pure.southwales.ac.uk€¦ · web viewsavvas, s, donnelly, j, patterson, t, dinsdale, r &...
TRANSCRIPT
Savvas, S, Donnelly, J, Patterson, T, Dinsdale, R & Esteves, S 2016, 'Closed nutrient recycling via microbial catabolism in an eco-engineered self regenerating mixed anaerobic microbiome for hydrogenotrophic methanogenesis' Bioresource Technology, vol 227, pp. 93-101. DOI: 10.1016/j.biortech.2016. 12.052
This is an Accepted Manuscript of an article published by Elsevier in Bioresource Technology on 18/12/2016, available online: http://dx.doi.org/10.1016/j.biortech.2016.12.052
© 2016. This accepted manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/
1
Closed Nutrient Recycling via Microbial Catabolism in an Eco-Engineered Self
Regenerating Mixed Anaerobic Microbiome for Hydrogenotrophic Methanogenesis
Savvas Savvasa,b*, Joanne Donnellya,b, Tim P. Pattersona,b, Richard Dinsdaleb and Sandra. R.
Estevesa,b
aWales Centre of Excellence for Anaerobic Digestion, bSustainable Environment Research
Centre, Faculty of Computing, Engineering and Science, University of South Wales,
Pontypridd CF37 1DL, Wales UK.1
A novel eco-engineered mixed anaerobic culture was successfully demonstrated for the first
time to be capable of continuous regeneration in nutrient limiting conditions. Microbial
catabolism has been found to support a closed system of nutrients able to enrich a culture of
lithotrophic methanogens and provide microbial cell recycling. After enrichment, the
hydrogenotrophic species was the dominating methanogens while a bacterial substratum
was responsible for the redistribution of nutrients. q-PCR results indicated that 7% of the
total population was responsible for the direct conversion of the gases. The efficiency of
H2/CO2 conversion to CH4 reached 100% at a gassing rate of above 60 v/v/d. The pH of the
1 Corresponding author: Savvas Savvas ([email protected])
2
culture media was effectively sustained at optimal levels (pH 7-8) through a buffering
system created by the dissolved CO2. The novel approach can reduce the process
nutrient/metal requirement and enhance the environmental and financial performance of
hydrogenotrophic methanogenesis for renewable energy storage.
Keywords: methanation; biocatalyst; nutrient recycling; CO2;
Highlights
A methanation biocatalyst was observed to be capable of self-regeneration
Self-regeneration was accomplished by creating a closed nutrient ecosystem
pH of the media was controlled solely by the amount of CO2 entering the reactor
1. Introduction
Despite an increase in the number of mitigation policies, global anthropogenic CO2
emissions are rising (Pachauri et al., 2014). At the same time, due to the recent green
intergovernmental agenda, by 2035 renewable energy sources are expected to be generating
more than 25% of the world’s electricity (Global Wind Energy Council (GWEC), 2014).
However, the fluctuating manner of energy production from these sources calls for
solutions which are capable of equalizing energy production to energy demand. When
power generation exceeds network capacity, curtailment (i.e. reducing renewable electricity
addition into the network) is often the only option. By 2030 due to a significant increase in
wind penetration, curtailment in northern Europe is expected to reach 9.3 TWh (Lew et al.,
2013). In the UK alone, due to the planned increase in onshore and offshore wind capacity,
3
curtailment could reach 2.8 TWh/a by 2020 and 50-100 TWh/a by 2050 (Qadrdan et al.,
2015).
The environmental and economic losses from this practice could be avoided if renewable
energy generation was coupled with the appropriate grid scale energy storage systems.
However, the flexibility and capacity of current energy storage technologies have major
limitations. Batteries need an increase in life cycle and depth of discharge accompanied
with a reduction in production costs (Barnhart et al., 2013). Super capacitors,
superconducting coils and flywheels have very short discharge periods, which makes them
suitable only as emergency UPS units (Gonzalez et al., 2004). Pumped hydro and
compressed air storage are limited by geographical factors (Denholm et al., 2010).
A novel way of tackling renewable energy storage is presented by the Power-to-Methane
(PtM) concept (Götz et al., 2016). This entails the conversion of renewable electricity into
H2 via water electrolysis, followed by the hydrogenation of CO2 to CH4, according to
Equation 1.
4H2 + CO2 → CH4 + 2H2O (ΔGo = -131 kJ/mol) (1)
The storage of renewable electricity as methane not only offers a way of balancing
generation with demand but could also be a means of increasing the supply of low carbon
methane to gas networks. The high capacity natural gas infrastructure of many countries
offers a supreme opportunity for the expansion of on-shore and off-shore renewable energy
generation with much higher energy return on investment (EROI) ratios due to the
reduction of curtailment. Additionally, areas which currently experience restricted
electricity grid availability can benefit from the PtM technology as it can offer an
4
alternative to the commissioning of new electricity transmission infrastructure. Renewable
electricity could then be converted to heat or to a transport fuel.
