Detailed below  is  a  full  listing of  all  errors  that have been  identified  in  the Manton  et  al.  (2010) manuscript  published  in  the  journal  Stem  Cells  and  Development.    These  errors were  identified during the QUT investigation into allegations of research misconduct initiated following a complaint from Mr. Luke Cormack lodged in April 2012.     Original Manton et al., 2010 ‐ Figure 1: 

   Original wording of Figure 1 legend: FIG.  1. Human  embryonic  stem  (hES)  cells  cultured  in  feeder‐cell‐free  and  serum‐free  conditions retain  expression  of  pluripotent  cell  surface  and  intracellular markers.  hES  cells  that  had  been propagated for at least 30 passages were fixed and probed for cell surface and intracellular markers using  immunofluorescence. ( A ) Morphology only, ( B ) DAPI, ( C ) SSEA‐4, ( D ) Oct‐4, ( E ) SSEA‐1, and ( F ) TRA‐1–60 (all photos at magnification 200×).   Explanation of error in Figure 1: The passage numbers reported in Figure 1 are incorrect.  The current wording in the Figure 1 legend should be changed from, “at least 30 passages” to “14 passages”.  Moreover, the morphology image in Figure 1A  is  incorrect.  It  is from p=6 hES cells. We provide a replacement Figure 1A morphology image, that is from p=14 hES cells.  

  

Released by QUT under Right to Information Act

Suggested change to the Figure 1 legend: FIG.  1. Human  embryonic  stem  (hES)  cells  cultured  in  feeder‐cell‐free  and  serum‐free  conditions retain  expression  of  pluripotent  cell  surface  and  intracellular markers.  hES  cells  that  had  been propagated  for  at  least  30  14  passages were  fixed  and  probed  for  cell  surface  and  intracellular markers using immunofluorescence. ( A ) Morphology only, ( B ) DAPI, ( C ) SSEA‐4, ( D ) Oct‐4, ( E ) SSEA‐1, and ( F ) TRA‐1–60 (all photos at magnification 200×).   Original Manton et al., 2010 ‐ Figure 2:  

  Original wording of Figure 2 legend: FIG.  2. Human  embryonic  stem  (hES)  cells  cultured  in  feeder‐cell‐free  and  serum‐free  conditions retain  expression  of  pluripotent  cell  surface  and  intracellular markers.  hES  cells  that  had  been propagated for at least 30 passages in serum‐free and feeder‐cell‐free conditions were analyzed for expression of  cell  surface  (SSEA‐4,  SSEA‐1,  and  TRA‐1–80)  and  intracellular  (Oct‐4) markers using fluorescence‐activated  cell  sorter  (FACS).  Unstained  cells  are  also  shown.  The  graph  shows  the percentage  of  cells  that  were  positive  for  undifferentiated  (Oct‐4,  SSEA‐4,  TRA‐1–80)  and differentiated (SSEA‐1) hES markers.  

Released by QUT under Right to Information Act

Explanation of error in Figure 2 legend: The passage numbers reported in Figure 2 are incorrect. The legend for Figure 2 states that the cells were ‘at least 30 passages’.  We have now established that the Oct4 data in Figure 2 was from FACS analysis  conducted  on  hES  cells  that were  p=27.    The  FACS  data  for  the  other  hES markers was conducted on p=37 hES  cells.      Therefore,  the  current wording  in  the  Figure 2  legend  should be changed from, “at least 30 passages” to “at least 27 passages”.     Suggested change to the Figure 2 legend: FIG.  2. Human  embryonic  stem  (hES)  cells  cultured  in  feeder‐cell‐free  and  serum‐free  conditions retain  expression  of  pluripotent  cell  surface  and  intracellular markers.  hES  cells  that  had  been propagated for at least 30 27 passages  in serum‐free and feeder‐cell‐free conditions were analyzed for expression of cell surface (SSEA‐4, SSEA‐1, and TRA‐1–80) and intracellular (Oct‐4) markers using fluorescence‐activated  cell  sorter  (FACS).  Unstained  cells  are  also  shown.  The  graph  shows  the percentage  of  cells  that  were  positive  for  undifferentiated  (Oct‐4,  SSEA‐4,  TRA‐1–80)  and differentiated (SSEA‐1) hES markers.    Original Manton et al., 2010 ‐ Figure 5:  

  Original wording of Figure 5 legend: FIG.  5. Human  embryonic  stem  (hES)  cells  cultured  for up  to  30  passages  in  feeder‐cell‐free  and serum‐free conditions retain the ability to differentiate down the germ  lineages. Differentiated hES cells were probed for markers of ectoderm (nestin) and mesoderm (smooth muscle actin, troponin) using  immunofl  uorescence  (top  row).  Real‐time  polymerase  chain  reaction  (PCR)  was  used  to determine  fold  increase  in  expression  of  markers  of  the  3  germ  lineages  as  compared  with undifferentiated hES (bottom table); p = passage number.   Explanation of error in Figure 5: In  reviewing  the manuscript we have  identified  a mistake  in  the  figure  5  table  and  legend.    The legend for figure 5 states that the cells were cultured for up to 30 passages.  However, in the table displaying the real‐time PCR data, the passage numbers indicates the hES cells were p=20 and p=25.  In addition, we have now identified that the p25 hES cells were in fact p22 hES cells.  Therefore, the current wording in the Figure 5 legend should be changed from “cultured for up to 30 passages” to 

Released by QUT under Right to Information Act

“cultured for 20 or 22 passages”.  In addition, the title of the right hand column in the table should be changed  from “P = 25” to “P = 22”. We provide a replacement Figure 5 table that contains this correction.  

   Suggested change to the Figure 5 legend: FIG. 5. Human embryonic stem (hES) cells cultured for up to 30 20 or 22 passages in feeder‐cell‐free and serum‐free conditions retain the ability to differentiate down the germ lineages. Differentiated hES  cells  were  probed  for markers  of  ectoderm  (nestin)  and mesoderm  (smooth muscle  actin, troponin) using immunofluorescence (top row). Real‐time polymerase chain reaction (PCR) was used to  determine  fold  increase  in  expression  of markers  of  the  3  germ  lineages  as  compared  with undifferentiated hES (bottom table); p = passage number.   Original Manton et al., 2010 manuscript: As a result of  the changes to the passage numbers  identified  in  the  figure 1,  figure 2 and  figure 5 legend,  the  attached  pdf  file  highlights  changes  that may  also  be  necessary  in  the  text  of  the manuscript.  Where highlighted, the wording should be changed from 30 passages to 14 passages in regards  to  the  immunoflourence  experiment  (ie:  Fig.  1);  from  30  passages  to  27  or  37  passages depending on the marker in regards to the FACS experiment (ie: Fig. 2) and from 30 passages to 20 passages in regards to the differentiation experiment (ie: Fig. 5).  

