protein kinase c d is a downstream effector of oncogenic k ......molecular and cellular pathobiology...

Molecular and Cellular Pathobiology

Protein Kinase C d Is a Downstream Effector of OncogenicK-ras in Lung Tumors

Jennifer M. Symonds1, Angela M. Ohm2, Cristan J. Carter2, Lynn E. Heasley1,2,Theresa A. Boyle3, Wilbur A. Franklin3, and Mary E. Reyland1,2

AbstractOncogenic activation of K-ras occurs commonly in non–small cell lung cancer (NSCLC), but strategies to

therapeutically target this pathway have been challenging to develop. Information about downstream effectorsof K-ras remains incomplete, and tractable targets are yet to be defined. In this study, we investigated the role ofprotein kinase C d (PKCd) in K-ras–dependent lung tumorigenesis by using a mouse carcinogen model andhuman NSCLC cells. The incidence of urethane-induced lung tumors was decreased by 69% in PKCd-deficientknockout (dKO) mice compared with wild-type (dWT) mice. dKO tumors are smaller and showed reducedproliferation. DNA sequencing indicated that all dWT tumors had activating mutations in KRAS, whereas only69% of dKO tumors did, suggesting that PKCd acts as a tumor promoter downstream of oncogenic K-ras whileacting as a tumor suppressor in other oncogenic contexts. Similar results were obtained in a panel of NSCLC celllines with oncogenic K-ras but which differ in their dependence on K-ras for survival. RNA interference–mediated attenuation of PKCd inhibited anchorage-independent growth, invasion, migration, and tumorigenesisin K-ras–dependent cells. These effects were associated with suppression of mitogen-activated protein kinasepathway activation. In contrast, PKCd attenuation enhanced anchorage-independent growth, invasion, andmigration in NSCLC cells that were either K-ras–independent or that had WT KRAS. Unexpectedly, our studiesindicate that the function of PKCd in tumor cells depends on a specific oncogenic context, as loss of PKCd inNSCLC cells suppressed transformed growth only in cells dependent on oncogenic K-ras for proliferation andsurvival. Cancer Res; 71(6); 2087–97. �2011 AACR.

Introduction

Non–small cell lung cancers (NSCLC) account for themajority of lung cancers, with adenocarcinomas being thepredominant subtype (1). Mutation of KRAS occurs in about30% of lung adenocarcinomas, resulting in its constitutiveactivation (2). To identify potential downstream effectors ofoncogenic K-Ras, we have explored the contribution of proteinkinase C d (PKCd) to K-Ras–dependent lung tumorigenesis.The PKC family of serine/threonine protein kinases consists of11 isoforms that regulate a wide variety of biological functions(3). Studies in PKCd knockout (dKO) mice have confirmed a

role for this kinase in cell proliferation and apoptosis (3–10). Inthe dKO mouse, cell death in response to irradiation issuppressed, and smooth muscle and epithelial cells culturedfrom these mice are resistant to multiple apoptotic stimuli (5,7, 11). PKCd may regulate apoptosis via p53, as p53 transcrip-tional activation in response to genotoxins and oxidativestress requires PKCd (12–15). In the context of proliferation,PKCd has been shown to be a downstream effector of theepidermal growth factor receptor (EGFR; refs. 6, 16–18) andcollaborates with the Hedgehog pathway to regulate extra-cellular signal regulated kinase (ERK) signaling (19). PKCd hasalso been shown to both positively and negatively regulatecell-cycle progression (19, 20).

The demonstration of a proapoptotic role for PKCd has leadto the suggestion that it may function as a tumor suppressor(3, 21). In support of this, PKCd protein expression is reducedin human squamous cell and bladder carcinomas (22, 23) anddecreases with increasing tumor grade in human endometrialcarcinomas (24). In contrast, PKCd expression is elevated inpancreatic cancer, myelogenous leukemia, and hepatocellularcarcinoma (25–27). To address these potentially diverse func-tions of PKCd, we have used a chemically induced mousemodel in which lung tumorigenesis is associated with activat-ing mutations in KRAS, and a panel of human NSCLC cellsthat harbor oncogenic K-ras. Our studies show that PKCd

