Journal of Microbiological Methods 98 (2014) 1–7

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j ourna l homepage: www.e lsev ie r .com/ locate / jmicmeth

Quantitative phenotyping of X-disease resistance in chokecherry usingreal-time PCR

Danqiong Huang a, James A. Walla b,1, Wenhao Dai a,⁎a Department of Plant Sciences, North Dakota State University, Fargo, ND 58108, USAb Department of Plant Pathology, North Dakota State University, Fargo, ND 58108, USA

⁎ Corresponding author. Tel.: +1 701 231 8473; fax: +E-mail address: wenhao.dai@ndsu.edu (W. Dai).

1 Current address: Northern Tree Specialties, Fargo, ND

0167-7012/$ – see front matter © 2013 Elsevier B.V. All rihttp://dx.doi.org/10.1016/j.mimet.2013.12.016

a b s t r a c t

a r t i c l e i n f o

Article history:Received 14 November 2013Received in revised form 20 December 2013Accepted 20 December 2013Available online 31 December 2013

Keywords:Quantitative phenotypingX-disease resistanceReal-time PCRCandidatus Phytoplasma pruni

A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-diseasephytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designedbased on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIIIgroup (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of bothchokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCRusing the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phe-notypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherrieshad a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCRassay provides amore objective tool to phenotype phytoplasma disease severity, particularly for early evaluationof host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and hasgreat potential in enhancing plant breeding.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

X-disease was first found in cherry and peach in 1931 and 1933 inCalifornia and Connecticut, respectively (Ogawa, 1991). It is one ofthe limiting factors for production of many major Prunus speciesand is particularly devastating to peaches, cherries, nectarines, andchokecherries (Peterson, 1984; Rosenberger and Jones, 1997; Daviset al., 2012). Its economic importance is due to complete loss of pro-ductivity and reduction of life span of diseased trees (Sinclair andLyon, 2005). X-disease is caused by phytoplasmas, a group of cell-wall-less prokaryotes (Doi et al., 1967). Phytoplasmas are known tocause diseases in more than 300 higher plant species includingmany economically important food, fiber, forage, fruit and ornamen-tal plants (Lee et al., 1992).

X-disease is classified in the yellows group that primarily causesgrowth decline or etiolation of plants (Kirkpatrick, 1989). The path-ogen is phloem-limited and primarily transmitted to hosts not onlyby leafhoppers, but also by natural and artificial phloem connectionsbetween plants. Phytoplasmas are unable to grow in vitro and theirtiters are low and variable in plants (Olivier et al., 2009); therefore,detection of phytoplasmas has relied heavily on their biologicalproperties (vector specificity and host range), symptomatology,and microscopic observations.

1 701 231 8474.

58102, USA.

ghts reserved.

Traditional phenotyping of disease resistance in plants is mainlybased on disease symptom evaluation by individual researchers; there-fore somedegree of inconsistency in phenotyping is unavoidable.More-over, theperennial nature of tree species complicates rating of symptomdevelopment due to different year-to-year overwintering conditions,tree phenology, and stage of disease progression. The typical symptomsof X-disease on chokecherry are stunted, discolored (red or yellow) anddeformed leaves, deformed and discolored fruit, stunting and reducedhardiness of current-year shoots and dieback of branches and stems.Early in disease development and in moderately resistant plants,these symptoms develop late in the growing season, and can be con-fused with symptoms of abiotic stresses and fall leaf color, makingsymptom-based phenotyping of X-disease resistance in chokecherrydifficult. Multiple phytoplasmas may cause similar symptoms in agiven host, and several phytoplasmas are known to infect Prunusspecies. Thus, it is necessary to confirm the identity of the pathogenassociated with visual symptoms in each experiment in addition todisease phenotyping.

Advances in polymerase chain reaction (PCR) technology haveenabled researchers to amplify any DNA sequences from both hostand pathogen genomes using specific primers. PCR has been appliedfor classification and differentiation of phytoplasmas. Phytoplasmagroups and subgroups are distinguished primarily by amplification of16S rRNA genes (Lee et al., 2000). X-disease in cherry and peach wasplaced in the 16SrIII group, 16SrIII-A subgroup (Lee et al., 2000;Bertaccini, 2007; Olivier et al., 2009). A single-step PCR often does notreliably result in a visible band due to low sequence titers in plantsand non-specific amplification; therefore, nested PCR is often used to

2 D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

amplify phytoplasma DNA from plants and insect vectors. In nested-PCR, the first PCR using universal primers increases the concentra-tion of phytoplasma DNA. The second PCR uses specific primers toamplify phytoplasma DNA from the product of the first PCR to givea high yield and greater specificity (Gundersen and Lee, 1996). How-ever, a second round of amplification increases the risk of cross-contamination that could lead to a false or non-specific detection.Moreover, neither conventional nor nested PCR can be used to quan-tify phytoplasma biomass (copy number) in host plants.

