lable at ScienceDirect

Anaerobe 43 (2017) 39e42

Contents lists avai

Anaerobe

journal homepage: www.elsevier .com/locate/anaerobe

Anaerobes in human infections (dental/oral infections)

Rapid identification of Robinsoniella peoriensis using specific 16S rRNAgene PCR primers*

Terence R. Whitehead a, *, Christelle Anoma b, Richard W. McLaughlin b

a Bioenergy Research Unit, National Center for Agricultural Research, USDA, Agricultural Research Service, 1815 N. University Street, Peoria, IL, 61604, USAb General Studies, Gateway Technical College, Kenosha, WI, 53144, USA

a r t i c l e i n f o

Article history:Received 19 August 2016Received in revised form21 November 2016Accepted 23 November 2016Available online 24 November 2016

Handling Editor: Elisabeth Nagy

Keywords:RobinsoniellaPCRAssayPeoriensis16S rRNAGastrointestinal

* Names are necessary to report factually on availaneither guarantees nor warrants the standard of thename by USDA implies no approval of the product tomay also be suitable.* Corresponding author. USDA/ARS/NCAUR/BER, 181

IL, 61604, USA.E-mail address: Terry.Whitehead@ars.usda.gov (T.R

http://dx.doi.org/10.1016/j.anaerobe.2016.11.0081075-9964/Published by Elsevier Ltd.

a b s t r a c t

Robinsoniella peoriensis is a Gram-positive, spore-forming anaerobic bacterium initially isolated andcharacterized from swine manure and feces. Since then strains of this species have been identified from avariety of mammalian and other GI tracts. More recently strains of this species have been isolated from aplethora of human infections. Therefore, it is of great interest to develop methods to rapidly identify thismicroorganism in the medical and other laboratories. This report describes the use of PCR primerstargeting the 16S rRNA gene of R. peoriensis to identify strains of this bacterium.

Published by Elsevier Ltd.

1. Introduction

Antimicrobial compounds have been commonly used as feedadditives for domestic animals to reduce infection and promotegrowth. It has been estimated that the swine industry alone in theUnited States uses over 83,000 kg of tetracycline and 25,000 kg oftylosin as growth promotants annually [1]. Recent concerns havesuggested such feeding practices may result in increased microbialresistance to antibiotics, which can have an impact on humanhealth [2]. Our laboratory has been studying the predominantcommensal anaerobic bacteria present in both swine feces andmanure storage pits in relation to odor production and antibioticresistance. As a result of these and other studies it had beendetermined that the major microbial populations of both ecosys-tems are composed of low mol %G þ C, Gram-positive anaerobic

ble data; however, the USDAproduct, and the use of thethe exclusion of others that

5 N. University Street, Peoria,

. Whitehead).

bacteria, including representatives of Clostridium, Lactobacillus, andEnterococcus genera [3e7]. Robinsoniella peoriensiswas isolated andcharacterized in our laboratories from swine manure and feces [8].Since then strains of this species have been identified from a varietyof mammalian and other GI tracts [9e16], suggesting it is a pre-dominantmember of the commensal microflora. More importantly,R. peoriensis has also been reported to be isolated from a number ofhuman infections [17e23] and may prove to be the causative agentfor other health risks. Because R. peoriensis is an anaerobic Gram-positive, spore-forming rod [8], it may be difficult to readily iden-tify this bacterium upon isolation and can be confused with othersimilar bacteria species. Therefore, it is of interest to be able torapidly identify this microorganism when presented in to themedical or environmental laboratories from human or other envi-ronmental samples. We now report on the development of the PCRprimers for use to identify R. peoriensis strains.

2. Materials and methods

2.1. Bacterial strains and media

Fifteen strains of R. peoriensis were obtained for this study fromour laboratories and throughout the United States and Europe. The

Table 1List of Robinsoniella peoriensis strains used in this study.