Hydrogenotrophic methanogens belong to the domain of Archaea and obtain their energy
by synthesizing CH4 from H2 and CO2. These have typically been an integral part of the
diverse microbial community within anaerobic digesters used for the conversion of
complex organic matter to CH4. However, they can be separately cultivated, thus creating a
single culture system. Such systems have been shown to successfully produce CH4 by using
CO2 as their sole carbon source and H2 as the electron donor, with efficiencies close to
100% (Burkhardt et al., 2015; Lee et al., 2012). Presently, such biological methanation
(biomethanation) has been primarily investigated at laboratory scale (Ako et al., 2008;
Burkhardt et al., 2015; Lee et al., 2012; Luo and Angelidaki, 2012; Martin et al., 2013;
Peillex et al., 1990; Rittmann et al., 2012; Schill et al., 1996; Seifert et al., 2014; Zhang and
Maekawa, 1993) with a small number of pilot projects, mainly in Germany, Denmark and
Austria (DENA, 2015; Götz et al., 2016).
Most knowledge regarding the biochemistry of methane formation from hydrogenotrophic
archaea has been derived by the study of two thermophilic strains, Methanothermobacter
thermautotrophicus and Methanothermobacter marburgensis. Due to their high doubling
times (< 5h and < 2h respectively), they were the first hydrogenotrophic methanogens to be
isolated and cultivated in high enough concentrations that allowed the purification of
enzymes/coenzymes involved in the reduction of CO2 to CH4 (Kaster et al., 2011). They
have fully decoded sequences, and have been the preferred options in pure culture
methanogenic reactors (Martin et al., 2013; Peillex et al., 1990; Rittmann et al., 2012; Schill
et al., 1996; Seifert et al., 2014).
5
Mixed thermophilic and mesophilic cultures have also been sourced from digested sewage
sludge or manure (Ako et al., 2008; Burkhardt et al., 2015; Lee et al., 2012; Zhang and
Maekawa, 1993). In these instances, enrichment of lithotrophic strains takes place by
continuous supply of CO2 and H2 while depriving the culture of an organic load, of solid or
liquid substrate. Mixed cultures have the advantage of being inexpensive and robust.
However, multiple strains with diverse growth rates and needs can result in difficulties in
achieving optimum conditions and performance (Ju et al., 2008; Luo and Angelidaki,
2012). So far, the reported CH4 productivity rates of mixed enriched culture reactors also
appear to be significantly lower (10.1 v/v/d with 91% v/v CH4 in the effluent gas) (Luo and
Angelidaki, 2012) than the ones achieved by monoculture reactors (511 v/v/d with 60% v/v
CH4 in the effluent gas) (Seifert et al., 2014) and (288 v/v/d with 96% CH4% in the effluent
gas) (Peillex et al., 1990), although some recent studies using pure cultures have only
achieved outputs significantly lower than this (9.84 v/v/d with 96% v/v CH4 in the effluent
gas and 65.6 v/v/d with 34% v/v CH4 in the effluent gas) (Martin et al., 2013).
Kinetic studies for pure and mixed enriched cultures in chemostats show that growth and
methane formation are dependent on the availability of hydrogen in its dissolved state as
well as the availability of a number of nutrients in the culture medium (Ako et al., 2008; De
Poorter et al., 2007; Schill et al., 1996; Zhang and Maekawa, 1993). Nutrient availability
has been regulated by the continuous dosing with a defined nutrient medium (liquid media
dilution rate); however, this requirement for nutrient addition can limit the practical and
economic viability of the process. In order for a steady state to be achieved growth rates
need to be equalized to biomass washout rates. However, growth and methanogenesis
appear to be closely coupled under conditions where the rate of hydrogen consumption
6
does not allow for a pool of excess hydrogen to be formed in the media (De Poorter et al.,
2007). For a system that aims for the complete conversion of input gases this means that as
conversion rates increase so do growth rates and consequently the required biomass
washout rates for a steady state to be achieved. This unavoidably leads to high nutrient
dosing requirements.
To give an example of magnitude, CH4 productivities of 288 v/v/d have been reported
(Peillex et al., 1990) with continuous CSTR reactors where the liquid medium was renewed
at a rate of 3.6 reactor volumes d-1 in order for the system to reach a steady state in terms of
biomass concentration. At a commercial scale this would add considerably to the running
costs of the system as it would increase both the degree of control required for stable
operation and the expenses for consumables. A high environmental cost could also be
incurred as effluents rich in microbial biomass and some heavy metals are likely to require
treatment prior to disposal. As a consequence, the elimination or at least the reduction of
the addition of chemical species would be desirable.
In this study an approach was examined where the biomethanation reaction was allowed to
proceed continuously in terms of gas conversion (chemolithotrophy) while the initial
inoculum (obtained from a full-scale digester) in the reactor was starved of any additional
micro or macro nutrients over a period of 6 months of operation. The aim of the study was
to investigate the extent to which the mixed microbial culture catabolism could redistribute
the initial pool of nutrients in the medium and if such a mechanism could exist in parallel
with the process of hydrogenotrophic methanogenesis. The study also introduces for the
first time a pH control mechanism which solely depends on the amount of CO2 entering the
methanation reactor thus substituting the use of pH buffering solutions.