Real-time quantitative PCR has been used to detect and quantifyplant pathogens including phytoplasmas due to its high sensitivityand accuracy and high-throughput capacity (Christensen et al., 2004;Torres et al., 2005; Hren et al., 2007; Martini et al., 2007; Li et al.,2009). This method is particularly applicable to pathogen detectionprior to symptomdevelopment. Recently, Daniëls et al. (2012) reportedusing real-time PCR to quantify scab resistance in apple cultivars duringthe initial latent stages of infection. Korsman et al. (2012) found thatDNA content of grey leaf spot (Cercospora spp.) in maize leaves sig-nificantly correlated with the resistance of maize lines. To date, nostudy has been reported to quantify X-disease phytoplasmas inchokecherry and other Prunus species. Very limited efforts havebeen made to quantitatively phenotype disease resistance based onpathogen biomass in plants, particularly for phytoplasma diseasesin woody species. The objective of this research was to develop arapid, sensitive, and specific real-time PCR for detection and quantifica-tion of X-disease phytoplasmas in chokecherry. We hypothesized thatthe biomass of X-disease phytoplasmas would be closely related toresistance to X-disease in chokecherry. To our knowledge, this isthe first study of correlating molecular quantification of X-diseasephytoplasmas with disease resistance in Prunus species; therefore,the result will facilitate germplasm screening and understandingthe mechanism of X-disease resistance in chokecherry and otherPrunus species.

2. Materials and methods

2.1. Plant material and inoculation with X-disease phytoplasmas

Chokecherry lines showing different X-disease severities wereoriginally collected from the field. Tissue cultures of these lineswere established for clonal propagation and pathogen elimination(Zhang et al., 2000). Tissue culture-propagated lines were inoculat-ed with a highly aggressive X-disease phytoplasma strain (designat-ed Pepsi-2) using a side grafting method in August 2012 (Wang,2012). Scions consisting of fresh chokecherry branches with typicalX-disease symptoms and previously confirmed by nested PCR tocontain X-disease phytoplasmas were collected from the source treeno more than 2 h before grafting. Two scions (1–2 buds and leaveseach) were grafted into different sides of the stem of each chokecherryplant (rootstock), with the phloem of both the scion and rootstockbeing placed in contact with each other. Scions on each grafted plantwere covered with a plastic bag to retain moisture and then a paperbag to minimize radiant heat. After 3 to 4 weeks, bags were removed.All grafted plants were grown in the greenhouse.

2.2. Evaluation of X-disease resistance in chokecherry

X-disease resistance in chokecherries was evaluated in August2013. X-disease severity was rated on a scale of 0 to 5 based on thelevel of X-disease symptoms and on tree vigor, including presence ofdiscolored leaves (usually red), degree of stunting of foliage and shoots,and amount of reduced plant vigor (length of current year shoots):0 = whole plant died; 1 = leaves were discolored, most shoots andleaves were very stunted, and very low growth vigor; 2 = leaveswere discolored, most shoots and leaves were stunted, and low growthvigor; 3 = leaves were discolored, most shoots and leaves were

moderately stunted, and moderate growth vigor; 4 = all or part oftree with slight symptoms and high growth vigor; and 5 = no symp-toms and high growth vigor.

2.3. PCR quantification of X-disease phytoplasmas in chokecherry

2.3.1. Primer designAn 837 bp nested-PCR product amplified from X-disease

phytoplasmas in chokecherry using the universal primer pairsR16F2/R2 and 16S rRNA group-specific primer R16(III)F2/R1 accordingtoGuo et al. (2000)was sequenced. Sequence similarity analysis verifiedthat the cloned 16S rRNA gene of X-disease phytoplasmas in chokecher-ry belongs to the western X-disease phytoplasma group (16SrIII)(Fig. 1). Therefore, we designed the primers for quantitative real-timePCR based on the published genome sequence of western X-diseasephytoplasmas in the NCBI database (accession: FJ376628). The primerswere designed using software DNASTAR (Lasergene). The forwardprimer is: ChXF10 (5′-CGAGGAACCTTCGGGTTTTAGTG-3′) and thereverse primer is: ChXR13 (5′-AGGCCTTTACCCTACCAACT-3′). A spe-cific 201 bp fragment was amplified from chokecherry X-diseasephytoplasmas by this primer pair.

2.3.2. Standard curveTo generate a standard curve for the absolute quantification of the

X-disease pathogen in chokecherry, an artificial plasmid DNA tem-plate containing the real-time PCR amplicon was constructed follow-ing the instructions for pGEM-T easy vector (Promega Corporation).The purified plasmid DNA was diluted 1:10 using 10 ng/μl DNA ex-tracted from healthy chokecherry (non-inoculated control) startingfrom 100 pg/μl to 0.001 pg/μl (Martini et al., 2007). The standardcurve was generated by the Absolute Quantification of ABI 7900 HTFast Real-Time system. The amount of phytoplasma DNA in a 10 ngDNA mix that contains both chokecherry genomic DNA and X-diseasephytoplasma DNA was recorded automatically based on the equationof the regression line fitted to the standard curve. The copy number ofphytoplasma DNA per 10 ng DNA mix was estimated based on theformula: number of copies = (DNA amount × 6.022 × 1023) / (lengthof plasmid DNA × 1 × 109 × 650), where DNA amount is the amount(ng) of phytoplasma DNA automatically recorded by the instrumentsoftware; 6.022 × 1023 is Avogadro's number indicating the numberof molecules of the template DNA per gram; length of plasmid DNA isthe nucleotide number of the plasmid DNA (3216 bp); 1 × 109 is usedto convert ng from gram; 650 is the average weight of a base pair nucle-otide of DNA (http://www.uri.edu/research/gsc/resources/cndna.html).