Released by QUT under Right to Information Act

1297

STEM CELLS AND DEVELOPMENTVolume 19, Number 9, 2010© Mary Ann Liebert, Inc.DOI: 10.1089/scd.2009.0504

The therapeutic use of human embryonic stem (hES) cells is severely limited by safety concerns regarding their culture in media containing animal-derived or nondefi ned factors and on animal-derived feeder cells. Thus, there is a pressing need to develop culture techniques that are xeno-free, fully defi ned, and synthetic. Our labo-ratory has discovered that insulin-like growth factor (IGF) and vitronectin (VN) bind to each other resulting in synergistic short-term functional effects in several cell types, including keratinocytes and breast epithelial cells. We have further refi ned this complex into a single chimeric VN:IGF-I protein that functionally mimics the effects obtained upon binding of IGF-I to VN. The aim of the current study was to determine whether hES cells can be serially propagated in feeder-cell-free and serum-free conditions using medium containing our novel chimeric VN:IGF-I protein. Here we demonstrate that hES cells can be serially propagated and retain their undifferenti-ated state in vitro for up to 35 passages in our feeder-cell-free, serum-free, chemically defi ned media. We have utilized real-time polymerase chain reaction (PCR), immunofl uorescence, and fl uorescence-activated cell sorter (FACS) analysis to show that the hES cells have maintained an undifferentiated phenotype. In vitro differen-tiation assays demonstrated that the hES cells retain their pluripotent potential and the karyotype of the hES cells remains unchanged. This study demonstrates that the novel, fully defi ned, synthetic VN:IGF-I chimera-containing medium described herein is a viable alternative to media containing serum, and that in conjunction with laminin-coated plates facilitates feeder-cell-free and serum-free growth of hES.

Introduction

The successful derivation of human embryonic stem (hES) cells by Thomson and colleagues in 1998 [ 1 ] was

hailed as the beginning of a new era of clinical therapies for the treatment of a range of human diseases. However, cur-rently no hES therapy has been used in clinical settings. This is mainly due to concerns about the introduction of xeno-derived pathogens (ie, bovine spongiform encephalopathy) through the use of hES cells cultured on animal feeder cell layers (most often inactivated mouse embryonic fi broblasts [iMEF]) and in media containing xeno-derived components. Indeed, these xeno-derived components have been shown to introduce immunogenic agents into hES cells [ 2 , 3 ].

Progress has been made toward successful xeno-free hES culture through removal of the animal-derived feeder cell layer and bovine serum. In early studies, the iMEF feeder cell layer was replaced with the use of Matrigel™ or lami-nin along with media conditioned by the MEF [ 4 ]. This was

further refi ned by Ludwig and colleagues by production of the commercially available mTESR1™ media, consist-ing of Matrigel™-coated plates supplemented with large amounts of bovine serum albumin (BSA) [ 5 , 6 ]. Additional studies have since been performed utilizing recombinant vitronectin [ 7 ] or synthetic surfaces [ 8 ] to replace the ani-mal-derived Matrigel™ in combination with the mTESR1™ media. The issue with these protocols is while they have successfully removed the need for animal feeder cell layers, they still require the inclusion of undefi ned human and/or animal products such as BSA. Additional work by Lu and colleagues in 2006 removed the bovine BSA and replaced it with undefi ned human-derived products such as albumin purifi ed from human serum [ 9 ], but again, this media still does not meet the gold standard of completely defi ned, syn-thetic, safe, and viable culture media.

Previous work by our laboratory has determined that synergistic effects exist between growth factors and the

A Chimeric Vitronectin: IGF-I Protein Supports Feeder-Cell-Free and Serum-Free Culture

of Human Embryonic Stem Cells

Kerry J. Manton , Sean Richards , Derek Van Lonkhuyzen , Luke Cormack, David Leavesley , and Zee Upton

Institute of Health and Biomedical Innovation, Queensland University of Technology, Kelvin Grove, Australia.

Released by QUT under Right to Information Act

MANTON ET AL. 1298

Establishment of a feeder-cell-free and serum-free hES culture

hES cells that had been passaged 5 times on iMEF feeder cells in KSR media (as described earlier) were transferred to feeder-cell-free culture in our serum-free media (described below). The 6-well plates utilized for hES feeder-free culture were precoated with purifi ed murine laminin (Millipore; 100 μg laminin/9.6 cm 2 ) in 2 mL of DMEM media for a mini-mum of 2 h at 37°C. The DMEM media was removed and the hES cells were immediately added.

hES feeder-cell-free and serum-free culture

The hES cells were cultured in 6-well tissue culture plates that were precoated with purifi ed mouse laminin (described above). The hES cells were cultured in 2.5 mL of serum-free media/well containing: Dulbecco’s modifi ed Eagle’s medium/F-12 (DMEM/F-12; Gibco, Grand Island, NY); 1,000 IU/mL pen-icillin and 1,000 μg/mL streptomycin (Invitrogen, Carlsbad, CA); 1 mM glutamax (Invitrogen); 1% nonessential amino acids (Gibco); 0.1 mM β-mercaptoethanol (Gibco); 1 mM LiCl (Gibco); 0.4% trace elements B and C (CELLGRO); 0.4% cholesterol lipid concentrate (protein-free; Gibco); 30 ng/mL recombinant human activin-A (PeproTech); 4.0 mg/mL recombinant human albumin (HA; Albucult™; Novozymes); and 100 ng/mL bFGF (Chemicon, Billerica, MA). The hES culture was also supplemented with 1.0 μg/mL of recombinant human VN:IGF-I chimeric protein (VN(1–64)–Linker–IGF-I), which was produced in our laboratory [ 14 ]. hES cells cultured in feeder-cell-free and serum-free condi-tions had their media changed daily and were sub-cultivated every 7–9 days (based on morphological evaluation) by mechan-ical dissociation. In brief, the media was removed from the hES cells that were to be passaged and 1.5 mL of fresh serum-free media was added to the well. The hES cells were detached from the culture vessel surface by gentle scraping with a 5-mL sterile pipette tip and were then resuspended by repeated pipetting. hES cells that displayed indications of differentiation (through morphological evaluation) were not passaged. The cells were di-luted at a ratio of 1:2 for weekly passaging and maintenance of optimal individual undifferentiated colonies.

