MOLECULAR AND CELLULAR BIOLOGY, Jan. 1987, p. 33-40 Vol. 7, No. 10270-7306/87/010033-08$02.00/0Copyright C) 1987, American Society for Microbiology

Gene Expression of the Chondroitin Sulfate Proteoglycan CoreProtein PG19

MARIO A. BOURDON,* MASANOBU SHIGA,t AND ERKKI RUOSLAHTI

Cancer Research Center, La Jolla Cancer Research Foundation, La Jolla, California 92037

Received 1 August 1986/Accepted 22 September 1986

We have examined genomic sequences and mRNA species hybridizing to a cDNA clone of a yolk saccarcinoma chondroitin sulfate proteoglycan designated PG19. Genomic blot hybridizations with cDNAscovering the majority of the PG19 mRNA sequence revealed 15 to 17 gene fragments. Similar analysis withprobes representing either the propeptide or the combined core protein COOH-terminal domain and 3'untranslated sequences revealed single genomic fragments indicating that a single gene codes for the PGl9proteoglycan. Genomic blot analysis with cDNA sequences coding for the serine-glycine repeat of the coreprotein identified the same gene fragments observed with the entire PG19 cDNA, indicating that this codingregion is homologous with sequences present in multiple genes. The same probes were also used to examinemRNA expression. In addition to the PG19 mRNA, several PG19-related mRNAs could be seen. ThesePG19-related mRNAs had homology with the serine-glycine coding sequence of the PG19 cDNA. These mRNAsmay be coding for proteoglycans. The mRNA coding for PG19 appeared to be uniquely expressed in parietalyolk sac and mast cell lineages. The PG19 mRNA existed in different forms in parietal yolk sac and mast celllines due to cell-type-specific differences in the length of the 5' untranslated sequences. These results indicatethat expression of the PG19 proteoglycan gene is regulated both in terms of cell-type-specific transcription andselection of a transcriptional start site.

Proteoglycans are protein glycoconjugates present in avariety of basement membranes (17, 20, 30), extracellularmatrices (3, 8, 17, 26, 31), and cell membranes (21, 34).Functionally and structurally, little is known about proteo-glycans beyond their glycoconjugate structure (17). It islikely, however, that the diversity of core proteins revealedby biochemical and immunological studies and, more re-cently, sequence analyses of cloned cDNAs (6, 6a, 12, 21a,35) reflects functional diversity as well. As examples, oneproteoglycan appears to represent a subpopulation of thetransferrin receptor (14), and another is associated with theintracellular transport of class II histocompatibility antigenpolypeptides (37). Other proteoglycans interact with themajor extracellular matrix and basement membrane compo-nents such as fibronectin (29), vitronectin (42), collagen (21,29), and laminin (36, 47) and in doing so may regulate theformation of extracellular matrices and the adhesion of cellsto such matrices (10, 21). The modulation of cell adhesion inparticular may be important for cell division and cell migra-tion, especially in malignant cells (10, 34).We have been interested in the structure and expression of

a chondroitin sulfate proteoglycan secreted by a yolk saccarcinoma cell line (27) because of its interaction withextracellular matrix proteins (7, 29) and its ability to inhibityolk sac carcinoma cell adhesion to collagen and fibronectin(7). The amino acid sequence of the yolk sac carcinomaproteoglycan core protein precursor and its processing havebeen deduced from cDNA (6, 6a). The proteoglycan istranslated as a 19-kilodalton preprocore protein and is sub-sequently processed to a 10-kilodalton 104-amino-acid ma-ture core protein. We have designated the proteoglycanPG19 on the basis of the molecular size of its core proteinprecursor. A prominent feature of the PG19 core protein is

* Corresponding author.t Present address: Dojindo Laboratories, 2861 Kengun-machi,

Kumamoto 862, Japan.

its 49-amino-acid serine-glycine repeat, which serves as aglycosaminoglycan attachment domain. Such a serine-glycine repeat(s) also appears to be a part of several otherproteoglycan core proteins (9, 33, 38). Moreover, aDrosophila melanogaster biological clock gene and a relatedmouse gene also contain serine-glycine as well as threonine-glycine repeats, and at least the Drosophila gene codes for aproteoglycan (19, 32). These observations indicate that theremay be a family of proteoglycan core proteins containing theserine-glycine repeat.

In this report we have used the PG19 cDNA probes toidentify the PG19 proteoglycan gene, to determine regions ofsequence homology with related genes, and to examineexpression of the PG19 mRNA. We show that PG19 isencoded by a single gene and that this gene is related tomultiple genes containing sequences homologous to theserine-glycine repeat coding sequences of the PG19 gene.Several of the related genes containing sequences homolo-gous to the proteoglycan serine-glycine repeat appear to betranscribed in various types of cells, while PG19 genetranscription is restricted to parietal yolk sac and mast cells.

MATERIALS AND METHODSCell culture. Cells were cultured in Dulbecco modified

Eagle medium (Flow Laboratories) supplemented with 10%fetal bovine serum. Cultures were maintained at 37°C in a 5%CO2 atmosphere. The fibroblastic cell lines NRK, Rat-1, andRFL-6, the basophilic leukemia cell line RBL-1, and hepa-toma cell line 7777 were obtained from the American TypeCulture Collection. The L2 cell line was provided by UllaWewer, University of Copenhagen, the neuroectoderm-derived cell line B49 by William Stallcup of this institution,and the Swarm rat chondrosarcoma by John Harper, Uni-versity of California, San Diego.DNA and RNA isolation. DNA for genomic blot analysis

was isolated from rat liver (22). Total RNA was isolated fromcell lines and tissues by guanidinium isothiocyanate extrac-