2.3.3. DNA extractionLeaves were randomly collected from both the inoculated and

control (un-grafted) chokecherry plants on August 2013. Total DNAwas extracted from leaf tissues following the method of Lodhi et al.(1994) with some modifications that included washing ethanol-precipitated DNA with 70% ethanol in a slow moving shaker for 3–5 hbefore dissolving in TE buffer and then digesting with both RNase A(10 mg/ml) and Proteinase K (1 mg/ml) for 60 min at 37 °C. The DNAconcentrationwas determined using aNanoDropND-1000 Spectropho-tometer (Thermo Fisher Scientific Inc.) and the DNAwas then stored ina refrigerator (4 °C) until use.

2.3.4. Real-time PCRReal-time PCR was performed in a 96-well optical reaction plate

using an ABI 7900HT Fast Real-Time system (Applied Biosystems).Absolute quantification assays and data analyses were performedusing the software version SDS v2.2 (Applied Biosystems). A 15 μl PCRreaction contained 10 ng template DNA (mix of chokecherry and phy-toplasma DNA) (for standard curve, using 0.001–100 pg plasmidDNA), 0.3 μMof each primer, 7.5 μl of PerfeCTa™ SYBRGreen SuperMix,ROX™ (Quanta Biosciences), and sterile ddH2O. A DNA-free control was

Forward primer16SrIC-HQ589196 ACGGAAACCTT------CGGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGCAACCTGC 8916SrIIIA-FJ376628 CGAGGAACCTT------CGGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGCAACCTGC 5516SrIA-AY863194 ----------------------------------------------------- -------16SrIIIB-AF189288 ------------------------------------------------------------16SrIIIA-JN882012 ------------------------------------------------------------16SrIV-JF309075 --------------------------------AACGGGTGAGTAACACGTAAGCAACCTGC 2916SrII-JX871467 ACGGAAACCTT------CGGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGCAACCTAC 11416SrVI-AF409070 ACGAAAACCCCTTAA--AAGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGTAACCTGC 11816SrVII-AF189215 ACGGAAACCCCTCAA--AAGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGTAATCTAC 11816SrV-AY197655 ACGGAGACCCTTCAA--AAGGTCTTAGTGGCGAACGGGTGAGTAACACGTAAGTAACCTAC 11816SrVIII-AF353090 ACGGAAACTTTGCAA--AGAGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGTAACCTGC 11816SrIX-EF186825 ACGGAAACCTT------AGGGTTTTAGTGGCGAACGGGTGAGTAACACGTAAGCAACCTGC 11416SrIB-FN298629 ACGGAAGTTTAAGCAATTAAACTTTAGTGGCGAACGGGTGAGTAACGCGTAAGCAATCTGC 9516SrXA-AF248958 ACGGAAACTT-------TTAGTTTCAGTGGCGAACGGGTGAGTAACACGTAAGTAACCTGC 113

Reverse primer16SrIC-HQ589196 CATTAGTTAGTTGGCAGGGTAAAGGCCTACCAAGACTATGATGTGTAGCTGGACTGAGAG 26716SrIIIA-FJ376628 CATTAGTTAGTTGGTAGGGTAAAGGCCTACCAAGACTATGATGTGTAGCTGGACTGAGAG 23316SrIA-AY863194 CATTAGTTAGTTGGCAGGGTAAAGGCCTACCAAGACTATGATGTGTAGCTGGGCTGAGAG 13516SrIIIB-AF189288 CATTAGTTAGTTGGCAGGGTAAAGGCCTACCAAGACTATGATGTGTAGCTGGACTGAGAG 14716SrIIIA-JN882012 CATTAGTTAGTTGGTAGGGTAAAGGCCTACCAAGACTATGATGTGTAGCTGGACTGAGAG 15516SrIV-JF309075 CATTAGTTAGTTGGTAGGGTAATGGCCTACCAAGACGATGATGTGTAGCTGGACTGAGAG 20816SrII-JX871467 TATTAGTTAGTTGGTAGGGTAA TGGCCTACCAAGACGATGATGTGTAGCTGGACTGAGAG 29216SrVI-AF409070 CATTAGTTAGTTGGTAGAGTAAAAGCCTACCAAGACGATGATGTGTAGCTGGACTGAGAG 29716SrVII-AF189215 CATTAGTTTGTTGGTGGGGTAATGGCCTACCAAGACGATGATGTGTAGCTGGACTGAGAG 29716SrV-AY197655 CATTAGTTAGTTGGTGAGGTAAAGGCTTACCAAGATTATGATGTGTAGCTGGACTGAGAG 29716SrVIII-AF353090 CATTAGTTTGTTGGTAAGGTAATGGCTTACCAAGACTATGATGTGTAGCTGGACTGAGAG 29816SrIX-EF186825 CATTAGTTAGTTGGTAAGGTAAAAGCTTACCAAGACGATGATGTGTAGCTGGACTGAGAG 29316SrIB-FN298629 CATTAGTTAGTTGGTGGGGTAAAGGCTTACCAAGACTATGATGTGTAGCCGGGCTGAGAG 27216SrXA-AF248958 CATTAGTTAGTTGGTAAGGTAA CGGCTTACCAAGACTATGATGTGTAGCTGGACTGAGAG 288

