co-circulate during HFMD outbreaks and such co-circulation may have

contributed to the genomic recombination between EV-A71 and CV-A16 (Yan et al.,

2012, Yip et al., 2013) which was believed to have led to the emergence of a

recombinant EV-A71 responsible for the large HFMD outbreak in China in 2008 (Zhang

et al., 2010). Phylogenetic analysis suggests that EV-A71 originated from CV-A16 from

as early as 1940 (Tee et al., 2010). EV-A71 isolates of sub-genotypes B3 and C4 had

high sequence homology to CV-A16 at P2 (≥ 81%) and P3 genomic regions (≥ 83%)

25

(Yoke-Fun and Abu Bakar, 2006). Hence, this corroborates surveillance data of possible

inter-typic recombination involving EV-A71 and CV-A16. These recombination events

could have played important roles in the emergence of the various EV-A71 sub-

genotypes.

The EV-A71 virus is a non-enveloped icosahedral viral particle that contains a

single-stranded, positive sense, polyadenylated viral Ribonucleic Acid (RNA) of

approximately 7.4kb (Figure 1.4). The capsid is made up of 60 protomers, each

consisting of 4 polypeptides that comprise the structural proteins, VP1, VP2, VP3 and

VP4. Of all the polypeptides, VP4 is located on the internal side of the capsid while

VP1, VP2 and VP3 are located on the external surface of the EV-A71 virus (SIB Swiss

Institute of Bioinformatics, 2014).

26

Table 1.1 Clinical manifestations of enteroviruses.

Each symptom may potentially be caused by more than one enterovirus (Melnick, 1997).

Enterovirus Serotypes Clinical

Manifestations

Poliovirus 1-3, Echovirus 4, 6, 9, 11, 30; Enterovirus 71

Paralysis

Poliovirus 1-3; CV A2, A4, A7, A9, A10, B1-B6;

Echovirus 1-11, 13 to 23, 25, 27, 28, 30, 31; Enterovirus 71

Aseptic Meningitis

Coxsackievirus A5, A8, A10, A16, Enterovirus 71 Hand, foot and

mouth disease

(HFMD)

Coxsackievirus A2 to A6, A8, A10 Herpangina

Coxsackievirus A24, Enterovirus 70 Acute hemorrhagic

conjunctivitis

Echovirus 2, 6, 9, 19 Encephalitis

Coxsackievirus B1-B5, Enterovirus 71 Meningoencephalitis

Coxsackievirus B3 Pericarditis,

myocarditis

27

Figure 1.4: Structure and genome of Enterovirus 71. The capsid consists of 60

protomers, each consisting of 4 polypeptides that comprise the structural proteins: VP1,

VP2, VP3, and VP4 are encoded by the P1 region of the genome. The P2 and P3 genes

encode for seven non-structural proteins: 2A-2C and 3A-3D. Reproduced from

ViralZone, with permission from Philippe Le Mercier, Swiss Institute of Bioinformatics

(SIB Swiss Institute of Bioinformatics, 2014)

28

The EV-A71 genome comprises a 5’ non-translated region (5’-NTR), a long

open reading frame (ORF) and a short 3’-NTR followed by a polyadenylated (poly A)

tail. The 5’-NTR contains an internal ribosome entry site (IRES) which allows viral

protein translation in a cap-independent manner (Belsham and Sonenberg, 1996). The

ORF is translated into a single large polyprotein of approximately 2100 amino acids (aa)

which is divided into three regions (P1-P3). The polyprotein undergoes a series of

processing events, culminating in the maturation cleavage of the polyprotein which

generates structural and non-structural viral proteins (Toyoda et al., 1986). The four

structural proteins, VP1, VP2, VP3 and VP4, are encoded by the P1 region which

constitutes the virus capsid. Proteins derived from the non-structural P2 (2Apro, 2B, 2BC,

2CATPase) and P3 (3A, 3AB, 3B, 3Cpro, 3CDpro, 3Dpol) regions are most directly involved

in virus replication, structural and biochemical changes which are observed within the

infected cell. (Shen et al., 2008). Non-structural proteins (2A and 3C proteinases) are

responsible for apoptosis of infected cells in vitro (Kuo et al., 2002; Li et al., 2002).

The EV-A71 virus commonly causes the hand, foot and mouth disease (HFMD)

in young children less than 6 years of age. Although EV-A71 started circulating as early

as 1963 in the Netherlands, EV-A71 was first reported to be isolated in 1969 from the

stool specimen of an infant with serious nervous system disease in California (Schmidt

et al., 1974). Mild symptoms of EV-A71 infection in children range from fever (≥

39oC), sore throat, loss of appetite and rash with vesicles on hands, foot and mouth area.

In addition, rupture of the vesicles would lead to ulcers in the throat, mouth and tongue

(Figure 1.5).

29

Figure 1.5: Vesicles on the foot, mouth and palm area of children infected

with hand, foot and mouth disease (HFMD). Adapted from the Dermatologic

Image Database, Department of Dermatology, University of Iowa College of

Medicine, USA, 1996 (Permission granted by University of Iowa).

30

EV-A71 can produce more severe symptoms such as aseptic meningitis, brain

stem encephalitis, acute flaccid paralysis, neurogenic pulmonary edema, delayed

neurodevelopment and reduced cognitive function (Ooi et al., 2010). In 1997, an

outbreak of EV-A71 caused 41 deaths in Sarawak, Malaysia. This was followed by a

large outbreak in Taiwan involving over 100,000 cases which led to 78 fatalities (Lin et

al., 2002). In more recent years, large outbreaks with high fatalities occurred across the

Asia Pacific in countries like Cambodia, Vietnam and China (Zhang, et al., 2009; Thoa,

et al., 2013). For example, 54 out of the 78 HFMD cases in a 2012 outbreak in

Cambodia were highly fatal.

Xing et al. (2014) discovered that between 2008 to 2012, there were 7, 200, 092

probable cases of HFMD reported. Approximately 82,486 patients developed

cardiopulmonary or neurological complications and 1,617 of laboratory confirmed

deaths were associated with EV-A71. In Vietnam, there were 13 deaths out of 49,317

cases of infection (WHO, 2014). Some of these young children died of complications

due to pulmonary edema, while others could not survive brain and spinal cord

inflammations due to virulent genotypes of EV-A71 (Zhang et al., 2010). The lack of

vaccines and antiviral drugs against EV-A71 highlights the urgency and significance of

developing preventive and treatment agents against EV-A71 to prevent further fatalities.

1.3.2 Distribution of EV-A71 genotypes and sub-genotypes worldwide

EV-A71 was found to evolve quickly in the past 15 years and many countries experience

cyclical epidemics (McMinn, 2002). To investigate the genetic variability of various

EV-A71 strains and their associations with outbreaks, the complete cDNA sequence

31

(891bp) encoding the VP1 capsid protein of EV-A71 strains isolated from various

countries over a 30-year period was analysed and the monophylogenetic serotype was

further divided into three distinct genotypes (A, B, C) and 11 sub-genotypes (A, B1-B5,

C1-C5) (Brown et al., 1999). This was reported by Brown and his colleagues (1999) in

the phylogenetic analysis of EV-A71 strains (Figure 1.6). In addition, a separate sub-

genotype B0 was proposed after analysing EV-A71 strains from the Netherlands from

1963 to 1967 (van der Sanden et al., 2009). A new sub-genotype B6 was isolated in

Columbia (AF135899), and another new sub-genotype B7 strain was isolated in Brazil

(AY278249) (Castro et al., 2005).

32

Fig. 1.6: Phylogenetic tree of the VP1 region of EV-A71 strains detected in various

countries, showing different genotypes and sub-genotypes of EV-A71. Eight hundred

and fifty-five nucleotide positions in each VP1 region were included in the analysis. The

tree was constructed by the neighbour joining method and bootstrap values calculated

from 1,000 trees. The scale bar indicates the estimated number of substitutions per 100

nucleotides. EV-A71 strains of potential novel genotype or sub-genotype were

highlighted in gray. GenBank accession numbers are indicated in parentheses (Brown et

al., 1999; Yip et al., 2013)

33

Genotype A contains a single member, the prototype EV-A71 strain BrCr while

genotype B has been expanded to include eight sub-genotypes (B0-B7) consisting of

thousands of strains isolated from 1972 to 2011 in the in the United States, Australia,

Bulgaria, Columbia, Hungary, Japan, Malaysia, Netherlands, Singapore, Taiwan and the

UK. Genotype C is made up of five sub-genotypes (C1-C5) which includes EV-A71

strains isolated from 1986 through to 2010 from Japan, United States, Australia, China,

Canada, Netherlands, France, Hong Kong, Singapore, Taiwan, Thailand, UK, Germany

and Malaysia. Two strains belonging to potential new sub-genotype C6 were isolated in

Taiwan (HM622391 and HM622392) (Figure 1.6). A strain belonging to a new genotype

D was isolated in India (AY179600) (Yip et al., 2013). Within the same sub-genotype,

EV-A71 strains share more than 92% nucleotide sequence identity whereas the

nucleotide sequence identity between the three genotypes ranges from 78% to 83%

(Brown et al., 1999). The EV-A71 strains had 46% amino acid identity with the

polioviral P1 capsid region and 55% with the entire polyprotein (Brown and Pallansch,

1995).

Lee and co-workers (2012) have established that the B and C genotypes were the

common ones circulating throughout the world from 1997 to 2012 (Table 1.2). For

example, EV-A71 outbreaks in Malaysia were caused by different predominant

genotypes occurring in 1998-2000 (C1 and B4), 2002–2003 (C1, B4 and B5) and 2005-

2006 (C1 and B5). In contrast, EV-A71 infections reported from Singapore have been

caused mainly by the B sub-genotypes: B3 (1997-1999), B4 (2000-2003) and B5 (2006-

2008) (Table 1.2) (Chan et al., 2003).

34

Table 1.2: Distribution of EV-A71 genotypes throughout the world from 1997 to 2012.

1997 1998

1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 ‘10 ‘11 ‘12

Malaysia C1,C2,

B3,B4

C1 C1, B4 B4,C1 C1, B4 B5,B4,

C1

B4,

B5

B5,C1 B5

Singapore B3,B4 B3,C1 B3 B4, B5 B4 B4,C1 B5 B5,

C2

Taiwan B3,C2,

C4

B4 B4 B4, C4 B4,C4 B4 C4 C4 C5 B5,C

5

B5,

C4,

C5

B5 C4 C4,

B5

B5

Japan C2,C4,

B3,B4

C2 C2 C2,B4 C2 B4,C2,C4 C4,C1,

B5,B4

C4 C4 C4

China C2 C4 B3,C1,

C4

C1,C4 B4,C4 C1,C2,C4 C2,C4 C4 C2,C4 C2,C4 C2,C

4

A,B5,

C2,

C4

C2,

C4

C2,

C4

C4 C4

Vietnam C1,C4,

C5

Australia C2 B3,C2 B4,C1 B4,C1 C1 C1 C4

Korea C3 C4 C2,

C4

Holland C1,C2 C2 C2 C1 C1, C2 C1,

C2

C1, C2 C1,

C2

C2 C2

United Kingdom

C2 C1, C2 C2 C1 C1 C1 C1 C1 C1,C2 C2 C2

35

However, there are some countries such as China whereby the sub-genotype C4

has been the predominant strain causing fatalities since 1998 based on phylogenetic

analysis. Hence, biopharmaceutical organisations in China have focused on developing

the inactivated vaccine to target the sub-genotype C4. In addition to China, the United

Kingdom (UK) has also experienced infections due to a consistent sub-genotype C1 that

was responsible for periodic outbreaks since 1998. It remains to be investigated if

pharmaceutical companies in the UK will be designing vaccines against sub-genotype

C1.

1.3.3 Development of Experimental EV-A71 Vaccines

There is currently no vaccine against EV-A71 that has been approved by the

United States Food and Drug Administration (FDA) or European Medicines Agency

(EMEA). Formalin-inactivated EV-A71 vaccines are currently being developed against

the C4 sub-genotype in China (Li et al., 2014). Although some research groups have

proposed that the sub-genotype C4 should be classified as genotype D (Chan et al.,

2010), there is increasing evidence that C4 should instead be further subdivided into C4a

and C4b (Xu, et al., 2013). Each genotype has approximately 15% genetic divergence

from each other, while each sub-genotype differs genetically from each other by

approximately 8% (Brown, et al., 1999).

Immunization with one sub-genotype could potentially cross-protect against all

other sub-genotypes. This was confirmed from a study by Chou et al. (2012) who

demonstrated that their inactivated EV-A71 vaccine based on the sub-genotype B4 could

elicit cross-neutralizing antibody responses against sub-genotypes B1, B5 and C4A.

36

However, the levels of neutralising antibody titers may not be high enough to be

protective against all the sub-genotypes. In addition, their vaccine was tested on a small

sample size of 60 adults. Further research could be carried out to target a larger sample

size consisting of young children and infants (Chou et al., 2012).

Huang et al. (2013) conducted studies with children to measure cross-reactive

neutralizing antibody titres against different EV-A71 genotypes. The serology data

showed that children infected with genotypes B and C had consistently lower

neutralizing antibody titres against genotype A (Huang et al., 2013). It could be possible

that immunization with a particular genotype could elicit higher cross-neutralizing

antibodies against that particular genotype. For example, a vaccine against genotype C

could cross-protect against sub-genotypes C1-C5. Zhang et al. (2014) analysed the

cross-reactive neutralizing antibodies (NtAb) in sera from EV-A71–infected and

children vaccinated with the inactivated vaccine. They showed that the NtAb titers in

children elicited by the EV-A71-C4a vaccine were higher against EV-A71-B4, B5, C1,

C2 and C4b than against other EV-A71 sub-genotypes. Surprisingly, the NtAb titre

against C4a was always lower than against all other genotypes and this indicated that the

current genotyping of EV-A71 may not reflect their antigenicity (Zhang et al., 2014).

1.3.4 Potential candidates for EV-A71 Vaccine

There is considerable interest in the development of EV-A71 vaccines as HFMD

has become a severe global and life-threatening disease in infants and young children. In

2014, China reported over 2.7 million cases of HFMD caused by EV-A71, CVA-16, and

other enteroviruses, that led to approximately 243 deaths (Western Pacific WHO, 2014).

37

Research groups have developed experimental inactivated vaccines (Liang et al., 2013),

recombinant VP1 vaccine (Wu et al., 2001), live attenuated vaccines (Arita et al., 2005,

Arita et al., 2007), virus-like particles (Li et al., 2013), synthetic peptide vaccine (Foo et

al., 2007, Kirk et al., 2012) and DNA vaccine (Tung et al., 2007).

Each type of vaccine has its own advantages and disadvantages. The inactivated

EV-A71 vaccine is considered the safest viral vaccine as there will be no reversion to the

infectious wild type strain. Reversion of the live attenuated poliovirus vaccine strains

generally happens in 1 out of 750, 000 vacinees, but this occurrence will not happen

with the inactivated poliovirus vaccine. Zhu and coworkers (2014) showed that the

inactivated EV-A71 vaccine was highly immunogenic and elicited antibodies in children

with a neutralizing titer of 1:16 and provided protection against mild to severe HFMD

for at least 1 year in children (Zhu et al., 2014).

Nevertheless, the inactivated vaccine has several major disadvantages as

immunogenicity is not long-lasting and requires multiple boosters. This is because

inactivated vaccines only initiate the humoral immunity and lacks cellular immunity

(CD8+ T cells) responses. In an inactivated vaccine, there is no viral replication and

hence, lower antigen content and less prolonged antigen persistence (Zhu et al., 2013).

As a result, inactivated vaccines elicit weaker and shorter antibody responses and no

long-term immune memory. This explains the need for multiple boosters after

administration of inactivated vaccines. Another disadvantage of the EV-A71 inactivated

vaccine would be their failure to prevent CV-A16 infections and that could compromise

the acceptability of inactivated monovalent EV-A71 vaccines. The study of Chong et al.

(2015) also concurred with the results that even though the efficacy of inactivated EV-

38

A71 vaccine was more than 90% against EV-A71-related HFMD, only >80% protection

against EV-71 associated serious diseases was reported (Chong et al., 2015).

Increasingly, there has been more research to develop recombinant VP1 vaccines

that contain VP1 as the major neutralizing antigen, harnessed into vaccine vectors. They

are advantageous as they are cost-effective immunogens when compared to the

inactivated vaccines and are safe. This was confirmed by Chen et al. (2006) who showed

that when transgenic tomatoes expressing the VP1 protein were fed to Balb/c mice as an

oral vaccine, the serum from the immunized mice showed IgG and IgA neutralizing

titers of 1:16. The vaccine had elicited both humoral and cellular immune responses

from the mice. The serum was also able to neutralize EV-A71 infection in

Rhabdomyosarcoma cells. This demonstrates the potential of recombinant VP1 vaccines

as good vaccine candidates (Chen et al., 2006).

However, recombinant VP1 vaccines produced lower levels of NtAb in vacinees.

This increases the risk of unwanted immune responses such as antibody-dependent

enhancement (ADE) (Han et al., 2011). ADE is a phenomenon whereby pre-existing

sub-neutralizing antibodies could not inhibit virus entry and replication. ADE has been

observed for EV-A71 (Han et al., 2011), poliovirus (Palmer et al., 2000), and CVB

(Girn et al., 2002). Han and colleagues (2011) demonstrated that previous exposure to

an avirulent strain of EV-A71 before another EV-A71 infection increased the risk factor

for developing severe neurological complications and deaths. They also concluded that

the presence of sub-neutralizing levels of antibodies exacerbated EV-A71 infection (Han

et al., 2011). The possible impact of ADE has to be taken into account when designing

vaccines to prevent unwanted induction of enhancing antibodies. Therefore, a better

39

alternative would be to use live attenuated vaccines that elicit the cellular immune

response, besides the humoral immunity.

The live attenuated vaccine (LAV) is cheaper to produce, induces excellent

immunogenicity and confers live-long immunity. LAV is preferred over the inactivated

EV-A71 vaccine as it can elicit both humoral and cellular immunity, alongside the

innate and adaptive immunity. There is an increasing body of research which indicates

that cellular immunity and not humoral immunity determines the clinical outcome of

EV-A71 infections. In the most severe cases with pulmonary edema, blood samples

showed lower levels of cellular cytokines and interferons (TNF-α, Th1 and IL-6), while

there was no difference in the level of NtAb titers between mild, severe and fatal cases.