33

34 BOURDON ET AL.

1OObp-I

A S K9

pPG6

NH2

S A

pPG 1pPG 1 -Il I

pPG 1-ISignal.Peptide. propeptide mature core protein

(Ser-Gly)24

FIG. 1. Diagram of PG19 cDNA probes. The relationship between PG19 clones pPG1, pPG6, and the pPG1-derived probes is shown. ThepPG1 and pPG6 clones share 662 bp of overlapping sequence. Clone pPG6 begins 113 bp 5' of clone pPG1 and codes for the complete aminoacid sequence of PG19. Probes pPG1-I, pPG1-II, and pPG1-III are derived from pPG1. Probe pPG1-I contains coding sequence for thepropeptide of PG19, pPG1-II contains those for the core protein NH2 terminus and the serine-glycine repeat coding sequences, and pPG1-IIIcontains the COOH-terminal domain and 3' untranslated sequences. Restriction enzyme cleavage sites used in preparing probes are indicated;A, AluI; K, KpnI; S, Sau3AI.

tion and CsCl density gradient ultracentrifugation (45).Polyadenylated [poly(A)+] RNA was isolated from totalRNA by oligo(dT)-cellulose (40).

Plasmid and oligonucleotide probes. PG19 cDNA cloneswere isolated from an L2 yolk sac carcinoma cell cDNAlibrary. These cDNA clones cover 987 nucleotides of PG19proteoglycan mRNA sequence and include the completeprotein coding region (6, 6a).Three nonoverlapping subclones from one of the PG19

cDNAs, pPG1, were cloned into the pGEM1 plasmid vector(Promega, Madison, Wis.) and used as probes. The deriva-tion of these probes is depicted in Fig. 1. pPG1-I contains a

149-base-pair (bp) PstI-Sau3AI 5' pPG1 fragment and codesfor the PG19 propeptide. pPG1-II is a 202-bp Sau3AI-AluIpPG1 fragment containing the NH2-terminal and serine-glycine repeat coding domains, and pPG1-III is a 336-bp AluIfragment containing the COOH-terminal coding region andover 200 bp of 3' untranslated sequence.

Oligonucleotides were synthesized on an Applied Bio-systems DNA synthesizer. For DNA hybridization, primerextension analyses, and RNA sequencing, the oligonucleo-tides were 5'-end labeled with [-y-32P]ATP and T4 polynucle-otide kinase (28).

Preparation of RNA probes. [32P]UTP-labeled in vitro-transcribed RNA probes were prepared as described byMelton et al. (25). Plasmids were lineafized in the polylinkerregion of pGEM1 at restriction sites adjacent to the 5' end ofeach insert, and radiolabeled antisense RNA runoff tran-scripts were synthesized by using T7 RNA polymerase.Plasmid DNA was removed by digestion with RNase-freeDNase I (Promnega) followed by phenol-chloroform extrac-tion and ethanol precipitation of the labeled RNA.DNA blot hybridization. Rat liver DNA was restricted with

a fivefold excess of the restriction enzyme EcoRI, BamHI,or Hindlll in appropriate buffers. Digested DNA (10 ,ug perwell) was electrophoresed in 0.8% agarose gels and blottedonto nitrocellulose (41) or dried, rehydrated, and used inoligonucleotide in situ gel hybridization (5). Duplicate DNAblots were hybridized with 2 x 106 cpm of [a-32P]dCTPnick-translated plasmid DNA probes per ml. Agarose DNAgels were hybridized in situ with 4 x 106 cpm of 5'-end-labeled oligonucleotides per ml. Hybridization buffer con-tained 50% formamide, 5x SSPE (lx SSPE is 0.18 M NaCl,10 mM NaPO4, pH 7.7, 1 mM EDTA), 4x Denhardt solu-tion, 250 jig of sheared salmon sperm DNA per ml, and 0.1%sodium dodecyl sulfate (SDS). Hybridizations were carriedout at 42 to 50°C for 36 h. Filters were washed twice with 2 xSSC (lx SSC is 0.15 M NaCl, 0.015 M sodium citrate, pH7.4)-0.1% SDS at room temperature and twice with 0.1x

SSC-0. 1% SDS at 60 to 65°C before being placed underXAR-5 X-ray film with an intensifier screen. In situ hybrid-ization gels were washed with the same wash buffers but atlower temperatures (50 to 55°C) in the final washes.RNA blot hybridization. Total RNA was denatured in

formaldehyde-formamide, electrophoresed on 1.4% aga-rose-formaldehyde gels with 5 ,ug of RNA per well (15, 43),and blotted onto nitrocellulose. rRNAs (16S, 18S, 23S, and28S) were used as size markers. RNA blots were hybridizedwith 2 x 106 cpm of [32P]UTP-labeled antisense RNAtranscripts per ml for 12 to 24 h at 60 to 65°C. Hybridizationbuffer contained 50% formamide, Sx SSPE, 2x Denhardtsolution, 0.1% SDS, 100 ,ug of salmon sperm DNA per ml,500 jig of yeast RNA per ml, and 10 mg of polyadenosine(Sigma) per ml. Blots were washed three to four times in 50mM NaCl-20 mM NaHPO4-1 mM EDtA-0.1% SDS at 65 to700C.RNA protection analysis. Total cellular RNA was hybrid-

ized to a [32P]UTP-labeled antisense RNA probe, and theprotected RNA probe was analyzed by RNase A and T1digestion and electrophoresis on 4% acrylamide-urea dena-turing gels (25).Primer extension analysis and mRNA sequencing. An oli-

gonucleotide primer was 5'-end labeled with [y-32P]ATP andhybridized to 1 to 10 ,ug of mRNA followed by primerextension with 20 U of reverse transcriptase in the presenceof 1 rhM deoxynucleotide triphosphates at 42°C (24). Primerextension products were electrophoresed on 8% acryl-amide-urea denaturing gels following denaturation in 80%formamide sample buffer. MspI digest fragments of pBR322were used as size markers. Dideoxynucleotide sequencing ofmRNA was carried out essentially as described for primerextension analysis with the addition of appropriatedideoxynucleotides in each nucleotide sequencing reaction(46).