Authors' Affiliations: 1Program in Cancer Biology, School of Medicine;2Department of Craniofacial Biology, School of Dental Medicine; and3Department of Pathology, School of Medicine, University of Colorado,Anschutz Medical Campus, Aurora, Colorado

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Mary E. Reyland, M.S. 8120, P.O. Box 6511, Uni-versity of Colorado, Anschutz Medical Campus, Aurora, CO 80045. Phone:303-724-4572; Fax: 303-724-4580; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-10-1511

�2011 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 2087

on July 8, 2021. © 2011 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 18, 2011; DOI: 10.1158/0008-5472.CAN-10-1511

http://cancerres.aacrjournals.org/

functions as a tumor promoter in transformed cells that aredependent on K-ras for proliferation and survival whereas, intumor cells that do not rely on K-ras, PKCd may function as atumor suppressor.

Materials and Methods

Animal modelsFVB dKO mice were generated by backcrossing C57/Bl6

dKO mice (28) with FVB mice for more than 10 generations.Nude mice were purchased from Jackson Laboratories. Ani-mals were maintained at the University of Colorado, DenverAnschutz Medical Campus, in accordance with LaboratoryAnimal Care guidelines and protocols and with approval of theUniversity of Colorado, Denver Institutional Animal Use andCare Committee. Male FVB dWT and dKO mice (6–8 weeks ofage) were injected with 1 mg/kg urethane in sterile water andsacrificed at 10 or 20 weeks postinjection. Mice were perfusedwith 10 mL of sterile-filtered heparinized PBS (500 U/mL), andthe lungs were inflated with 10% formalin. Fixed lungs wereprocessed and paraffin embedded or were stored for DNAextraction at �80�C.

Tumor analysisTumor sections (5 mm) were stained with hematoxylin and

eosin (H&E) and anti-Ki67 as previously described (5). Quan-tification of tumors at 20 weeks was done by countingmacroscopic tumors in dissected lungs. Tumor diameterwas measured using digital microcalipers; because of thespherical shape of the tumors, tumor volume was calculatedusing the formula 4/3pr3. For quantification of microscopictumors at 10 weeks, paraffin-embedded tumors were cut intosequential 4 mm thick sections and stained with H&E. Tumornumber was determined by analysis of sections, representingthe entire lung, by light microscopy. Tumor volume wasdetermined using the formula 4/3pr3, where tumor diameterequaled 4 mm � the number of sections the tumor spanned.

Sequencing of KRAS in urethane-induced tumorsDNA was extracted using the DNeasy Blood and Tissue Kit

and theQiacubeAutomatedExtraction System (Qiagen). Exons2 and 3 of the mouse KRAS gene were sequenced using theAppliedBiosystems IncorporatedBigDyeCycle SequencingKitand ABI 3730 Sequencer. The following primer sets were used:

Exon 2: Forward external 50 TTTACACACAAAGGTGAGTGT 30

Exon 2: Forward internal TGTGTGAGACATGTTCTAATTTAGTTG

Exon 2: Reverse GCACGCAGACTGTAGAGCAGExon 3: Forward CCAGACTGTGTTTCTCCCTTCExon 3: Reverse external TGCAGGCATAACAATTAGCAAExon 3: Reverse internal TCACATGCCAACTTTCTTATTC

NSCLC cell culture and depletion of PKCdNSCLC cell lines, A549, NCI-H2009, NCI-H441, NCI-H727,

NCI-H460, SW1573, Colo699, and NCI-H226, were acquired

from the University of Colorado Denver Lung SPORE CellBank. Cell line profiling for authentication was done at theDNA Sequencing Core at University of Colorado AnschutzMedical Campus by using the ABI profiler plus and ABIidentifier profiling kits. Cells were maintained in RPMI-1640with 2 mmol/L L-glutamine and 10% FBS. Transient depletionof PKCd by siRNA was done using ON-TARGETplus SMART-pool siRNA for human PKCd (Dharmacon; Thermo Fisher)consisting of the following sequences: 50-CCAUGUAUCCUGA-GUGGAA, 50-CCAAGGUGUUGAUGUCUGU, 50-AAAGAACG-CUUCAACAUCG, and 50-CCGCACCGCUUCAAGGUUC, andthe ON-TARGETplus Nontargeting Pool. Stable depletion ofPKCd was done using lentiviral constructs containing shorthairpin (shRNA) to human PKCd (Open Biosystems; pLKO-TRC00010193 or pLKO-TRC00010203) or an shRNA control(pLKO-scrambled). Lentiviral particle containing media wasprepared as previously described (29). NSCLC cell lines wereinfected with 1 mL of lentiviral particle containing media plus500 mg/mL polybrene for 1 hour, followed by the addition ofcomplete media. Cell lines were maintained in selection mediawith 2 mg/mL puromycin and used at low passage (