******* ***** **** ** ******** ************ ** *******

Fig. 1. Partial sequence alignment of the 16S rRNA gene from different phytoplasma groups. The primer pair (underlined) used for quantitative real-time PCR was designed based on thesequence of 16SrIIIA (red boxed). Red and pink shadows indicate the nucleotide variation; “*” indicates an identical nucleotide, “-” indicates a gap in the sequence. Nucleotide accessions:16SrIA-AY863194, tomato big bud phytoplasma; 16SrIB-FN298629, aster yellows phytoplasma; 16SrIC-HQ589196, clover phyllody phytoplasma; 16SrII-JX871467, peanut witches'-broom phytoplasma; 16SrIIIA-FJ376628, western X phytoplasma; 16SrIIIA-JN882012, Canadian peach phytoplasma; 16SrIIIB-AF189288, clover yellow edge phytoplasma; 16SrIV-JF309075, palm lethal yellowing phytoplasma; 16SrV-AY197655, elm yellows phytoplasma;16SrVI-AF409070, clover proliferation phytoplasma; 16SrVII-AF189215, ash yellows phyto-plasma; 16SrVIII-AF353090, loofah witches'-broom phytoplasma; 16SrIX-EF186825, pigeon pea witches'-broom phytoplasma; 16SrXA-AF248958, apple proliferation phytoplasma.

3D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

run for each experiment. Amplification conditions were: (1) incuba-tion at 95 °C for 5 min; and (2) DNA amplification for 35 cycles at95 °C for 15 s, 56 °C for 20 s, and 72 °C for 30 s. To evaluate amplifi-cation specificity, melting curve analysis was performed at the end ofeach PCR run according to the manufacturer's recommendation. Themelting curve temperature profile was generated through the cycleof 95 °C for 1 min, 60 °C for 1 min, and heating to 95 °C for 20 min.PCR product identity was confirmed by electrophoresis in a 2% aga-rose gel. Signal threshold level was set automatically by the instru-ment software.

2.3.5. Specificity and sensitivity of real-time PCRPrimer specificity was evaluated by melting curve analysis at the

end of each PCR run as described above and by amplification of 16SrRNA from other phytoplasmas. Melting curve analysis could deter-mine if the melting temperature of the PCR product of chokecherryDNA is the same as that of the plasmid DNA. The primers were alsoused to amplify DNA from non-inoculated chokecherry and fromphytoplasma DNA of peach X-disease (PX, 16SrIII-A), goldenrod yel-lows (GRY, 16SrIII-D), elm yellows (EY1, 16SrV-A), jujube witches'-broom (JWB, 16SrV-B), and ash yellows (AshY, 16SrVII-A) using con-ventional PCR. Conventional PCR was performed under the sameconditions as real-time PCR except 2× GoTaq® Green Master Mix(Promega) was used instead of PerfeCTa™ SYBR Green SuperMix.To assess the detection sensitivity, real-time PCR was carried outusing serial dilutions of 0.1 pg–50,000 pg DNA extracted from theinoculated chokecherry. The same serial dilutions of DNA wereused to compare the detection efficiency of the real-time PCR andnested PCR. The nested PCR was performed based on the method ofWang (2012). The universal primer pair was R16 F2: 5′-ACGACTGCTGCTAAGACTGG-3′ and R16 R2: 5′-TGACGGGCGGTGTGTACAAACCCCG-3′ and the X-disease phytoplasma-specific primer pair wasR16 (III) F2: 5′-AAGAGTGGAAAAACTCCC-3′ and R16 (III) R1: 5′-TCCGAACTGAGATTGA-3′.

2.4. Statistical analysis

Real-time PCR data were exported from ABI 7900 software ver-sion SDS v2.2 for calculation of mean threshold (Ct) values and stan-dard deviations (SD). Standard linear regressions (Y = a + bX) ofthe log concentration of the target DNA copies (Y) versus the meanCt values (X) were obtained. PCR amplification efficiency (E) wascalculated from the slopes of the regressions using the equation:Efficiency = −1 + 10(−1/slope) (http://www.genomics.agilent.com/CalculatorPopupWindow.aspx?CalID=8). The Student's T-test wasused to determine if there is a statistically significant difference in theamount of phytoplasma between X-disease resistant and susceptiblechokecherries.

3. Results

3.1. Primer specificity and sensitivity

Primers ChXF10 and ChXR13 were designed based on the 16SrRNA sequence of western X-disease phytoplasmas (accession:FJ376628) and a 201 bp fragment was expected. To test the specific-ity, this primer pair was used to amplify phytoplasma DNA in the16SrIII group and other phytoplasma groups. Amplification was ob-served from all phytoplasmas in the 16SrIII group (chokecherry X-disease, peach X-disease, and goldenrod yellows), while no amplifica-tion was detected from the 16SrV-A group (elm yellows), 16SrV-Bgroup (jujube witches'-broom), and 16SrVII-A group (ash yellows), in-dicating that the primer is specific to the X-disease phytoplasma group(Fig. 2). A uniquemelting peak at 79.9 °C (±0.3)was observed from thereal-time PCR for chokecherry X-disease, peach X-disease, and golden-rod yellows phytoplasmas, and the same peak was detected when theartificial plasmid DNA was used. It further confirmed that the primerpair is specific to X-disease phytoplasmas.