RESULTS

PG19 cDNA probes identify single gene sequences andmultiple related gene sequences in genomic DNA. We initiallyobserved that the PG19 cDNA, pPG1, which contains mostof the PG19 protein coding sequence, hybridized to 15 to 17gene fragments of rat liver DNA digested with either EcoRI,BamHI, or Hindlll (Fig. 2). These three restriction enzymeswere chosen because none of them cleaves the cDNA. Sinceit is unlikely that a single PG19 gene would give rise to thenumerous bands through cleavage within introns, this resultstrongly suggests the presence of multiple genes related to

A

pPG 1 -m

I COOH

MOL. CELL. BIOL.

PROTEOGLYCAN GENE EXPRESSION 35

the PG19 gene. To see which portion of the PG19 sequencethese genes were related to, we next studied hybridization ofgenomic blots with probes representing nonoverlapping frag-ments of pPG1 (see Fig. 1 for the derivation of the probes).The 5' probe pPG1-I, which contains the sequences coding

for the propeptide of PG19, primarily hybridized to a singlegene fragment in all three DNA digests. The sizes of theEcoRI, BamHI, and Hindlll fragments detected were 17, 19,and 9 kilobases (kb), respectively. Hybridization of genomicDNA digests with probe pPG1-III, which contains codingsequences for the COOH-terminal domain and 216 bp of the3' untranslated sequence, also identified single gene frag-ments in each restriction enzyme digest. The hybridizinggene fragment in the EcoRI, BamHI, and HindIII digestscorresponded to sizes of 17, 19, and 14 kb, respectively. Thedifference in the size of the HindlIl fragments detected withthe pPG1-III probes indicates that one or more HindIllcleavage sites were present in intervening sequences be-tween the pPG1-I exon squences and those contained inpPG1-III, since the cDNA did not have HindIII cleavagesites. This result suggests that the PG19 gene is a single-copygene, since cleavage within the gene did not result inhybridization to multiple gene fragments with either the 3' or5' probe. This conclusion was confirmed by gene copyreconstruction in genomic blots of HindIll-digested genomicDNA and pPG1 plasmid DNA probed with pPG1-III. Thelevel of probe hybridization to the single genomic DNAfragment and to pPG1 at ti(results not shown).

In contrast to the singleand 3' probes, pPG1-II Ements even under stringera hybridization pattern ind

pPG 1

E B H

23-

.-ft

r

*9 q

2.3-

2.0-

23-

9.4-

6.5-

4.3-

2.3-2.0-

FIG. 2. Genomic DNA blcDNA (10 ,ug per lane) was c](lanes B), or HindIll (lanes Iand blotted onto nitrocellulosblots were hybridized with n

fragments pPG1-I, pPG1-II,,graphed. HindIIl restriction fas markers. The molecular si2(in kilobase pairs).

pPGI-1I pPG1-Z

1 2 3 4 5 6 7 1 2 3 4 5 6 7

28S- S

p w

18S- w

FIG. 3. RNA transfer blot analysis of RNA from cultured cells.Total RNA (5 ,ug) from L2 (lanes 1), Rat-1 (lanes 2), RBL-1 (lanes 3),NRK (lanes 4), B49 (lanes 5), Swarm rat chondrosarcoma (lanes 6),and 7777 cells (lanes 7) was electrophoresed on 1.4% agarose-formaldehyde gels, blotted onto nitrocellulose, and hybridized at 65or 60°C in 50% formamide with 32P-labeled mRNA-complementaryRNA probes derived from pPG1-II and pPG1-III, respectively (seeFig. 1). Calf liver (18S and 28S) and Escherichia coli (16S and 23S)rRNAs were used as markers.

ie single-copy level were the same with the complete cDNA probe (Fig. 2, pPGII panel). ThepPG1-II probe contains sequences coding for the 49-amino-

6-fragment hybridization of the 5' acid serine-glycine repeat of the core protein as well as for 18iybridized to multiple gene frag- amino acids from the propeptide and NH2 terminus of theit hybridization conditions, giving mature core protein. To determine which of the two regionslistinguishable from that observed hybridized to the multiple gene fragments, genomic DNA

was further analyzed with oligonucleotides complementaryto either the 5' 18-amino-acid NH2-terminal coding sequence

pPGI-I pPG1-ll pPG1-III of pPG1-II or a portion of the serine-glycine coding se-E B H E B H E B H quence. Results of in situ gel hybridization of EcoRI-

digested DNA with a 42-mer oligonucleotide(ATAGTCATCAGAAATGGGGAAGAAA

-__ TCATTCGGGAATCCTCT) complementary to the 18--P*~amino-acid propeptide-mature core protein coding sequence

- - of pPG1-II demonstrated hybridization to a single DNAfragment. In contrast, a 40-mer oligonucleotide (GCCAGAGCCAGAGCCGGAGCCAGAGCCAGAGCCAGAGCCG)

.-. complementary to the adjacent serine-glycine coding se-quence hybridized to multiple DNA fragments (results notshown). The serine-glycine coding region sequence thereforeaccounts for the multigene hybridization pattern.