Chang and co-workers (2006) also discovered that humoral immunity did not

affect the clinical outcome in severe cases of EV-A71 infection. This is possible because

a lower cellular immunity would delay viral killing, increase viral dissemination and

sustain a systemic inflammatory response that leads to disease severity. This also

explains why fatal HFMD infections generally afflict infants as they would have weaker

cellular immunity although they may have maternal EV-A71 NtAb. However, the low

NtAb levels would have no effect in neutralizing the high EV-A71 viral load (Chang et

al., 2006).

In addition, recent research demonstrated that the VP2 antigen subjugates the

IFN-ᵞ-secreting CD4+ T cell responses against EV-A71, compared with VP1, VP3 and

VP4 (Tan et al., 2013). This was in contrast to previous investigations on T cell

immunity that focused on the VP1 antigen as it is highly exposed on the structure of the

40

EV-A71 virus (Figure 1.4). For example, a previous study showed that VP1-145G/Q

was associated with milder disease, while VP1-145E was associated with disease

severity (Nishimura et al., 2013). Further research showed that VP1-145G/Q regulated

the binding of VP1-244K to sulfated Tyr residues at the P-selectin glycoprotein ligand-1

(PSGL-1) N-terminus on leukocytes (Lee et al., 2013). As PSGL-1 is involved in

leukocyte migration and cytokine production, EV-A71 interaction with PSGL-1 is vital

for dissemination within the host and regulation of antiviral host response. These

discoveries have led to an increased understanding about disease progression of EV-A71

post-infection, which range from an absence of symptoms (~71%) to fatality (~0.05%)

(Chang et al., 2002). Taken altogether, an effective LAV should carry both B and T cell

epitopes.

However, the disadvantage of LAVs is the possibility of genetic instability and

possible reversion to wild-type virulence. This phenomenon of reversion has been

observed in countries with extensive polio LAV programs (Kew et al., 2005). The

mutation rate of single-stranded RNA viruses is especially high when compared to DNA

viruses. RNA viruses have a mutability rate of 10-3 to 10-5 mutations per nucleotide

copied, per replication cycle (Holland et al., 1982). This could be due to the lower

fidelity of the wild-type RNA-dependent RNA polymerases. They are estimated to

misincorporate one or two bases in every genome copying event, which explains the

high mutation rate of RNA viruses (Hicks and Duffy, 2011).

In addition, as LAVs are excreted from vaccine recipients, they pose a risk to

immunocompromised individuals who have yet to be vaccinated. The excreted virus can

mutate to more virulent forms. As a result, regulatory bodies are duly concerned about

41

the safety of such vaccines as there is always a potential of viral escape or mutation to

revertants. Nevertheless, recent studies have shown that it is possible to generate LAVs

that have much lower risks of reversion. Meng and Kwang (2014) showed that

attenuated high-fidelity variants of EV-A71 with a single amino acid change, L123F in

its 3D Polymerase (3DPol) greatly reduced viral pathogenicity in vivo. These EV-A71

mutants have lower pathogenicity as they are unable to generate replication-efficient

mutations and have much lower genetic diversity to withstand a wide range of selective

pressures (Meng and Kwang, 2014). Hence, high-fidelity EV-A71 variants can reduce

mutation risk and increase stability of LAVs. With that, there is great potential in LAVs

and the past success of LAVs for diseases such as poliovirus, yellow fever, rubella,

measles, mumps, rabies, rotavirus, influenza and varicella zoster has proven that safe

and effective LAVs can be developed through optimization of immunogenicity and

genetic stability.

Since the same Type 1 IRES structure is present in both poliovirus and the EV-

A71 Genotype A (BrCr) genome, Arita and co-workers (2005) introduced 3 mutations at

nucleotides 485, 486 and 474 in the EV-A71 genome which corresponded to the

mutations present in Sabin 1, 2 and 3 strains, respectively. They constructed a LAV from

the BrCr strain (S1-3’) carrying the 3 mutations in the 5’-NTR, 2 mutations in the 3Dpol

and a single mutation in the 3’-NTR. Although there was reduced virulence, mild

neurological symptoms were still observed in the 3 cynomolgus monkeys immunized

with the EV-A71 (S1-3’) strain and the virus was still isolated from the spinal cord.

Hence, the plan to use this strain as a LAV was discontinued (Arita et al., 2005). The

42

LAV constructed was still able to multiply extensively in the neuronal cells and hence,

still caused tremors in the monkeys.

The molecular basis of virulence in EV-A71 is still uncertain. It remains to be

investigated if there is a universal molecular determinant present in every EV-A71 fatal

sub-genotype strain or whether every fatal sub-genotype strain differs in virulence

determinant. In a comparison of the amino acid sequence of the fatal (EV-A71 strain

5865/Sin/000009) and the non-fatal (EV-A71 strain 5666/Sin/002209) strain isolated

from the HFMD outbreak in Singapore, Singh and co-workers (2002) reported that a

nucleotide change at position 5262 in the 3A non-structural region could possibly

contribute to the virulence of EV-A71 strain 41. Comparative analysis revealed 99%

amino acid similarity except for the amino acid 1506. The fatal strain contains adenine at

position 5262 that encoded for threonine, while the non-fatal strain contains guanine that

encoded for alanine (Singh et al., 2002) (Figure 1.7).

Li et al. (2011) compared the sequences of virulent and non-virulent strains and

concluded that four amino acids at two positions (Gly/Gln/Arg in position 710 and Glu

in position 729) in the VP1, one (Lys in position 930) and four nucleotides at three

positions (G in position 272, U in position 488 and A/U in position 700) in the 5’-NTR

region are likely to contribute to the EV-A71 virulent phenotype (Li et al., 2011). In

another study, Yeh et al. (2011) reported that nucleotide 158 in the EV-A71 5’-NTR

contributed to the virulence of the virus belonging to the sub-genotype B1 (Figure 1.8).

43

Figure 1.7: Differences of nucleotide between the B4 genotype fatal strain

(GenBank: AF316321) and the non-fatal strain 10 (GenBank: AF352027). There is

99% nucleotide similarity, except at nucleotide 5262 in the 3A non-structural region

(Singh et al., 2002).

A5262G

44

Figure 1.8: A single nucleotide change from Cytosine to Uridine at position 158 in

Stem Loop II of 5’-NTR contributes to virulence of EV-A71 sub-genotype B1 in

mice. This nucleotide change led to reduced viral translation and virulence in mice (Yeh

et al., 2011).

45

A single nucleotide change from cytosine to uridine at position 158 caused an

alteration in the RNA secondary structure of stem loop II which led to reduced viral

translation and virulence in mice (Yeh et al., 2011). An earlier study published by Izuka

et al. (1989) demonstrated that deletion from nucleotides 564 to 726 in the 5’-NTR of

the poliovirus Mahoney genome was successfully expressed as a stable, less

neurovirulent phenotype. Mutant strains carrying long deletions maybe more stable and

safer than those carrying point mutations, short deletions or short insertions.

With the discovery of virulence determinants for some EV-A71 sub-genotypes,

rational design of a LAV based on site-directed mutagenesis of specific nucleotides

allows control of the primary structure of proteins. Therefore, it is of interest that by

changing the nucleotides in the virulence-associated positions of the viral genome,

neurovirulence can be reduced and genetic stability increased to reduce the possibility of

reversion to virulence. However, complete stability may be difficult to attain as there

may be other virulent determinants of attenuation that have yet to be discovered. In

addition, recombination between different group C enteroviruses occur so frequently in

humans that exchange of the attenuation region maybe inevitable, especially if there is

high circulation of viruses (Liu et al., 2014).

Recent research has also focused on virus-like particles (VLP) as good vaccine

candidates. VLPs resemble the authentic virus in terms of morphology, capsid proteins

and protein composition, but are devoid of genetic material. Hence, VLPs are not

infectious but can self-assemble in eukaryotic expression systems such as

Saccharomyces cerevisiae (Li et al., 2013) and Pichia pastoris (Cereghino and Cregg,

2000). More importantly, VLPs contain an arrangement of epitopes on its surface that

46

can elicit NtAb against that particular virus. Indeed, VLPs have been developed as

licensed vaccines for human papillomavirus (Paavonen, et al., 2007) and Hepatitis B

virus (Roldao et al., 2010). Therefore, there remains potential for VLPs to be an

excellent choice of vaccine for EV-A71. In a recent publication by Zhang et al. (2015),

high yield production of recombinant VLPs of EV-A71 (approximately 150 mgVLP/liter

of yeast culture) was achieved in Pichia pastoris. Maternal immunization with the VLP

co-expressing P1 and 3CD proteins of EV-A71 was able to protect neonatal mice in both

intraperitoneal and oral challenge against EV-A71. The transgenic Pichia pastoris

produced more VLPs than that reported for baculovirus/insect cell expression system as

the latter only produced 64.3 mg/L under optimized condition (Paavonen, et al., 2007).

The overall cost of insect cell culture is relatively high and there is a potential risk of

contamination with baculovirus particles. Recombinant virus-like particles produced

from baculovirus formulated with CFA/IFA adjuvants elicited a neutralization titer of

1/160 which was significantly lower than the neutralization titer (1/640) elicited by the

inactivated EV-A71 formulated in alum (Chou, et al., 2012).

In addition, there is an increasing trend to develop a bivalent VLP vaccine

against both EV-A71 and CAV 16 as both viruses tend to co-circulate in major HFMD

outbreaks. There has been a greater understanding of the crystal structure of the EV-A71

virus. Lyu et al., (2014) discovered that at least 18 residues from the N-terminus of VP1

BC loop are transiently externalized, making it suitable for foreign peptide insertion for

the generation of recombinant EV-A71 viruses. It was observed that such insertions did

not affect the capsid structural changes and virus uncoating process. This would provide

more insights into vaccine development against HFMD. In their more recent study, they

47

deduced that the crystal structures of EV-A71 VLP and chimeric EV-A71/CV-A16 VLP

contained major neutralization epitopes of EV-A71 that are mostly preserved in both

VLPs. The replacement of 4 amino acid residues in the VP1 GH loop of the SP70

epitope was able to change the chimeric VLP to elicit neutralization responses against

both EV-A71 and CV-A16. The mutated VP1 GH loop in the chimeric VLP was well

exposed on the particle surface and exhibited a surface charge potential different from

that contributed by the original VP1 GH loop in EV-A71 VLP (Lyu et al., 2015).

Xu and co-workers (2014) demonstrated that passive transfer of neutralizing

monoclonal antibody (nMAb) against the VP2 protein of EV-A71 protected BALB/c

mice against lethal EV-A71 infection. Interestingly, they showed that the cross-

neutralizing EV-A71 antibodies were induced using hepatitis B virus core protein (HBc)

as a carrier, and the VP2 epitope (amino acids 141-155) was able to elicit neutralizing

antibodies with a titer of 1/32 and conferred 100% in vivo passive protection (Xu et al.,

2014). Taken altogether, a broad-spectrum vaccine strategy targeting the high-affinity

epitopes of VP1 and VP2 may elicit effective immune responses against EV-A71

infection.

In exploring peptide vaccines, there are many benefits such as no risk of

reversion, increased stability and induction of specific NtAbs. Synthetic peptide

vaccines against HFMD contain EV-A71 neutralization B-cell epitope such as the SP70

from the VP1 protein of EV-A71 strain 41. This SP70 peptide was able to elicit NtAb

against different EV-A71 sub-genotypes. When anti-SP70 sera was passively

administered into suckling Balb/c mice, followed by lethal challenge with various EV-

A71 genotypes (B2, B5, C3, C4), neutralizing antibodies elicited by SP70 were able to

48

confer good passive protection (Foo et al., 2007). However, protection of mice was

found to be only at 80%. When compared to the inactivated and recombinant VP1

vaccines, immunogenicity of peptide vaccines is low (Chou et al., 2012). Low levels of

NtAb may also lead to unwanted side effects like ADE.

The immunogenicity of peptide vaccines can be further increased when they are

co-delivered with strong mucosal-immune adjuvants or nanoparticles (Gregory et al.,

2013). However, the usage of strong adjuvants such as complete Freund's adjuvant is not

acceptable for human use and even incomplete Freud's adjuvant is reactogenic and may

be responsible for cold abscesses. Currently, aluminium salts and MF59 are the only

vaccine adjuvants approved for human use. The low immunogenicity of peptide

vaccines could be due to structural and conformational differences between the peptide

that is synthesized in a recombinant protein expression system which differs from the

endogenous EV-A71 viral protein. More studies could be performed to identify

Enterovirus-specific and cross-genotype neutralization epitopes in VP1 that could

induce a protective immune response to ensure high levels of NtAb responses.

Recent investigations showed that peptide vaccines based on recombinant

multiple tandem linear neutralizing epitopes (mTLNE) have been constructed by linking

VP1-SP55, VP1-SP70 and VP2-SP28 with a Gly-Ser linker. It was demonstrated that

passive transfer of anti-mTLNE sera was able to confer full protection in neo-natal mice

against lethal EV-A71 challenge by inducing both the humoral and cellular immunity

(Li et al., 2014). In addition, a recent study was performed by Xu and co-workers (2014)

who also constructed a recombinant vaccine containing the epitope within the VP2 EF

loop. They discovered that passive transfer of anti-sera that was induced by the

49

recombinant VP2 vaccine were able to protect newborn mice against EV-A71 lethal

challenge with a cross-neutralizing titer of 1:32 (Xu et al., 2014)

DNA vaccines comprise of DNA coding for a particular antigen which can be

directly injected into the human muscle. The DNA antigen gene encoded by the DNA

vector would then manufacture that particular antigen in the host cells. The host immune

system would recognize the antigen as a foreign substance and hence, produce NtAbs

against it. DNA vaccines have many advantages as they are very stable and easy to

manufacture. However, no DNA vaccines have been found to elicit substantial immune

response that is needed to prevent an infection, which was a major disadvantage.

Nevertheless, Tung and co-workers (2007) managed to construct a DNA vaccine that

was able to elicit NtAb response in Balb/c mice. The anti-VP1 IgG in the mice that had

been immunized with the DNA vaccine exhibited neutralizing activity against EV-A71

(Tung et al., 2007). In another study, a DNA vaccine was able to induce cellular and

humoral immune responses which were capable of providing protection against

Chikungunya virus challenge in mice (Mallilankaraman et al., 2011). To date, no DNA

vaccines have been commercialized (Nakayama and Aruga, 2015).

1.3.5 Inactivated EV-A71 Vaccines

Up to date, five organizations have completed pre-clinical studies to develop an

inactivated vaccine which is at different phases of clinical trials. Three of the companies

are from mainland China while the other two are from Taiwan and Singapore. The three

China-based biopharmaceutical companies are Vigoo, Sinovac and Chinese Academy of

Medical Science (CAMS). They have all completed Phase III Clinical Trials in 2014 for

50

an inactivated EV-A71 vaccine against the sub-genotype C4 as it was the main sub-

genotype responsible for outbreaks in China (Table 1.3). The three companies conducted

randomized, double-blind, placebo-controlled, multicentre trials involving 10,007-

12,000 healthy children. Each vaccine candidate received two intramuscular doses of

vaccine or placebo within a span of 28 days apart (Liang and Wang, 2014).

Sinovac reported that their inactivated vaccine efficacy was 94.8% and anti-EV-

A71 immune response elicited by the two dose vaccines were found in 98.8% of

participants. In addition, the anti-EV-A71 neutralizing titre of 1:16 associated with

protection against EV-A71 was intended to last for at least 1 year. However, the NtAb

titre declined 50% after 6 months (Li et al., 2014). In addition, there were different NtAb

levels induced by the 3 vaccine strains although they were all from the sub-genotype

C4a strain.

The NtAb levels (VNA GMT) in children vaccinated with the inactivated

vaccines produced by Sinovac and CAMS were 191 and 170 at 1 year post-vaccination

and 4 weeks, respectively. The lowest VNA GMT was observed with the inactivated

EV-A71 vaccine from Vigoo at a VNA GMT of 92 at 1 year post-vaccination. This

could be due to the different manufacturing processes, cell substrates, culture systems

and vaccine doses used by the 3 companies (Chong et al., 2015). Mao et al. (2012) also

discovered that the aluminium hydroxide adjuvant used, though similar in concentration,

had differing immunological-enhancing effects. Compared with the vaccine strains

without the adjuvant, the differences in immunogenicity among the vaccine strains

absorbed with alum adjuvant produced by the three manufacturers were reduced,

especially at 14-day and 28-day after immunization.

51

Table 1.3: Five EV-A71 inactivated vaccines at different clinical phases of development.

Organizations

Cell lines&EV-A71

strain

Clinical trials

Dosage (µg of

EV-A71

antigen)

Population target Current status of

clinical trial

Adjuvant Technology for vaccine

production

NHRI (Taiwan)

Vero cell & EV-

A71

B4 (GMP-certified)

5 and 10 Young adults Phase 1 completed

Aluminium phosphate

Roller bottles

Sinovac (China)

Vero cell & EV-

A71

C4

1

Young adults,

young children

and infants

Phase III completed 1,

2 and 3 completed

Aluminium hydroxide

Cell factory

Beijing Vigoo

(China)

Vero cell & EV-

A71

C4

0.8

Young adults,

young children

and infants

Phase III completed

Phase 1, 2 and 3

completed

Aluminium hydroxide

Microcarrier bioreactors,

fermentation cylinder

CAMS (China)

Human diploid cell

KMB-17 & EV-A71

C4

0.25

Young adults,

young children

and infants

Phase III completed 1,

2 and 3 completed

Aluminium

hydroxide, glycine

Microcarrier bioreactors

Inviragen

(Singapore)

Vero cell &

EV-A71 B3 0.3 and 3 Young adults

Phase 1 completed

Phase 1

Completed

Aluminium hydroxide Cell factory

52

The inactivated vaccines containing aluminium adjuvants when used at the lowest dose

(162U) showed good protective effects in sucking mice against lethal challenge (90-

100% survival).

The inactivated vaccines should also be based on international manufacturing

process criteria, global vaccine standards and high regulation of quality. Currently, roller

bottles and cell factories are employed for upstream cell culture but they are labour

intensive. Chong et al. (2012) reported the feasibility of producing a C4-based protective

vaccine (0.25 µg) at US$0.1/dose using a 40-L pilot scale batch reactor. Upstream

manufacturing processes could be further improved with the use of bioreactors, micro-

carriers and perfusion technology. To lower the production cost, a simple and efficient

downstream chromatographic purification step will need to be incorporated (Chong et

al., 2012). To determine the potency and efficacy of inactivated vaccines produced by

different manufacturing processes, there is a need for standardization of the vaccine

strain, quality control reagents, immunoassays and animal models at the international

level. A global surveillance network for enterovirus outbreaks is needed to monitor

immune responses to the inactivated EV-A71 vaccine.