Strain Country Source Referencea

PPC31T USA Swine Manure [8]PPC37 USA Swine Manure [8]PC44 USA Swine Feces [8]PPC47 USA Swine Manure [8]PPC50 USA Swine Manure [8]PPC108 USA Swine Manure [8]FTC8 USA Swine Feces This StudyFTC10 USA Swine Feces This StudyCCUG 52336 Sweden Human Wound [8]CCUG 65238 Sweden Human Blood e

Mayo 1 USA Human Infection [14]WTD USA Turtle Feces [9]SWP02 Germany Mouse GI e

118 France Human Neonate [10]KNHs208 USA Forest Soil e

KNHs210 USA Forest Soil e

a Where available.

T.R. Whitehead et al. / Anaerobe 43 (2017) 39e4240

source ecosystems varied from swine feces and manure to turtlefecal material, mouse GI tract, forest soil and several human in-fections (see Table 1). Interestingly, the strains shared a number ofresistances to antibiotics but varied in their resistance to tetracy-cline, erythromycin, and tylosin [24]. All strains were grown inBrain-Heart Infusion (BHI) medium (Becton, Dickinson and Co.,Sparks, MD), prepared anaerobically using the method of Hungateas modified by Bryant [25], at 37 �C. Four of the closest bacterialrelatives to R. peoriensis (see Fig. 1 (from reference [8]), 26) werealso used as negative controls, although a BLAST search demon-strates that the closest species demonstrate only 93% or less 16SrRNA gene sequence similarity. Murimonas intestini DSM26524 T

Fig. 1. Unrooted 16S rRNA gene sequence tree showing the phylogenetic relationships of sconstructed using the neighbour-joining method, was based on a comparison of approx. 132only values > 90% are shown. Bar, 1% sequence divergence. Figure from reference [8].

[26], Blautia hansenii DSM20583T [27], B. coccoides DSM935T [27]and Clostridium xylanolyticum DSM6555T [28] were obtained fromthe Deutsche Sammlung von Mikroorganismen und ZellkulturenGmbH Culture Collection (Braunschweig, Germany) and the strainswere grown on anaerobic BHI as described above.

2.2. DNA extraction and 16S rRNA gene PCR analyses

For analyses of bacterial pure cultures, an aliquot of an overnightculture grown on BHI mediumwas removed and genomic DNAwasisolated using the UltraClean Microbial DNA Isolation Kit (Mo Bio,Solana Beach, CA) according tomanufacturer's instructions. The 16SrRNA sequence for the type strain of R. peoriensis, PPC31T, was usedfor determining PCR primers (GenBank accession numberAF445285). Perspective primers sets were located using thePrimer-Blast program on the NCBI website (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Two primer sets (RP16S1andRP16S2) were initially tested against genomic DNA (gDNA) from thevarious strains. Each PCR reaction contained 2.5U AmpliTaq 360DNA Polymerase (Life Technologies, Grand Island, NY), 1X 360Buffer, 1 ml genomic DNA and primers in 50 ml final volume.Annealing temperature and MgCl2 concentration were varied foroptimal performance. Based on preliminary PCR results (data notshown) the primer set RP16S1 was chosen for the assay (seeTable 2). PCR parameters used were an annealing temperature of64 �C and a MgCl2 concentration of 1 mM. Final conditions for thePCR assay were: 94 �C for 5 min, followed by 25 cycles of 94 �C for45 s, 63 �C for 30 s, 72 �C for 2 min, and a final extension step of72 �C for 10 min. An aliquot of each reaction was analyzed usingagarose egel electrophoresis to identify the PCR product. Twoadditional testing of the primer sets was carried out using wholecells of the strain. In the first test, a small colony from strains

train PPC31T and some other organisms within the family Lachnospiraceae. The tree,0 nt. Bootstrap percentages (based on 1000 replications) are given at branching points;

Table 2Sequences of PCR primers used in this study.