Expression and identification of PG19-specific and relatedRNA transcripts. Cellular RNAs from a variety of rat celllines were examined for expression of PG19-specific andrelated transcripts by using antisense RNA probes tran-scribed from pPG1-III and pPG1-II. The pPG1-III probe,which according to the genomic hybridization data containssequences specific for PG19, detected high levels of a 1.3-kbtranscript in rat yolk sac carcinoma (L2) cells and of a 1.1-kbtranscript in rat basophilic leukemia (RBL-1) cells (Fig. 3,right panel). In addition, much lower levels of a 1.5-kb and

)t analysis of rat liver DNA. Rat liver 3.5-kb RNA were detected in L2 and RBL-1 RNA transferleaved with EcoRI (lanes E), BamHI blots. These RNAs may be minor alternative forms of theH), electrophoresed in 0.8% agarose, major PG19 mRNA since they hybridized with the pPG1-III

lick-translated pPG1 or its subcloned probe even at high stringency. The two RNAs were seenand pPG1-III (Fig. 1) and autoradio- only in cells expressing high levels of PG19 mRNA and mayaragments of A phage DNA were used reflect higher levels of mRNA processing intermediates inzes of restriction fragments are shown these cells. However, we cannot rule out alternative tran-

scriptional start sites or polyadenylation sites as a source of

VOL. 7, 1987

36 BOURDON ET AL.

28S- f

18S-

1 2

FIG. 4. RNA transfer blot analysis of L2 cell total and poly(A)+RNA. RNA transfer blots of L2 cell total RNA (lane 1, 5 ,ug) andpoly(A)+ RNA (lane 2, 2 ,ug) were hybridized with 32P-labeledpPG1-II RNA probe at 60°C in 50% formamide and washed understringent conditions.

these mRNAs. Hybridization to PG19-specific sequenceswas not detected in fibroblastic cell lines (NRK, Rat-1, orRFL-6), a neuroectoderm-derived cell line (B49), Swarm ratchondrosarcoma, or a hepatoma cell line (7777) (Fig. 3).The pPGII probe, containing the coding region for the

serine-glycine repeat, identified a variety of RNA tran-scripts, including the 1.3- and 1.1-kb PG19 transcripts and1.5- and 3.5-kb RNAs identified in L2 and RBL-1 cells withthe pPG1-III probe, as well as 1.7-kb, 4.3-kb, and 5.0-kbRNAs present in all cells examined (Fig. 3, left panel). TheseRNAs were detected even under stringent hybridization andwashing conditions.To assess whether the RNAs detected with the pPG1-II

probe were all mRNA transcripts, RNA transfer blots of L2cell total RNA and poly(A)+ RNA isolated on oligo(dT)-cellulose were blotted and hybridized with the pPG1-IIprobe under slightly lower stringency conditions than used inFig. 3. With the concentrations of total and poly(A)+ RNAchosen, levels of poly(A)+ RNAs were greatly increased,allowing detection of even minor related mRNAs, whilerRNAs were proportionately decreased. With the exceptionof the 1.7-kb RNA, which due to its dramatically reducedlevels in poly(A)+ RNA is probably an 18S rRNA, thetranscripts detected in the poly(A)+ fraction were probablymRNAs (Fig. 4). However, the 4.3-kb RNA band may alsobe rRNA, since the level of hybridization did not increase inthe poly(A)+ RNA fraction, although the presence of theband in the poly(A)+ fraction contrasts with the substantialreduction of the 1.7-kb band in this fraction.We next examined the expression of the PG19 mRNA in

RNA samples isolated from various tissues with the PG19-specific pPG1-III probe. This probe detected low levels ofthe 1.3-kb mRNA in rat embryo parietal yolk sac tissue andof the 1.1-kb mRNA in rat lung, kidney, liver, and spleentissue (Fig. 5). In these long-term exposures, weak hybrid-ization to a 4.3-kb RNA could also be detected in samplesfrom all tissues. This latter RNA species could also be

detected in long-term exposures of cellular RNA blots withthe pPG1-III probe as well as with the pPG1-II probe. ThisRNA was not studied further.RNA protection (RNase mapping) analysis. Since the 1.3-kb

transcript of the L2 cells appeared to be closely related to the1.1-kb transcript of the RBL-1 cells in that it hybridized tothe specific pPG1-III probe, we next used RNA protectionexperiments to study the relationship of these transcripts.Total cellular RNA was hybridized to labeled antisense RNAtranscripts of pPG1 and pPG6 cDNAs under stringent con-ditions, digested with RNase A and RNase T1, and analyzedby gel electrophoresis.L2 and RBL-1 RNA fully protected PG19 cDNA se-

quences contained within the pPG1 (Fig. 6A) and pPG6 (Fig.6B) probes. The difference in protected fragment and probesize is accounted for by linker and vector sequences in theprobe. No protected probe fragments could be detectedwhen Rat-1 fibroblasts were used as the source of RNA. Asshown above, these cells did not express the PG19-specificmRNA. The results indicate that the L2 and RBL-1 mRNAshave sequence homology over the combined cDNA probelength of 987 bp. The combined length of protected PG19cDNA sequences appeared to account for the majority of thecoding sequence of the smaller RBL-1 mRNA, indicatingthat the 5' end of the RBL-1 mRNA was near the 5' end ofthe pPG6 cDNA. Indeed, the 5' end of RBL-1 mRNA, unlikethe longer mRNA from L2 cells, was capped only 5 to 6nucleotides upstream from pPG6 probe sequences (see be-low). In addition to the fully protected pPG6 probe, lowerlevels of a second band that was 20 to 30 nucleotides smallerthan the fully protected probe were detected with L2 andRBL-1 mRNAs (Fig. 6B). Since this band was much strongerwith the smaller RBL-1 mRNA, this suggests that theRNase-sensitive site may result from mRNA secondarystructure at the 5' end of the RBL-1 mRNA or incompleteprocessing of a 5' intron. This qualitative difference notwith-standing, these results indicate that the 1.3-kb PG19 mRNAfrom L2 cells and the 1.1-kb mRNA from RBL-1 cells arehomologous over nearly the full length of the RBL-1 mRNA,including the complete core protein coding sequence ofPG19.

PPG 1 -m1 2 3 4 5 6 7 8 9

214 " 0

18S-

' a -4I

FIG. 5. RNA transfer blot analysis of tissue RNA. Total RNA (5,ug) from L2 cells (lane 1), adult lung (lane 2), adult kidney (lane 3),adult liver (lane 4), adult spleen (lane 5), adult brain (lane 6), parietalyolk sac (day 12) (lane 7), visceral yolk sac (day 12) (lane 8), andwhole embryo (day 12) (lane 9) were electrophoresed on 1.4%agarose-formaldehyde denaturing gels, blotted onto nitrocellulose,and hybridized with RNA probe pPG1-III. The lane containing L2RNA was exposed for 8 h, and the remaining lanes were exposed for48 h.