A serial dilution of chokecherry X-disease phytoplasmas wasused to test the sensitivity of the primers in real-time PCR assays.

766 50030015050

M NC CX PX GRY EY AY JWB M

Fig. 2. PCR amplification of phytoplasma DNA from diseased-plant samples. M = DNAmarker (bp); NC = negative control (healthy chokecherry); CX = chokecherry X-disease (16SrIII); PX = peach X-disease (16SrIII); GRY = goldenrod yellows (16SrIII);EY = elm yellows (16SrV); AY = ash yellows (16SrVII); JWB = jujube witches' broom(16SrV).

4 D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

The correlation between Ct values and log10 values of the initial amountof X-disease phytoplasma DNAwas nearly perfect (R2 N 0.999). This pairof primers was able to detect X-disease phytoplasmas from the DNAmix(chokecherry genomic DNA and X-disease phytoplasma DNA) at theamount of 10 and 1 pg by conventional PCR and real-time PCR, respec-tively. In another experiment, both real-time PCR and nested PCR hadsimilar sensitivity, with the limit of detection of X-disease phytoplasmasat 1 pg of X-disease infected chokecherry DNA (Fig. 3).

3.2. Quantification of X-disease phytoplasmas in chokecherry

To accurately quantify the copy number of X-disease phytoplasmasin chokecherry, a standard curve was developed by amplifying 10-foldserially diluted plasmid DNAs. A 201 bp X-disease phytoplasma-specific fragmentwas amplifiedwhen the concentration of the templateplasmid DNA was ≥0.001 pg. The amplification efficiency was 1.75(Fig. 4). Using the formula provided above, 1 ng of artificial plasmidDNA contains 2.88 × 108 copies of the plasmid DNA or 0.001 pg plas-mid DNA contains 288 copies of X-disease phytoplasma DNA. The stan-dard curve showed a linear relationship between the log 10 value of thetemplate DNA amount and Ct values (R2 N 0.9997), indicating that themethod is suitable for a quantitative assaywithin theDNA copy numberfrom 288 to 2.88 × 107 (Fig. 4A). Products of the real-time PCR showeda single band with the expected size (201 bp) (Fig. 4B). Therefore,the standard curve can be used to accurately detect and quantify X-disease phytoplasmas in chokecherry when its copy number fallsinto the range of 288 to 2.88 × 107 with a Ct value ≤ 30.4. X-diseasephytoplasmas in 46 infected chokecherry plants were quantified usingquantitative real-time PCR. The copy number of the phytoplasmas ineach individual chokecherry plant was calculated using the standardcurve. Based on their Ct values (17.7–31.2), the copy number of X-disease phytoplasmas in these chokecherry plants ranged from 168 to314,920 (Table 1).

DNA serial dilutions (ng)M

50 10 1

Real-time PCR (Ct) 16.6 19.1 22.8

Conventional PCR

Nested PCR

300150

1000750

Fig. 3.Comparison of amplification sensitivity among real-time PCR, conventional PCR, andnestvalue is an average of triplicates. M = DNA marker (bp); ND = not detected; NC = negative

3.3. Correlation between X-disease resistance and copy number ofphytoplasmas in chokecherry

Chokecherry plants that were graft-inoculated were visually ratedfor resistance to X-disease based on the symptomatic criteria. Of 46plants, 15, 0, 13, 12, and 6 chokecherries were rated 5, 4, 3, 2, and 1, re-spectively (Table 1). It is noted that no plant was rated 4. Real-time PCRresults showed that all chokecherries thatwere rated 5 contained≤900copies of X-disease phytoplasmas except one plant (OO-2) that had1957 copies. Plants thatwere rated 1–3 contained a significantly greaternumber of phytoplasmas than plants rated 5, with a range from 11,155(19–5) to 314,920 (JJ-4) (Table 1). Therewas no significant difference incopy number among chokecherries that were rated 1 to 3. Statisticalanalysis showed that the copy number of X-disease phytoplasmas inthe resistant chokecherries (rated 5) was significantly less than the sus-ceptible chokecherries (rated 1–3) (P b 0.001) (Fig. 5).

4. Discussion

Quantitative real-time PCR is able to monitor the progress of DNAamplification by measuring fluorescence. The type of probes (SYBRGreen) and data analysis (software) are two major factors affectingefficacy and accuracy of qPCR method. In this study, we used the ABI7900HT Fast Real-Time PCR system with PerfeCTa™ SYBR GreenSuperMix, ROX™ (Quanta Biosciences) meets the requirement of themachine. For another machine, such as LightCycler (Roche MolecularBiochemicals), is used, SYBR Green PCR Master Mix (Roche) should beused for the best result. Torres et al. (2005) tested the same samplesin two different machines (ABI 7700 and LigthCycler). Similar resultswere obtained even though the melting peak was different. Althoughsamples in this study were not tested in other real-time PCR instru-ments, similar results would be expected if the PCR reaction and condi-tions can be modified accordingly.