Name Sequence (5'-3') Position of primera Size of Product (bp)

RP16S1-FW GTCTCTCCAGAGTGCCCAAC 385e404RP16S1-RV AGGTAACGGCTTACCAAGGC 1260e1241 876

a From R. peoriensis PPC31T 16S rRNA gene sequence (GenBank accession number AF445285.2).

Fig. 3. Agarose gel electrophoresis of PCR products from genomic DNA isolated fromrepresentative bacterial strains (see Table 1.) using the primer set RP16S1. Lanes: 1,MW markers; 2, PCC31T; 3, WTD; 4, CCUG 52336; 5, 118; 6, C. xylanolyticum DSM655T;7, B. coccoides DSM935T; 8, B. hansenii DSM20583.

T.R. Whitehead et al. / Anaerobe 43 (2017) 39e42 41

streaked out on BHI-agar plates was picked using a sterile toothpickand suspended in 100 ml of sterile distilled water. In the second test,100 ml of an overnight culture was transferred to an Eppendorf tubeand centrifuged at 14,000 � g at RT for 1 min. The cell pellet wasthen suspended in 100 ml of sterile distilled water. Both sampleswere then placed in boiling water for 10 min, followed by centri-fugation at 14,000 � g for 1 min. 1 ml of each sample was used forPCR analysis as described above.

3. Results and discussion

Genomic DNA isolated from the bacterial strains was subjectedto PCR with the 16S rDNA primer set RP16S1 as describe above.Results from representative strains are shown in Fig. 1. All of theR. peoriensis strains tested demonstrated the predicted PCR prod-ucts, including those shown in Fig. 1. Genomic DNA isolated fromstrains phylogenically close to R. peoriensis (M. intestine, C. xyla-nolyticum, B. coccoides, B. hansenii) were found to be negative withthe PCR test, including those shown in Fig. 1., indicating the assaywas specific for R. peoriensis. Alignment of the DNA sequences ofthe primers with 16S rRNA gene target sequences from the nega-tive strains tested and other close relatives are shown in Fig. 2.While primer RP16S1-FW had 0-3 base differences with the targetDNA sequences, primer RP16S1-RV demonstrated 3e4 base dif-ferences with all strains examined. Such sequence differencessupport the negative results seen with the PCR test with strainsother than R. peoriensis confirms the specificity of the assay. Thespecificity of primer RP16S1-RV may also prove useful forquantitative-PCR to determine the relative numbers of R. peoriensiscells (see Figs. 3,4).

In order to mimic what might be found in a testing laboratory,whole cells from either an overnight culture or a colony from a BHI-agar plate were used for the PCR assay. As shown in Fig. 2, bothpreps were positive when using the PCR assay. These resultsconfirm the rapid ability of the PCR assay to identify R. peoriensis

Fig. 2. Alignment of R. peoriensis 16S rRNA PCR primer sequences with target DNAsequences from closely related species. Mismatches are indicated by grey boxes.

Fig. 4. Agarose gel electrophoresis of PCR products from R. peoriensis PPC31T using PCRprimer set RP16S1. Lanes: 1, genomic DNA; 2, boiled cells prepared from colonies onagar plates; 3, boiled cells from overnight pure cultures as described in Materials andMethods.

strains.Based on these results, it is clear that the use of specific PCR

primers to the 16S rDNA gene of R. peoriensis can rapidly andaccurately identify the strain when recovered from human in-fections as well as other ecological sources. Such an assay shouldprove useful in a variety of laboratory settings.

T.R. Whitehead et al. / Anaerobe 43 (2017) 39e4242

Funding

This research did not receive any specific grant from fundingagencies in the public, commercial, or not-for-profit sectors.

References

[1] M.D. Apley, E.J. Bush, R.B. Morrison, R.S. Singer, H. Snelson, Use estimates ofin-feed antimicrobials in swine production in the United States, FoodbornePath. Dis 9 (2012) 1e8.