MOL. CELL. BIOL.

9A_R

PROTEOGLYCAN GENE EXPRESSION 37

Primer extension analysis and RNA sequencing of L2 andRBL-1 proteoglycan mRNA. To explore further the apparentdifferences of the L2 and RBL-1 RNAs at their 5' ends weused mRNA primer extension to analyze the size and, whenpossible, the 5' sequences of these mRNAs.A 20-mer oligonucleotide complementary to the sequence

GCTGGTCAGGATGCGGCAGG 30 bp from the 5' end ofthe pPG6 clone was used as the primer in primer extensionanalysis of L2 and RBL-1 poly(A)+ RNA. The resultingprimer extension product for the L2 cell mRNA was approx-imately 180 nucleotides longer than that for the RBL-1mRNA (Fig. 7), indicating that the cap sites for the twomRNAs are different. The multiple primer extension prod-ucts toward the 5' end of L2 cell PG19 mRNA are probablythe result of reverse transcriptase stops, although more thanone cap site is also a possibility.RNA sequencing of RBL-1 PG19 mRNA showed that the

RBL-1 mRNA cap site was only 5 to 6 nucleotides upstreamfrom the 5' end of clone pPG6. The sequence from RBL-1cell RNA appeared to be identical to the pPG6 cDNAsequence (an L2 cell cDNA sequence) in this region. TheRNA sequence of PG19 mRNA from L2 cells upstream fromthe RBL-1 cap site was examined to determine whetherpromoter elements for the 1.1-kb PG19 mRNA could beidentified. The sequence (not shown) contained nucleotideambiguities but did not appear to code for consensus ofeither the TATA or CAAT regulatory elements (13) thatmight serve as transcription promoters for the 1.1-kb RBL-1mRNA. These results demonstrate that the 1.3-kb PG19mRNA of L2 cells and the 1.1-kb mRNA from RBL-1 cellsare transcribed from the same gene, differing only in thelength of their 5' untranslated sequence and probably in theuse of the 5' cap site. The reason for the alternative use ofcap sites remains to be determined by analysis of the gene.

A B1 2 3 4 1 2 3 4

1418-

1418-_ q

679-

L

679-

FIG. 6. RNA protection analysis. mRNA preparations from L2,RBL-1, and Rat-1 cells were analyzed for their ability to protectantisense RNA copies of PG19 cDNA in an RNA-RNA protectionassay with RNase A and RNase T1. [32P]UTP-labelled pPG1 (A) andpPG6 (B) in vitro-transcribed RNAs (lanes 1) were hybridized tototal RNA from L2 (lanes 2), RBL-1 (lanes 3), and Rat-1 (lanes 4)cells. Protected RNA-RNA hybrids were analyzed on 4%acrylamide-urea gels. Fully protected pPG1 and pPG6 RNA probesequences correspond to 874 and 773 nucleotides, respectively. Inaddition, these probes include approximately 100 nucleotides ofpolylinker and vector flanking sequence. Markers (1,418 and 679nucleotides) are RNAs transcribed in vitro from HincII-digestedpGEM1 plasmid with T7 RNA polymerase.

-J

238-201-

160-

M.

67-

.

34-

26-

FIG. 7. Primer extension analysis. The 5' end of PG19 mRNAfrom L2 and RBL-1 cells was analyzed with a 5'-end-labeled 20-merantisense strand oligonucleotide to prime cDNA synthesis by re-verse transcriptase beginning 30 nucleotides from the 5' end ofpPG6. Primer extension products were electrophoresed on 8%acrylamide-urea denaturing gels and autoradiographed. MspI cleav-age fragments of pBR322 were 3'-end labeled and used as markers,and their sizes (in base pairs) are shown to the left.

DISCUSSION

The results of genomic DNA blot hybridization show thatthe PG19 proteoglycan core protein is encoded by a singleunique gene and that there is a family of genes in the ratgenome related to the PG19 gene through homology in theserine-glycine coding sequence of this gene. The existence ofa single gene for PG19 was established with probes from the5' and 3' ends of the PG19 cDNA. Both probes identified asingle strongly hybridizing gene fragment in genomic blotsunder stringent hybridization conditions. There was someindication of hybridization to one or two additional genefragments with these probes, suggesting some homologywith additional genes. However, homologous genes werereadily detected with the probe coding for the serine-glycinerepeat region of PG19.The serine-glycine repeat probes revealed as many as 15 to

17 hybridizing gene fragments. The identification of thesehomologous sequences under stringent hybridization condi-tions indicates a high degree of homology between them andthe PG19 serine-glycine coding sequence.The results ofRNA blot hybridization suggest that at least

some of the PG19-related genes are transcribed. The RNAhybridization results paralleled the genomic blotting results.

VOL. 7, 1987

38 BOURDON ET AL.

Multiple transcripts hybridizing with probes from the serine-glycine coding sequence could be detected, whereas the 5'and 3' probes hybridized almost exclusively to the PG19mRNA. These results suggest that the mRNAs related to thePG19 mRNA share a serine-glycine repeat coding sequence,

but differ in the sequences flanking such a repeat. Whilesome of these flanking sequences are probably entirelydifferent from those of PG19, there was an indication ofsome homology with 5'- and 3'-flanking probes. Thesetranscripts may collectively represent a gene family, themembers of which are strongly homologous within a serine-glycine repeat coding sequence but also have some homol-ogy outside this region.Of particular interest in regard to the identity of the

transcripts related to the serine-glycine repeat are theDrosophila per gene and a homologous murine gene (19, 39),both coding for threonine-glycine and serine-glycine repeats.The per gene functions as a biological clock in Drosophila,regulating circadian rhythms and the frequency of malecourtship song (19). It is not known whether the mouse