The real-time PCR primer pair used in this studywas designed basedon the X-disease phytoplasma sequence that showed the most dif-ference in nucleotides among searched phytoplasmas in the 16SrRNA region (Fig. 1). Although this primer pair is not exclusively spe-cific to chokecherry X-disease, it proved to be specific to the 16SrIIIgroup of phytoplasmas (X-disease group) after testing on three otherphytoplasmas (Fig. 2). High specificity of PCR primers will increasethe accuracy of detection and quantification of plant pathogens. Evenif this primer set was not specific to the X-disease phytoplasma group,it would not be a problem for detection and quantification in an artifi-cially inoculated plant population with a known phytoplasma strainonly, especially for amapping population, because plants in the popula-tion generally are seedlings that are phytoplasma-free before the artifi-cial inoculation if they are grown in the greenhouse.

The real-time PCR assay in this study showed high sensitivity. It candetect phytoplasmas from a DNA mix at as low as 0.001 ng, while theminimum concentration of the DNA mix for a visual amplification was

0.1 0.01 0.001 0.0001 NCM

26.2 29.5 33.5 ND ND

ed PCR. DNAwas extracted from a chokecherry inoculatedwith X-disease phytoplasmas. Ctcontrol (healthy chokecherry).

y = -4.126x + 30.268R² = 0.9997

efficiency=1.750

10

20

30

40

0 1 2 3 4 5 6C

t va

lue

fg plasmid DNA (log 10)

M 100pg 10pg 1pg 0.1pg 0.01pg 0.001pg 0.0001pg NC M

76650030015050

A

B

Fig. 4. A: The standard curve used for real-time PCR assay to quantify X-disease phytoplasmas in chokecherry plants. B: Products of real-time PCR were detected in 2% agarose gel(M = DNAmarker, bp; NC = negative control). The graphs illustrate the efficiency and sensitivity of 16S rRNA gene fragment amplification from serial dilutions of artificial plasmidDNA.

5D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

0.01 ng for a conventional PCR using the same primer pair (Fig. 3),which largely improves the detection sensitivity. A separate experimentwas conducted to detect X-disease phytoplasmas in graft-inoculatedchokecherry plants through the entire growing season. Although noX-disease symptoms could be seen on young leaves, more than 379copies of X-disease phytoplasmas were detected from those leaves,which further confirmed that this method showed high sensitivity use-ful for early detection of phytoplasmas in chokecherry plants. The highsensitivity of the real-time PCR is particularly valuable to detect and

Table 1Threshold cycles (Ct) values, X-disease resistance rating, and phytoplasma copy number (per 1

Chokecherry lines Ct values Copies Rating

CC-2 31.2 168 5CC-1 30.4 264 5R4 30.1 315 5T1 29.7 397 5QQ-1 29.3 495 5QQ-3 29.2 523 5CC-4 29.0 570 5KK3 28.9 608 5R3 28.9 621 5CC-3 28.5 766 52-1 28.4 806 5R5 28.4 833 5207-1 28.3 855 5JJ2 28.3 857 5OO-2 26.8 1957 5Average 29.0 669 R

quantify X-disease phytoplasmas because the appearance of phytoplas-ma symptoms is not fast in trees. Aldaghi et al. (2007) reported that 75%of apple rootstocks showed symptoms by the end of the 7thmonth aftergraft inoculation. Peterson (1984) studied the spread and damage of X-disease for chokecherry in eastern Nebraska and found that typicalsymptoms of X-disease appeared on 60% of the trial chokecherry treeswithin 3 years after the X-disease pathogen was introduced and moretrees had symptoms after another two years. Such a long time for symp-tom development may cause unreliable results in symptom-based

0 ng DNA mix) in inoculated chokecherry plants.

Chokecherry lines Ct values Copies Rating

19-5 23.7 11,155 3D1 23.3 13,933 3203-3 22.9 17,461 1203-4 22.8 18,550 1U-1 22.6 20,433 2203-1 21.6 36,530 22-2 21.4 40,195 17-1 21.3 43,639 319-2 21.1 46,843 3207-3 21.0 49,571 2OO-1 21.0 51,226 3QQ-2 20.9 52,300 3J2 20.9 54,791 1QQ-4 20.8 55,931 3D2 20.8 57,546 3D5 20.8 58,345 3203-2 20.7 61,628 1R2 20.6 61,806 37-4 20.5 65,436 2J3 20.3 73,926 2J4 20.3 75,089 27-3 20.0 87,628 2R1 19.8 97,998 3JJ5 19.5 114,993 3U-2 19.4 125,765 2GG-1 18.8 172,860 1GG-4 18.7 180,466 2JJ3 18.6 188,887 3JJ1 18.6 192,719 2GG-5 18.2 241,070 2JJ4 17.7 314,920 2Average 20.6 86,569 S

5

10

15

20

25

30

Resistant Susceptible

0

35

Ct

valu

e/10

ng c

hoke

cher

ry D

NA ***

Fig. 5. Ct values generatedwhen using quantitative real-time PCR to amplify phytoplasmaDNA from X-disease resistant and susceptible chokecherry plants. Standard error wasexpressed using a vertical line on the bar. Asterisks indicate significant difference in Ctvalues between resistant and susceptible plants (P b 0.001).

6 D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

screening for disease resistance, particularly for field grown trees. Areal-time PCR assay will not only provide the tool for early detectionof phytoplasmas, it will also be a more objective method to evaluateplant resistance because inhibition of pathogen proliferation inplants might be an early and direct sign or evidence of host resistancethat cannot be known with visual evaluation of disease symptoms.