hES in vitro differentiation

hES cells that had been cultured in serum-free and feeder-cell-free conditions for at least 30 passages were cul-tured for a further 2 weeks in monolayer in differentiation media (DMEM media containing 10% FCS, 1,000 IU/mL penicillin/1,000 μg/mL streptomycin [Invitrogen], and 1 mM glutamax [Invitrogen]) as previously described [ 18 ]. The media was changed every 3 days for 2 weeks, after which the hES cells were either fi xed for immunofl uorescence analysis or lysed for RNA extraction for RT-PCR.

hES cell immunofl uorescence

SSEA-1 expressed by differentiated hES cells and SSEA-4, TRA-1–60, and Oct-4 expressed by undifferentiated hES cells were used to monitor the differentiation status of the hES cells. hES cells at greater than passage 30 were cultured on laminin-coated coverslips in 12-well plates for 6 days. The cells were fi xed using 4% paraformaldehyde/phosphate-buffered saline for 20 min and were then washed twice for 5 min/wash in PBS. The

extracellular matrix (ECM) protein vitronectin (VN) [ 10 , 11 ]. This led to the development of novel dimeric, trimeric, and multimeric molecular complexes incorporating growth fac-tors such as insulin-like growth factors (IGFs) and insulin-like growth factor binding proteins (IGFBPs) in conjunction with VN. Furthermore, the addition of these complexes to chemically defi ned media formulations has been demon-strated to stimulate short-term migration and proliferation in a range of cells, including adult keratinocyte and corneal-derived epithelial cells [ 12 , 13 ]. These responses are depen-dent upon the co-activation of VN-binding integrins and the insulin-like growth factor I receptor (IGF-IR) [ 13 ]. These observations have led us to design and produce novel chi-meric proteins containing domains of VN linked to IGF-I, which can mimic the actions of multimeric complexes by co-activation of the VN-binding integrins and the IGF-IR [ 14 , 15 ]. We have previously reported the use of this chime-ric protein in the serum-free growth of keratinocytes and hES cells [ 16 , 17 ] and the focus of the studies herein was on removing the requirement for feeder cells in hES culture. We report that a VN:IGF-I chimeric protein can facilitate the suc-cessful long-term cultivation (up to 35 passages) of hES cells in feeder-cell-free and serum-free conditions. Importantly, the hES cells remain undifferentiated and retain pluripotent potential during this entire culture period.

Materials and Methods

Ethics

Ethics approval to conduct this project was provided by the Queensland University of Technology (QUT) Human Research Ethics Committee (ID: 2943H). The hES cell line used, BGO1V (BresaGen Inc., Melbourne, Australia), was obtained with strict adherence to the state, federal, and “National Health and Medical Research Council” (NHMRC) guidelines regarding the conduct of research using hES cells.

Culture of hES cells on iMEF in KSR media

BGO1V hES cells were cultured on inactivated mouse embryonic fi broblasts (iMEFs) (Millipore) in knockout serum replacement (KSR) medium (Dulbecco’s modifi ed Eagle’s medium [DMEM; Invitrogen, Carlsbad, CA]; 20% KSR [Invitrogen]; 1,000 IU/mL penicillin/1,000 μg/mL streptomycin [Invitrogen]; 1 mM glutamax [Invitrogen]; 1% nonessential amino acids; 0.1 mM β-mercaptoethanol; 20 ng/mL recombinant human basic fi broblast growth fac-tor [bFGF; Chemicon, Billerica, MA]). These hES cells (ie, on iMEF feeders in KSR media) also act as the control culture for the real-time polymerase chain reaction (PCR) experi-ments. hES cells were passaged by washing in 2 mL PBS per well (Invitrogen) followed by exposure to 0.05% trypsin/EDTA (Invitrogen) for a 1–2 min incubation (37°C, 5% CO 2 ) to remove the iMEF feeder layer. The trypsin was removed and an additional 2 mL of media/well was added. The hES cells were detached from the culture vessel surface by gentle scraping with a 5-mL sterile pipette tip. The cells were then resuspended in KSR media and spun at 500–600 g for 5 min. The supernatant was removed and the hES cell pellet was resuspended in KSR media. The cells were diluted at a ratio of 1:12 for weekly passaging and maintenance of optimal individual undifferentiated colonies.

Released by QUT under Right to Information Act

SERUM-FREE AND FEEDER-CELL-FREE HES CULTURE 1299

expression units (REU) were calculated by normalizing the ∆Ct values of the genes to the ∆Ct of GAPDH. A “no cDNA template” was added as a control for contamination.

A 2-way ANOVA with Bonferroni post-test analysis was used to compare differences in gene expression in feeder-cell-free, serum-free culture versus serum-free, iMEF feeder culture. Signifi cance was set at P < 0.05 and the analysis was performed using GraphPad PRISM ® version 4.00 for win-dows software (GraphPad Software, USA).

hES karyotype analysis

BGO1V hES cells that had been cultured for at least 40 pas-sages in our feeder-cell-free and serum-free culture condi-tions were analyzed for their karyotype by the GTG banding method [ 20 ] (performed by Sullivan Nicolaides Pathology, Cytogenetics Laboratory, Toowong, Queensland, Australia).

hES FACS analysis

hES cells that had been cultured for at least 30 passages in our serum-free and feeder-cell-free culture system were exam-ined for the expression of cell surface (SSEA-1, SSEA-4, TRA-1–80) and intracellular (Oct-4) markers using fl ow cytometric analysis. Fluorescence-activated cell sorter (FACS) analysis was performed as described previously [ 21 ]. In brief, all pri-mary antibodies (1.0 μg of mouse IgG; Chemicon, Billerica, MA) were preincubated for 30 min at 4°C with 0.5 μg of Alexa-Fluor 488 anti-mouse IgG (Molecular Probes, Eugene, OR) in a fi nal volume of 100 μL FACS buffer (2% FCS in PBS). For cell surface markers, 1 × 10 6 dissociated hES cells were stained with preincubated antibody for 30 min at 4°C, followed by 3 wash steps in FACS buffer (2% FCS in PBS). For intracellular staining (Oct-4), cells were fi xed and permeabilized prior to antibody incubation using CALTAG “Fix-and-Perm” as per the manufacturer’s instructions (Invitrogen). The cells were stained with 7-AAD for 20 min at room temperature just prior to FACS analysis. Live cells were identifi ed by 7-AAD exclusion and analyzed for cell marker expression using the FC500 FACSCalibur (BD) and Cell Quest Software (BD).