per-related gene has a biological clock function. From thesequence homology it would appear likely that the transla-tion products are proteoglycans. Indeed, while the transla-tion product of the per-related mouse gene has not as yetbeen characterized, it has now been shown that the Drosoph-ila per gene product is a heparan sulfate proteoglycan (32).These results indicate that the serine-glycine and threonine-glycine repeat-containing gene products may be proteogly-cans, perhaps with regulatory functions in mammalian cellssimilar to those indicated for the Drosophila per gene

proteoglycan.Analyses of PG19 mRNAs demonstrate that PG19 gene

transcription is highly cell type specific. Moreover, twocell-type-specific PG19 mRNA forms are expressed whichapparently differ in their 5' cap sites. Results of RNA blotanalysis show that the PG19 mRNA is expressed in L2 yolksac carcinoma cells as well as in the rat basophilic leukemiacell line RBL-1, but not in any of the other cell lines tested,which included fibroblastic lung and kidney cells, chondro-sarcoma, and hepatoma cells. Low levels of PG19 mRNAwere also detected in parietal yolk sac and in adult rat lung,kidney, spleen, and liver. This tissue distribution agrees withthe idea that the proteoglycan is selectively expressed inparietal yolk sac cells in the embryo and in basophilicleukocytes and the related mast cells of the adult, mast cellsbeing abundant in the tissues in which expression of themRNA was detected. Moreover, biochemical analyses haveshown that mast cells express a proteoglycan with a serine-glycine glycosaminoglycan attachment domain (33, 38).The difference in size of the PG19 mRNA from L2 and

RBL-1 cells that was apparent in RNA hybridization blotsresulted from cell-type-specific use of different mRNA 5' cap

sites. The results of mRNA hybridization show that embry-onic expression of the PG19 gene in parietal yolk sac resultsin a larger mRNA transcript than is expressed in the rat

basophilic leukemia RBL-1 and adult tissues. RNA protec-

tion experiments, primer extension analysis, and RNA se-

quencing demonstrate that while the proteoglycan mRNAsfrom L2 and RBL-1 cell lines were identical over the entirecoding sequence of the RBL-1 mRNA, the L2 mRNA cap

site was about 180 nucleotides upstream from the 5' cap siteof the RBL-1 and adult tissue mRNA, accounting for thedifference in mRNA size between the two mRNA forms.Multiple cap sites have been observed in a number of genes,including those for alcohol dehydrogenase (4), a-amylase(48), dihydrofolate reductase (23), ferritin (11), the globin

gene family (2, 16), and rat brain mRNAs (44); however, theroles of such alternative or multiple cap sites and theresulting untranslated 5' mRNA sequences are unknown. Ithas been proposed that differences in the 5' cap site anduntranslated sequences regulate transcriptional stability andtranslational efficiency (1, 18). That the proteoglycan mRNAdifferences in 5' untranslated sequences may have a func-tional significance is suggested by the development andcell-type-specific expression of the two PG19 mRNA forms,a pattern also observed for the alcohol dehydrogenase geneof D. melanogaster (4) and the mouse a-amylase gene (48).The cell-type-specific expression and use of two distinct andapparently developmentally regulated transcriptional startsites suggest that the PG19 gene may be controlled bytissue-specific regulatory sequences. By analogy with thealcohol dehydrogenase (4) and a-amylase (48) genes, theexpression of two cell-type-specific forms of the PG19mRNA could result from the differential use of two promot-ers. However, sequencing of PG19 mRNA from L2 cells didnot reveal typical promoter sequences (4) in the 5' untransl-ated sequences upstream from the sequences correspondingto the mRNA cap site in RBL-1 cells. Since promotersequences could be within intron sequences, as is the casewith the alcohol dehydrogenase gene, we do not knowwhether one or more promoters are present in the PG19gene. The possible use of alternative splicing to generate thetwo mRNAs is also a possibility, although less likely, sincethe two mRNAs were apparently identical in their entireoverlapping sequence, differing only in the additional 5'sequences present in the larger mRNA form.On the protein level, the mRNAs of L2 and RBL-1 cells

have identical translation products, as inferred from theirmRNA sequence. The L2 and RBL-1 cell proteoglycans,however, may differ in their glycosaminoglycan chain com-position. The proteoglycan from L2 cells has chondroitinsulfate and dermatan sulfate chains (27), whereas the serine-glycine-rich proteoglycan of RBL-1 cells has, in addition tochondroitin sulfate chains, approximately 30% heparinchains (38). The same proteoglycan core protein productmay be expressed in mast cells, in which the heparinglycosaminoglycan attachment domain of the heparin prote-oglycan core protein is composed of serine and glycineresidues (33). If these proteoglycans prove to be the productof a single gene, then the implication for glycosaminoglycanaddition is that the stage of differentiation or lineage of thecell may be involved in determining the type of glycosamino-glycan chain added to the same core protein.The identification of sequences of the PG19 gene that are

shared to various extents by other genes, presumably pro-teoglycan genes, provides us with the means to isolate andcharacterize the PG19 gene as well as additional proteogly-can gene and cDNA sequences. Accumulation of suchinformation will be important for an understanding of prote-oglycan structure-function relationships, biosynthesis, andgene regulation.

ACKNOWLEDGMENTS

We thank John Knight of this institution for preparing the oligo-nucleotides and Rhonda Jenkins for preparing the manuscript.

This work was supported by Public Health Service grantsCA-28896 and CA-42507 and Cancer Center Support grant CA-30199from the National Cancer Institute. M.A.B. is the recipient of anNational Research Service Award fellowship from the NationalCancer Institute. M.S. was on leave from Dojindo Laboratories.

MOL. CELL. BIOL.

PROTEOGLYCAN GENE EXPRESSION 39

LITERATURE CITED

1. Alfonso-Pizarro, A., D. P. Carlson, and J. Ross. 1984.Subcellular localization of RNAs in transfected cells: role ofsequences at the 5' terminus. Nucleic Acids Res. 12:8363-8380.