Studies of host resistance and pathogen aggressiveness to eluci-date mechanisms rely on highly controlled conditions of host, path-ogen, and environment. Here, clonally propagated chokecherry linesof known resistance to a particular X-disease strain of known aggres-siveness are inoculated in an environment in which the expected hostreactions develop reliably and other phytoplasmas are excluded. ThePepsi-2 chokecherry X-disease phytoplasma strain is not known orexpected to be unique among 16SrIII phytoplasmas. For early studiesof X-disease resistance in chokecherry, it has been used as a representa-tive highly aggressive strain in which susceptible andmoderately resis-tant chokecherry phenotypes develop typical X-disease symptoms ascompared to no X-disease symptoms on highly resistant phenotypes.Some other isolates behaved similarly in early trials, while a widerange of aggressiveness levels was exhibited among other chokecherryX-disease isolates. With identification of chokecherry lines with knownresistance reactions to the Pepsi-2 strain, hypotheses of resistancemechanisms can begin to be evaluated, as in this study. As evaluationsproceed, greater understanding of the mechanism of resistance inchokecherry to the Pepsi-2 strain will be sought, and expansion of thehost and pathogen pools is expected to identify pathosystems inwhich other resistance and aggressiveness mechanisms operate. Thus,the results reported in this study to be a significant but still early devel-opment in understanding and utilizing X-disease resistance mecha-nisms to control the disease in chokecherry and other stone fruits.

Limited information on genetics of plant resistance to phytoplasmasis available. Singh et al. (2007) reported that a single recessive genewasfound to control phyllody (a phytoplasma disease) resistance in cul-tivated sesame varieties. Recently, X-disease resistance in a choke-cherry mapping population was studied (Wang, 2012). X-diseaseresistance was rated in a 40-plant population in the third year afterinoculation, of which, 9, 5, 15, and 11 lines were rated as 5, 2, 1,and 0, respectively. There were no lines rated as 4 or 3. The ratiobetween resistant (R) and susceptible (S) lines was 9R:31S, whichfit to 1:3 (X2 = 0.13 b X2

0.05, 1 = 3.84) by chi-square analysis, suggest-ing that X-disease resistance in chokecherrymight be governed by a re-cessive gene. However, the distribution of X-disease resistanceappeared to be normal in another large mapping population; thereforeX-disease resistance may be controlled by QTLs (quantitative trait loci)(data not shown). In this study, similar ratings were taken on 46 tissue

culture-propagated chokecherry plants that were inoculated andgrown in the greenhouse. Phytoplasma copy number derived fromthe real-time PCR and disease severity ratings indicated that these46 chokecherries could be classified into two groups: resistant(b1000 copies and rating of 5) and susceptible (N10,000 copies andrating of 1 to 3). A significant difference in copy number in plantsrated as resistant compared to plants rated as susceptible indicatesthat X-disease phytoplasmas proliferate much less in resistant plantsthan in susceptible plants. No significant difference in copy numberamong plants that were rated from 1 to 3 was observed, suggestingthat differences in copy numbers do not explain disease severity dif-ferences among susceptible plants in these chokecherry selections.

Evaluation of disease resistance in plants is currently predominantlybased on disease symptoms. However, development of diseasesymptoms is inevitably influenced by environmental factors, partic-ularly for many perennial woody plants; therefore visual phenotypicrating of plant disease resistance, especially some quantitative resis-tance, appears to be changeable and often unreliable. Uncertainty inphenotyping of disease resistance is a major limitation in identifyingand mapping of disease resistance genes and understanding of themolecular basis of resistance. In this study, a quantitative real-timePCR method that is specific and sensitive was developed to detectand quantify X-disease phytoplasmas in chokecherry plants. Quanti-tative data derived from this assay would be more objective for eval-uating disease resistance because it directly monitors pathogenproliferation in plants at different developmental stages as com-pared to visual phenotypic rating scores; therefore, this methodwill facilitate quantitative phenotyping of disease resistance andhas great potential in enhancing plant breeding.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgments

This research was supported in part by the McIntire–StennisProject ND06212 and ND SBARE New & Emerging Crops ResearchFund Grant.

References

Aldaghi, M., Massart, S., Roussel, S., Jijakli, M.H., 2007. Development of a new probe forspecific and sensitive detection of ‘Candidatus Phytoplasma mali’ in inoculated appletrees. Ann. Appl. Biol. 15, 251–258.

Bertaccini, A., 2007. Phytoplasmas: diversity, taxonomy, and epidemiology. Front. Biosci. 12,673–689.

Christensen, N.M., Nicolaisen, M., Hansen, M., Schulz, A., 2004. Distribution ofphytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Mol.Plant-Microbe Interact. 17, 1175–1184.

Daniëls, B., De Landtsheer, A., Dreesen, R., Davey, M.W., Keulemans, J., 2012. Real-timePCR as a promising tool to monitor growth of Venturia spp. in scab-susceptible and-resistant apple leaves. Eur. J. Plant Pathol. 134, 821–833.