cells were permeabilized with 0.1% Triton X-100/PBS for 10 min prior to a further washing step. The cells were blocked in 4% BSA (Sigma, St. Louis, MO) for 30 min at room temperature, fol-lowed by incubation with mouse IgG primary antibodies (1:100 dilution; Chemicon) in 4% BSA (or diluent alone) for 1 h. The primary antibodies were removed and the wash steps repeated. The Alexa-Fluor ® 488 or Alexa-Fluor ® 555 anti-mouse secondary antibodies (1:100 dilution; Invitrogen) were incubated for 1 h. The secondary antibodies were removed, the wash steps re-peated, and the cells were mounted on microscope slides under mounting medium (containing DAPI). The stained hES colonies were viewed with a Nikon TE-2000 epifl uorescent microscope.

hES real-time PCR analysis

The genes (Nanog, hTERT, UTF1, SOX2, FOXD4, Oct-4, Dppa, and REX-1) that are accepted markers for undifferen-tiated hES cells [ 19 ] were assayed using real-time PCR. In addition, genes (HAND1, Troponin, AFP, GATA, nestin, and MAP2) that are accepted markers for differentiated hES cells [ 19 ] were also assayed using real-time PCR. To perform this total RNA was extracted from the cells using the Qiagen RNeasy plus mini kit (Qiagen, Valencia, CA) as per the manu-facturer’s instructions. cDNA was then synthesized from 2 μg of total RNA using SuperScript III Reverse Transcriptase (Invitrogen) and random oligonucleotide primers (Invitrogen). In brief, random primers were added to 2 μg of total RNA and allowed to anneal for 5 min at 65°C. Samples were then held on ice for 2 min before the addition of the SuperScript III Reverse Transcriptase and buffers. cDNA synthesis was formed by heating these samples for 5 min at 25°C followed by 1 h incubation at 50°C and then 15 min at 70°C.

Real-time PCR was performed on 100 ng of cDNA tem-plate using the SYBR Green PCR Master Mix (Qiagen) and the primers (Sigma-Aldrich) described in Table 1 . These primers were designed using the Invitrogen OligoPerfect™ software design program and span an exon/intron bound-ary. PCRs were performed in triplicate with an initial 10-min activation step at 95°C followed by 45 cycles of 95°C for 20 s, 55°C for 10 s, 60°C for 30 s, and 72°C for 40 s. Relative

T able 1. S equences of P rimers U sed in R eal -T ime PCR to E xamine G ene E xpression in hES C ells C ultured in F eeder -C ell -F ree and S erum -F ree C onditions

Gene Forward Primer (5′ to 3′) Reverse Primer (5′ to 3′) PCR Product

Rex1 ACCAGCACACTAGGCAAACC TCTGTTCACACAGGCTCCAG 109Nanog GATTTGTGGGCCTGAAGAAA CAGATCCATGGAGGAAGGAA 100hTERT CGGTGTGCACCAACATCTAC GGGTTCTTCCAAACTTGCTG I00UTFI CGCCGCTACAAGTTCCTTA ATGAGCTTCCGGATCTGCT 86SOX2 CAAGATGCACAACTCGGAGA GCTTAGCCTCGTCGATGAAC 95FoxD3 TCTGCGAGTTCATCAGCAAC TTGACGAAGCAGTCGTTGAG 103Oct4 GAAGGATGTGGTCCGAGTGT GCCTCAAAATCCTCTCGTTG 90Dppa5 AAGTGGATGCTCCAGTCCAT TCACTTCATCCAAGGGCCTA 111GAPDH ACAGTCAGCCGCATCTTCTT ACGACCAAATCCGTTGACTC 94HAND1 TGAACTCAAGAAGGCGGATG AGGGCAGGAGGAAAACCTT 81Troponin TGAGGAGCGATACGACATTG GGTCCATCACCTTCAGCTTC 80AFP GCAGAGGAGATGTGCTGGAT GTGGTCAGTTTGCAGCATTC 112GATA TTCCCAAGATGTCCTTGTCC TCCGCTTGTTCTCAGATCCT 96Nestin ACTTCCCTCAGCTTTCAGGA TGGGAGCAAAGATCCAAGAC 84MAP2 GAGAATGGGATCAACGGAGA CTGCTACAGCCTCAGCAGTG 110

hES, human embryonic stem.

Released by QUT under Right to Information Act

MANTON ET AL. 1300

nitrogen and the culture was terminated. The morphology of the cells appeared undifferentiated at this time point.

hES cells cultured in our feeder-cell-free and serum-free culture conditions showed no signifi cant changes in the expression of Nanog, TERT, and Oct-4 as compared with hES cells cultured in KSR media on a iMEF feeder layer ( Fig. 3 ). FOXD4 only showed signifi cant changes in expression lev-els following 35 passages ( P < 0.01). SOX2 expression varied throughout the culture period with expression levels rang-ing from being almost identical between the 2 different cul-ture techniques (at p14 and p24) to signifi cantly different at p17 ( P < 0.05) and p35 ( P < 0.01). UTF1 and Dappa expression were found to be equivalent in the 2 culture methods dur-ing the initial stages of culture (up to passage 15). However, continued culture revealed signifi cantly different levels of expression of both these genes in the feeder-cell-free, serum-free culture compared with hES cells cultured in KSR media on iMEF feeder layer. REX-1 expression was found to be signifi cantly lower ( P < 0.001) in the hES cells cultured in feeder-cell-free and serum-free conditions throughout the entire culture period ( Fig. 3 ).