7
2. Materials and Methods
2.1. Inoculum
Anaerobically digested mesophilic sewage sludge collected from Cog Moors Wastewater
Treatment Plant in Cardiff, South Wales, UK was used as the inoculum. The plant operates
a conventional digestion process and treats approximately 90% of secondary and 10% of
primary sludge. The plant runs typically at a temperature of 35±2oC. Prior to use, the sludge
was filtered through a 125 μm stainless steel sieve to approximately 17 g/L TS and 9.5 g/L
VS. No pH/redox buffering agents or nutrient solutions were used throughout the
experiment.
2.2. Reactor set up and operating conditions
The main body of the reactor comprised a 110 cm tall glass cylinder with a working volume
of 1.5 L. A centrifugal pump (NewJet 1200, Newa Tecno Industria Srl, Italy) was
connected to a port at the side of the reactor to recirculate the liquid media at a constant
flowrate (6 L/min) by taking the liquid from the bottom side of the reactor and
reintroducing it at the top as shown in Figure 1. A gas inlet was attached to the bottom of
the glass cylinder so that the gas was directly drawn into the pump as soon as it entered the
reactor. As such, the pump served as a gas - liquid mixer and contributed to the breaking up
of the gas bubbles as these passed through the pump impeller (Esteves et al., 2015). Several
other ports served as data collection points for continuous pH, temperature and reaction
efficiency measurements and for sampling and analysis purposes. The gas feedstock was a
mixture of CO2 and H2, both supplied from compressed gas cylinders. The gas flowrate and
composition were continuously monitored by a series of gas sensors and flow meters
(bespoke manufactured tip meters) and adjusted according to experimental requirements.
8
The gas flow exiting the reactor was also continuously analysed by the same methodology.
The temperature of the liquid media was maintained at 37±0.5oC throughout the experiment
with the use of an external heating element connected to a temperature control unit (Elitech
STC-1000, Elitech, UK).
2.3. Analytical methods
Gas composition was determined in real time by infra-red sensors (Premier Series 0-100%
Vol CO2/CH4 Voltage output 0.4-2.0V, Dynament Ltd) and by in-line hydrogen solid-state
sensors (H2Scan HY-OPTIMA 740, 0-100% Vol H2, 4-20mA output). Gas composition
was also periodically analysed with a gas chromatograph (Varian Inc., CP-4900) equipped
with two columns, one for CO2 (Porapack Q, Varian – 10 m x 0.15 mm) and one for CH4,
H2, N2 and O2 (Molsieve 5A Plot, Varian – 10 m x 0.32 mm). The carrier gas used was Ar.
Gas flow rates were measured by custom made tip-meters and logged in LabVIEWTM.
Volatile Fatty Acids (VFAs) were determined according to (Cruwys et al., 2002) using a
head space autosampler gas chromatograph (Perkin Elmer, AutosystemXL) equipped with
a flame ionization detector and a Supelco Ltd. column (30 m x 0.32 mm). The carrier gas
was N2. Metal analysis was carried out by ICP-OES (Inductively coupled plasma optical
emission spectrometry) on samples prepared by acid digestion according to (EPA, 1996).
pH was determined in real time with the use of a pH electrode HI-1001 (Hannah
Instruments, UK) connected to the main body of the reactor. The electrode was connected
to a BL-931700-1 pH controller (Hannah Instruments, UK). Total Solids (TS) and Volatile
Solids (VS) of the reactor matrix/effluent were measured according to (APHA, 2012).
2.4. Data acquisition
9
Data on temperature, pH, gas composition and gas flow were collected in real time with the
use of individually dedicated sensors connected to a data acquisition device (DAQ USB
6002, National InstrumentsTM UK). The software used for data logging was LabVIEW
(National InstrumentsTM UK). An interface unit was built and used as a server for signal and
power distribution. The data logging frequency was set to 0.3 Hz. Recalibration of the gas
and pH sensors took place once a month according to the manufacturer’s guidelines.
2.5. Microbial profiling
A PowerSoil DNA Isolation kit (Mo Bio Laboratories Inc., USA) was used for DNA
extraction. After purification, DNA concentration was measured with a spectrophotometer
based on absorbance at 260 nm (NanoDrop 1000, Thermo Scientific, UK). Bacterial rDNA
standards were used for the quantification of total bacteria according to the method
described in (Suzuki et al., 2000). Hydrogenotrophic and acetoclastic methanogens were
quantified by using the method defined in (Yu et al., 2005). The DNA for positive controls
was extracted from pure cultures supplied by the Leibniz Institute (DSMZ). The species
Halorubrum saccharovorum (DSM 1137) was used as control for total bacteria. In order to
cover most of the methanogenic populations typically present in AD systems, five different
order and family levels were investigated by using the following species: Methanosaeta
concilii (DSM 6752), Methanosarcina barkeri (DSM 800), Methanobacterium bryantii
(DSM 863), Methanomicrobium mobile (DSM 1539), Methanococcus voltae (DSM 1537).