Prior to the release of the inactivated EV-A71 vaccine, there were a few studies

that are addressing whether the NtAb elicited by one EV-A71 sub-genotype could cross-

neutralize other sub-genotypes or confer protection across genotypes or sub-genotypes.

For example, it was reported that neutralizing antibodies elicited by 10 strains of the C4

genotype in rabbits had variable cross-neutralizing effects against different strains of the

same sub-genotype and the genotype A BrCr strain (Mao et al., 2012), while another

study demonstrated that mice challenged with lethal doses of B3 genotype survived due

53

to prior vaccination with a C4 genotype vaccine (Bek et al., 2011). In addition, Zhang et

al. (2014) showed that the titers of NtAb in children elicited by the EV-A71-C4a vaccine

were higher against EV-A71-B4, B5, C1, C2 and C4b than against other EV-A71 sub-

genotypes. Interestingly, the NtAb titers raised against the C4a sub-genotype used for

immunization was lower than those of all the other EV-A71 sub-genotypes and this

indicated that the current genotyping scheme may not truly reflect their antigenicity

(Zhang et al., 2014).

It is important to conduct studies with more antisera collected from future phase

III clinical trials to further evaluate the efficacy of cross-protection against all EV-A71

genotypes and sub-genotypes, determine the types of immune response and understand

immune correlates of protection. There is no data to show vaccine efficacy against

serious EV-A71-associated neurologic disease, such data might become available after

the vaccines are licensed and post marketing surveillance is undertaken. A global

surveillance network to monitor the emergence of new EV-A71 after the introduction of

the vaccine should be established. As the child needs to be immunized with the

commercial pentavalent vaccine, the EV-A71 vaccine could be included in the

Expanded Programme on Immunization Vaccines.

There also remains insufficient information on the inactivated EV-A71 vaccine-

induced immunity to ensure wide and safe use of the vaccine inside and outside of

China. Samples collected during Phase III Clinical Trials should be analyzed for

immune response types and immune correlates of protection (Lu, 2014). Also, as

Coxsackie type A16 (CV-A16) is also a leading cause of severe HFMD infections, there

54

should be more research into formulating a combined EV-A71-CA16 vaccine to

effectively prevent severe HFMD outbreaks.

1.3.5 Immunogenicity of vaccines

Vaccines against viral diseases could be potentially improved if the

immunogenicity of the vaccine could be enhanced. A major hurdle to the development

of LAVs is the difficulty in achieving a satisfactory level of attenuation without severely

compromising rate of replication and immunogenicity. Many factors such as safety have

to be taken into consideration during the development of live viruses as potential LAVs.

Bukreyev et al. (2002) have discovered that immunogenicity in primates of a

LAV for human parainfluenza virus type 3 (HPIV3) could be enhanced by expression of

granulocyte–macrophage colony-stimulating factor (GM-CSF) from an extra gene

inserted into the genome of a cDNA-derived virus. GM-CSF is a major cytokine vital in

the maturation and activation of dendritic cells and macrophages. Their recombinant

GM-CSF HPIV3 virus showed a decrease in viral replication by 40-fold when compared

to the wild type HPIV3. In addition, this attenuated vaccine virus expressing GM-CSF

displayed 3- to 6-fold higher NtAb levels than that induced by the non-attenuated wild

type virus (Bukreyev et al., 2002). As the NtAb titer is vital to confer life-long

protection against any virus, their LAV maybe a suitable candidate against the HPIV3 as

it has high immunogenicity and low pathogenicity.

Another major factor that should be taken into consideration when developing a

LAV strain would be the monitoring of antigenic variations of EV-A71. A study

conducted by Chia et al (2014) showed that rabbits immunized with genotype B and C

viruses consistently had lower NtAb titers against genotype A (≥ 8-fold difference) and

55

antigenic variations between genotype B and C viruses could be detected but did not

have a clear pattern. This was consistent with previous human studies (Huang et al.,

2010). A rabbit model was used as it was difficult to obtain large amounts of sera from

children for neutralization assays.

Interestingly, the authors deduced that sub-genotype B2 and B5 viruses were

highly immunogenic and could induce high NtAb titers against all genogroup B and C

viruses (Chia et al., 2014). This was consistent with serology data from Huang et al.

(2013) that showed children infected with genotypes B and C consistently have lower

NtAb titers against genotype A (4-fold difference). Sequence comparisons revealed that

five amino acid signatures (N143D in VP2; K18R, H116Y, D167E, and S275A in VP1)

were responsible for the antigenic variations in genotype A. This further corroborates the

idea that vaccine development should monitor the antigenic and genetic variations of

each EV-A71 genotype/sub-genotype.

1.4 Aims of Study

Arita et al. (2005) had attempted to develop a live-attenuated vaccine (LAV)

against EV-A71 by introducing 3 mutations at nucleotides 485, 486 and 475 in the EV-

A71 genotype A genome which corresponded to the mutations present in Sabin 1, 2 and

3, respectively. Although there was reduced virulence, mild neurological symptoms

were still observed in the 3 cynomolgus monkeys that received intravenous inoculation

with the EV-A71 (S1-3’) strain carrying mutations in the 5’NTR, 3Dpol and in the

3’NTR. However, the virus still caused tremors and was isolated from the spinal cord.

Hence, this strain did not meet the criteria to be used as a LAV.

56

The inactivated EV-A71 vaccine has been advanced to almost production level in

the next 12 months in China. However, the lack of long-term protection has necessitated

the search for other types of vaccines. LAVs have been the focus of current research and

development. This type of vaccine induces excellent immunogenicity, elicits humoral

and cellular immunity and thereby, confers live-long immunity. It can be introduced via

oral delivery like the OPV.

In this study, we are investigating if EV-A71 sub-genotype B4, strain 41

(5865/Sin/000009) has a different virulence determinant from the sub-genotype B1

(clinical isolate 237) reported by Yeh et al. (2011). The EV-A71 sub-genotype B4 virus

(accession number: AF316321) will be modified to carry a single mutation at nucleotide

position 158 by site-directed mutagenesis to assess if the nucleotide is a common

virulence determinant between sub-genotypes B4 and B1 (Fig. 1.9). An EV-A71 mutant

bearing a long deletion in the 5’-NTR of the genome will also be constructed. The

virulence of the various mutated EV-A71 strains will be evaluated in the

Rhabdomyosarcoma (RD) cell culture by plaque assays, viral infectivity by tissue

culture infectious dose (TCID50) determinations, real time Reverse-Transcriptase

Polymerase Chain Reaction (RT-PCR) and detection of VP1 by immunoblotting with

monoclonal antibody directed at VP1. RD cells are chosen as they were very efficient in

exhibiting cytopathic effect typically 7-10 days after inoculation (Pallansch and Ross,

2001).

Our first objective in this study is to genetically modify the EV-A71 strain 41

(sub-genotype B4) virus by substituting nucleotides at positions 158, 475, 486, and 487

based on the fact that these nucleotides are responsible for the neuro-virulence of

57

poliovirus Sabin strains 1, 2 and 3 (Table 1.4). The virulence determinants of poliovirus

and EV-A71 reported in previous studies served as references in this study to produce

EV-A71 viruses that are highly attenuated. Figure 1.9 illustrates the predicted RNA

secondary structure of EV-A71 strain 41 from nt. 474 to 541.

Table 1.4: Common genetic determinants between EV-A71 and Sabin polio strains.

Nucleotide Substitution Position in Sabin strains Position in EV-A71 strain

41

C to T 472 475

A to G 480 486

G to A 481 487

58

Figure 1.9: Predicted RNA secondary structure of EV-A71 strain 41 from nt. 474 to

541. Due to slight differences in the length of the 5’-NTR, nt. 480 in Sabin 1 is at the

equivalent position 486 (1) in this figure. Nt. 481 in Sabin 2 is at the equivalent position

487 (2), and nt. 472 in Sabin 3 is at the equivalent position 475 (3) of the EV-A71

genome (Yin Quan Tang, personal communication, 2014).

59

Our second aim for this study is to investigate if the single nt. difference (strain

41) between the fatal and the non-fatal strain (strain 10) is responsible for neuro-

virulence by introducing a nt. substitution at nt. position 5262 in the EV-A71 viral

genome. This is to be carried out with reference to a previous study conducted by Singh

et al. (2002). The nt. at position 5262 will be changed from A to G.

Our third objective is to construct a genetically stable and safe LAV through

partial deletion of the 5’-NTR region in the EV-A71 genome. This may reduce the

efficiency of viral replication as Izuka et al. (1989) was able to generate genetically

stable poliovirus. Deletion will be created from nt. positions 475 to 485. Our final

objective is to evaluate the virulence of the various EV-A71 mutants in vitro in RD cells

and the in vivo immunogenicity of the various mutants.

CHAPTER 2

MATERIALS AND METHODS

2.1 Cell Culture

Human Rhabdomyosarcoma cells (RD, ATCC # CCL-136) were cultured in

Dulbecco's modified Eagle's minimal medium/F-12 (DMEM/F-12, Invitrogen, USA),

supplemented with 10% foetal bovine serum (FBS) (Gibco, USA), 1%

penicillin/streptomycin, 1% L-glutamine and 1% essential amino acids. All cell lines

were grown at 37°C in 5% CO2 until 80-90% confluency.

2.2 Viral infection

60

RD cell monolayers in 75-cm2 flasks were inoculated with 100µL EV-A71 strain

5865/Sin/000009 (GenBank accession number AF316321). Infected cells were

incubated with 1 mL DMEM containing antibiotics but no serum at 37°C until the

complete cytopathic effect (CPE) was apparent. RD cells were frozen at −80°C and

thawed, three times, and cell debris was removed by centrifugation at 14,000 x g for 10

minutes at 4°C. Supernatants were used for harvesting the virus.

2.3 RNA Extraction and Reverse Transcription

Viral RNA was extracted from EV-A71 using the QIAmp® Viral RNA Mini Spin

Kit (Qiagen, Calif., USA). The kit was used according to the manufacturer’s

instructions. The purified RNA was reverse transcribed into cDNA by using the

SuperScript® III First Strand Synthesis SuperMix Kit (Invitrogen, Calif., USA). Each

cDNA synthesis mixture contained 10X annealing buffer, 25mM MgCl2, 0.1 M

oligo(dT), RNAseOUT/Superscript III RT and viral RNA as template.

2.4 Cloning of EV-A71 cDNA into the pCR-XL-TOPO vector

Full length cDNA of EV-A71 was amplified using polymerase chain reaction

(PCR). Each PCR reaction contained 5X Phusion HF buffer, 10mM dNTP, 0.1g of each

primer, 1 µg template cDNA and Phusion HSII DNA Polymerase. The following cycling

conditions were employed for the PCR reactions: 98oC for 30s, followed by 98oC for

10s, 64oC for 30s and 72oC for 5 min for 30 cycles. The cycles were terminated with a

30s extension at 68oC. The amplified cDNA was cloned into the pCR®-XL-TOPO®

vector (Invitrogen, Calif., USA).

61

Approximately 100 ng of the full length EV-A71 cDNA was ligated to 1µL

pCR®-XL-TOPO® vector according to the manufacturer’s protocol in the TOPO® XL

PCR Cloning Kit (Invitrogen, Calif., USA) (Figure 2.1). The ligation mixture was

incubated for 5 min at room temperature, then 1 µl of the 6x TOPO® Cloning stop

solution was added and the tubes were placed on ice. The recombinant EV-A71 pCR-

XL-TOPO vector (Fig.2.1) was stored at -20oC for further downstream processes.

2.5 Site-directed mutagenesis

The EV-A71 full genome in the pCR-XL-TOPO plasmid acted as the substrate for single

mutations using designed primers (Table 2.1) and the QuickChange Lightning Site-

Directed Mutagenesis Kit (Agilent Technologies, Calif., USA). EV-A71 mutants were

constructed by introducing site-directed mutations at nucleotide positions 158, 475, 486,

487, in the 5’-NTR and at position 5262 of the viral genome, respectively. In the 1st

stage of the reaction, PCR was carried out. The mixture contained 10x reaction buffer,

100ng/µl of each primer, 100ng ds DNA template, 1µL dNTP mix and 1µL QuikChange

Lightning Enzyme mix. The PCR mixture was added up to a total reaction volume of 50

µl. The PCR conditions were set up at 95°C for 2 min for initial denaturation, followed

by 18 cycles of 95°C for 20 sec, 60°C for 10 sec, 68°C for 5 min 30 sec. Final

elongation was carried out at 68°C for 5 min.

62

Figure 2.1: Schematic illustration of EV-A71 cDNA clone in pCR-XL-TOPO.

EV-A71 genomic cDNA was cloned downstream of a SP6 RNA polymerase promoter.

The in vitro transcribed positive-sense RNA carried an additional G residue at the 5’ end

and a poly(A)50 tail followed by additional CGGCC residues at the 3’ end. The arrow

indicates the transcription start site.

Table 2.1: Primers used for site-directed mutagenesis and partial-deletion in the 5’-

NTR of EV-A71 genome.

Name Sequence (5’-3’)

EV-5UTR-F(A486G) GCTAATCCTAACTGTGGGGCACATGCCTTCAATCC

63

EV-5UTR-R(A486G) GGATTGAAGGCATGTGCCCCACAGTTAGGATTAGC

EV-5UTR-F(G487A) GCTAATCCTAACTGTGGAACACATGCCTTCAATCCAG

EV-5UTR-R(G487A) CTGGATTGAAGGCATGTGTTCCACAGTTAGGATTAGC

EV-5UTR-F(C475T) CCCTGAATGCGGCTAATTCTAACTGTGGAGCACA

EV-5UTR-R(C475T) TGTGCTCCACAGTTAGAATTAGCCGCATTCAGGG

EV-5UTR-F(A5262G) GTCGTGCAATCCATCGCTACTGTGGTGGCAG

EV-5UTR-R(A5262G) CTGCCACCACAGTAGCGATGGATTGCACGAC

EV-5UTR-F(A158T) GGCGCACCAGCTTTGTCTTGATCAAG

EV-5UTR-R(A158T) CTTGATCAAGACAAAGCTGGTGCGCC

EV-UTR-F(∆11) AGCACATGCCTTCAATCCAGAGGG

EV-UTR-R(∆11) ATTAGCCGCATTCAGGGGCCGGAG

In the 2nd stage of mutagenesis, 2 µl of the Dpn I restriction enzyme was added

to the amplification product to digest the methylated and hemimethylated parental DNA.

The ligation mixture was incubated for 5 min at 37°C. In the 3rd stage, transformation

was performed using XL 10-Gold® Ultracompetent cells (Agilent Technologies, Calif.,

USA). The ligated mixture (2 µl) was added to the competent cells and incubated on ice

for 30 min. The cells were then subjected to heat shock at 42°C for 30 sec, and

64

immediately placed on ice for 2 min. An aliquot of the NZY+ broth (500 µl) was added

to the XL 10-Gold competent cell suspension, followed by shaking of the transformed

bacterial cells at 37°C for 1 hour.

After the 1 hour incubation, tubes were centrifuged at 13,000 x g for 1 min. Clear

supernatant was discarded and the cell pellet was resuspended in 500 µl of fresh NZY+

medium and an aliquot of 0.2 ml was plated on LB agar supplemented with 25 µg/ml

kanamycin sulphate (Invitrogen, Calif., USA). The E.coli cells were incubated overnight

for 16h at 37°C. Figure 2.2 shows a schematic representation of the site-directed

mutagenesis (SDM) steps. Nucleotide substitutions were confirmed by DNA sequence

analysis using nucleotide Basic Local Alignment Software (BLAST by NCIB).

65

Figure 2.2: Schematic representation of the Site-Directed Mutagenesis (SDM) steps.

The diagram was adapted with modifications from the instruction manual for the

QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene).

x – Indicates positions of the mutated nucleotides both within the mutagenic primers and

newly synthesised DNA.

66

2.6 Storage of transformed E. coli cells containing recombinant plasmid with

the desired mutations

For short term storage, E. coli cells carrying the recombinant plasmid on plates

were stored at 4oC for up to one month. For longer term storage, transformed bacteria

were maintained in LB broth supplemented with 20% glycerol (v/v) and stored at -80oC.

To revive the E. coli from the glycerol stock, a sterile wire loop was placed into the

glycerol stock and cells that were picked up were streaked onto a LB agar plate

containing 25 µg/ml kanamycin. The plate was incubated for 16h overnight at 37oC.

2.7 Partial-deletion in the 5’-NTR of EV-A71 genome

EV-A71 with a partial deletion from nucleotide positions 475 to 485 in the 5’-

NTR was constructed using two designed primers that were 24 nucleotides in length

[namely EV-UTR-F(∆11) and EV-UTR-R(∆11)] (Table 2.1) and the Q5® Site-Directed

Mutagenesis Kit (New England Biolabs, USA) (Chua et al., 2008). The melting

temperature of the primers were approximately 63oC, determined using the calculation

below:

Tm = 81.5 + (0.41)(%GC) - 675/N - % mismatch,

where N = primer length in bases, (%GC) and % mismatch = whole numbers

The EV-A71 deletion mutant was confirmed by DNA sequence analysis by

nucleotide Basic Local Alignment Software (BLAST by NCIB). Bacterial colonies that

carried the viral genome with the correct mutations were kept in 20% glycerol stock at -

80oC for long term storage.

67

2.8 Plasmid isolation and purification

The recombinant EV-A71 pCR®-XL-TOPO® plasmid was isolated from 5 ml of

overnight culture of E. coli with Endofree Plasmid Purification Kit (QIAGEN, Calif.,

USA) following the manufacturer's recommended protocol. Extracted plasmid was

eluted in 300 µl of TE Buffer and stored at -20°C.

2.9 Restriction endonuclease digestion of plasmid DNA

Plasmid DNA (30 µg) purified from the E.coli transformants was digested with

EagI (New England BioLabs, Massachusetts, USA). The reaction was incubated at 37oC

in a water bath for 2h. Screening of DNA fragments after digestion of the recombinant

pCR-XL-TOPO EV-A71 plasmid was carried out using DNA agarose gel

electrophoresis. The agarose gel was pre-stained with GelRed nucleic acid stain

(Biotium, USA) prepared in 0.5X TAE buffer. DNA products were mixed with gel

loading buffer and loaded into wells in the agarose gel. Electrophoresis was carried out

using 80V and DNA bands were illuminated with UV light. The size of the DNA

fragments were compared with a GeneRuler 1 kbp DNA ladder (Invitrogen, USA).