Feeder-cell-free culture did not produce hES chromosomal abnormalities

To ensure that culturing the hES cells in our feeder-cell-free and serum-free conditions did not produce additional chromosomal abnormalities, we performed a karyotype analysis on the hES after passage 40. The karyotype of BGO1V hES cells was found to be 49, XXY, +12, +17 (ISCN Nomenclature 2009; Fig. 4 ). This is the original karyotype of the BGO1V cell line [ 22 ], hence no additional chromosome abnormalities were induced following culture in our feeder-cell-free and serum-free conditions.

hES cells grown in serum-free and feeder-cell-free conditions retain the ability to differentiate

To determine if hES cells cultured in our feeder-cell-free and serum-free culture conditions retain their pluripotent

Results

hES cells maintain expression of pluripotent cell surface and intracellular markers

We determined that use of our new media containing the novel chimeric VN:IGF-I allowed hES cells to survive and be serially propagated in feeder-cell-free and serum-free cul-ture conditions for up to 35 passages (based on marker anal-ysis) and up to 50 passages (based on morphology alone). hES cells cultured in the feeder-cell-free and serum-free culture conditions maintained their undifferentiated state as demonstrated by high levels of expression of SSEA-4, Tra-1–60, and Oct-4, and low or undetectable levels of expression of SSEA-1, a marker of differentiation ( Fig. 1 ). A “no primary antibody control” was included to detect nonspecifi c binding between the secondary antibodies and the cells, and immu-noreactivity was found to be minimal (data not shown).

The hES cells cultured in our feeder-cell-free and serum-free conditions were observed to retain expression of pluri-potent markers as shown by FACS analysis of hES cells after culture for at least 30 passages ( Fig. 2 ). hES cells remained positive for TRA-1–80, SSEA-4, and Oct-4 expression (mark-ers of undifferentiated hES cells), while the SSEA-1 (marker of differentiated cells) was undetectable.

hES cells retain expression of pluripotent genes

To determine the effect of our feeder-cell-free and serum-free culture conditions on hES gene expression, we com-pared pluripotent gene expression in hES cells grown on an irradiated iMEF feeder cell layer in KSR media (described in Materials and Methods) and hES cells grown in our new feeder-cell-free and serum-free conditions. We examined gene expression at passages 14, 17, 24, and 35 ( Fig. 3 ). As the hES cells were passaged every 8–9 days, this represents ~126, 153, 216, and 315 days, respectively, of continuous feeder-cell-free and serum-free culture. We cultured the hES cells to ~400 days of continuous culture (representing up to 50 passages), at which point the hES cells were frozen in liquid

A B C

D E F

FIG. 1. Human embryonic stem (hES) cells cultured in feeder-cell-free and serum-free conditions retain expression of pluripotent cell surface and intracellular markers. hES cells that had been propagated for at least 30 pas-sages were fi xed and probed for cell surface and intracellular markers using immunofl uo-rescence. ( A ) Morphology only, ( B ) DAPI, ( C ) SSEA-4, ( D ) Oct-4, ( E ) SSEA-1, and ( F ) TRA-1–60 (all photos at magnifi cation 200×).

Released by QUT under Right to Information Act

SERUM-FREE AND FEEDER-CELL-FREE HES CULTURE 1301

Discussion

Most of the current conditions for culturing hES cells utilize animal-derived feeder cells and other poorly de-fi ned components in the culture systems. The possibility that these xeno-derived or nonsynthetic components can contaminate the hES culture process makes these cells un-viable for safe and effective human clinical use. Thus, there is a global push to develop hES culture conditions that are free from xeno-derived feeder layers and components and that are instead composed of synthetic, fully defi ned for-mulations. Previously 2 key articles were published, which investigated ways to minimize the use of animal-derived

potential, we performed in vitro differentiation experi-ments. hES cells that had been cultured for up to 30 passages were successfully differentiated into ectoderm (nestin) and mesoderm (troponin, smooth muscle actin) tissue lineages, as shown by positive immunofl uorescence ( Fig. 5 , top row). We also performed real-time PCR for markers of differenti-ation using RNA from hES cells that had undergone differ-entiation and compared them with RNA from hES cells that were maintained in an undifferentiated state. Real-time PCR revealed hES cells differentiated into mesoderm (HAND1, Troponin), ectoderm (nestin, MAP2), and endoderm (AFP, GATA) lineages ( Fig. 5 , bottom table) compared with undif-ferentiated hES.

SSEA-1 Oct-4

TRA-1–80SSEA-4

Unstained

R2

Counts

Counts

Counts

Counts

Counts

R2

R2R2

R2

1000 0

00

0

181

362

543

724

64

129

193

258

54

108

162

217

124

248

372

496

103

206

309

412

101 102

FL2 Log

103 104 100 101 102

FL2 Log

103 104

100 101 102

FL2 Log

103 104100 101 102

FL2 Log103 104

100 101 102

FL2 Log103 104

0

Unstained

SSEA1

SSEA4

Oct-4

TRA-1-80

20 40 60

% Cells Positive

80 100

FIG. 2. Human embryonic stem (hES) cells cultured in feeder-cell-free and serum-free conditions retain expression of pluripotent cell surface and intracellular markers. hES cells that had been propagated for at least 30 passages in serum-free and feeder-cell-free conditions were analyzed for expression of cell surface (SSEA-4, SSEA-1, and TRA-1–80) and intracel-lular (Oct-4) markers using fl uorescence-activated cell sorter (FACS). Unstained cells are also shown. The graph shows the percentage of cells that were positive for undifferentiated (Oct-4, SSEA-4, TRA-1–80) and differentiated (SSEA-1) hES markers.

Released by QUT under Right to Information Act

MANTON ET AL. 1302

colleagues (2006) published the HESCO media (not yet com-mercially available) that incorporates bFGF, insulin, trans-ferrin, Wnt3a, April, and Matrigel™ [ 9 ]. Notably, both the mTESR1 and HESCO media still contain animal-derived substrates for coating the tissue culture plastic and large concentrations of poorly defi ned and/or animal-derived

components in hES culture. Ludwig and colleagues (2006) reported the development of what is now the commer-cially available mTESR1™ media (Stem Cell Technologies, Vancouver, BC). This media utilizes BSA, insulin, puri-fi ed HA, and Matrigel™ as replacements for the fetal calf serum and the animal-derived feeder cell layer [ 5 , 6 ]. Lu and

FIG. 3. Human embryonic stem (hES) cells cultured in feeder-cell-free and serum-free conditions retain expression of plu-ripotent genes. Real-time polymerase chain reaction (PCR) analysis was used to quantitate RNA expression of pluripotent genes in hES cells grown in feeder-cell-free and serum-free conditions after 14, 17, 24, and 35 passages. Relative expression unit (REU) values are normalized to the GAPDH housekeeping gene. Each RT-PCR analysis was performed on pooled dupli-cate hES samples. Error bars depict the standard deviation of triplicate real-time reactions. *** P < 0.001; ** P < 0.01; * P < 0.05.