Real-time PCR was conducted on a Roche LightCycler nano by using TaqMan
primers/probe sets (Life Technologies, Thermo Scientific, U.K) targeting 16S rRNA gene
sequences. Calibration curves were produced by using known amounts of oligonucleotides
10
(Table 1) that contained complementary sequences to the primers and probes. All real-time
PCR samples were analysed in triplicate.
3. Results and discussion
3.1. Hydrogenotrophic methanogenic capacity and regulation of pH
During operation the reactor was subjected to a series of different gas feeding rates
according to the observed methanogenic capacity of the culture at various H2/CO2 ratios.
The aim was to achieve almost complete conversion of CO2 to CH4. The reason for this was
the fact that in the absence of additional chemical pH buffering agents, any amount of
unconverted CO2 was observed to lower the pH to sub-optimal levels (< 7) due to the
formation of H2CO3. Conversely, it was also observed that by decreasing the amount of
CO2 in the feeding gas to levels below the level required for its complete utilization resulted
in an increase of the pH to sub-optimally high levels (> 8). Figure 2 shows the volumetric
percentage of CH4 in the effluent gas relative to the percentage of CO2 in the feeding gas in
the course of 180 days. Figure 3 shows the volumetric percentage of CH4 in the effluent gas
in relation to the applied gas feeding rates during the same period as well as the pH of the
media.
Due to the high data logging frequency (0.3 Hz) the data points representing the pH and the
volumetric percentage of gases in Figures 2 and 3 had to be averaged to 1 hour periods.
Also any non-operational periods have been omitted from the graphs. From Figure 2 it can
be observed that for almost half of the operational period (up to day 65), the percentage of
CO2 entering the reactors was not stable. This is due to the gas mixing and delivery system
being sub-optimised and regularly drifting from the chosen set-point as well as due to the
effort to control and stabilize the pH of the culture by regulating the amount of CO2 in the
11
gas feed (H2/CO2 ratio), which was accomplished through a degree of adjustments based
initially on trial and error. Figure 2 reveals how strongly the percentage of CH4 in the
effluent gas depended on the percentage of CO2 in the influent gas since many of the peaks
and troughs of the two curves are mirroring each other. After a certain degree of stability
has been established regarding the feeding gas composition (after day 65), it can also be
seen that the H2/CO2 ratio does not follow the stoichiometry described in equation 1. This
can be attributed to the fact that during hydrogenotrophic methanogenesis an extra amount
of CO2 is actually directed towards the anabolic needs of the microbes and therefore it has
to be added on top of the amount used for methanogenesis.
Regarding the marked disturbances in Figure 2, numbers 1, 3, 6 and 8 were due to known
technical reasons whereas numbers 2, 4 and 7 were related to large drifts from the optimum
H2/CO2 ratio. Specifically, disturbance number 3 was produced by a pump failure and
resulted in the introduction of an undetermined amount of oxygen in the reactor for a
couple of hours. Disturbance number 5 was due to a 45 day fasting period with no gas input
into the system (this period of non-feeding is omitted from the graph). Disturbance number
9 was related to an oxygenation experiment; the effects of fasting and oxygenation on the
microbiome of the media are not discussed here. Smaller non-marked disturbances indicate
sampling and routine equipment maintenance.
From Figure 3 it can be seen that the pH of the media could be regulated within an
acceptable range (pH 7-8) throughout the experiment despite the stepwise increase of gas
feeding rates (from 27.9 to 60.5 v/v/d). This was possible due to the gradual increase in the
hydrogenotrophic activity of the culture.
12
As the enrichment of H2/CO2 consuming groups took place, the higher rates of CO2
consumption allowed for higher rates of CO2 injection into the system without this affecting
the pH of the media. A degree of volatilization of nitrogen (via NH3) may have also
affected the impact of CO2 injection on the pH.
Figure 4 indicates that the pH of the media could be finely tuned by controlling the levels
of CO2 entering the system in relation to the data obtained at the time in terms of
conversion efficiency and pH. The figure displays the course of 3 days of operation during
which, by finding an optimum for the CO2/H2 ratio of the gas entering the system. pH was
stabilized at just below 7.2 whereas conversion efficiency was close to 100%. It can also be
seen that during this period CO2 conversion was complete as there was no detection of CO2
exiting the reactor.
The diffusion rate of CO2 into the media was directly linked to two measurable parameters:
the pH and the amount of CO2 in the exhaust gas. Since the values of both these parameters
were continuously registered, they could potentially be used as reference for a system that
automatically controls the H2/CO2 ratio of the feeding gas as well as the gassing rate. By
simultaneously aiming for a certain pH range and for complete conversion of CO2 to CH4,
the H2/CO2 ratio and gassing rate could be continuously adjusted by active control of the
gas feeding devices (e.g. individual mass flow controllers). This way, and without human
interference, the system would be able to always detect the methanogenic capacity of the
culture in order to achieve the highest conversion rates and efficiency.