2.10 Phenol-chloroform purification and ethanol precipitation of DNA

The DNA solution was mixed with an equal volume of phenol-chloroform

(Amresco, Calif., USA) and vortexed for 1 min. The mixture was centrifuged at 15,000

x g for 10 min to separate the aqueous and solvent phases. The desired aqueous layer

was carefully removed and mixed with an equal volume of phenol-chloroform (1:1)

(Amresco, Calif., USA) and vortexed for 1 min. The mixture was again centrifuged at

68

15,000 x g for 10 min. The aqueous layer was removed and 1/10 volume of chilled 3M

sodium acetate (pH 5.2) and 1/10 volume of isopropanol were added to the DNA sample

and mixed well by inverting the tube multiple times.

Then, the sample was incubated at -20oC for 2h to precipitate the DNA. The

DNA was pelleted by centrifugation at 15,000 x g for 30 minutes at 4oC. The

supernatant was carefully removed and 1 ml of cold 70% ethanol was added to wash off

the remaining salts. The DNA pellet was allowed to air dry for 5 minutes with the lid

opened. The desired amount of TE buffer was added into the tube in order to dissolve

the DNA.

2.11 Production of infectious EV-A71 RNA from cloned cDNA

RNA transcription was carried out using RiboMAX™ Large Scale RNA

Production System-SP6 (Promega, Calif., USA). The reaction was set up in 20 µl of

reaction volume by following the recommended protocol. The reaction mixture was

subjected to incubation at 37°C for 4h and followed by DNase treatment for 30 minutes.

The DNase (Promega, Calif., USA) was added to the in vitro transcription reaction at a

final concentration of 1 U per µg of DNA template. The Linear Control DNA supplied

by RiboMAX™ Large Scale RNA Production System-SP6 was used as a template for

production of RNA transcripts of approximately 1.8 kb in length and served as a positive

control for the in vitro transcription reaction. The in vitro transcribed EV-A71 RNA was

visualized by agarose gel electrophoresis prior to being used in transfection of RD cells

(Han et al., 2010).

69

2.12 Transfection of RD cells with in vitro RNA transcripts

RD cells were seeded in a 24-well plate and incubated for 24 h. When the cell

confluence reached about 50%, transfection was performed following the manufacturer's

instructions with the use of Lipofectamine 2000 reagent (Invitrogen, Calif., USA) with a

multiplicity of infection (MOI) of 0.1. Unbound viruses were washed away 4h after

infection and cells were then cultured in fresh medium containing 10% fetal bovine

serum. Once cytophatic effects (CPE) were observed (round and shrunken cells), the

mutated viruses were harvested.

2.13 Plaque Assay

A 6-well plate with 6 X 105 RD cells/well was prepared and incubated overnight

at 37oC in 5% CO2. Prior to viral infection, the complete growth medium (DMEM

supplemented with 10% FBS) was removed and approximately 1 mL serial 10-fold

dilutions of virus inoculum was added to the cells for 1 h at room temperature with

gentle shaking to allow for virus attachment. After 1 h incubation, the inocula was

removed and replaced with 2 mL of 1.2% w/v carboxylmethylcellulose. After 72 h

incubation, the plaque medium was removed and the cells were fixed with 4%

formaldehyde and stained with 0.5% crystal violet. The plaques were visible against a

white background. The plaque forming unit per millilitre (PFU/ml) was calculated using

the formula:

PFU/ml = Number of plaques X Dilution factor

Volume of inoculum (mL)

70

2.14 Tissue Culture Infectious Dose (TCID50) Assay

The EV-A71 mutant virus titers were quantitatively determined by TCID50.

TCID50 refers to the quantity of a virus that will produce a cytopathic effect in 50% of

the cultures inoculated. The TCID50 assay was carried out in RD cells using the Reed

and Muench formula (Appendix VII). A monolayer of RD cells from a 75cm2 tissue

culture flask was harvested after trypsinization with 3 ml of trypsin-EDTA (Gibco,

Calif., USA) and the addition of MEM growth media to obtain a final concentration of 1

x 103 cells /μl.

To assay the number of infectious virions in a purified virus stock, serial 10-fold

dilutions of the stock virus suspension in quadruplicates, were carried out in a 96-well

microtiter plate using MEM growth media as diluent. The negative control wells

contained RD cells without any virus. The plate was incubated at 37oC and observed

daily for CPE up to 48h.

2.15 Real-Time RT-PCR

Total RNA was extracted from various EV-A71 mutant strains grown in RD

cells the inocula using the RNeasy extraction kit (Qiagen, USA). Quantitative real-time

PCR was performed using the Applied Biosystems 7500 Sequence Detection system

(Applied Biosystems, USA), with 4 μl of RNA template, 10 μl of 2x SensiFAST probe

No-ROX One Step Mix, 0.8uL Forward and Reverse primer (10uM), 0.2 µL probe

(10uM), 0.2 µl reverse transcriptase, and 0.4 µL RiboSafe RNase inhibitor (BioLine,

California, USA) contained in 20 μl of the final reaction mixture. The reaction was

71

performed for one cycle at 48oC for 10 min, 95°C for 2 min, followed by 40 cycles at

95°C for 5s and 60°C for 20s in a 96-well plate. Three independent experiments were

conducted for each sample. Threshold cycle value (Cq) data was determined using

default threshold settings, and the mean Cq was calculated from the duplicate PCRs. A

standard graph was plotted based on a series of standard solutions.

2.16 EV-A71 VPl Immunoblot

Total cellular proteins were extracted by incubating wild-type and EV-A71

mutant cells in lysis buffer (20 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 137 mM NaCl,

50 mM EDTA, protease inhibitor mixture and 1 mM phenylmethylsulfonyl fluoride).

After centrifugation at 14,000 x g for 10 min at 4°C, supernatants were transferred and

mixed with an equal amount of protein sample buffer (120 mM Tris-HCl, pH 8.0, 20%

glycerol, 4% SDS, 2.5% β-mercaptoethanol and 0.05% bromophenol blue). Lysates

were separated by SDS-PAGE and transferred to nitrocellulose membrane (Millipore,

Calif., USA) that had been blocked with 5% BSA in Tris-Buffered Saline and Tween 20

(TBST) buffer for 1 h at room temperature. The membrane was then incubated overnight

at 4°C with anti-enterovirus VP1 monoclonal antibody (LifeSpan BioSciences, Calif.,

USA) diluted in the blocking buffer. After hybridization with primary antibody, the

membrane was washed three times with TBST before hybridizing with anti-mouse HRP

secondary antibody (Sigma Aldrich, St Louis, USA) diluted in TBST. The blots were

then washed three times with TBST and detected by chemiluminescence using

ImageQuant (GE Healthcare Life Sciences, Calif., USA).

72

2.17 Immunization of mice

Inbred Balb/c mice were purchased from Monash University. All institutional guidelines

for animal care and use were strictly followed throughout this study. Heat inactivation of

EV-A71 virus was carried out for 30 min at 56oC and the PFU determined. Groups of 5

adult (6 weeks old) female Balb/c mice were intraperitoneally immunized with either

103 TCID50 of EV-A71 mutant strain or the positive control EV-A71 strain 41 (103

TCID50) in a 50% emulsion of Freund’s complete adjuvant (Sigma Aldrich, Calif.,

USA). Two booster doses in 50% emulsion with Freund’s incomplete adjuvant (Sigma

Aldrich, Calif., USA) were administered to the mice at 3 weeks intervals. The volume of

each vaccine suspension administered was 400 μl. The blood from the mice were

collected 7 days after the last immunization. To collect the immune sera, blood was

centrifuged at 6000 x g for 15 min to precipitate the blood cells. Sera containing EV-

A71-neutralizing antibodies were pooled and stored at -80oC until use.

2.18 EV-A71 neutralization assay.

The presence of neutralizing antibodies against EV-A71 was determined by an in vitro

microneutralization assay using RD cells, as described previously (Foo et al., 2007).

Murine antisera were first incubated at 56°C for 30 min to inactivate the complement

activity. Briefly, 25 µl of twofold serial dilutions of the heat-treated serum was

coincubated with an equal volume containing 103 50% tissue culture infective doses of

virus (TCID50) in a 96-well microtiter plate. Two hours later, 5 X 104 RD cells were

added to each well and incubated at 37°C for 48 h. The cells were examined for CPE

after 48h and the neutralizing antibody titer was defined as the highest dilution of serum

73

that inhibited virus growth by 100%, thereby preventing CPE. The assay was performed

three times independently.

2.19 IgG-subtying

The profiles of specific IgG subtypes in the mice hyperimmune sera were determined by

a commercially available mouse sub-type isotyping kit (Thermo Scientific., Rockford,

USA) according to the manufacturer’s instructions. Pouches of cassettes from the kit

were removed from refrigeration and equilibrated fully to room temperature. Mouse

serum was diluted 1:100 by adding 50 µL of serum to 450 µL of sample diluent and

vortexed to mix. The diluted sample (150µL) was added to the well of each cassette.

Red colour bands appeared after 5-10 minutes. In brief, the gold conjugates embedded in

the cassette form specific class- and subclass-soluble complexes with the antibodies in

the serum sample. These complexes travel the length of the membrane and are resolved

on the anti-isotype and class-specific antibody-impregnated membrane. Results are

displayed as a red band indicating the antibody isotype or subclass.

2.20 Bioinformatics Analysis

The protein sequence of EV-A71 viral proteins was analysed and alignment of the amino

acid sequences was undertaken by using the Clustal method of DNASTAR MegAlign.

Predictions of 5’NTR secondary structures of probable base pairs predictions, which

might include pseudoknots was conducted by using databases such as RNA Structure at

Rochester University: http://rna.urmc.rochester.edu/RNAstructureWeb/index.html and

the mfold Web Server at http://molbiol-tools.ca/RNA_analysis.htm.

74

2.21 Statistical Analysis

Means ± standard deviations were obtained from at least two independent biological

replicates. Statistical significance was calculated using the Mann-Whitney test. A P

value of < 0.05 was considered as statistically significant.

75

CHAPTER 3

RESULTS

3.1 Molecular Basis of Pathogenicity

It remains to be investigated if there is a universal molecular determinant present

in every EV-A71 fatal sub-genotype strain or whether every fatal sub-genotype strain

differs in virulence determinant. Yeh et al. (2011) reported that the virulence

determinant in an EV-A71 sub-genotype B1 (clinical isolate 237) was a single

nucleotide change from cytosine to uridine at position 158. The EV-A71 sub-genotype

B4 virus (accession number: AF316321) was genetically modified to carry a single

mutation at nucleotide position 158 by site-directed mutagenesis to assess if the

nucleotide is a common virulence determinant between sub-genotypes B4 and B1. The

effect of this change was evaluated by qualitative assays such as cytopathic effects

(CPE) in Rhabdomyosarcoma (RD) cells. Mutant EV-A71 158 (A158T) had minimal

CPE when transfected into RD cells with a MOI of 0.1 (Figure 3.1A) as compared to the

positive control (EV-A71 wild type strain 41) (Figure 3.1C). CPE was seen as round and

shrunken cells that floated on the surface and there was extensive CPE seen with the

EV-A71 wild type strain 41 cells. All experiments were repeated at least three times on

separate days.

76

(A)

(B) (C)

Figure 3.1: Cytopathic effects (CPE) caused by (A) the mutant EV-A71 158

(A158T) in Rhabdomyosarcoma (RD) cells in comparison with (B) uninfected RD

cells (negative control using Opti-MEM) and (C) EV-A71 wild type strain 41

infected RD cells (positive control). Transfection of infectious RNA into RD cells was

performed with the use of Lipofectamine 2000 reagent using EV-A71 mutants with a

MOI of 0.1. CPE was seen as round and shrunken cells that eventually dislodged from

the surface. Magnification used (X 100).

77

The EV-A71 strain 41 virus was also genetically modified by substituting

nucleotides at positions 475, 486, and 487 as these nucleotides were responsible for the

neuro-virulence of poliovirus Sabin strains 1, 2 and 3 (Table 1.4). The virulence

determinants of poliovirus and EV-A71 reported in previous studies served as references

in this study to produce EV-A71 viruses that might become highly attenuated. The

mutant EV-A71 475 (C475T) (Figure 3.2A) caused the lowest CPE in RD cells when

compared to mutants 486 (A486G) (Figure 3.3A) and 487 (G487A) (Figure 3.4A). Out

of the three mutants, A486G demonstrated the highest amount of CPE (Figure 3.3A) as

evident from the rounding and shrunken nature of many cells. EV-A71 mutant 487

(G487A) displayed intermediate CPE when transfected into RD cells with a MOI of 0.1

(Figure 3.4A).

78

(A)

(B) (C)

Figure 3.2: Infection of RD cells by (A) the mutant EV-A71 475 (C475T) in RD cells

in comparison with (B) uninfected RD cells (negative control using Opti-MEM) and

(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of

infectious RNA into RD cells was performed with the use of Lipofectamine 2000

reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken

cells that eventually dislodged from the surface. Magnification used (X 100).

79

(A)

(B) (C)

Figure 3.3: CPE caused by (A) the mutant EV-A71 486 (A486G) in RD cells in

comparison with (B) uninfected RD cells (negative control using Opti-MEM) and

(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of

infectious RNA into RD cells was performed with the use of Lipofectamine 2000

reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken

cells that eventually dislodged from the surface. Magnification used (X 100).

80

(A)

(B) (C)

Figure 3.4: CPE caused by (A) the mutant EV-A71 487 (G487A) in RD cells in

comparison with (B) uninfected RD cells (negative control using Opti-MEM) and

(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of

infectious RNA into RD cells was performed with the use of Lipofectamine 2000

reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken

cells that eventually dislodged from the surface. Magnification used (X 100).

81

Analysis of the genomic sequences of two EV-A71 strains, one isolated from a

non-fatal case and another isolated from a fatal case shows that the single nucleotide (nt)

difference between the fatal strain (EV-A71 strain 5865/Sin/000009, designated as strain

41), and the non-fatal strain (EV-A71 strain 5666/Sin/002209, designated as strain 10)

might be responsible for neuro-virulence. This is based on the previous study by Singh

et al. (2002) where they indicated the difference between the fatal and non-fatal strain is

at nucleotide (nt) position 5262. In the current investigation, the Adenine residue at

position 5262 present in the fatal strain (strain 41) was changed to the Guanine residue.

Based on the morphology as shown in Figure 3.5A, RD cells showed no CPE as cells

were relatively healthy when compared to the extensive lysis observed with the positive

wild type control (Figure 3.5C). There was hardly any floating cells observed and this is

similar to no CPE being observed with the negative control (without virus) (Figure

3.5B).

82

(A)

(B) (C)

Figure 3.5: Infection of RD cells by (A) the mutant EV-A71 5262 (A5262G) in RD

cells in comparison with (B) uninfected RD cells (negative control using Opti-

MEM) and (C) EV-A71 wild type strain 41 infected RD cells (positive control).

Transfection of infectious RNA into RD cells was performed with the use of

Lipofectamine 2000 reagent using EV-A71 mutant 5262 with a MOI of 0.1. CPE was

seen as round and shrunken cells that eventually dislodged from the surface (C).

Magnification used (X 100).

83

An EV-A71 mutant that carried a partial deletion in the 5’-NTR region in the

viral genome was also constructed. This was carried out to reduce the efficiency of viral

replication as Iizuka et al. (1989) had created a deletion in this region to generate

genetically stable poliovirus (Iizuka et al., 1989). In this study, deletion was created

from nt. positions 475 to 485 (∆11). The mutant EV-A71 PD (Partial Deletant 5’-NTR)

did not show any CPE (Figure 3.6A) and the microscopic image showed similarity with

the image taken from the uninfected RD cells that acted as a negative control (Figure

3.6B). These microscopic images are in direct contrast to the extensive CPE microscopic

image recorded for the EV-A71 wild type strain 41 (Figure 3.6 C).

84

(A)

(B) (C)

Figure 3.6: Infection of RD cells by (A) the mutant EV-A71 PD (Partial Deletant 5’-

NTR) in RD cells in comparison with (B) uninfected RD cells (negative control

using Opti-MEM) and (C) EV-A71 wild type strain 41 infected RD cells (positive

control). Transfection of infectious RNA into RD cells was performed with the use of

Lipofectamine 2000 reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as

round and shrunken cells that eventually dislodged from the surface (C). Magnification

used (X 100).

85

3.2 Quantification of Viral RNA Copy Number

Observation of CPE in Rhabdomyosarcoma (RD) cells is a qualitative indication

of the extent of infectivity of the various mutants in comparison with the EV-A71 wild

type strain 41. Approaches such as determination of the viral RNA copy number, plaque

forming units (PFU), 50% tissue culture infectious doses (TCID50) and amount of viral

capsid protein 1 (VP1) present in each strain will enable a better quantitative comparison

of attenuation of the various mutant strains. The viral RNA copy number of the various

EV-A71 mutant strains was evaluated after growing in the Rhabdomyosarcoma (RD)

cell culture for 24 hours.

RD cells infected with the wild type EV-A71 strain 41 gave the highest yield of

viral RNA copy number (5.5 X103). As for EV-A71 mutant 475 and PD, low copy

number was detected for both mutants at 1.02 X 102 and 1.05 X 102 viral RNA,

respectively. From Figure 3.7, there are a few positions that appear to attenuate the virus

when the mutated strains were evaluated in vitro. For example, EV-A71 mutant 158

mutated at position 158 (A158T) gave a yield of 2.0 X 103 RNA copy number which is

slightly less than that of the wild type RNA copy number. Amongst all the mutants

being evaluated, mutant 486 carrying SDM at position 486 (A486G) expressed the

highest viral RNA copy number of 4.2 X103 when compared to the wild type strain 41.

The mutant 487 carrying SDM at position 487 (G487A) produced a viral RNA copy

number of 2 X 102. The mutant 5262 with a SDM at position 5262 also showed much

reduced viral RNA copy number of 7 X 102. Attenuated strains with low viral RNA

copy number are possible good vaccine strains as they cannot replicate fast enough and

86

yield high viral load to cause destruction of the tissue cells. Slow replication could infer

that the cells could still carry enough antigens to stimulate an immune response.