Davis, R.E., Zhao, Y., Dally, E.L., Lee, I.M., Jomantiene, R., Douglas, S.M., 2012. ‘CandidatusPhytoplasma pruni’, a novel taxon associated with X-disease of stone fruits, Prunusspp.: multilocus characterization based on 16S rRNA, secY, and ribosomal proteingenes. Int. J. Syst. Evol. Microbiol. 63, 766–776.

Doi, Y., Teranaka, M., Yora, K., Asuyama, H., 1967. Mycoplasma- or PLT-group-like micro-organisms found in the phloem elements of plants infected with mulberry dwarf, po-tato witches' broom, aster yellows, or paulownia witches' broom. Ann. Phytopathol.Soc. Jpn. 33, 259–266.

Gundersen, D.E., Lee, I.M., 1996. Ultrasensitive detection of phytoplasmas by nested-PCRassays using two universal primer pairs. Phytopathol. Mediterr. 35, 144–151.

Guo, Y.H., Cheng, Z.M., Walla, J.A., 2000. Characterization of X-disease phytoplasmas inchokecherry from North Dakota by PCR-RELP and sequence analysis of the rRNAgene region. Plant Dis. 84, 1235–1240.

Hren, M., Boben, J., Rotter, A., Kralj, P., Gruden, K., Ravnikar, M., 2007. Real-time PCR de-tection systems for Flavescence dorée and Bois noir phytoplasmas in grapevine: com-parison with conventional PCR detection and application in diagnostics. Plant Pathol.56, 785–796.

Kirkpatrick, B.C., 1989. Strategies for characterizing plant pathogenic mycoplasma-like or-ganisms and their effects on plants. In: Kosuge, T., Nester, E.W. (Eds.), Plant–Microbe

7D. Huang et al. / Journal of Microbiological Methods 98 (2014) 1–7

Interactions—Molecular and Genetic Perspectives. McGraw-Hill Publishing Co., NewYork, NY, pp. 241–294.

Korsman, J., Meisel, B., Kloppers, F.J., Grampton, B.G., Berger, D.K., 2012. Quantitative phe-notyping of grey leaf spot disease in maize using real-time PCR. Eur. J. Plant Pathol.133, 461–471.

Lee, I.M., Gundersen, D.E., Davis, R.E., Chiykowski, L.N., 1992. Identification and analysis ofa genomic strain cluster of mycoplasmalike organisms associated with Canadianpeach (eastern) X disease, Western X disease, and clover yellow edge. J. Bacteriol.174, 6694–6698.

Lee, I.M., Davis, R.E., Gundersen-Rindal, D.E., 2000. Phytoplasma: phytopathogenicmollicutes. Annu. Rev. Microbiol. 54, 221–255.

Li, W., Abad, J.A., French-Monar, R.D., Rascoe, J., Wen, A., Gudmestad, N.C., Secor, G.A., Lee,I.M., Duan, Y., Levy, L., 2009. Multiplex real-time PCR for detection, identification andquantification of ‘Candidatus Liberibacter solanacearum’ in potato plants with zebrachip. J. Microbiol. Meth. 78, 59–65.

Lodhi, M.A., Ye, G.N., Weeden, N.F., Reisch, B.I., 1994. A simple and efficient method forDNA extraction from grapevine cultivars, Vitis species and Ampelopsis. Plant Mol.Biol. Report. 12, 6–13.

Martini, M., Loi, N., Ermacora, P., Carraro, L., Pastore, M., 2007. A real-time PCRmethod fordetection and quantification of ‘Candidatus Phytoplasma prunorum’ in its naturalhosts. Bull. Insectol. 60, 251–252.

Ogawa, J.M., 1991. Diseases of temperate zone tree fruit and nut crops. Divisions of Agri-culture and Natural Resources. University of California, California.

Olivier, C.Y., Lowery, D.T., Stobbs, L.W., 2009. Phytoplasma diseases and their relationshipswith insect and plant hosts in Canadian horticultural and field crops. Can. Entomol.141, 425–426.

Peterson, G.W., 1984. Spread and damage ofWestern X-disease of chokecherry in easternNebraska plantings. Plant Dis. 68, 103–104.

Rosenberger, D.A., Jones, A.L., 1997. Seasonal variation in infectivity of inoculum from X-diseased peach and chokecherry plants. Plant Dis. Rep. 61, 1022–1024.

Sinclair, W.A., Lyon, H.H., 2005. Diseases of Trees and Shrubs, Second edition. ComstockPubl. Assoc., Ithaca and London.

Singh, P.K., Akram,M., Vajpeyi, M., Srivastava, R.L., Kumar, K., Naresh, R., 2007. Screening anddevelopment of resistant sesame varieties against phytoplasma. Bull. Insectol. 60,303–304.

Torres, E., Bertolini, E., Cambra, M., Montón, C., Martín, M.P., 2005. Real-time PCR for si-multaneous and quantitative detection of quarantine phytoplasmas from apple pro-liferation (16SrX) group. Mol. Cell. Probes 19, 334–340.

Wang, H.X., 2012. Identification of Molecular Markers Linked to X-disease Resistance inChokecherry (Prunus virginiana L.). (Dissertation) North Dakota State University.

Zhang, Z., Dai,W., Cheng, Z.M.,Walla, J.A., 2000. A shoot-tip culturemicropropagation sys-tem for chokecherry. J. Environ. Hortic. 18, 234–237.