2. Allan, M., W. G. Lanyon, and J. Paul. 1983. Multiple origins oftranscription in the 4.5 Kb upstream of the epsilon-globin gene.Cell 35:187-197.

3. Axelsson, I., and D. K. Heinegard. 1980. Characterization ofchondroitin sulfate-rich proteoglycans from bovine cornealstroma. Exp. Eye Res. 31:57-66.

4. Benyajati, C., N. Spoerel, H. Haymerle, and M. Ashburner.1983. The messenger RNA for alcohol dehydrogenase inDrosophila melanogaster differs in its 5' end in different devel-opmental stages. Cell 33:125-133.

5. Bos, J. L., M. Verlaan-de Vries, A. M. Jansen, G. H. Veeneman,J. M. van Boom, and A. J. ver der Erb. 1984. Three differentmutations in codon 61 of the human N-ras gene detected bysynthetic oligonucleotide hybridization. Nucleic Acids Res.12:9155-9163.

6. Bourdon, M. A., A. Oldberg, M. Pierschbacher, and E.Ruoslahti. 1985. Molecular cloning and sequence analysis of a

chondroitin sulfate proteoglycan cDNA. Proc. Natl. Acad. Sci.USA 82:1321-1325.

6a.Bourdon, M. A., M. Shiga, and E. Ruoslahti. 1986. Identificationfrom cDNA of the precursor form of a chondroitin sulfateproteoglycen core protein. J. Biol. Chem. 261:12534-12537.

7. Brennan, M. J., A. Oldberg, E. G. Hayman, and E. Ruoslahti.1983. Effect of a proteoglycan produced by rat tumor cells ontheir adhesion to fibronectin-collagen substrata. Cancer Res.43:4302-4307.

8. Brennan, M. J., A. Oldberg, M. D. Pierschbacher, and E.Ruoslahti. 1984. Chondroitin/dermatan sulfate proteoglycan inhuman fetal membranes. J. Biol. Chem. 259:13742-13750.

9. Couchman, J. R., A. Woods, M. Hook, and J. E. Christner.1985. Characterization of a dermatan sulfate proteoglycan syn-thesized by murine parietal yolk sac (PYS-2). J. Biol. Chem.260:13755-13762.

10. Culp, L. A., B. A. Murray, and B. J. Rollins. 1979. Fibronectionand proteoglycans as determinants of cell-substratum adhesion.J. Supramol. Struct. 11:401-427.

11. Didsbury, J. R., E. C. Theil, R. E. Kaufman, and L. F. Dickey.1986. Multiple red cell ferritin mRNAs, which code for anabundant protein in the embryonic cell type, analyzed by cDNAsequence and by primer extension of the 5'-untranslated re-

gions. J. Biol. Chem. 261:949-955.12. Doege, K., P. Fernandez, J. R. Hassell, M. Sasaki, and Y.

Yamada. 1986. Partial cDNA sequence encoding a globulardomain at the C terminus of the rat cartilage proteoglycan. J.Biol. Chem. 261:8108-8111.

13. Efstratiadis, A., J. W. Posakony, T. Maniatis, R. M. Lawn, C.O'Connell, R. A. Spritz, J. K. De Riel, B. G. Forget, S. M.Weissman, J. L. Slightom, A. E. Blechl, 0. Smithies, F. E.Baralle, C. C. Shoulders, and N. J. Proudfoot. 1980. The struc-ture and evolution of the human P-globin gene family. Cell21:653-668.

14. Fransson, L.-A., I. Carlstedt, L. Coster, and A. Malmstrom.1984. Binding of transferrin to the core protein of fibroblastproteoheparan sulfate. Proc. Natl. Acad. Sci. USA 81:5657-5661.

15. Goldberg, D. A. 1980. Isolation and partial characterization ofthe Drosophila alcohol dehydrogenase gene. Proc. Natl. Acad.Sci. USA 77:5794-5798.

16. Grindlay, G. J., W. G. Lanyon, M. Allan, and J. Paul. 1984.Alternative sites of transcription initiation upstream of thecanonical cap site in human y-globin and ,B-globin genes. Nu-cleic Acids Res. 12:1811-1820.

17. Hascall, V. C., and G. K. Hascall. 1981. Proteoglycans, p. 39-63.In E. D. Hay (ed.), Cell biology of extracellular matrix. PlenumPublishing Corp., New York.

18. Hultmark, D., R. Klemenz, and W. J. Gehring. 1986. Transla-tional and transcriptional control elements in the untranslated

leader of the heat-shock gene hsp22. Cell 44:429-438.19. Jackson, F. R., T. A. Bargiello, S.-H. Yun, and M. W. Young.

1986. Product of per locus of Drosophila shares homology withproteoglycans. Nature (London) 320:185-188.

20. Kanwar, Y. S., and M. G. Farquhar. 1979. Isolation ofglycosaminoglycans (heparan sulfate) from glomerular base-ment membranes. Proc. Natl. Acad. Sci. USA 76:1303-1307.

21. Koda, J. E., and M. Bernfield. 1984. Heparan sulfate proteogly-cans from mouse mammary epithelial cells. Basal extracellularproteoglycan binds specifically to native type I collagen fibrils.J. Biol. Chem. 259:11763-11770.

21a.Krusius, T., and E. Ruoslahti. 1986. Primary structure of anextracellular matrix proteoglycan core protein deduced fromcloned cDNA. Proc. Natl. Acad. Sci. USA 83:7683-7687.

22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual, p. 280. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

23. McGrogan, M., C. C. Simonsen, D. T. Smouse, P. J. Farnham,and R. T. Schimke. 1985. Heterogeneity at the 5' end termini ofmouse dihydrofolate reductase mRNAs. J. Biol. Chem.260:2307-2314.