[2] B.M. Marshall, S.B. Levy, Food animals and antimicrobials : impacts on humanhealth, Clin. Microbiol. Rev. 24 (2011) 718e733.

[3] M.A. Cotta, T.R. Whitehead, R.L. Zeltwanger, Isolation, characterization andcomparison of bacteria from swine faeces and manure storage pits, Environ.Microbiol. 5 (2003) 737e745.

[4] T.R. Whitehead, M.A. Cotta, Stored swine manure and swine feces as reser-voirs of antibiotic resistance genes, Lett. Appl. Microbiol. 56 (2012) 264e267.

[5] T.R. Whitehead, M.A. Cotta, Examination of the aerobic microflora of swinefeces and stored swine manure, J. Environ. Qual. 45 (2016) 604e608.

[6] T.D. Leser, J.Z. Amenuvor, T.K. Jensen, R.H. Lindecrona, M. Boye, K. Moller,Culture-independent analysis of gut bacteria: the pig gastrointestinal tractmicrobiota revisited, Appl. Environ. Microbiol. 68 (2002) 673e690.

[7] R. Snell-Castro, J.J. Godon, J.P. Delgenes, P. Dabert, Characterisation of themicrobial diversity in a pig manure storage pit using small subunit rDNAsequence analysis, FEMS Microbiol. Ecol. 52 (2005) 229e242.

[8] M.A. Cotta, T.R. Whitehead, E. Falsen, E. Moore, P.A. Lawson, Robinsoniellapeoriensis gen. nov., sp. nov., isolated from a swine manure storage pit and ahuman clinical source, Int. J. Syst. Evol. Microbiol. 59 (2009) 150e155.

[9] J.L. Braasch, C.N. Lapin, S.E. Dowd, R.W. McLaughlin, Draft genome sequence ofRobinsoniella peoriensis strain WTD, isolated from the fecal material of a woodturtle, Genome Ann. 3 (2015) 1, 1.

[10] L. Ferraris, M.J. Butel, F. Campeotto, M. Vodovar, J.C. Roze, J. Aires, Clostridia inpremature neonates' gut: incidence, antibiotic susceptibility, and perinataldeterminants influencing colonization, PLoS One 7 (2012) 1e7.

[11] R.W. McLaughlin, J. Zheng, R. Ruan, C.-Q. Wang, Q.-Z. Zhao, D. Wang, Isolationof Robinsoniella peoriensis from the fecal material of the endangered Yangtzefinless porpoise, Neophocaena asiaeorientalis, Anaerobe 20 (2013) 79e81.

[12] L. Weldon, S. Abolins, L. Lenzi, C. Bourne, E.M. Riley, M. Viney, The gutmicrobiota of wild mice, Plos One (2015), http://dx.doi.org/10.1371/journal.-pone.o134643. Published online.

[13] Q. Niu, P. Li, S. Hao, Y. Zhang, S.W. Kim, H. Li, X. Ma, S. Gao, L. He, W.J. Wu,X. Huang, J. Hua, B. Zhou, Dynamic distribution of the gut microbiota and therelationship with apparent crude fiber digestibility and growth stages in pigs,Sci. Rep. 5 (2015), http://dx.doi.org/10.1038/srep09938. Article Number 9938.

[14] E. Hernandez-Sanabria, L.A. Goonewardene, Z. Wang, O.N. Durunna,S.S. Moore, L.L. Guan, Impact of feed efficiency and diet on adaptive variations

in the bacterial community in the rumen fluid of cattle, Appl. Environ.Microbiol. 78 (2012) 1203e1214.

[15] J.B. Holm, A. Ronnevik, S.H. Tstesen, E. Fjaere, K.R. Fauske, U. Liisberg,L. Madsen, K. Kristiansen, B. Liaset, Diet-induced obesity, energy metabolismand gut microbiota in C57BL/6J mice fed Western diets based on lean seafoodor lean meat mixtures, J. Nutr. Biochem. 31 (2016) 127e136.