3.2. Enrichment of the hydrogenotrophic methanogenic population
As the only input of external agents into the system after inoculation was a stream of
H2/CO2 mixture, this created a closed ecosystem in terms of organic material (sugars, lipids
13
and amino-acids) essential for the survival of a wide range of bacterial species. In a
chemostat arrangement this would have resulted in the decline of all microbial activity
apart from the one relying on the conversion of the two supplied gases. However, since
there was no washout of biomass during the experimental period (apart from sampling and
to keep a constant liquid media volume due to the generation of water) dead biomass in the
reactor appeared to have been continuously recycled as feed. This hypothesis is supported
by three lines of evidence.
Firstly, the gradual increase in gas conversion rates (from 27.9 to 60.5 v/v/d) and efficiency
as shown in Figure 3 indicates that there was no decrease in metabolic activity as would
have been expected in the case of a non-dividing, ageing population. A non-dividing
population would have been the result of nutrient limiting conditions as dictated by batch
culture kinetics (Shuler and Kargi, 2002). Since no further micro or macro nutrients where
supplied to the system after start-up, a mechanism for the recycling of the initial pool of
these must have taken place.
Figure 5 supplies the second line of evidence. Samples taken on days 1 and 171 and
analysed by q-PCR show that the relative quantities of bacteria and archaea have stayed
comparatively unaffected while there was almost complete displacement of the acetotrophic
methanogenic species by their hydrogenotrophic counterparts. More specifically, the gene
copy numbers of total bacteria increased from 2.6 x 109 to 6.8 x 109 and the gene copy
numbers for hydrogenotrophic methanogens from 4.6 x 105 to 4.8 x 108 while the gene
copy numbers of acetotrophic methanogens declined from 1.7 x 108 to 1.5 x 107. It must be
noted that although the hydrogenotrophic methanogens detected included the orders of
Methanobacteriales and Methanomicrobiales and the family of Methanosarcinaceae, on
14
day 171 the order of Methanobacteriales dominated the hydrogenotrophic population by
100%.
The initial inoculum contained all the necessary microbes involved in the stages of
hydrolysis, acidogenesis, acetogenesis, and acetoclasis together with a range of
hydrogenotrophic methanogens. Under non-restricted conditions in terms of carbon and
energy but restricted in terms of micro and macronutrients, the mixed populations created
syntrophic relationships that promoted recycling of their cellular material, thus leading to a
self-regenerative system where decaying biomass became utilized to yield new biomass.
In this closed system a significant imbalance factor came from the metabolically produced
water as shown in the following, (equation 1) hydrogenotrophic methanogenesis reaction.
Due to the high rate of methanogenesis when compared to the digestion of biomass any
other possible routes of metabolically produced water can be ignored.
Equation 1 states that for the generation of every mole of CH4, 2 moles (≈36 ml) of water
are produced that result in a reduction of the concentration of nutrients over time through
dilution. The effect of dilution through metabolically produced water can be seen in Figure
6 which displays the concentration of total and volatile solids throughout the experiment.
The amount of undigested solids can be calculated from equation 2:
Mineral content = Total solids – Volatile solids (2)
After 185 days of operation it can be safely assumed that the concentration of biomass in
g/L in the media was represented by the VS which experienced an overall reduction of
35.2%. The mineral content experienced a reduction of 76.4%. The difference in the two
values can be explained by the fact that although the concentration of undigested solids was
influenced by the production of water, the concentration of the microbial mass in the
15
reactor was dictated by the amount of available nutrients which appeared to be adequate at
a wide range of dilutions. This is also reflected in Figure 6 which shows that despite the
dilution factor the density of the microbial population experienced an increase of 167%. At
the beginning of the experiment the inoculum contained a certain amount of organics that
must have been gradually taken up by the microbes which justifies the reduction in VS with
the concurrent increase in gene copy numbers.
Table 2 displays the concentration of 16 elements in the media that are considered essential
to methanogenic cells (Angelidaki and Sanders, 2004; Demirel and Scherer, 2011; Glass
and Orphan, 2012; Zhang and Gladyshev, 2010). Concentration was measured with ICP-
OES and the values have been adjusted to represent their concentration per 10 g of TS. The
values show that apart from the dilution factor there was no loss of these elements during
operation.
The third line of evidence for the recycling of dead biomass material comes from the fact
that the concentration of VFAs in the media throughout the duration of the experiment was
always below 100 mg/L (data not shown). In AD systems several intermediates play a
crucial role for the mineralization of organic compounds to CH4 and CO2. Among them,
propionate and butyrate are considered as rate limiting because acetotrophic
methanogenesis depends on their successful oxidation which is thermodynamically
unfavorable (Amani et al., 2010). The degradation of these intermediates depends on the
establishment of a syntrophic relation between acetogenic bacteria and H2/formate
scavengers which are part of the hydrogenotrophic population. Accumulation of propionate
or butyrate is therefore often a sign of disruption of this syntrophy which can be caused by
various factors such as hydrogen partial pressure, pH and even the accumulation of VFAs
16
as a form of self-inhibition (Li et al., 2012). In the case of acetate, its oxidation is exergonic
and accumulation is most often linked directly to underperforming acetoclastic species
(Amani et al., 2010).