Based on the viral RNA copy number, the mutations introduced at positions 486

and 158 have contributed to slight attenuation of the infectivity but both of the mutants

are not suitable to serve as live attenuated vaccine strain (LAV). The mutation

introduced at position 5262 had considerably reduced the viral RNA copy number to 10-

fold less when compared to the wild type copy number. Therefore, mutant 5262 will

need to be further evaluated on plaque forming units, TCID50 and the amount of VP1

formed. Minimal RNA copy number (1.2 X 10²) was expressed by mutants 487, 475 and

PD. These three mutants appear to hold promise and will be subjected to further

evaluation tests to assess whether they could serve as potential LAV strains.

87

Figure 3.7: Quantification of Viral RNA Copy Number.

The viral RNA copy number was quantified at 24h post-infection by TaqMan Real-Time

PCR. Viral RNA copy numbers are the average of three biological replicates; Error bars

represent the standard deviation of the mean.

88

3.3 Quantitation of virus by tissue culture infectious dose (TCID50)

The tissue culture infectious dose (TCID50) for the EV-A71 wild type strain 41

and mutant virus titers were quantitatively determined. TCID50 refers to the quantity of

virus that will produce a cytopathic effect in 50% of the cultures inoculated.

89

Neat -1 -2 -3 -4 -5 -6 -7 -8 (-)C

Fig. 3.8: Schematic diagram of the TCID50 assay for enumerating EV-A71 viruses. The virus samples were added to column 1 and serially diluted 1:10 across

the plate to column 9 (added directly to the cells). The negative control – (C) wells contained RD cells without any virus. The wells that have red spots indicate

cell death while red wells indicate healthy cells. The TCID50 assays were performed on monolayer RD cells incubated at 37oC and were repeated at least two

separate times.

Wt

()

A158T

A486G

A5262G

G487A

C475T

PD

90

Table 3.1: Tissue Culture Infectious Dose 50 (TCID50) of EV-A71 mutants in

comparison with EV-A71 strain 41 and the negative control.

The plate was incubated at 37oC and observed daily for CPE up to 48h. The TCID50

/ml

values are calculated using the Reed and Muench formula (Reed, and Muench, 1938)

determined from at least two independent experiments. The formula is presented in

Appendix VII.

EV-A71 Mutants TCID50

A158T 1.00 X 104

C475T 1.00 X 106

A486G 1.00 X 104

G487A 7.50 X 105

A5262G 3.41 X 105

Partial Deletant (PD) 5’-NTR 1.00 X 106

Positive Control (EV-A71 strain 41) 1.00 X 103

91

This study also further investigated whether the different EV-A71 mutants

exhibited reduced EV-A71 viral growth. As shown in Table 3.1, EV-A71 mutant 158 at

position 158 demonstrated a higher TCID50 of 1.00 X 104 when compared against the

positive control EV-A71 wild type strain 41 (TCID50 of 1.00 X 103). This indicates that

EV-A71 mutant 158 would require a higher quantity of virus (approximately 10 times)

to produce a cytopathic effect in 50% of the cultures inoculated (Figure 3.8).

In addition, the mutant 486 carrying SDM at position 486 also had 10 times

increased value of TCID50 value (1.00 X 104) when compared with the positive control

EV-A71wild type strain 41, suggesting that the mutant had decreased virulence. Both

mutants 5262 with a SDM at position 5262 and mutant 487 showed more than 100-fold

increase in TCID50 value when compared against the EV-A71 wild type strain 41.

Mutant 475 with SDM at position 475 and mutant PD both showed a significant 1000

fold increase in TCID50 to 1.00 X 106 (Table 3.1).

Analysis of the TCID50 values indicates that mutant 475 and the partial deletant

(PD) required higher doses of viruses to cause cytopathic effects in 50% of the tissue

culture. Thus, mutants 475 and PD may serve as potential LAV candidates for further

evaluations by other tests in vitro.

92

3.4 Quantification of virus by the plaque assay

The number of plaques produced by the various EV-A71 mutant strains was

evaluated in the Rhabdomyosarcoma (RD) cell culture by plaque assays. Our objective

is to evaluate the ability of the various mutants to form plaques. Prior to viral infection,

the complete growth medium was removed and 1 mL of 10-fold dilutions of virus

inoculum was added to the cells and incubated for 1 h at 37oC. After 1 h incubation, the

inoculum was removed and replaced with 3 mL of 1.2% w/v CMC. After 72 h

incubation, the plaque medium was removed and the cells were fixed with 4%

formaldehyde and stained with 0.5% crystal violet stain.

93

(a) EV-A71 (Strain 41) (158) (475) (486)

(5.0 x 107 PFU/mL) (20 x 104 PFU/ml) (7.0 x 104 PFU/mL) (35 x 104 PFU/ml)

Viral count: 5.0x107 2.0x105 7.0x104 3.5x105

(b) EV-A71 (487) (5262) (PD) Negative Control

(10 x104 PFU/mL) (18 x 104 PFU/mL) (9.0 x 104 PFU/mL) (0 PFU/mL)

Virus titer: 1.0x105 1.8x105 9.0x104 0

Figure 3.9: Quantification of plaque forming units by EV-A71 mutants and wild

type EV-A71 strain 41.

(a) Quantification of plaque forming units by the wild type EV-A71 strain 41, mutants

158, 475, and 486.

(b) Quantification of plaque forming units by the EV-A71 mutants 487, 5262, partial

deletant 5’-NTR (PD) and the negative control (uninfected RD cells). The plaque assays

were performed on monolayer RD cells incubated at 37oC and were repeated at least two

separate times.

94

Figure 3.10: Plaque Forming Units by EV-A71 mutants and the wild type EV-A71

strain 41.

RD cells were transfected with EV-A71 mutants and the wild type EV-A71 strain 41 at a

MOI of 0.1. Plaque formation was observed 72 hours post-infection. PFU numbers are

the average of two biological replicates; Error bars represent the standard deviation of

the mean.

158 475 486 487 5262 PD (-) C (+) C

95

RD cells infected with the wild type EV-A71 strain 41 gave the highest number

of plaques (5.0 x 107 PFU/mL). The least number of viral plaques were formed by the

mutant 475 carrying SDM at position 475 (7.0 x 104 PFU/mL) and the partial deletant

(PD) in the 5’-NTR (9.0 x 104 PFU/mL) (Figure 3.10).

From analysis of the data presented in Figure 3.10, there are a few positions in

the viral genome that are likely to attenuate the virus. The EV-A71 mutant 158 (SDM at

position 158) gave a yield of 2.0 x 105 PFU/ml and the mutant 486 also had reduced

plaque number (3.5 x 105 PFU/ml) when compared to the positive control (EV-A71wild

type strain 41), albeit at a much higher copy number than the mutant 487 carrying SDM

at position 487 (1.0 x105 PFU/mL). The mutant 5262 with a SDM at position 5262 also

showed much reduced plaque number (1.8 x 105 PFU/mL). As the ability to form

plaques is reduced for certain mutant strains, viral growth is lower. This would mean

that viraemia caused by a lower number of viruses will be milder as viral load would

affect pathogenicity.

96

3.5 Western Blotting

The ability of the various mutated EV-A71 strains to produce viral particles

could be evaluated by detection of VP1 by immunoblotting with the monoclonal

antibody directed at VP1. Supernatant derived from transfected RD cells was processed

and subjected to electrophoresis to separate the EV-A71 total proteins. The amount of

VP1 present in each mutant was assessed by the Western blot analysis. A single band

was revealed at an approximate molecular weight (MW) of 32kDa (Figure 3.10). This

band corresponds to the VP1 monomer with an apparent MW of 32.7kDa.

97

M 1 2 3 4 5 6 7 8

Figure 3.11: Western blot analysis using monoclonal antibody against VP1 as the

primary antibody.

The amount of EV-A71 total proteins and β-actin loaded in each lane was 5 μg. The

lanes are as follows: lane M, molecular weight marker (from 10 - 250 kilodaltons), lane

1, EV-A71 Mutant 158; lane 2, EV-A71 Mutant 475; lane 3, EV-A71 Mutant 486; lane

4, EV-A71 Mutant 487; lane 5, EV-A71 Mutant 5262; lane 6, EV-A71 Mutant Partial

Deletant (PD) 5’-NTR; lane 7, Positive control (EV-A71 Virus); lane 8, Negative

control (RD cells). The molecular weights of the EV-A71 protein and β-actin are 36 kDa

and 32.7 kDa, respectively. Arrow indicates the presence of VP1 in respective lanes.

β-actin

42 k

70

35

98

RD cells infected with the wild type EV-A71 strain 41 (Lane 7) demonstrated the

largest amount of VP1 protein (32.7 kDa) detected in Western blot analysis. Minimal

amount of VP1 was detected in the mutant strain 475 carrying the site specific mutation

at position 475 (Lane 2) and the partial deletant (PD) in the 5’-NTR (Lane 6). This was

consistent with results from plaque assays, TCID50, and RT-PCR. From Figure 3.10,

there are a few nucleotide (nt) positions in the viral genome that are likely to attenuate

the virus as we can observe the amount of viral capsid VP1 being formed are less than

the amount of VP1 being formed by the wild type strain 41. For example, EV-A71

mutant 158 at position 158 (Lane 1) and mutant 5262 (Lane 5) showed much reduced

amounts of viral VP1 protein when compared to the wild type EV-A71 (Lane 7).

99

3.6 Determination of neutralizing antibody titer elicited by the EV-A71 wild

type strain 41 in comparison with the various EV-A71 mutants.

Eight groups of 5 female Balb/c mice were immunized intraperitoneally with

either the heat-inactivated EV-A71 mutants 158, 475, 486, 487, 5262, PD, and the EV-

A71 strain 41 or PBS which represented positive and negative controls, respectively.

The neutralizing activities of individual antisera obtained from the same group of mice

were determined by an in vitro microneutralization assay. The infectivity of the various

EV-A71 mutants and the EV-A71 wild type strain 41 was observed in RD cells over a

period of 48 hours.

The anti-EV-A71 wild type immune serum allowed complete protection from

cytopathic effect (CPE) of the RD cells at serum dilutions up to 1:32 (Figure 3.12).

Complete protection of RD cells from CPE was also observed with serum dilutions

ranging from neat to 1:32 for antisera obtained from mice immunized with the EV-A71

mutants 5262 (A5262G) (Figure 3.17) and PD (Figure 3.18). In contrast, the neutralizing

activity of antisera from mice immunized with the EV-A71 mutant 158 (A158T) against

the EV-A71 wild type strain 41 was significantly lower with a neutralizing antibody titer

of 1:8 (Figure 3.13). However, the pooled antisera from mutants 475 (C475T) (Figure

3.14), 486 (A486G) (Figure 3.15), and 487 (G487A)-immunized mice (Figure 3.16),

displayed similar neutralizing activity with each other and with a neutralizing antibody

titer 1:16. These data demonstrate that the neutralizing levels of the immune sera

obtained from the mutants 5262 (A5262G) (Figure 3.17) and PD-immunized mice

(Figure 3.18) were as good as those elicited by the wild type strain 41. Mice immunized

with the mutants 475 (C475T), 486 (A486G) and 487 (G487A) contained 2-fold less

100

neutralizing antibodies than the levels observed with those elicited by the wild-type

strain 41, mutants 5262 and the PD (Table 3.2).

Table 3.2: Neutralizing antibody titers elicited by heat-inactivated EV-A71 mutants

and EV-A71 strain 41 in mice.

Two-fold serial dilutions of heat-inactivated serum were co-incubated with 103 TCID50

in a 96-well plate. Two hours later, 5 X 104 RD cells were added to each well and

incubated at 37°C. The cells were examined for CPE after 48h.

Immunogen Neutralizing Antibody Titer

Positive Control (EV-A71 strain 41) 1:32

A158T 1:8

C475T 1:16

A486G 1: 16

G487A 1: 16

A5262G 1:32

Partial Deletant(PD)5’-NTR 1:32

101

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

(E) 1:64

Figure 3.12: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the heat-inactivated EV-A71 wild type strain 41. RD cells

were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of anti-EV-

A71 immune serum. Survival of RD cells was observed with the neat serum (A);

antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); antiserum dilution of 1:32

(D); but not with antiserum dilution of 1:64 (E).

102

(A) Neat (B) 1:8

(C) 1:16

Figure 3.13: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the heat-inactivated EV-A71 mutant 158 (A158T). RD cells

were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-

EV-A71 mutant 158 (A158T) immune serum. Survival of RD cells was observed with

the neat antiserum (A); antiserum dilution of 1:8 (B); but not with antiserum dilution of

1:16 (C).

103

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

Figure 3.14: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the heat-inactivated EV-A71 mutant 475 (C475T). RD cells

were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-

EV-A71 mutant 475 (C475T) immune serum. Survival of RD cells was observed with

the neat antiserum (A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but

not with antiserum dilution of 1:32 (D).

104

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

Figure 3.15: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the EV-A71 mutant 486 (A486G). RD cells were infected with

103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-EV-A71 mutant

486 (A486G) immune serum. Survival of RD cells was observed with the neat antiserum

(A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but not with antiserum

dilution of 1:32 (D).

105

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

Figure 3.16: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the EV-A71 mutant 487 (G487A). RD cells were infected with

103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-EV-A71 mutant

487 (G487A) immune serum. Survival of RD cells was observed with the neat antiserum

(A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but not with antiserum

dilution of 1:32 (D).

106

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

(E) 1:64

Figure 3.17: In vitro microneutralization assay using pooled antisera from mice

(n=5) immunized with the EV-A71 mutant 5262 (A5262G). Survival of RD cells was

observed with the neat antiserum (A); antiserum dilution of 1:8 (B); antiserum dilution

of 1:16 (C); antiserum dilution of 1:32 (D); but not with antiserum dilution of 1:64 (E).

107

(A) Neat (B) 1:8

(C) 1:16 (D) 1:32

(E) 1:64

Figure 3.18: In vitro microneutralization assay using pooled antisera from mice (n=5)

immunized with the heat-inactivated EV-A71 mutant PD (deletant in the 5’NTR). Survival

of RD cells was observed with the neat antiserum (A); antiserum dilution of 1:8 (B) antiserum

dilution of 1:16 (C); antiserum dilution of 1:32 (D); but not with antiserum dilution of 1:64 (E).

108

3.7 Analysis of IgG responses elicited by EV-A71 Mutants

One of the goals for vaccination is to induce a strong and long memory humoral

and cellular immune response and protect against the targeted infectious agent. A good

vaccine should contain epitopes that can induce both B-cell and T-cell immune

responses. Besides induction of either B-cell or cytotoxic T-cell (CD8+) responses, the

induction of helper T-cells (CD4+) is essential as it mediates the immune responses. For

example, helper T cells help to activate cytotoxic T cells. Helper T cells can be divided

into two subsets of effector cells based on their functional capabilities and the cytokines

produced. The Th1 subset of CD4+ T helper cells secretes cytokines such as IFN-γ, IL-2

and TNF-β and induces cell mediated immunity. The Th-2 cells produce cytokines such

as IL-4 and IL-5 and help B cells to proliferate and stimulate a humoral response. The

Th-1 cells promote the production of immunoglobulin IgG2a in mice and CD8+

cytotoxic T cells. To clear viruses from the infected cells, cytotoxic T cells (CD8+) seek

out the infected cells and killing them. The Th-2 cells promote the production of IgG1 in

mice.

An ideal live attenuated vaccine is expected to be safe and provide protective

immunity by inducing both humoral and cellular immunity. Protective immunity against

viruses conferred by the LAV can be mediated by the secretion of neutralizing

antibodies and the production of cytotoxic CD8+ cells. In this study, the isotypic

distributions of IgG antibodies elicited by the mutant strains of EV-A71 (mutants 158,

475, 486, 487, 5262 and PD) in response to immunization in mice were analysed.

109

(a) EV-A71 (158) (475) (486) (487)

(b) EV-A71 (5262) (PD) Negative Control Strain 41

Figure 3.19: IgG1 and IgG2 responses elicited by EV-A71 Mutants and Controls.

(a) Red bands correspond to IgG2a and IgG2b for EV-A71 mutants 158, 475, 486 and

487. (b) EV-A71 mutants 5262, partial deletant 5’-NTR, negative control and wild type

EV-A71. The IgG isotyping assays were repeated at least two separate times.

110

(a) EV-A71 (158) (475) (486) (487)

(b) EV-A71 (5262) (PD) Negative Control Strain 41

Figure 3.20: IgG3, IgA and IgM responses elicited by EV-A71 Mutants and

Controls.

(a) Red bands correspond to IgG3, IgA and IgM for EV-A71 mutants 158, 475, 486 and

487. (b) EV-A71 mutants 5262, partial deletant 5’-NTR, negative control and wild type

EV-A71. The IgG isotyping assays were repeated at least two separate times.

111

Examination of the profiles of specific IgG subtypes in the mice antisera

revealed that IgM, IgA, IgG2a and IgG2b antibodies were predominantly produced in

pooled immune sera raised against the six EV-A71 mutants, and at levels comparable to

that measured in the pooled immune sera obtained from mice immunized with the heat-

inactivated homologous EV-A71 whole virion. It was based on the observation of red

bands from the mouse sub-type isotyping kit that showed red bands corresponded to

isotypes IgM, IgA, IgG2a and IgG2b. This was consistent with previous studies that

showed mouse infection with various viruses triggered an antiviral antibody response

that was largely restricted to the IgG2a isotype (Coutelier et al., 1987). In addition,

among the four antibodies (IgG1, IgG2a, IgG2b, IgG3), it was reported that IgG2a

delayed the onset and progression of lactate dehydrogenase-elevating virus (LDV)

induced polio-encephalomyelitis more than the other subtypes. This suggested that the

IgG2a predominance observed in many IgG antibody responses elicited by live viruses

may potentially correspond to the selection of the best protection for the infected host

(Markine-Goriaynoff and Coutelier, 2002).

In contrast, the levels of IgG1 and IgG3 measured in pooled immune sera from

mice immunized with the EV-A71 mutants were not significantly different from the

levels measured in the negative control mice while those measured in the pooled

immune sera from mice immunized with the heat-inactivated EV-A71 whole virion

showed significantly more intense red bands corresponding to the IgG isotypes,

respectively. The presence of the IgA in the antisera indicates the induction of mucosal

immunity. Generally, IgG1 in mice is associated with a Th2 profile and IgM, IgA, IgG2

and IgG3 are mainly associated with a Th1 profile (Banerjee et al., 2010). Altogether,

these data indicate that the intraperitoneal administration of heat-inactivated EV-A71

112

mutants 158, 475, 486, 487, 5262 and PD and the homologous EV-A71 whole virion

triggered a stronger Th1 response which is cell mediated immunity.