Ras pull-down assayCell lysates were prepared using the Ras activation assay kit

from Millipore and precleared with 50 mL of packedglutathione sepharose 4B (GE Healthcare) per 500 mL of lysate.For controls, lysates plus GTPgS (positive) or GDP (negative)were used. For the Ras pull-down, 350 mL of precleared lysatewas transferred to a tube containing 10 mg of PBD-Pak1agarose and incubated for 1 hour at 4�C. Pellets were washed,resuspended in 2� Laemmli sample buffer, and separated bySDS-PAGE. Proteins were detected by immunoblotting for Rasas described in the following text.

Adenovirus infectionNSCLC cells were plated at 1 � 106 cells per 60-mm dish.

The following day cells were infected with either the Ad-LacZcontrol or Ad-PKCdKD adenovirus at an MOI (multiplicity ofinfection) ¼ 250 as previously described (10). Cells wereharvested for protein 24 hours post transduction and ranon a 10% SDS-polyacrylamide gel. Proteins were immobilizedon polyvinylidene difluoride membrane and then immuno-blotted for the indicated proteins.

Immunoblot analysisImmunoblotting was done as previously described (5).

Antibodies to PKCd (sc-937) and actin (sc-1616) werepurchased from Santa Cruz Biotech. The followingantibodies were purchased from Cell Signaling Technologies:phospho-Akt (#4060; pAkt); Akt (#9272); phospho-ERK1/2(#9101; pERK1/2); ERK1/2 (#4695); phospho-MEK (MAP/ERK kinase) 1/2 (#9121; pMEK;); MEK1/2 (#9122); phospho-PDK1 (#3061; pPDK1;); PDK1 (#3062). Anti-Ras was purchasedfrom Millipore and antibodies to RSK1 and phospho-RSK1(#AF889; pRSK90;) were purchased from R&D Systems.

Growth of H441 cells as xenograftsNude mice were injected with control [scrambled shRNA

control (scr); n ¼ 10] H441 cells in the left flank or H441 cellsexpressing either d193 (n¼ 5) or d203 (n¼ 5) in the right flank.Tumors were measured using digital microcalipers everysecond day starting at day 9, and tumor volume was calculatedusing the formula p/6 (L � 0.5L2). Mice were sacrificed at day27, and tumor lysates were immunoblotted for pERK andstripped and reprobed for total ERK or immunoblotted forPKCd and stripped and reprobed for actin.

Results

Reduced urethane-induced lung tumorigenesis in thedKO mouseTo determine whether PKCd contributes to lung tumor-

igenesis, we analyzed the development of urethane-inducedtumors in mice in which the PKCd gene has been disrupted(dKO) and in their wild-type (dWT) littermates. As shown inFigure 1A, lung tumors in dKO mice treated with urethane for20 weeks were reduced by 69% compared with dWTmice, withan average of 13.1 � 1.1 tumors per dWTmouse and 4.1 � 0.7tumors per dKO mouse (P < 0.0001). Tumors from bothgenotypes resembled well-differentiated adenomas; however,

tumors from dKO mice were significantly smaller than thosefrom dWT mice (Fig. 1B and C, top). Expression of theproliferation marker Ki67 was reduced by 30% in dKO tumorsas compared with dWT tumors (Fig. 1C, bottom). Cellspositive for cleaved caspase-3 were only very rarely observedin any tumors (data not shown), suggesting that aberrantregulation of apoptosis is unlikely to explain the reduced lungtumorigenesis in dKO mice.