The degradation of propionic acid has been reported to be dependent on the successful
removal of its products, most notably H2 although formate and acetate might as well play a
role (De Bok et al., 2004). In the present case, the absence of accumulated intermediates
points towards their continuous and successful utilization even at high H2 partial pressures.
The continuous gassing with H2 did not appear to inhibit the oxidation of propionate or
butyrate due to its immediate consumption by the hydrogenotrophic population. The low
acetate levels also indicate the presence of uninhibited aceticlastic methanogens at high
enough numbers for its complete utilization.
Nevertheless, the gradual weakening of the culture through consecutive mutations, loss of
volatile nutrients (e.g. H2S, NH3) through evaporation or the accumulation of undigested
intermediates could cause imbalance and possible failure. Therefore, longer operational
periods need to be assessed in order for any potential impediments to be identified. Another
issue that has to be addressed is the water that is produced during methanogenesis. In the
case of a closed system, dilution is unavoidable and will eventually lead to nutrient scarcity.
Consequently, methods for the removal of water should be devised. However, these ought
not to be energy intensive or disrupt the methanation process. Biofilms will likely aid in
this direction by separating the culture from any liquid processing route.
Stable isotope labeling could also provide a clearer image of the pathways involved in the
process via the detection of the carbon entering the system with the gas in certain microbial
groups and their metabolites. Since the only constantly renewed carbon source is CO2, the
17
substitution of 12C with its heavier isotope 13C intermittently and for short time periods
could help identify how, at what rate and by which microbial groups it is utilized thus
giving us their individual growth and death rates. The quantification of 13C in the biomass
and its metabolic products versus time would offer a better understanding of how this
mixed, partially closed ecosystem works and an insight on how it can be improved.
4. Conclusions
The present study shows that an eco-engineered mixed culture biocatalyst that promotes the
gaseous conversion of CO2 and H2 to CH4 is capable of regeneration relying on catabolism.
This is the first time that microbial recycling has been allowed to evolve in the process of
ex-situ biomethanation. This is also the first time that the different groups of a mixed
microbial population involved in ex-situ hydrogenotrophic methanogenesis have been
quantified. The avoidance of the continuous addition of nutrients and pH buffering agents is
expected to bring a significant reduction in the running costs of future commercial
biomethanation units.
Acknowledgements
This research was supported by the University of South Wales, UK, through the award of a
Centenary Postgraduate Scholarship. The authors also acknowledge the European Regional
Development Funding (ERDF) support provided by the Welsh Government A4B scheme
for the Knowledge Transfer Centre for Advanced Anaerobic Processes and Biogas Systems
(Project Ref: HE 14 15 1009), and funding provided by Innovate UK / BBSRC for an
Industrial Biotechnology Catalyst program early stage feasibility study (Project Ref:
P132133).
18
Table 1 Oligonucleotide sequences used as calibration standards.
Microbial target group
Sequence
Total bacteria CGGTGAATACGTTCYCGGGACTTGTACACACCGCCCGTCTCAAGTCGTAACAAGGTAWCC
Methanosaetaceae TAATCCTYGARGGACCACCAGTACGGCAAGGGACGAAAGCTAGGACGTKGTYGGTGCCGTAGG
Methanosarcinaceae GAAACCGYGATAAGGGGAGTTTAGCAAGGGCCGGGCAAACCGTAAACGATGYTCGCTA
Methanococcales TAAGGGCTGGGCAAGTACTAGCGGTGRAATGYGTTGATCCGTTAAACTYTGCGRACTAGGTG
Methanomicrobiales ATCGRTACGGGTTGTGGGACTYCGACAGTGAGGRACGAAAGCTGGTGTAAACDATGYGCGTTAGGTG
Methanobacteriales CGWAGGGAAGCTGTTAAGTGTAGCACCACAACGCGTGGAACAAGGAGTGGACGACGGTA
Table 2 Concentration of 16 elements in the liquid media at three different dates
mg/10 g TS
Al B Ca Co Cu Fe K Mg
day 39 115.61 0.43 257.54 0.09 2.69 188.26 76.83 59.26 day 67 131.69 0.08 252.04 0.09 3.06 176.52 78.28 63.82 day 133 117.45 0.37 244.85 0.10 2.83 179.46 89.35 59.98 Mn Mo Na Ni P S Se Zn
day 39 4.69 0.93 49.52 3.78 148.73 102.97 <0.02 7.59 day 67 5.64 1.23 43.24 4.16 155.27 123.79 <0.02 8.73 day 133 4.95 1.42 56.84 5.44 148.38 109.21 <0.02 7.48
19
Fig. 1 Schematic of the methanation reactor connected to the gas supply and the real time
data logging system.
Fig. 2 Volumetric percentage of CH4 in the effluent gas compared to the volumetric percentage of CO2 in the feeding gas; full monitoring was available from day 10.
20
Fig. 3 Volumetric percentage of CH4 in the effluent gas related to the gassing rate with the H2/CO2 mix and the pH of the liquid media.