113

CHAPTER 4

DISCUSSION

Previous studies by Arita et al. (2005) showed that cynomolgus monkeys

immunized with an EV-A71 (S1-3’) mutant strain still developed mild neurological

symptoms, although there was reduced virulence. They had attempted to develop a live-

attenuated vaccine (LAV) against EV-A71 by introducing 3 mutations at nucleotides

485, 486 and 475 in the EV-A71 genotype A genome which corresponded to the

mutations present in Sabin 1, 2 and 3, respectively. However, the virus still caused

tremors and was isolated from the spinal cord. Hence, this strain did not meet the criteria

to be used as a LAV.

Therefore, we examined EV-A71 sub-genotype B4, strain 41 (5865/Sin/000009)

to generate attenuated EV-A71 strains. We genetically modified the EV-A71 virus by

substituting nucleotides at positions 475, 486, and 487 based on the fact that these

nucleotides are responsible for the neurovirulence of poliovirus Sabin strains 1, 2 and 3

(Table 1.4). The virulence determinants of poliovirus and EV-A71 reported in previous

studies served as references in this study to produce EV-A71 viruses that are highly

attenuated. In addition, we also investigated if EV-A71 sub-genotype B4 has a different

virulence determinant from the sub-genotype B1 (clinical isolate 237) (Yeh et al., 2011).

The EV-A71 sub-genotype B4 virus was modified to carry a mutation at nucleotide

position 158 to assess if the nucleotide is a common virulence determinant between the

sub-genotypes B4 and B1 (Fig. 1.9).

114

Liu et al. (2014) found that there were nine amino acid substitutions (H22Q,

P27S, N31S/D, E98K, E145G/Q, D164E, T240A/S, V249I, A289T) that were detected

after aligning the VP1 sequences of fatal and mild EV-A71 strains of sub-genotype C4

(Liu et al., 2014). As such, these residues maybe potential virulence determinants in

VP1 and could convert mild EV-A71 cases into severe cases. The study was consistent

with previous investigations by Chang et al. (2012) who observed that the E145Q

substitution at the 5’-NTR was a common difference in the EV-A71 genome of mild and

fatal cases of HFMD. Additionally, they also discovered that strains isolated from

patients with fatal outcomes had greater substitutions in the 5’-NTR and IRES regions

(Chang et al., 2012). This is to be expected as these regions were responsible for

receptor binding and cap-independent translation of viral proteins. The position of a

certain specific amino acid in the genome may have a profound significance on

virulence. For example, it was reported that the presence of Asn at position 165 of VP2

in Coxsackievirus B3 was responsible for a cardio virulent phenotype (Knowlton et al.,

1996).

It remains to be investigated if there is a universal molecular determinant present

in every EV-A71 fatal strain or whether every fatal strain differs in virulence

determinant depending on their sub-genotype. An EV-A71 mutant bearing a long

deletion in the 5’-NTR of the genome was also constructed. In addition, the single nt.

difference between the fatal (strain 41) and non-fatal strain (strain 10) of EV-A71 (sub-

genotype B4) is examined for neuro-virulence by changing the nt. substitution at

position 5262 in the EV-A71 viral genome (Singh et al., 2002). However, as exemplified

by the human immunodeficiency virus, laboratory strains are sometimes so

115

phenotypically and genotypically distinct from those found in infected individuals that

therapeutic or preventative measures effective against these laboratory strains do not

always correlate with naturally circulating strains (Mascola et al., 1996).

The virulence of the various mutated EV-A71 strains was evaluated in the

Rhabdomyosarcoma (RD) cell culture by plaque assays, viral infectivity by tissue

culture infectious dose (TCID50) determinations, real time Reverse-Transcriptase

Polymerase Chain Reaction (RT-PCR) and detection of VP1 by immunoblotting as well

as in vivo studies. The TCID50 for the EV-A71 wild type strain 41 and mutant virus titers

were quantitatively determined. The lower the virulence of a mutant strain, the higher

the TCID50 value. Analysis of the TCID50 values indicated that mutants 475 and strain

PD required higher doses of viruses to cause cytopathic effects in 50% of the tissue

culture. Thus, mutants 475, and PD may serve as potential LAV candidates for further

evaluation by other tests in vitro.

Subsequently, the number of plaques produced by the various EV-A71 mutant

strains was evaluated in the RD cell culture by plaque assays. If the ability to form

plaques is reduced, this would mean that viral growth is slower, thereby producing a

lower PFU/ml value. For example, the mutant 487 (10 x104 PFU/mL) and mutant 5262

showed a much reduced plaque number (1.8 x 105 PFU/mL) when compared to the

positive control (EV-A71 wild type strain 41) with 5.0 x 107 PFU/mL. The least number

of viral plaques were formed by the mutant 475 carrying SDM at position 475 (7.0 x 104

PFU/mL) and the partial deletant (PD) (9.0 x 104 PFU/mL).

116

The ability of the various mutated EV-A71 strains to produce viral particles

could be evaluated by detection of VP1 by immunoblotting with the monoclonal

antibody directed against VP1. RD cells infected with the wild type EV-A71 strain 41

demonstrated the largest amount of the VP1 protein detected as evident from a thick,

single band with molecular weight (MW) of 32kDa. This band corresponds to the VP1

monomer with an apparent MW of 32.7kDa. Minimal amount of VP1 was detected in

the mutant strain carrying the site specific mutation at position 475 and the partial

deletant (PD) in the 5’-NTR.

An additional approach such as determination of the viral RNA copy number

would enable a better quantitative comparison of attenuation of the various mutant

strains. The viral RNA copy number of the various EV-A71 mutant strains was

evaluated after growing in the RD cell culture for 24 hours. RD cells infected with the

wild type EV-A71 strain 41 gave the highest yield of viral RNA copy number (5.5 X

103). As for EV-A71 mutant 475 and PD, minimal RNA copy no. was detected for both

mutants at 1.02 X 102 and 1.05 X 102 viral RNA, respectively. This was consistent with

results from plaque assays, TCID50, and immunoblotting. These two mutants appear to

hold promise and will be subjected to further evaluation tests to assess whether they

could serve as potential LAV strains. Amongst all the mutants being evaluated, mutant

486 carrying SDM at position 486 (A486G) expressed the highest viral RNA copy

number of 3.2 X 103 when compared to the wild type strain 41. Attenuated strains with

low viral RNA copy number are possible good vaccine strains as they cannot replicate

fast enough to yield high viral load and cause destruction of the tissue cells. Slow

replication could infer that the cells could carry enough antigens to stimulate an immune

response.

117

Previous studies have shown that the VP1 capsid protein of EV-A71 constitutes a

potential subunit vaccine candidate by triggering the production of protective anti-EV-

A71 neutralizing antibodies in a murine model of infection (Chen et al., 2006; Chiu; et

al., 2006). Chang and co-workers (2015) discovered that a single amino acid variation

in VP1 could lead to significant differences in the sensitivity of EV-A71 to neutralizing

antibody responses. They also identified EV-A71 strains that could induce potent

immunogenic and cross-neutralizing antibody responses against diverse EV-A71 strains.

Furthermore, these neutralizing antibodies could protect neonatal mice from lethal dose

challenge with various circulating EV-A71 viruses (Chang et al., 2015).

In this study, two EV-A71 mutants, PD and 5262, successfully elicited high titers

of neutralizing antibodies (1:32) against EV-A71. To a lesser extent, the 475, 486 and

487-immunized mice produced neutralizing antibodies against the EV-A71 strain 41

with a neutralizing antibody titer of 1:16 (Table 3.2). The levels of neutralizing

antibodies obtained by the EV-A71 mutants were lower than the levels obtained by

Chou et al. (2012) (1:640). This could be due to alum being as an adjuvant in their

studies while Freund’s complete adjuvant was used in our investigation. In addition, an

anti-EV-A71 neutralizing titre of 1:16 or higher is able to confer protection against

HFMD (Zhu et al., 2014). As EV-A71 mutants PD (1:32) and 475 (1:16) had high

neutralizing titers, they are potential LAVs to be developed further as they have low

pathogenicity and high immunogenicity. As neutralizing response plays a protective role

against viral infectivity, EV-A71-neutralizing antibodies elicited by EV-A71 mutants

PD and 475 should be characterized based on their specificities and functional roles in

the neutralization process. In addition, the immunogenicity studies could be repeated

118

with a different adjuvant and the genetic stability of these mutants has to be further

investigated.

An ideal LAV should be able to induce a protective antibody response as well as

a cytotoxic T-cell response important for killing infected host cells. Such knowledge on

the immune response to EV-A71 infection is crucial to the development of the LAV and

special vaccination challenges presented by this virus. A previous study by Lidbury et

al. (2000) showed that the antibody responses of irradiated virus-erythrocyte complex

(IV-EC) and live virus-erythrocyte complex (LV-EC) vaccinated mice showed

significantly elevated lung and serum IgG2a levels post live virus challenge, with no

comparable increases in IgG1 levels compared to controls. Their results suggested that

protection from live influenza (H3N2) challenge after IV-EC or LV-EC vaccination was

due to an IFN-mediated IgG2a response.

This was consistent with our results as the IgG subtype analysis of EV-A71

mutants 158, 475, 486, 487, 5262 and PD antisera demonstrated strong IgA, IgM, IgG2a

and IgG2b specific antibody response and low IgG1 and IgG3 antibody responses which

indicates a skewed Th1 immune response. There has been support in alternative vaccine

approaches that induce a more Th1 skewed response. IgG titres detected by the antigen

ELISA were lower than neutralization titres and this could possibly be due to high assay

background and low sensitivity of the assay (Bielinska et al., 2008; Wille-Reece et al.,

2015). Bek and co-workers (2011) also surmised that the dosage of vaccine suspension

administered and the type of adjuvant used could also account for the differing

neutralizing and IgG titres.

The results in a study by Visciano et al. (2012) showed that adjuvants are able to

skew the immune response of HIV-VLPs toward a Th1 profile. Additionally, the role of

119

the adjuvant in the vaccine formulation may influence the IgG profile and this should

not be discounted. Nevertheless, the results are desirable as an effective LAV should

trigger both the humoral and cellular immune response. These observations suggest that

EV-A71 mutants 158, 475, 486, 487, 5262 and PD contained B cell epitopes and the

neutralizing antibodies elicited by these mutants belong to the IgM subtype. Production

of large amounts of IgG2a and IgG2b by all the mutants and the wild type indicates

good cellular immune responses and the presence of IgA points to a good mucosal

response as well.

Although a number of EV-A71 mutants with good in vivo passive protective

potential have been identified, further studies could be performed to assess the genetic

stability of the mutant strains. Reversion of the mutant strains will indicate if it is

genetically stable or it will revert to the original nt. This can be performed by serial

passaging and recovering the viral strain after a series of passaging. If the mutant

reverts, this will be picked up during serial passages by sequencing of the whole viral

genome. In addition, better attenuated mutants could be constructed by introducing

multiple mutations into the attenuated EV-A71 mutant 475 or PD. With advances in

molecular biology, novel approaches to viral attenuation can be further studied such as

altered replication fidelity, codon deoptimization and microRNA-controlled LAVs. As

high mutation rates often hinder the effectiveness of a LAV, altering the replication

fidelity can attenuate the entire virus population, leading to population collapse without

mutation of key immunogenic epitopes. miRNAs can be used to control the replication

of RNA viruses, respectively. By controlling viral replication temporally, a strong,

natural immune response can be elicited before the virus is eliminated (Lauring et al.,

2010).

120

As for codon deoptimization, synonymous codons can be substituted throughout

a viral genome, hence preventing loss of immunogenicity and little risk of reversion to

wild type. Studies on codon bias for viral replication and pathogenicity of poliovirus

(PV) have been reported. Burns et al., (2006) replaced half of the total codons in the

capsid region of Sabin type 2 oral polio vaccine strain with non-preferred synonymous

codons. They discovered that synthesis and processing of viral proteins were unaffected

but viral fitness was significantly reduced (Burns et al., 2006). In a later study (2009),

they replaced natural capsid region codons with synonymous codons that had increased

frequencies of CpG and UpA dinucleotides. They produced codon-deoptimised PVs that

had significantly lower overall fitness as indicated by lower viral plaque number and

virus yields (Burns et al., 2009). Also working with codon-deoptimized PVs, Mueller et

al., (2006) used gene synthesis technology to introduce the largest possible number of

rarely used synonymous codons in the capsid region of PV type 1 Mahoney. They found

a significant decrease in replicative fitness and number of infectious viral progeny.

There was also reduction of genome translation and virus-particle infectivity of up to

1,000-fold as compared to the wild type (Mueller et al., 2006). Interestingly, both Burns

et al., (2006) and Mueller et al., (2006) discovered that the deoptimised viruses

remained attenuated after repeated cell passages and hence, were genetically stable with

minimal risk of reversion.

It is well known that some virulent strains of EV-A71 are capable of causing

paralytic disease indistinguishable from poliomyelitis caused by the poliovirus. Virulent

strains of EV-A71 are referred to as the new polio as it is neurotropic. The EV-A71

strains had 46% amino acid identity with the polioviral P1 capsid region and 55% with

the entire polyprotein (Brown and Pallansch, 1995). In addition, EV-A71 and PV share

121

high sequence homology especially in the 5’-NTR region hence, the codon

deoptimisation research on PV reported in previous studies could serve as references to

produce EV-A71 viruses that are highly attenuated.

122

CHAPTER 5

CONCLUSION

The Hand, Foot and Mouth Disease is caused by a group of Enteroviruses such

as Enterovirus 71 (EV-A71) and Coxsackievirus CVA5, CVA6, CVA10, and CV-A16.

Mild symptoms of EV-A71 infection in children range from high fever, vomiting, rashes

and ulcers in the mouth, commonly affecting children and infants. EV-A71 can produce

more severe symptoms such as brainstem and cerebellar encephalitis, leading up to

cardiopulmonary failure and death. The lack of vaccines and antiviral drugs against EV-

A71 highlights the urgency of developing vaccines to prevent and antiviral agents to

treat EV-A71 infections.

The molecular basis of virulence in EV-A71 is still uncertain. It remains to be

investigated if there is a universal molecular determinant present in every EV-A71 fatal

strain or whether every fatal strain differs in virulence determinant depending on their

sub-genotype. In this study, the EV-A71 virus was genetically modified by substituting

nucleotides at positions 158, 475, 486, and 487 based on the neuro-virulence of

poliovirus Sabin strains 1, 2 and 3. We also investigated if the single nucleotide

difference in strain 41 (5865/Sin/000009) between the fatal and the non-fatal strain

(strain 10) was responsible for neurovirulence by introducing a nucleotide substitution at

position 5262 in the EV-A71 genome. Another mutant strain was also constructed

through partial deletion of the 5’-NTR region in the EV-A71 genome.

In conclusion, EV-A71 mutant 158 was not the most attenuated as it still

produced more RNA, plaques and VP1 than mutants 5262, 487, 475 and the partial

123

deletant PD. Therefore, it is not the single neuro-virulence determinant for strain 41

which belongs to genotype B4 when compared to EV-A71 genotype B1 studied by Yeh

et al. (2011). Results support the hypothesis that every EV-A71 genotype or sub-

genotype carries a different virulence determinant. The single site mutation created by

introducing a nt. change at position 5262 did not completely eliminate the ability to

replicate and form plaques. There was some attenuation by SDM at this site but the

effect of attenuation at this site was less than the effects brought about by introducing

SDM into sites 475, 487 and the partial deletion. The partial deletant may be the most

stable mutant genetically as it demonstrated high immunogenicity (neutralizing titre of

1:32) and low pathogenicity and hence, could be a good potential LAV candidate for

further studies. In addition, intraperitoneal administration of the heat-inactivated EV-

A71 mutants 158, 475, 486, 487, 5262 and PD and the homologous EV-A71 whole

virion triggered a skewed Th1 response.

Further studies should be conducted to investigate the stability of the mutations

created by SDM in each mutant. A strain that is genetically highly stable and does not

revert easily would thereby make a better LAV for EV-A71. Compared to conventional

vaccines, the LAV is cheaper to produce, induces excellent immunogenicity and confers

live-long immunity. LAV is preferred over the inactivated EV-A71 vaccine as it can

elicit both humoral and cellular immunity, alongside the innate and adaptive immunity.

In view of the rising concerns over EV-A71 infections with resulting fatalities in the

large scale outbreaks in the Asia Pacific region, the results obtained in this study

demonstrated potential LAV candidates against EV-A71 infections.

124

REFERENCES

Arita M, Shimizu H, Nagata N, Ami Y, Suzaki Y, Sata T, Iwasaki T, Miyamura T.

(2005). Temperature-sensitive mutants of enterovirus 71 show attenuation in

cynomolgus monkeys. Journal of General Virology. 86:1391-1401.

Arita M, Nagata N, Iwata N et al. (2007). An attenuated strain of enterovirus 71

belonging to genotype A showed a broad spectrum of antigenicity with attenuated

neurovirulence in cynomolgus monkeys. Journal of Virology. 81:9386–9395.

Banerjee K, Klasse PJ, Sanders RW, Pereyra F, Michael E, Lu M, et al. (2010). IgG

subclass profiles in infected HIV type 1 controllers and chronic progressors and in

uninfected recipients of Env vaccines. AIDS Research Human Retroviruses. 26:445-458.

Bek EJ, Hussain KM, Phuektes P, Kok CC, Gao Q, Cai F, Gao Z, MP. (2011). Formalin-

inactivated vaccine provokes cross-protective immunity in a mouse model of human

enterovirus 71 infection. Vaccine. 29:4829–4838.

Belsham, GJ and Sonenberg, N (1996). RNA-protein interactions in regulation of

picornavirus RNA translation. Microbiological Reviews. 60:499-511.

Bible JM, Pantelidis P, Chan PK, Tong CY. (2007). Genetic evolution of enterovirus 71:

epidemiological and pathological implications. Reviews in Medical Virology 17:371-

379.

Bielinska AU, Janczak KW, Landers JJ, Markovitz DM, Montefiori DC, Baker JR Jr

(2008). Nasal immunization with a recombinant HIV gp120 and nanoemulsion adjuvant

produces Th1 polarized responses and neutralizing antibodies to primary HIV type 1

isolates. AIDS Research on Human Retroviruses. 24:271-281.

Bouchard MJ, Lam DH, Racaniello V. (1995). Determinants of attenuation and

temperature sensitivity in the type 1 poliovirus Sabin vaccine. Journal of Virology

69:4972–4978.