24. McKnight, S. L., E. R. Gavis, R. Kingsbury, and R. Axel. 1981.Analysis of transcriptional regulatory signals of the HSV thy-midine kinase gene: identification of an upstream control region.Cell 25:385-398.

25. Melton, D. A., P. A. Krieg, M. R. Rebagliati, T. Maniatis, K.Zinn, and M. R. Green. 1984. Efficient in vitro synthesis ofbiologically active RNA and RNA hybridization probes fromplasmids containing a bacteriophage SP6 promoter. NucleicAcids Res. 12:7035-7056.

26. Oegema, T. R., Jr., V. C. Hascall, and R. Eigenstein. 1979.Characterization of bovine aorta proteoglycan extracted withguanidine hydrochloride in the presence of protease inhibitors.J. Biol. Chem. 254:1312-1318.

27. Oldberg, A., E. G. Hayman, and E. Ruoslahti. 1981. Isolation ofa chondroitin sulfate proteoglycan from a rat yolk sac tumor andimmunochemical demonstration of its cell surface localization.J. Biol. Chem. 256:10847-10852.

28. Oldberg, A., E. Linney, and E. Ruoslahti. 1983. Molecularcloning and nucleotide sequence of a cDNA clone coding for thecell attachment domain in human fibronectin. J. Biol. Chem.258:10193-10196.

29. Oldberg, A., E. Ruoslahti. 1982. Interactions betweenchondroitin sulfate proteoglycan, fibronectin, and collagen. J.Biol. Chem. 257:4859-4863.

30. Parthasarathy, N., and E. G. Spiro. 1981. Characterization ofthe glycosaminoglycan component of the renal glomerular base-ment membrane and its relationship to the peptide portion. J.Biol. Chem. 256:507-513.

31. Radhakrishnamurthy, B., E. Smart, E. R. Dalferes, Jr., andG. S. Berenson. 1980. Isolation and characterization of proteo-glycans from bovine lung. J. Biol. Chem. 255:7575-7582.

32. Reddy, P., A. C. Jacquier, N. Abovich, G. Petersen, and M.Rosbash. 1986. The period clock locus of D. melanogaster codesfor a proteoglycan. Cell 46:53-61.

33. Robinson, H. M., A. A. Horner, M. Hook, S. Ogren, and U.Lindahl. 1978. A proteoglycan form of heparin and its degrada-tion to single-chain molecules. J. Biol. Chem. 253:6687-6693.

34. Robinson, J., M. Viti, and M. Hook. 1984. Structure andproperties of an under-sulfated heparan sulfate proteoglycansynthesized by a rat hepatoma cell line. J. Cell Biol. 98:946-953.

35. Sai, S., T. Tanaka, R. A. Kosher, and M. L. Tanzer. 1986.Cloning and sequence analysis of a partial cDNA for chickencartilage proteoglycan core protein. Proc. Natl. Acad. Sci. USA83:5081-5085.

36. Sakashita, S., E. Engvall, and E. Ruoslahti. 1980. Basementmembrane glycoprotein laminin binds to heparin. FEBS Lett.116:243-246.

37. Sant, A. J., S. E. Cullen, K. S. Giacoletto, and B. D. Schwartz.1985. Invariant chain is the core protein of the Ia-associatedchondroitin sulfate proteoglycan. J. Exp. Med. 162:1916-1934.

38. Seldin, D. C., K. F. Austen, and R. L. Stevens. 1985. Purificationand characterization of protease-resistant secretory granule

VOL. 7, 1987

40 BOURDON ET AL. MOL. CELL. BIOL.

proteoglycans containing chondroitin sulfate Di-B and heparin-like glycosaminoglycans from rat basophilic leukemia cells. J.Biol. Chem. 260:11131-11139.

39. Shin, H.-S., T. A. Bargiello, B. T. Clark, F. R. Jackson, andM. W. Young. 1985. An unusual coding sequence from a

Drosophila clock gene is conserved in vertebrates. Nature(London) 317:445-448.

40. Singer, R. H., and S. Penman. 1973. Messenger RNA in HeLacells: kinetics of formation and decay. J. Mol. Biol. 78:321-334.

41. Southern, E. M. 1975. Detection of specific sequences among

DNA fragments separated by gel electrophoresis. J. Mol. Biol.99:503-517.

42. Suzuki, S., M. D. Pierschbacher, E. G. Hayman, K. Nguyen, Y.Ohgren, and E. Ruoslahti. 1984. Domain structure ofvitronectin. Alignment of active sites. J. Biol. Chem.259:15307-15314.

43. Thomas, P. S. 1980. Hybridization of denatured RNA and smallDNA fragments transferred to nitrocellulose. Proc. Natl. Acad.

Sci. USA 77:5201-5205.44. Tsou, A.-P., C. Lai, P. Danielson, D. J. Noonan, and J. G.

Sutcliffe. 1986. Structural characterization of a heterogeneousfamily of rat brain mRNAs. Mol. Cell. Biol. 6:768-778.

45. Ulirich, A., J. Shine, J. Chergwin, R. Pictet, E. Fischer, W. J.Rutter, and H. M. Goodman. 1977. Rat insulin genes: construc-tion of plasmids containing the coding sequences. Science196:1313-1319.

46. Van Beveren, C., F. van Straaten, T. Curran, R. Muller, andI. M. Vetma. 1983. Analysis of FBJ-MuSV provirus and cfos(mouse) gene reveals that viral and cellular fos gene productshave different carboxytermini. Cell 32:1241-1255.

47. Woodley, D. T., C. N. Rao, J. R. Hassell, L. A. Liotta, G. R.Martin, and H. K. Kleinman. 1983. Interactions of basementmembrane components. Biochim. Biophys. Acta 761:287-283.

48. Young, R. A., 0. Hagenbuchle, and U. Schibler. 1981. A singlemouse a-amylase gene specifies two differet tissue-specificmRNAs. Cell 23:451-458.