Fig. 4 Stabilisation of the pH of the media by manual control of the CO2 entering the reactor.
21
Fig 5 Gene copy numbers per ml of sample and relative quantities of bacteria and archaea at start-up and after 171 days of operation. 1Acetoclastic methanogens cover the family of Methanosaetaceae. 2Hydrogenotrophic methanogens cover the orders of Methanobacteriales (MBT) and Methanomicrobiales (MMB) and the family of Methanosarcinaceae (MSC).
Fig. 6 Concentration of Total Solids and Volatile Solids in the reactor during operation; comparison with the density of the microbial population on days 1 and 171.
22
References
1. Ako, O.Y., Kitamura, Y., Intabon, K., Satake, T., 2008. Steady state characteristics of
acclimated hydrogenotrophic methanogens on inorganic substrate in continuous
chemostat reactors. Bioresource Technology 99, 6305–6310.
doi:10.1016/j.biortech.2007.12.016
2. Amani, T., Nosrati, M., Mousavi, S.M., Kermanshahi, R.K., 2010. Study of syntrophic
anaerobic digestion of volatile fatty acids using enriched cultures at mesophilic
conditions. International Journal of Environmental Science & Technology 8, 83–96.
doi:10.1007/BF03326198
3. Angelidaki, I., Sanders, W., 2004. Assessment of the anaerobic biodegradability of
macropollutants. Reviews in Environmental Science and Biotechnology 3, 117–129.
doi:10.1007/s11157-004-2502-3
4. APHA, 2012. Standard Methods for the Examination of Water and Wastewater, 22nd
ed. American Public Health Association, American Water Works Association, Water
Environment Federation, Washington, D.C.
5. Barnhart, C.J., Dale, M., Brandt, A.R., Benson, S.M., 2013. The energetic implications
of curtailing versus storing solar- and wind-generated electricity. Energy &
Environmental Science 6, 2804–2810. doi:10.1039/c3ee41973h
6. Burkhardt, M., Koschack, T., Busch, G., 2015. Biocatalytic methanation of hydrogen
and carbon dioxide in an anaerobic three-phase system. Bioresource Technology 178,
330–333. doi:10.1016/j.biortech.2014.08.023
7. Cruwys, J.., Dinsdale, R.., Hawkes, F.., Hawkes, D.., 2002. Development of a static
headspace gas chromatographic procedure for the routine analysis of volatile fatty
23
acids in wastewaters. Journal of Chromatography A 945, 195–209. doi:10.1016/S0021-
9673(01)01514-X
8. De Bok, F.A.M., Plugge, C.M., Stams, A.J.M., 2004. Interspecies electron transfer in
methanogenic propionate degrading consortia. Water Research 38, 1368–1375.
doi:10.1016/j.watres.2003.11.028
9. De Poorter, L.M.I., Geerts, W.J., Keltjens, J.T., 2007. Coupling of
Methanothermobacter thermautotrophicus methane formation and growth in fed-batch
and continuous cultures under different H2 gassing regimens. Applied and
Environmental Microbiology 73, 740–749. doi:10.1128/AEM.01885-06
10. Demirel, B., Scherer, P., 2011. Trace element requirements of agricultural biogas
digesters during biological conversion of renewable biomass to methane. Biomass and
Bioenergy 35, 992–998. doi:10.1016/j.biombioe.2010.12.022
11. DENA, 2015. Power to Gas system solution. Opportunities, challenges and parameters
on the way to marketability. Danish Energy Agency.
12. Denholm, P., Ela, E., Kirby, B., Milligan, M., 2010. The Role of Energy Storage with
Renewable Electricity Generation The Role of Energy Storage with Renewable
Electricity Generation. National Renewable Energy Laboratory Publication (NREL) 1–
61. doi:69
13. EPA, 1996. Acid Digestion of Sediments, Sludges and Soils [WWW Document]. U.S
Environmental Protection Agency. URL
http://www3.epa.gov/epawaste/hazard/testmethods/sw846/pdfs/3050b.pdf
14. Esteves, S., Dinsdale, R., Patterson, T., Savvas, S., 2015. Microbial Processing of
Gasses. PCT/GB2015/054176.
24
15. Glass, J.B., Orphan, V.J., 2012. Trace metal requirements for microbial enzymes
involved in the production and consumption of methane and nitrous oxide. Frontiers in
Microbiology 3, 1–20. doi:10.3389/fmicb.2012.00061
16. Global Wind Energy Council (GWEC), 2014. Global Wind Report Annual Market
Update 2013. Brussels, Belgium.
17. Gonzalez, A., Gallachoir, B., McKeogh, E., 2004. Study of Electricity Storage
Technologies and Their Potential to Address Wind Energy Intermittency in Ireland -
Final Report. UCC Sustainable Energy Research Group.
18. Götz, M., Lefebvre, J., Mörs, F., McDaniel Koch, A., Graf, F., Bajohr, S., Reimert, R.,
Kolb, T., 2016. Renewable Power-to-Gas: A technological and economic review.