Brown BA, P. M. (1995). Complete nucleotide sequence of enterovirus 71 is distinct

from poliovirus. Virus Research. 39:195–205.

Brown, B. A., Oberste, M. S., Alexander, J. P., & Kennett, ML. (1999). Molecular

Epidemiology and Evolution of Enterovirus 71 Strains Isolated from 1970 to 1998.

Journal of Virology. 73:9969–9975.

Bukreyev A, Skiadopoulos MH, McAuliffe J, Murphy BR, Collins PL, Schmidt AC.

(2002). More antibody with less antigen: Can immunogenicity of attenuated live virus

vaccines be improved? Proceedings of the National Academy of Sciences. 99:16987–

16991.

125

Burns, C. C., Shaw, J., Campagnoli, R., Jorba, J., Vincent, A., Quay, J., & Kew, O.

(2006). Modulation of Poliovirus Replicative Fitness in HeLa Cells by Deoptimization

of Synonymous Codon Usage in the Capsid Region. Journal of Virology. 80:3259-3272.

Burns, C. C., Campagnoli, R., Shaw, J., Vincent, A., Jorba, J., & Kew, O. (2009).

Genetic Inactivation of Poliovirus Infectivity by Increasing the Frequencies of CpG and

UpA Dinucleotides within and across Synonymous Capsid Region Codons. Journal of

Virology. 83:9957-9969.

Castro CM, Cruz AC, Silva EE, Gomes Mde L. (2005). Molecular and

seroepidemiologic studies of enterovirus 71 infection in the state of Para, Brazil. Review

of the Institute of Tropical Medicine Sao Paulo. 47:65-71.

Cereghino JL, and Cregg JM. (2000). Heterologous protein expression in the

methylotrophic yeast Pichia pastoris. FEMS Microbiological Reviews. 24:45-66.

Chan KP, Goh KT, Chong CY, Teo ES, Lau G, Ling AE. (2003). Epidemic hand, foot

and mouth disease caused by human enterovirus 71, Singapore. Emerging Infectious

Diseases. 9:78-85.

Chan YF, Sam IC, Abu Bakar S. (2010). Phylogenetic designation of enterovirus 71

genotypes using complete genome sequences. Infection, Genetics and Evolution.

10:404-412.

Chang LY, King CC, Hsu KH, Ning HC, Tsao KC, Li CC, Lin TY. (2002). Risk Factors

of Enterovirus 71 Infection and Associated Hand, Foot, and Mouth Disease/Herpangina

in Children During an Epidemic in Taiwan. Pediatrics. 109:88.

Chang LY, Hsiung C, Lu CY, Lin TY, Huang FY, Lai YH, Huang LM. (2006). Status of

cellular rather than humoral immunity is correlated with clinical outcome of enterovirus

71. Pediatrics Research 60:466–471.

Chang SC, Li WC, Chen GW, Tsao KC, Huang CG, Huang YC, Chiu CH, et al. (2012).

Genetic Characterization of enterovirus 71 isolated from patients with severe disease by

comparative analysis of complete genomes. Journal of Medical Virology. 84:931-939.

Chang JL, Li JL, Wei W, Liu X, et al. (2015). Determinants of EV-A71

immunogenicity and protection against lethal challenge in a mouse model.

Immunology Research. 62:306-315.

Chen HF, Chang MH, Chiang BL, Jeng ST. (2006). Oral immunization of mice using

transgenic tomato fruit expressing VP1 protein from enterovirus 71. Vaccine. 24: 2944–

2951.

126

Chia MY, Chung WY, Chiang PS, Chien YS, Ho MS, et al. (2014) Monitoring

Antigenic Variations of Enterovirus 71: Implications for Virus Surveillance and Vaccine

Development. PLoS Neglected Tropical Diseases 8:e3044.

Chiu CH, Chu C, He CC, Lin TY. (2006). Protection of neonatal mice from lethal

enterovirus 71 infection by maternal immunization with attenuated Salmonella enterica

serovar Typhimurium expressing VP1 of enterovirus 71. Microbes and Infection.

8:1671-1678.

Chong P, Hsieh SY, Liu CC et al. (2012). Production of EV-A71 vaccine candidates.

Human Vaccines and Immunotherapeutics 8:1-9.

Chong P, Liu CC, Chow YH, Chou AH, Klein M. (2015). Review of enterovirus 71

vaccines. Clinical Infectious Diseases. 60:797-803.

Chou Ai-Hsiang, Chia-Chyi Liu, Jui-Yuan Chang, Shu-Pei Lien, Meng-Shin Guo, Hau-

Pong Tasi, et al. (2012). Immunological Evaluation and Comparison of Different EV-

A71 Vaccine Candidates. Clin Dev Immunol. Article ID 831282.

Chou AH, Liu CC, Chang JY et al. (2013). Formalin-inactivated EV-A71 vaccine

candidate induced cross-neutralizing antibody against sub-genotypes B1, B4, B5 and

C4A in adult volunteers. PLoS One 8: e79783.

Chua BH, Phuektes P, Sanders SA, Nicholls PK, McMinn PC. (2008). The molecular

basis of mouse adaptation by human enterovirus 71. Journal of General Virology.

89:1622–1632.

Chumakov K, Ehrenfeld E. (2008). New Generation of Inactivated Poliovirus Vaccines

for Universal Immunization after Eradication of Poliomyelitis. Vaccine. 47: 1587-1592.

Coutelier JP, van der Log JT, Heessen FW, Warnier G, Van Snick J. (1987). IgG2a

restriction of murine antibodies elicited by viral infections. The Journal of Experimental

Medicine 165:64–69.

Ding FX, Wang F, Lu YM, Li K, Wang KH, He XW, Sun SH. (2009). Multiepitope

peptide-loaded virus-like particles as a vaccine against hepatitis B virus-related

hepatocellular carcinoma. Hepatology. 49:1492-1502.

Fitzpatrick M. (2006). The Cutter Incident: How America’s First Polio Vaccine led to a

Growing Vaccine Crisis. Journal of the Royal Society of Medicine. 99:156.

Foo DG, Alonso S, Chow VT, Poh CL. (2007). Passive protection against lethal

enterovirus 71 infection in newborn mice by neutralizing antibodies elicited by a

synthetic peptide. Microbes Infections. 9:1299–1306.

127

Foo DGW, Alonso S, Phoon MC, Ramachandran NP, Chow VTK, Poh CL. (2007).

Identification of neutralizing linear epitopes from the VP1 capsid protein of enterovirus

71 using synthetic peptides. Virus Research. 125: 61-68.

Girn J, Kavoosi M, Chantler J. (2002). Enhancement of coxsackievirus B3 infection by

antibody to a different coxsackievirus strain. Journal of General Virology 83:351–358.

Grassly NC, Wenger J, et al (2006). New strategies for the elimination of polio from

India. Science 314: 1150-1153.

Gregory AE, Titball R, Williamson D. (2013). Vaccine delivery using nanoparticles.

Cellular and Infection Microbiology. 3:1-13.

Han JF, Cao RY, Deng YQ, Tian X, Jiang T, Qin ED, Qin CF. (2011). Antibody

dependent enhancement infection of enterovirus 71 in vitro and in vivo. Virology

Journal. 8:106-112.

Han JF, Cao RY, Tian X, Yu M, Qin ED, Qin CF. (2010). Producing infectious

enterovirus type 71 in a rapid strategy. Journal of Virology 7:116-120.

Hicks AL, Duffy S. (2011). Genus-specific substitution rate variability among

Picornaviruses. Journal of Virology. 85:7942-7947.

Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT, Tsai SF, Wang JR, Shih SR. (1999). An

Epidemic of Enterovirus 71 Infection in Taiwan. New England Journal of Medicine.

341:929–935.

Holland J, Spindler K, Horodyski F, Grabau E, Nichol S, VandePol S. (1982). Rapid

evolution of RNA genomes. Science. 215:1577–1585.

Huang YP, Lin TL, Hsu LC, Chen YJ, Tseng YH, et al. (2010) Genetic diversity and

C2-like subgenogroup strains of enterovirus 71, Taiwan, 2008. Virology Journal. 7:277-

287.

Huang ML, Chiang PS, Chia MY, Luo ST, Chang LY, Lin TY, et al. (2013). Cross-

reactive neutralizing antibody responses to enterovirus 71 infections in young children:

implications for vaccine development. PLoS Neglected Tropical Diseases. 7:e2067.

Iizuka N, Kohara M, Hagino-Yamagishi K, Abe S, Komatsu T, Tago K, et al. (1989).

Construction of less neurovirulent polioviruses by introducing deletions into the 5'

noncoding sequence of the genome. Journal of Virology. 63:5354-5363.

Kawamura N, Kohara M, Abe S, Komatsu T, Tago K, Arita M, Nomoto A. (1989).

Determinants in the 5’ noncoding region of poliovirus Sabin 1 RNA that influence the

attenuation phenotype. Journal of Virology. 63:1302–1309.

128

Kew OM, Sutter RW, de Gourville EM, Dowdle WR, Pallansch M. (2005). Vaccine-

derived polioviruses and the endgame strategy for global polio eradication. Annual

Reviews in Microbiology. 59:587–635.

Kirk K, Poh CL, Fecondo J, Pourianfar H, Shaw J, Grollo L. (2012) Cross-reactive

neutralizing antibody epitopes against Enterovirus 71 identified by an in silico approach.

Vaccine. 30:7105-7110.

Knowlton KU, Jeon E, Berkley N, Wessely R, Huber S. (1996). A mutation in the puff

region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the

Woodruff variant of coxsackievirus B3. Journal of Virology. 70:7811–7818.

Kowane B, Wassilak S, Orenstein W, Bart K, et al. (1987) Vaccine-associated paralytic

poliomyelitis United States: 1973 through 1984. Journal of American Medical

Association. 257:1335-1340.

Kung YA, Hung CT, Liu YC, Shih SR. (2014). Update on the development of

enterovirus 71 vaccines. Expert Opinion on Biological Therapy. 14:1455–1464.

Kuo RL, Kung SH, Hsu YY, Liu WT. (2002). Infection with enterovirus 71 or

expression of its 2A proteases induces apoptotic cell death. Journal of General

Virology. 83:1367–1376.

Kuo RL, Shih SR. (2013). Strategies to develop antivirals against enterovirus 71.

Virology Journal. 10:28-35.

Lauring AS, Jones JO, Andino R. (2010). Rationalizing the development of live

attenuated virus vaccines. Natural Biotechnology. 28:573-579.

Lee H, Cifuente JO, Ashley RE et al. (2013) A strain-specific epitope of enterovirus 71

identified by cryo-electron microscopy of the complex with Fab from neutralizing

antibody. Journal of Virology. 87:11363-11370.

Lee MS, Tseng FC, Wang JR, Chi CY, Chong P, Su IJ. (2012). Challenges to licensure

of enterovirus 71 vaccines. PLoS Neglected Tropical Diseases. 6:e1737.

Liang ZL, Wang JZ. (2014). EV-A71 vaccine, an invaluable gift for children. Journal of

Clinical and Translational Immunology. 3:e28.

Li M-L, Hsu T-A, Chen T-C, Chang S-C, Lee J-C, Chen C-C, Stollar V, Shih S-R.

(2002). The 3C Protease Activity of Enterovirus 71 Induces Human Neural Cell

Apoptosis. Virology. 293:386-395.

Li, Z., Yi, Y., Yin, X., Zhang, Z., & Liu, J. (2008). Expression of foot-and-mouth

disease virus capsid proteins in silkworm-baculovirus expression system and its

utilization as a subunit vaccine. PloS One. 3:e2273.

129

Li R, Zou Q, Chen L, Zhang H, WY. (2011). Molecular analysis of virulent

determinants of enterovirus. PLoS One. 71:e26237.

Li, H.-Y., Han, J.-F., Qin, C.-F., & Chen, R. (2013). Virus-like particles for enterovirus

71 produced from Saccharomyces cerevisiae potently elicits protective immune

responses in mice. Vaccine. 31:3281–7.

Li, Y.-X., Zhao, H., Cao, R.-Y., Deng, Y.-Q., Han, J.-F., Zhu, S.-Y., Qin, C.-F. (2014).

Recombinant tandem multi-linear neutralizing epitopes of human enterovirus 71 elicited

protective immunity in mice. Virology Journal. 11:79.

Liang ZL, Mao QY, Wang YP, Zhu FC, Li JX, Yao X, Gao F, Wu X, Xu M, WJ.

(2013). Progress on the research and development of inactivated EV-A71 whole-virus

vaccines. Hum Vaccin Immunother. 9:1701-1705.

Liang Z, Wang J. (2014). EV-A71 vaccine, an invaluable gift for children. Journal of

Clinical and Translational Immunology. 3:e28.

Lin TY, Chang LY, Hsia SH, et al. (2002). The 1998 Enterovirus 71 outbreak in

Taiwan: pathogenesis and management. Clinical Infectious Diseases. 34:52-57.

Lin KH, Hwang KP, Ke GM, Wang CF, Ke LY, Hsu YT, et al. (2006). Evolution of

EV-A71 genogroup in Taiwan from 1998 to 2005: an emerging of subgenogroup C4 of

EV-A71. Journal of Medical Virology. 78: 254-262.

Lidbury BA, Grissell TV, Sizer PJ, Clancy R, Cripps AW. (2000). Studies on the IgA-

independent immunological responses in mice to influenza virus challenge after oral

vaccination with irradiated whole virus and an erythrocyte complex. Immunology and

Cell Biology. 78: 149–155.

Liu HM, Zheng DP, Oberste MS, Kew OM, Pallansch MA. (2003). Serial recombination

during circulation of type 1 wild-vaccine recombinant polioviruses in China. Journal of

Virology. 77:10994–11005.

Liu Y, Fu C, Wu S, Chen X, et al. (2014). A novel finding for enterovirus virulence

from the capsid protein VP1 of EV-A71 circulating in mainland China. Virus Genes.

48:260-272.

Liu W, Wu S, Xiong Y et al. (2014). Co-circulation and genomic recombination of

coxsackievirus A16 and enterovirus 71 during a large outbreak of hand, foot and mouth

disease in central China. PLoS One. 9:e96051.

130

Liu SL, Pan H, Liu P et al. (2015). Comparative epidemiology and virology of fatal and

nonfatal cases of hand, foot and mouth disease in mainland China from 2008 to 2014.

Reviews in Medical Virology. 25:115-128.

Lu Shan. (2014). EV-A71 vaccines: a milestone in the history of global vaccine

development. Emerging Microbes and Infections. 3:e27.

Lyu K, Wang GC, He YL, Han JF, Ye Q, Qin CF, Chen R. (2014). Crystal structures of

Enterovirus 71 (EV-A71) recombinant virus particles provide insights into vaccine

design. Journal of Biological Chemistry. 290:3198-3208.

Lyu K, He Y-L, Li H-Y, Chen R. (2015). Crystal structures of yeast-produced

enterovirus 71 and enterovirus 71/coxsackievirus A16 chimeric virus-like particles

provide structural basis for novel vaccine design against hand-foot-and-mouth disease.

Journal of Virology doi:10.1128/jvi.00422-15.

Ma JH, Yang FR, Yu H, Zhou YJ, Li GX, Huang M, Tong G. (2013). An M2e-based

synthetic peptide vaccine for influenza A virus confers heterosubtypic protection from

lethal virus challenge. Virology Journal. 10:227-232.

Mallilankaraman K, Shedlock DJ, Bao H, Kawalekar OU, Fagone P, et al. (2011) A

DNA Vaccine against Chikungunya Virus Is Protective in Mice and Induces

Neutralizing Antibodies in Mice and Nonhuman Primates. PLoS Neglected Tropical

Diseases 5:e928.

Mao Q, Li N, Yu X, Yao X, Li F, Lu F, et al. (2012). Antigenicity, animal protective

effect and genetic characteristics of candidate vaccine strains of enterovirus 71. Archives

in Virology. 157:37–41.

Mao Q, Dong C, Li X, Gao Q, Guo Z, Yao X, Wang J. (2012). Comparative analysis of

the immunogenicity and protective effects of inactivated EV-A71 vaccines in mice. PloS

One. 7:e46043.

Markine-Goriaynoff and Coutelier JP. (2002). Increased Efficacy of the

Immunoglobulin G2a Subclass in Antibody-Mediated Protection against Lactate

Dehydrogenase-Elevating Virus-Induced Polioencephalomyelitis revealed with Switch

Mutants. Journal of Virology. 76:1432-1435.

Mascola JR, Snyder SW, Weislow OS., et al. (1996). Immunization with envelope

subunit vaccine products elicits neutralizing antibodies against laboratory-adapted but

not primary isolates of human immunodeficiency virus type 1. Journal of Infectious

Diseases. 173:340–348.

McMinn PC. (2002). An overview of the evolution of enterovirus 71 and its clinical and

public health significance. FEMS Microbiology Reviews. 26:91-107.

131

Melnick JL, Brennan JC (1959). Monkey neurovirulence of attenuated poliovirus

vaccines being used in field trials. In: Live polio virus vaccines. Washington DC: Pan

American Health Organization. 65-101.

Melnick JL. (1984). Enterovirus type 71 infections: a varied clinical pattern sometimes

mimicking paralytic poliomyelitis. Review of Infectious Diseases. 6:387–389.

Melnick J.L. (1997) Poliovirus and other enteroviruses. In Evans AS and Kaslow RA

eds. Viral infections of humans: epidemiology and control. Plenum Publishing

Corporation, 4th edition: 583-663.

Meng T, Kwang J. (2014). Attenuation of human enterovirus 71 high-replication-fidelity

variants in AG129 mice. Journal of Virology. 88:5803–5815.

Mueller, S., Papamichail, D., Coleman, J. R., Skiena, S., & Wimmer, E. (2006).

Reduction of the Rate of Poliovirus Protein Synthesis through Large-Scale Codon

Deoptimization Causes Attenuation of Viral Virulence by Lowering Specific Infectivity.

Journal of Virology. 80:9687-9696.

Nakayama Y, Aruga A. (2015). Comparison of current regulatory status for gene-based

vaccines in the US, Europe and Japan. Vaccines. 3:186-202.

Nishimura Y, Lee H , Hafenstein S, Kataoka C, Wakita T, Bergelson JM, Shimizu H.

(2013). Enterovirus 71 binding to PSGL-1 on leukocytes: VP1-145 acts as a molecular

switch to control receptor interaction. PLoS Pathogens. 9:e1003511.