Released by QUT under Right to Information Act

SERUM-FREE AND FEEDER-CELL-FREE HES CULTURE 1303

of the literature and a preliminary proteomic analysis of the culture medium (Luke Cormack, personal communication), we elected to include several proteins and metabolites in the serum-free media formulation—cholesterol lipid concentrate, lithium chloride, and trace elements B and C. Interestingly, the removal of LIF did not effect the serum-free and feeder-cell-free culture of the hES cells. However, higher amounts of bFGF (100 ng/mL) were required in our current formulation compared with 20 ng/mL of bFGF, which we reported previously for the serum-free formulation in Richards (2008). This sug gests that MEF feeder cells may be involved in the paracrine pro-duction of this mitogen. We also observed that growth of hES cells in the feeder-cell-free, serum-free culture system had an absolute requirement for 4 mg/mL of recombinant HA fol-lowing the removal of the irradiated iMEF cell feeder layer. In addition, our new media formulation included the use of a novel VN:IGF-I chimeric protein [ 14 ]. This single chimeric protein was able to replace the IGF-I, IGFBP3, and VN that was previously used in our original serum-free media formu-lation [ 16 ]. This is signifi cant as the chimeric protein offers sig-nifi cant manufacturing and cost advantages as only a single protein is required, rather than 3.

Morphological analysis, as well as RNA and protein-based characterization studies, demonstrated that hES cells could be grown for up to 30 passages in the serum-free and feeder-cell-free culture system while still maintaining a phenotype equivalent to hES cells grown in serum-containing media. While acknowledging that the culture of the hES cells in the serum-free, feeder-cell-free media still requires the use of HA, we have employed recombinant HA, hence the medium we used is fully defi ned. Furthermore, in the main nano-gram doses of proteins and growth factors are required. In addition, signifi cantly lower amounts of recombinant HA (4 mg/mL) compared with that reported by Ludwig et al. (13 mg/mL) were incorporated into the formulation [ 6 ]. It is also interesting to note that recombinant human vitronectin has been utilized by others as a substrate for coating tissue cul-ture plates and has been shown to support hES culture in mTeSR1™ media. The hES cell growth obtained in this sit-uation is equivalent to that of hES cells in MEF-conditioned

components. In addition, the large concentrations of pro-teins in these media suggest that they are not commercially viable from a cost perspective nor are they sustainable in the emerging regulatory environment.

Our previous success in propagating hES cells in serum-free media [ 16 ] required the hES cells to be co-cultivated with inactivated MEF cells. We anticipated, however, that removal of the MEF cells from the culture system would require addi-tional factors to substitute for those produced from the MEF cells in an autocrine and paracrine manner. Through analysis

1

6 7 8 9 10 11 12

13 14 15 16 17 18

19 20

08-BRESA 032 A 49,XXY,+12,+17 49

4~A –1260/–8896 QA 3

21 22 X Y

2 3 4 5

FIG. 4. Feeder-cell-free and serum-free culture of the BG01V human embryonic stem (hES) cells does not produce any additional chromosome abnormalities. Karyotype anal-ysis on the hES cells grown serum-free and feeder-cell-free conditions for 40 passages was conducted by the GTG band-ing method. The BG01V hES cells were found to be 49, XXY, +12, +17 (ISCN Nomenclature 2009).

Actin Smooth Muscle

Mesoderm HAND1 17.91

10.16

1.05

4.81

18.78

475.44

20.74

10.85

0.83

3.25

9.25

169.93

P = 20 P = 25

Troponin

AFP

GATA

Nestin

MAP2

Endoderm

Ectoderm

Nestin Troponin

FIG. 5. Human embryonic stem (hES) cells cultured for up to 30 passages in feeder-cell-free and serum-free conditions retain the ability to differentiate down the germ lineages. Differentiated hES cells were probed for markers of ectoderm (nestin) and mesoderm (smooth muscle actin, troponin) using immunofl uorescence (top row). Real-time polymerase chain reaction (PCR) was used to determine fold increase in expression of markers of the 3 germ lineages as compared with undif-ferentiated hES (bottom table); p = passage number.

Released by QUT under Right to Information Act

MANTON ET AL. 1304

The ability to culture hES cells in serum-free and feeder-cell-free conditions using defi ned synthetic formulations is clearly the preferred culture approach for toxicity testing of pharmaceutical reagents and for testing of cellular thera-pies [ 26 ]. This ensures that consistent results are generated as there is limited batch-to-batch or culture-to-culture var-iation. Although the BG01V hES cell line contains an ab-normal karyotype, this cell line has been utilized as a useful experimental tool for cell therapy, developmental biology, and genetic research [ 22 ], thereby explaining our initial focus on this cell line in our evaluation of the feeder-cell-free and serum-free culture system. A further benefi t of this serum-free and feeder-cell-free culture method is that it will enable proteomic analyses of hES cell-conditioned media without the complications that arise from the presence of highly abundant proteins, such as those present in animal serum. Indeed, we have recently established that the recom-binant HA that is used in this media can be removed for 48 h prior to the collection of conditioned media, thus re-moving all highly abundant large molecular mass species to facilitate more effi cient, accurate, and informative proteomic analyses.

In summary, we have demonstrated the synthetic VN:IGF-I chimera and the new media formulation holds potential in supporting serum-free and feeder-cell-free culture of hES cells, and this may have profound implications in facilitating clinical translation of hES cells. For example, human epi-dermal cells for clinical use in skin reconstruction have re-cently been successfully derived from hES [ 27 ]. This technique used animal protein (ie, serum) and feeder cells for both the hES cell culture and the epidermal differentiation processes. The hES culture methodology we report here, combined with our previously published methods for serum-free culture of human keratinocytes and dermal fi broblasts [ 16 , 17 ], suggests it will be possible to achieve completely xeno-free derivation of such epidermal cells from hES for safe effective clinical use. This culture methodology, incorporating our chimeric VN:IGF-I protein, not only holds the potential to deliver ben-efi ts to the hES research community, but also provides a clear way forward toward the generation of safe, reliable culture of suffi cient quantities of hES cells for human clinical therapies. Moreover, this may well be achievable at lower cost than has been reported previously by others.