Renewable Energy 85, 1371–1390. doi:10.1016/j.renene.2015.07.066
19. Ju, D.-H., Shin, J.-H., Lee, H.-K., Kong, S.-H., Kim, J.-I., Sang, B.-I., 2008. Effects of
pH conditions on the biological conversion of carbon dioxide to methane in a hollow-
fiber membrane biofilm reactor (Hf–MBfR). Desalination 234, 409–415.
doi:10.1016/j.desal.2007.09.111
20. Kaster, A.K., Goenrich, M., Seedorf, H., Liesegang, H., Wollherr, A., Gottschalk, G.,
Thauer, R.K., 2011. More than 200 genes required for methane formation from H2 and
CO2 and energy conservation are present in methanothermobacter marburgensis and
methanothermobacter thermautotrophicus. Archaea 2011. doi:10.1155/2011/973848
21. Lee, J.C., Kim, J.H., Chang, W.S., Pak, D., 2012. Biological conversion of CO2 to
CH4 using hydrogenotrophic methanogen in a fixed bed reactor. Journal of Chemical
Technology and Biotechnology 87, 844–847. doi:10.1002/jctb.3787
25
22. Lew, D., Bird, L., Milligan, M., Speer, B., Wang, X., Carlini, E.M., Estanqueiro, A.,
Flynn, D., Gomez-lazaro, E., Menemenlis, N., Orths, A., Pineda, I., Smith, J.C., Soder,
L., Sorensen, P., 2013. Wind and Solar Curtailment Preprint. International Workshop
on Large-Scale Integration of Wind Power Into Power Systems.
23. Li, J., Ban, Q., Zhang, L., Jha, A.K., 2012. Syntrophic propionate degradation in
anaerobic digestion: A review. International Journal of Agriculture and Biology 14,
843–850.
24. Luo, G., Angelidaki, I., 2012. Integrated biogas upgrading and hydrogen utilization in
an anaerobic reactor containing enriched hydrogenotrophic methanogenic culture.
Biotechnology and Bioengineering 109, 2729–2736. doi:10.1002/bit.24557
25. Martin, M.R., Fornero, J.J., Stark, R., Mets, L., Angenent, L.T., 2013. A single-culture
bioprocess of methanothermobacter thermautotrophicus to upgrade digester biogas by
CO2-to-CH4 conversion with H2. Archaea 2013, 11. doi:10.1155/2013/157529
26. Pachauri, R.K., Allen, M.R., Barros, V.R., Broome, J., Cramer, W., Christ, R., 2014.
Climate Change 2014 Synthesis Report.
27. Peillex, J.-P., Fardeau, M.-L., Belaich, J.-P., 1990. Growth of Methanobacterium
thermoautotrophicum on H2-CO2: high CH4 Productivities in Continuous Culture.
Biomass 21, 315–321.
28. Qadrdan, M., Abeysekera, M., Chaudry, M., Wu, J., Jenkins, N., 2015. Role of power-
to-gas in an integrated gas and electricity system in Great Britain. International Journal
of Hydrogen Energy 40, 5763–5775. doi:10.1016/j.ijhydene.2015.03.004
26
29. Rittmann, S., Seifert, A., Herwig, C., 2012. Quantitative analysis of media dilution rate
effects on Methanothermobacter marburgensis grown in continuous culture on H2 and
CO2. Biomass and Bioenergy 36, 293–301. doi:10.1016/j.biombioe.2011.10.038
30. Schill, N., van Gulik, W.M., Voisard, D., von Stockar, U., 1996. Continuous cultures
limited by a gaseous substrate: development of a simple, unstructure mathematical
model and experimental verification with Methanobacterium thermoautotrophicum.
Biotechnol. Bioeng. 51, 645–658.
31. Seifert, A.H., Rittmann, S., Herwig, C., 2014. Analysis of process related factors to
increase volumetric productivity and quality of biomethane with Methanothermobacter
marburgensis. Applied Energy 132, 155–162. doi:10.1016/j.apenergy.2014.07.002
32. Shuler, M., Kargi, F., 2002. Bioprocess Engineering: Basic Concepts. Upper Saddle
River, N.J.: Prentice Hall.
33. Suzuki, M.T., Taylor, L.T., Delong, E.F., Long, E.F.D.E., 2000. Quantitative Analysis
of Small-Subunit rRNA Genes in Mixed Microbial Populations via 5 ′ -Nuclease
Assays. Applied and environmental microbiology 66, 4605–4614.
doi:10.1128/AEM.66.11.4605-4614.2000.Updated
34. Yu, Y., Lee, C., Kim, J., Hwang, S., 2005. Group-specific primer and probe sets to
detect methanogenic communities using quantitative real-time polymerase chain
reaction. Biotechnology and Bioengineering 89, 670–679. doi:10.1002/bit.20347
35. Zhang, Y., Gladyshev, V.N., 2010. General trends in trace element utilization revealed
by comparative genomic analyses of Co, Cu, Mo, Ni, and Se. Journal of Biological
Chemistry 285, 3393–3405. doi:10.1074/jbc.M109.071746
27