Nomoto A, Omata T, Toyoda H, et al. (1982). Complete nucleotide sequence of the

attenuated poliovirus Sabin 1 strain genome. Proceedings of the National Academy of

Sciences USA. 79:5793–5797.

Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T. (2010). Clinical features,

diagnosis, and management of enterovirus 71. Lancet Neurology. 9:1097-1105.

Paavonen J, Jenkins D, Bosch FX, et al. (2007). Efficacy of a prophylactic adjuvanted

bivalent L1 virus-like-particle vaccine against infection with human papillomavirus

types 16 and 18 in young women: an interim analysis of a phase III double-blind,

randomised controlled trial. Lancet. 369:2161-7210.

Pallansch MA, Roos R. Enteroviruses: polioviruses, coxsackieviruses, echoviruses and

newer enteroviruses. (2006). In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin

MA, Roizman B, Strauss SE editors. Fields Virology Fifth Edition. Philadelphia:

Lippincott Williams & Wilkins. 1:839-893.

132

Palmer P, Charley B, Rombaut B, Daëron M, Lebon P. (2000). Antibody-dependent

induction of type I interferons by poliovirus in human mononuclear blood cells requires

the type II fcgamma receptor (CD32). Virology. 278:86–94.

Paul AV, Mugavero J, Yin J, Hobson S, Schultz S, van Boom JH, et al. (2000). Studies

on the attenuation phenotype of polio vaccines: poliovirus RNA polymerase derived

from Sabin type 1 sequence is temperature sensitive in the uridylylation of VPg.

Virology. 272:72–84.

Philippe Le Mercier, SIB Swiss Institute of Bioinformatics, ViralZone. Available from

http://viralzone.expasy.org/all_by_species/33.html

Racaniello VR, Meriam C. (1986) Poliovirus temperature-sensitive mutant containing a

single nucleotide deletion in the 5'-noncoding region of the viral RNA. Virology.

155:498-507.

Reed LJ, Muench H. (1938). A simple method of estimating fifty per cent endpoints.

American Journal of Hygiene. 27:493–497.

Roldao A, Mellado MC, Castilho LR. (2010). Corrondo MJ, Alves PM. Virus-like

particles in vaccine development. Expert Review of Vaccines. 9:1149-1176.

Salk JE, Krech U, Younger JS, Bennett BL, Lewis LJ, Bazeley PL. (1954)

Formaldehyde treatment and safety testing of experimental poliomyelitis vaccines.

American Journal of Public Health and the Nation’s Health. 44:563-570.

Schmidt NJ, Lennette EH, Ho HH. (1974). An apparently new enterovirus isolated from

patients with disease of the central nervous system. Journal of Infectious Diseases.

129:304–309.

Siegrist, C. (2012). Vaccine immunology.United Kingdom:Elsevier. 2:17-36.

Singh S, Poh CL, Chow VT. (2002). Complete sequence analyses of enterovirus 71

strains from fatal and non-fatal cases of the hand, foot and mouth disease outbreak in

Singapore (2000). Microbiology and Immunology. 46:801-808.

Shen M, Reitman ZJ, Zhao Y, Moustafa I, Wang Q, Arnold JJ, et al. (2008).

Picornavirus genome replication. Identification of the surface of the poliovirus (PV) 3C

dimer that interacts with PV 3Dpol during VPg uridylylation and construction of a

structural model for the PV 3C2-3Dpol complex. Journal of Biological Chemistry.

283:875-888.

Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, Ooi MH. (2010).

Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infectious

Diseases. 10:778–790.

133

Small, J. C., & Ertl, H. C. (2011). Viruses - from pathogens to vaccine carriers. Current

Opinion in Virology. 1: 241-245.

Tan CW, Chan YF, Sim KM, Tan EL, Poh CL. (2012). Inhibition of enterovirus 71 (EV-

71) infections by a novel antiviral peptide derived from EV-71 capsid protein VP1. PloS

One. 7:e34589.

Tan S, Tan X, Sun X, Lu G, Chen CC, Yan J, Gao GF. (2013). VP2 dominated CD4+ T

cell responses against enterovirus 71 and cross-reactivity against coxsackievirus A16

and polioviruses in a healthy population. Journal of Immunology. 191:1637–1647.

Tee KK, Lam TT, ChanYF, Bible JM, Kamarulzaman A, Tong CYW, Pybus OG.

(2010). Evolutionary Genetics of Human Enterovirus 71 : Origin, Population Dynamics,

Natural Selection, and Seasonal Periodicity of the VP1 Gene. Journal of Virology

84:3339–3350.

The College of Physicians of Philadelphia. (2014). The Future of Immunization.

Retrieved November 11, 2014, from

http://www.historyofvaccines.org/content/articles/future-immunization.

Thoa Le PK, Chiang PS, Khanh TH, Luo ST, Dan TN, Wang YF, et al. (2013). Genetic

and antigenic characterization of enterovirus 71 in Ho Chi Minh city, Vietnam, 2011.

PLoS ONE. 8:e69895.

Thomassen YE, van’t Oever AG, van Oijen MG, Wijffels RH, van der Pol LA, et al.

(2013). Next Generation Inactivated Polio Vaccine Manufacturing to Support Post

Polio-Eradication Biosafety Goals. PLoS One. 8:e83374.

Toyoda H, Nicklin MJ, Murray MG, Anderson CW, Dunn JJ, Studier FW, Wimmer, E.

(1986). A second virus-encoded proteinase involved in proteolytic processing of

poliovirus polyprotein. Cell. 45:761-770.

Tseng FC, Huang HC, Chi CY, Lin TL, Liu CC et al. (2007). Epidemiological survey of

enterovirus infections occuring in Taiwan between 2000 and 2005: analysis of sentinel

physician surveillance data. Journal of Medical Virology. 79:1850-1860.

Tung WS, Bakar SA, Sekawi Z, Rosli R. (2007). DNA vaccine constructs against

enterovirus 71 elicit immune response in mice. Genetic Vaccines and Therapy. 19:6-18.

Van der Sanden S, Koopmans M, Uslu G, van der Avoort H. (2009). Epidemiology of

enterovirus 71 in the Netherlands, 1963 to 2008. Journal of Clinical Microbiology.

47:2826–2833.

Van Wezel AL (1967) Growth of cell-strains and primary cells on microcarriers in

homogeneous culture. Nature. 216:64-65.

134

Visciano ML, Tagliamonte M, Tornesello ML, Buonaguro FM, Buonaguro L. (2012).

Effects of adjuvants on IgG subclasses elicited by virus-like particles. Journal of

Translational Medicine. 10:4-11.

Westrop GD, Wareham KA, Evans DM, Dunn G, Minor PD, Magrath DI, et al. (1989).

Genetic basis of attenuation of the Sabin type 3 oral poliovirus vaccine. Journal of

Virology. 63:1338–1344.

WHO (2002) Recommendations for the production and control of poliomyelitis vaccine

(Inactivated). Technical Report Series No. 910 World Health Organization.

WHO (2004) Guidelines for the safe production and quality control of inactivated

poliomyelitis vaccine manufactured from wild polioviruses Addendum, 2003, to the

Recommendations for the Production and Quality Control of Poliomyelitis Vaccine

(Inactivated). Technical Report Series No.926 World Health Organization.

WHO (2009) WHO global action plan to minimize poliovirus facility associated risk

after eradication of wild polioviruses and cessation of routine OPV use (Draft 2009).

Available: www.polioeradication.org.

WHO (2011) Sabin-IPV Development in IMB, CAMS, China. Available:

http://www.who.int/immunization_standards/vaccine_quality/11_liq_sabin_ipv_devt.pdf

WHO. WPRO Hand, foot and mouth disease situation Update, 29 Jan 2014 [cited 29 Jan

2014]. http://www.wpro.who.int/emerging_diseases/HFMD/en/index.html

Wille-Reece U, Wu CY, Flynn BJ, Kedl RM, Seder RA. (2005). Immunization with

HIV-1 Gag protein conjugated to a TLR7/8 agonist results in the generation of HIV-1

Gag-specific Th1 and CD8+ T cell responses. Journal of Immunology. 174:7676-7683.

Wu CN, Lin YC, Fann C, Liao NS, Shih SR, HM. (2001). Protection against lethal

enterovirus 71 infection in newborn mice by passive immunization with subunit VP1

vaccines and inactivated virus. Vaccine. 20:895–904.

Xing W, Liao Q, Viboud C et al. (2014). Hand, foot and mouth disease in China, 2008-

12: an epidemiological study. Lancet Infectious Disease. 14:308-318.

Xu L, He D, Li Z, et al. (2014). Protection against lethal enterovirus 71 challenge in

mice by a recombinant vaccine candidate containing a broadly cross-neutralizing epitope

within the VP2 EF loop. Theranostics. 4:498–513.

Xu M, Su L, Cao L, Zhong H, Dong N, Xu J. (2013). Enterovirus genotypes causing

hand, foot and mouth disease in Shanghai, China: a molecular epidemiological analysis.

BMC Infectious Diseases. 13:489-497.

135

Yan XF, Gao S, Xia JF, Ye R, Yu H, et al. (2012) Epidemic characteristics of hand, foot,

and mouth disease in Shanghai from 2009 to 2010: Enterovirus 71 subgenotype C4 as

the primary causative agent and a high incidence of mixed infections with

coxsackievirus A16. Scandinavian Journal of Infectious Diseases. 44:297–305.

Yeh MT, Wang SW, Yu CK, Lin KH, Lei HY, Su IJ, W. J. (2011). A single nucleotide

in stem loop II of 5’-untranslated region contributes to virulence of enterovirus 71 in

mice. PLoS One. 6:e27082.

Yin QT, personal communication, 2014.

Yip CCY Lau SKP, Zhou B, Zhang MX, Tsoi HW, Chan KH, Yuen KY. (2010).

Emergence of enterovirus 71 “double-recombinant” strains belonging to a novel

genotype D originating from southern China: first evidence for combination of intratypic

and intertypic recombination events in EV-A71. Archives of Virology. 155:1413–1424.

Yip CCY, Lau SKY, Woo PCY, Yuen KY. (2013). Human enterovirus 71 epidemics:

what’s next? Emerging Health Threats Journal. 6:10.3402.

Yoke-Fun, C., and Abu Bakar, S. (2006). Phylogenetic evidence for inter-typic

recombination in the emergence of human enterovirus 71 subgenotypes. BMC

Microbiology. 6: 74-84.

Zhang Y, Tan XJ, Wang HY, Yan DM, Zhu SL, Wang DY, et al. (2009). An outbreak of

hand, foot, and mouth disease associated with sub-genotype c4 of human enterovirus 71

in Shandong, China. Journal of Clinical Virology. 44:262–267.

Zhang YC, Li XW, Zhu XD et al. (2010). Clinical characteristics and treatment of sever

encephalitis associated with neurogenic pulmonary edema caused by enterovirus 71in

China. World Journal of Emergency Medicine. 1:108-113.

Zhang Y, Zhu Z, Yang W, Ren J, Tan X, Wang Y, et al. (2010). An emerging

recombinant human enterovirus 71 responsible for the 2008 outbreak of hand foot and

mouth disease in Fuyang city of China. Virology Journal. 7:94-102.

Zhang H, An D, Liu W, Mao Q, Jin J, Xu L, Jiang C. (2014). Analysis of cross-reactive

neutralizing antibodies in human HFMD serum with an EV-A71 pseudovirus-based

assay. PloS One. 9:e100545.

Zhang C, Ku Z, Liu Q, Wang X, Chen T, Ye X, Li D, Jin X, Huang Z. (2015). High-

yield production of recombinant virus-like particles of enterovirus 71 in Pichia pastoris

and their protective efficacy against oral viral challenge in mice. Vaccine. 33:2335-2341.

136

Zhu F, Meng FY, Li JX, Li XL, Mao QY, Tao H, et al. (2013). Efficacy, safety, and

immunology of an inactivated alum-adjuvant enterovirus 71 vaccine in children in

China: a multicentre, randomised, double-blind, placebo-controlled, phase III trial.

Lancet. 38: 2024-2032.

Zhu F, Xu W, Xia J, Liang Z, Liu Y, Zhang X, Wang N. (2014). Efficacy, safety, and

immunogenicity of an enterovirus 71 vaccine in China. New England Journal of

Medicine. 370:818–828.

137

APPENDICES

Appendix I Reagents for growth media

DMEM growth medium

2X DMEM 500 ml

FBS 100 ml

Penicillin/streptomycin 10 ml

NEAA 10 ml

L-glutamine 10 ml

MiliQ H2O 370 ml

The media was stored at 4°C until use.

DMEM maintenance medium

2X DMEM 500 ml

FBS 20 ml

Penicillin/streptomycin 10 ml

NEAA 10 ml

L-glutamine 10 ml

MiliQ H2O 450 ml

The media was stored at 4°C until use.

Plaque medium (1.2% w/v carboxymethylcellulose)

2X DMEM 500 ml

FBS 20 ml

Penicillin/streptomycin 10 ml

NEAA 10 ml

L-glutamine 10 ml

MiliQ H2O 450 ml

138

Carboxymethylcellulose 12 g

The media was stored at 4°C until use.

MEM Freezing Media

1x MEM 89.5 ml

1x Penicillin/Streptomycin 1.0 ml

Fetal Calf Serum (FCS) 5.0 ml

1.0 M HEPES Buffer 2.0 ml

7% Sodium Bicarbonate 1.5 ml

Dimethyl sulphoxide (DMSO) 1.0 ml

The media was prepared fresh before carrying out the procedure for cell freezing.

DMSO was protected from light and stored at room temperature.

Media for Bacterial Culture

LB (Luria-Bertani) Medium, per liter (Miller, 1972)

NaCl 10 g

Trytone 10 g

Yeast extract 5 g

139

Appendix II Sequencing Results

Mutant A158T

Mutant C475T

140

Mutant A486G

141

Mutant G487A

142

Mutant A5262G

143

5’-NTR Partial Deletant Mutant (475-485)

144

Appendix III Real Time RT-PCR

Standard Curve for Interpolation of Unknown RNA Copy Number

Standards: RNA of different concentrations from 10-1 to 10-6 uM.

Calculations of viral RNA copy number were based on interpolation of the standard

curve.

Log Concentration

Cycle

No

145

Appendix IV Materials for SDS-PAGE

6x SDS Gel Loading Dye

Tris-HCl 0.35 M

SDS 10.28 %

Glycerol 36.0 %

Dithiothreitol (DTT) 0.6 M

Bromophenol Blue 0.012 %

The pH was adjusted to 6.8 and stored at -20oC until used.

SDS Running Buffer

Tris-BASE 25 mM

Glycine 192 mM

SDS 0.1 %

The pH was adjusted to 8.3 and the volume was prepared up to 10 L with distilled water.

SDS Staining Solution

Ethanol 40 %

Acetic acid 10 %

Coomassie Brilliant Blue 0.1 %

Distilled water 50 %

The mixture was stored at 4oC until used.

SDS Destaining Solution

Ethanol 40 %

Acetic acid 10 %

Distilled water 50 %

The mixture was stored at 4oC until used.

146

Appendix V Materials for Western Blot

Western Transfer Buffer

Tris-HCL 3.03 g

Glycine 1.44 g

Methanol 200 ml

The volume was prepared up to 1 L with distilled water and stored at 4oC until used.

Western Blocking Buffer

Tris-HCL 20 mM

NaCl 150 mM

Tween 20 0.05 %

Bovine Serum Albumin 1 %

Western Washing Buffer

Tris-HCL 20 mM

NaCl 150 mM

Tween 20 0.05 %

147

APPENDIX VI TCID50 Assay

Determination of infective dose (TCID50)

TCID50 was calculated using the Reed and Muench formula.

1. The cumulative number of infected wells was obtained by adding all the wells which

showed CPE at every dilution. (E.g. at dilution 10-5, 2 wells showed CPE. At dilution 10-

4, 3 wells showed CPE. Hence, the total number of wells which showed CPE up to

dilution factor 10-4 was 2 + 3 = 5)

2. The cumulative number of wells which were not infected with the virus was obtained

by subtracting the number of wells which showed CPE from the number of wells

inoculated. (E.g. at dilution 10-4, 1 well did not show CPE. At dilution 10-5, 2 wells did

not show CPE. Hence, the total number of wells which did not show CPE up to the

dilution factor 10-5 was 1 + 2 = 3).

3. The percentage of infectivity was calculated by dividing the total sum of the wells

which showed CPE and those did not show CPE by the cumulative number of wells

which showed CPE. (E.g. at dilution 10-4, 5/5+1 = 0.83 = 83%).

4. TCID50 end point calculation: The negative logarithm of the dilution factor which was

the closest to 50% was -4. Hence, the TCID50 end point = -4.0 + (0.7) = -4.7. Therefore,

the log of TCID50 end point or titer = 10 X 104.7 =

5. TCID50 = (% wells infected at dilution next above 50%) – (50%)

(% wells infected at dilution next above 50%) – (% wells infected at dilution next below 50%)

Whereby h = dilution factor

Dilution of original suspension that is equal to the TCID50 = 10 (log dilution next above 50%) – (I x

log h)

Since the wells were inoculated with 100uL virus suspension, 1mL of the virus

suspension will contain ten times the reciprocal of the calculated dilution above.

148

PUBLICATIONS

Review Articles

Yee PTI and Poh CL. (2016). The Final Stage of Developing Genetically Modified

Inactivated Sabin vaccine for the Eradication of Poliovirus. Austin J Microbiol. 1:1009-

1013.

Yee, PTI, Poh, C.L. (2016). Development of Novel Vaccines against Enterovirus-71.

Viruses. 8:1-13.

Book Chapters

Isabel Yee PT, Chit Laa Poh (2015). Attenuation of Virulence as antimicrobial strategy.

In A. Méndez-Vilas (Ed.), The Battle against Microbial Pathogens: Basic Science,

Technological Advances and Educational Programs (pp 886-894). Spain: Formatex

Research Center.

Conferences

Isabel Yee PT, Kuan Onn Tan, Chit Laa Poh. Rational design of live attenuated vaccine

by site-directed mutagenesis and deletion in the 5’- non coding region of the Enterovirus

71 (EV-A71) genome. Presented in European Academy of Allergy and Clinical

Immunology Congress. 6th-10th June 2015.

Chit Laa Poh, Isabel Yee PT. Enterovirus 71: Candidates for vaccines and antivirals.

World Congress and Expo on Microbiology, Frankfurt, Germany. 18-20th August, 2015.

Abstract also appears in Journal of Microbial & Biochemical Technology. 7(4). ISSN:

1948-5948.