Acknowledgments

We thank Dr. Leonore De Bore for assistance with the FACS analysis. This work was funded by a Queensland Government Smart State Research Industries Partnership Program (RIPP) Grant and the Queensland University of Technology (QUT) Tissue Repair and Regeneration Program. ZU was supported by a Queensland State Government Smart State Senior Fellowship.

Author Disclosure Statement

No competing fi nancial interests exist.

References

1. Thomson JA , J Itskovitz-Eldor , SS Shapiro , MA Waknitz , JJ

Swiergiel , VS Marshall and JM Jones . ( 1998 ). Embryonic stem cell

lines derived from human blastocysts . Science 282 : 1145 – 1147 .

medium [ 7 ]. These results, combined with the studies we report herein demonstrating that our VN:IGF-I chimera in combination with other factors allows serum-free and feed-er-cell-free culture of hES cells, indicate that vitronectin is an essential component for hES culture in either adherent [ 7 ] or soluble form (described herein).

An important issue to acknowledge is that our hES cul-ture methodology still required laminin-coated culture ware. We did conduct preliminary studies investigating other sub-strates for coating (ie, collagens I and IV), but found laminin to be the most desirable. Unfortunately, the current high cost of recombinant human laminin necessitated the use of puri-fi ed mouse laminin for our hES studies. The next step would clearly incorporate recombinant human laminin, together with good manufacturing process (GMP)-compliant chimeric VN:IGF-I protein (currently in manufacture) to arrive at the end point of a fully defi ned, synthetic, recombinant GMP grade hES culture system. Clearly GMP-compliant products are required for the safe culture of hES cells for human clin-ical and therapeutic applications.

Our characterization studies revealed that hES cells that were cultured serum-free and feeder-cell-free showed con-sistently low levels of REX-1 expression compared with hES cells cultured in serum-containing media on iMEF feeders. This suggests that: (1) the serum-free, feeder-cell-free cul-ture affects the expression of REX-1 and the phenotype of the hES cells; or that (2) REX-1 is not an essential gene product required to maintain hES pluripotency. Recently, iPS cells generated by Sommer and colleagues [ 23 ] showed very low/undetectable expression of REX-1, thus indicating that per-haps REX-1 is not an essential gene for the pluripotent pheno-type in hES cells. Conversely, work by Chan and colleagues [ 24 ] showed that REX-1 expression is correlated with pluripo-tent, fully reprogrammed iPS cells. Hence, the true function of REX-1 in ES cells remains unclear. In addition, the expres-sion of Dppa and UTF1 remained stable in the feeder-cell-free and serum-free hES culture while, conversely increasing in the hES cells cultured in KSR medium on iMEF feeders. However, despite these changes in gene expression, several key pluripotent genes (Nanog, TERT, and Oct-4) showed no signifi cant changes in gene expression throughout the cul-ture period, indicating that the hES cells cultured in feeder-cell-free and serum-free conditions still retain pluripotent potential and validating the media described herein.

The BG01V hES cells cultured in feeder-cell-free and serum-free conditions were capable of differentiating into cells of the mesoderm lineage, as demonstrated by expres-sion of troponin protein and the up-regulation of HAND1 and Troponin RNA expression. However, the BG01V hES showed limited potential to differentiate into cells of the en-doderm lineage. Immunofl uorescent reactivity for AFP was negative (data not shown) and the gene expression of AFP and GATA was only slightly increased in the differenti ated hES cells. Previously, the BG01V hES cell line has been shown to transcribe relatively low AFP mRNA in differentiating hES cells, while maintaining the expression of other markers of mesoderm and pluripotency [ 25 ]. The data presented herein refl ect the previously published neural (ectoderm) dominant differentiation tendency of the BGO1V hES cell line [ 22 ]. All the same, the BG01V cells have been shown by others to form teratomas containing all 3 germ lineages in SCID mice, sug-gesting they do in fact have pluripotent potential [ 22 ].

Released by QUT under Right to Information Act

SERUM-FREE AND FEEDER-CELL-FREE HES CULTURE 1305

17. Mujaj S , K Manton , Z Upton and S Richards . ( 2010 ). Serum-Free

Primary Human Fibroblast and Keratinocyte Coculture . Tissue

Eng Part A .

18. D’Amour KA , AD Agulnick , S Eliazer , OG Kelly , E Kroon

and EE Baetge . ( 2005 ). Effi cient differentiation of human

embryonic stem cells to defi nitive endoderm . Nat Biotechnol

23 : 1534 – 1541 .

19. Chen HF , HC Kuo , CL Chien , CT Shun , YL Yao , PL Ip , CY

Chuang , CC Wang , YS Yang and HN Ho . ( 2007 ). Derivation, char-

acterization and differentiation of human embryonic stem cells:

comparing serum-containing versus serum-free media and evi-

dence of germ cell differentiation . Hum Reprod 22 : 567 – 577 .

20. Seabright M . ( 1971 ). A rapid banding technique for human chro-

mosomes . Lancet 2 : 971 – 972 .

21. Wang L , L Li , P Menendez , C Cerdan and M Bhatia . ( 2005 ).

Human embryonic stem cells maintained in the absence of

mouse embryonic fi broblasts or conditioned media are capable

of hematopoietic development . Blood 105 : 4598 – 4603 .

22. Plaia TW , R Josephson , Y Liu , X Zeng , C Ording , A Toumadje ,

SN Brimble , ES Sherrer , EW Uhl , WJ Freed , TC Schulz , A

Maitra , MS Rao and JM Auerbach . ( 2006 ). Characterization of

a new NIH-registered variant human embryonic stem cell line,

BG01V: a tool for human embryonic stem cell research . Stem

Cells 24 : 531 – 546 .

23. Sommer CA , M Stadtfeld , GJ Murphy , K Hochedlinger , DN

Kotton and G Mostoslavsky . ( 2009 ). Induced pluripotent stem

cell generation using a single lentiviral stem cell cassette . Stem

Cells 27 : 543 – 549 .