[16] S. Wohlgemuth, S. Keller, R. Kertscher, M. Stadion, D. Haller, S. Kisling,G. Jahreis, M. Blaut, G. Loh, Intestinal steroid profiles and microbiotacomposition in colitic mice, Gut Microbes 2 (2011) 159e166.

[17] H. Reiber, A. Frontzek, A. Bell, L. Frommelt, Robinsoniella peoriensis, originallyisolated from swine manure, and early periprosthetic hip infection: casereport and review of the literature, Anaerobe 42 (2016) 33e36.

[18] D. Shen, R. Chen, L. Ye, Y. Luo, Y.-W. Tang, Robinsoniella peoriensis bacteremiain a patient with pancreatic cancer, J. Clin. Microbiol. 48 (2010) 3448e3450.

[19] E. Gomez, D.R. Gustafson, R. Colgrave, T. Ly, R. Santana, J.E. Rosenblatt, R. Patel,Isolation of Robinsoniella peoriensis from four human specimens, J. Clin.Microbiol. 49 (2011) 458e460.

[20] M. Illiaquer, S. Corvic, Anaerobes isolated from bone and joint infections andtheir susceptibility to antibiotics, J. Infect. 65 (2012) 473e475.

[21] Y. Jeon, T.S. Kim, H.B. Kim, K.U. Park, J. Song, E.C. Kim, First Korean case ofRobinsoniella peoriensis bacteremia in a patient with aspiration pneumonia,Ann. Lab. Med. 32 (2012) 370e374.

[22] P. Lopez, S. Belda, M. Garcia, G. Royo, Infection of a spontaneous muscularhematoma due to Robinsoniella peoriensis, in a patient with alcoholic livercirrhosis, Enferm. Infecc. Microbiol. Clin. 28 (2010) 565e567.

[23] N. Cassir, L. Laget, A. Renvoise, J.-M. Gennari, M. Drancourt, Robinsoniellapeoriensis infection following surgery for scoliosis: a case report, J. Med. CaseRep. 6 (2012) 174e177.

[24] T.R. Whitehead, Robinsoniella Peorieneis: A Model Anaerobic CommensalBacterium for Acquisition of Antibiotic Resistance? Abstr 200, Abstr AmericanSociety for Microbiology Microbe 2016, Boston, MA, 2016, p. 1113.

[25] M.P. Bryant, Commentary on the Hungate technique for culture of anaerobicbacteria, Am. J. Clin. Nutr. 25 (1972) 1324e1328.

[26] K. Klaring, S. Just, I. Lagkouvardos, L. Hanske, D. Haller, M. Blaut, M. Wenning,T. Clavel, Murimonas intestine gen. nov., sp. nov., an acetate-producing bac-terium of the family Lachnospiraceae isolated from the mouse gut, Int. J. Syst.Evol. Microbiol. 65 (2015) 870e878.

[27] C. Liu, S.M. Finegold, Y. Song, P.A. Lawson, Reclassification of Clostridiumcoccoides, Ruminococcus hansenii, Ruminococcus hydrogentrophicus, Rumino-coccus luti, Ruminococcus productus and Ruminococcus schinkii as Blautia coc-coides gen. nov., comb. nov., Blautia hansenii comb. nov., Blautiahydrogenotorphica comb. nov., Blauia luti comb. nov., Blautia producta comb.nov., Blautia schinkii comb. nov., and description of Blautia wexlerae sp. nov.,isolated from human faeces, Int. J. Syst. Evol. Microbiol. 58 (2008) 1896e1902.

[28] G.M. Rogers, A.A.W. Baecker, Clostridium xylanolyticum sp. nov., an anaerobicxylanolytic bacterium from decayed Pinus patula wood chips, Int. J. Syst.Bacteriol. 41 (1991) 140e143.