24. Chan EM , S Ratanasirintrawoot , IH Park , PD Manos , YH Loh ,

H Huo , JD Miller , O Hartung , J Rho , TA Ince , GQ Daley and

TM Schlaeger . ( 2009 ). Live cell imaging distinguishes bona

fi de human iPS cells from partially reprogrammed cells . Nat

Biotechnol 27 : 1033 – 1037 .

25. Tavakoli T , XR Xu , E Derby , Y Serebryakova , Y Reid , MS Rao ,

MP Mattson and W Ma . ( 2009 ). Self-renewal and differentiation

capabilities are variable between human embryonic stem cell

lines 13, 16 and BG01V . BMC Cell Biol 10 : 44 .

26. Améen C , R Strehl , P Björquist , A Lindahl , J Hyllner and P

Sartipy . ( 2008 ). Human embryonic stem cells: current tech-

nologies and emerging industrial applications . Crit Rev Oncol

Hematol 65 : 54 – 80 .

27. Guenou H , X Nissan , F Larcher , J Feteira , G Lemaitre , M Saidani ,

M Del Rio , CC Barrault , FX Bernard , M Peschanski , C Baldeschi

and G Waksman . ( 2009 ). Human embryonic stem-cell deriva-

tives for full reconstruction of the pluristratifi ed epidermis: a

preclinical study . Lancet 374 : 1745 – 1753 .

2. Martin MJ , A Muotri , F Gage and A Varki . ( 2005 ). Human em-

bryonic stem cells express an immunogenic nonhuman sialic

acid . Nat Med 11 : 228 – 232 .

3. Heiskanen A , T Satomaa , S Tiitinen , A Laitinen , S Mannelin , U

Impola , M Mikkola , C Olsson , H Miller-Podraza , M Blomqvist ,

A Olonen , H Salo , P Lehenkari , T Tuuri , T Otonkoski , J Natunen ,

J Saarinen and J Laine . ( 2007 ). N-glycolylneuraminic acid xeno-

antigen contamination of human embryonic and mesenchymal

stem cells is substantially reversible . Stem Cells 25 : 197 – 202 .

4. Xu C , MS Inokuma , J Denham , K Golds , P Kundu , JD Gold and

MK Carpenter . ( 2001 ). Feeder-free growth of undifferentiated

human embryonic stem cells . Nat Biotechnol 19 : 971 – 974 .

5. Ludwig TE , V Bergendahl , ME Levenstein , J Yu , MD Probasco

and JA Thomson . ( 2006 ). Feeder-independent culture of human

embryonic stem cells . Nat Methods 3 : 637 – 646 .

6. Ludwig TE , ME Levenstein , JM Jones , WT Berggren , ER

Mitchen , JL Frane , LJ Crandall , CA Daigh , KR Conard , MS

Piekarczyk , RA Llanas and JA Thomson . ( 2006 ). Derivation

of human embryonic stem cells in defi ned conditions . Nat

Biotechnol 24 : 185 – 187 .

7. Braam SR , L Zeinstra , S Litjens , D Ward-van Oostwaard , S van

den Brink , L van Laake , F Lebrin , P Kats , R Hochstenbach , R

Passier , A Sonnenberg and CL Mummery . ( 2008 ). Recombinant

vitronectin is a functionally defi ned substrate that supports

human embryonic stem cell self-renewal via alpha V beta 5

integrin . Stem Cells 26 : 2257 – 2265 .

8. Derda R MS , BP Orner , JR Klim , L Li and LL Kiessling . ( 2010 ).

High-throughput discovery of synthetic surfaces that support

proliferation of pluripotent cells . J Am Chem Soc . [Epub ahead

of print]

9. Lu J , R Hou , CJ Booth , SH Yang and M Snyder . ( 2006 ). Defi ned

culture conditions of human embryonic stem cells . Proc Natl

Acad Sci USA 103 : 5688 – 5693 .

10. Kricker JA , CL Towne , SM Firth , AC Herington and Z Upton .

( 2003 ). Structural and functional evidence for the interaction

of insulin-like growth factors (IGFs) and IGF binding proteins

with vitronectin . Endocrinology 144 : 2807 – 2815 .

11. Upton Z , H Webb , K Hale , CA Yandell , JP McMurtry , GL Francis

and FJ Ballard . ( 1999 ). Identifi cation of vitronectin as a novel

insulin-like growth factor-II binding protein . Endocrinology

140 : 2928 – 2931 .

12. Ainscough SL , Z Barnard , Z Upton and DG Harkin . ( 2006 ).

Vitronectin supports migratory responses of corneal epithelial

cells to substrate bound IGF-I and HGF, and facilitates serum-

free cultivation . Exp Eye Res 83 : 1505 – 1514 .

13. Hollier BG , JA Kricker , DR Van Lonkhuyzen , DI Leavesley

and Z Upton . ( 2008 ). Substrate-bound insulin-like growth fac-

tor (IGF)-I-IGF binding protein-vitronectin-stimulated breast

cell migration is enhanced by coactivation of the phosphati-

dylinositide 3-Kinase/AKT pathway by alphav-integrins and

the IGF-I receptor . Endocrinology 149 : 1075 – 1090 .

14. Van Lonkhuyzen DR , GK Shooter and Z Upton . ( 2005 ).

Production and characterization of a Vitronectin-insulin-like

growth factor-I chimeric molecule . FEBS J 272 : 278 – 279 .

15. Van Lonkhuyzen DR , BG Hollier , GK Shooter , DI Leavesley

and Z Upton . ( 2007 ). Chimeric vitronectin:insulin-like growth

factor proteins enhance cell growth and migration through co-

activation of receptors . Growth Factors 25 : 295 – 308 .

16. Richards S , D Leavesley , G Topping and Z Upton . ( 2008 ).

Development of defi ned media for the serum-free expansion of

primary keratinocytes and human embryonic stem cells . Tissue

Eng Part C Methods 14 : 221 – 232 .

Received for publication December 15, 2009 Accepted after revision February 2, 2010

Prepublished on Liebert Instant Online February 3, 2010

Address correspondence to: Dr. Kerry J. Manton

Tissue Repair and Regeneration Program Institute of Health and Biomedical Innovation

Queensland University of Technology 60 Musk Avenue

Kelvin Grove, QLD 4059 Australia

E-mail : kerry.manton@qut.edu.au

Released by QUT under Right to Information Act

Released by QUT under Right to Information Act