The dramatic reduction in tumor number in dKO micecould result from delayed tumor growth or possibly tumorregression. To address this further, we analyzed tumor num-ber and size in dKO and dWT mice at 10 weeks followingurethane treatment (Fig. 1D). Microscopic and macroscopictumors were apparent in the lungs of both genotypes; 6 of 7dWT mice had 3 or more tumors, whereas only 2 of 7 dKOmice had a similar tumor burden. This suggests a trendtoward reduced tumor number in dKO mice; however, tumornumber per mouse was not statistically different between the2 groups (Fig. 1D, top). In contrast, a statistically significantreduction in tumor size was seen in 10-week urethane-treateddKO mice (Fig. 1D, bottom). In addition, although tumorsgreater than 2.5 � 106 mm3 comprised 40% of the tumorsfound in dWT mice, this population was absent from the dKOmice. This suggests that in the absence of PKCd, urethane-induced tumors either do not progress or progress moreslowly.

To determine the KRASmutational status of dWT and dKOtumors, we sequenced exons 2 and 3 of KRAS, which containthe codons (12, 13, and 61) most frequently mutated in lungcancer. All 20 tumors analyzed from dWTmice had oncogenicmutations in codon 61 of KRAS. No mutations in codons 12 or13 were found. The reduction in urethane-induced tumors indKO mice suggests that in the context of oncogenic KRAS,PKCd functions as a tumor promoter. However, only 22 of 32tumors sequenced from dKO mice had KRAS codon 61 muta-tions (P < 0.008; Table 1). Hence, more than 30% of the dKOtumors arise via a K-Ras–independent mechanism. Further-more, as WT KRAS tumors are found only in dKO mice, inthis subset of tumors loss of PKCd seems to be permissivefor tumorigenesis, suggesting that in some oncogenic contextsPKCd may function as a tumor suppressor.

PKCd is required for transformed growth of human K-Ras–dependent NSCLC cells

Although many NSCLC cell lines harbor oncogenic KRAS,recent studies from Settleman and colleagues show that only asubset of these cells continue to require activated K-Ras forproliferation and survival (30). To determine the role of PKCdin transformed growth, we used a panel of NSCLC cell linesthat are dependent on activated K-Ras for survival (H2009,H441, and H727), independent of K-Ras for survival (A549,H460, and SW1573), or express WT K-Ras protein (Colo669and H226). The K-Ras dependency of these cell lines forgrowth was verified in cells depleted of K-Ras. As reportedpreviously, H2009 and H441 cells were highly dependent on K-Ras for growth whereas H727 cells were only slightly depen-dent (Supplementary Fig. 1; ref. 30). PKCd expression in these8 NSCLC cell lines and a human cell line derived from normal

PKCd and Lung Cancer

www.aacrjournals.org Cancer Res; 71(6) March 15, 2011 2089




Table 1. KRAS mutations in lung adenomas from dWT and dKO urethane treated mice

Genotype WT KRAS Mutant KRAS Q61R Q61L

dWT 0 20 19 1dKO 10a 22 19 3

NOTE: Number of lung tumors from dWT and dKO mice with KRAS codon 61 mutations. KRAS codons 12, 13, and 61 weresequenced in 32 dKO and 20 dWT tumors; no codon 12 or 13 mutations were found in either tumor group.aSignificantly different from dWT (P < 0.008) by Fisher's exact 2-tailed test.

Figure 1. Urethane-induced lungtumorigenesis is suppressed indKO mice. FVB dWT or dKO micewere injected with 1 mg/kgurethane in sterile water andsacrificed as described inMaterials and Methods. A, lungtumors/mouse at 20weeks (n¼ 11each genotype) post–urethaneinjection. B, quantification of dWTand dKO tumor sizes at 20 weekspost–urethane injection. C, top,H&E staining (40� and 400�) andKi67 immunohistochemistry(200�) of dWT and dKO tumorsfrom 20-week treated mice;bottom, quantification of Ki67expression. Data represent theaverage number of Ki67-positivecells/total tumor cells � SEM (P <0.001). Greater than 1,000 cellswere quantified for each tumor; n¼ 17 tumors derived from 4 dWTmice and 14 tumors derived from 4dKO mice. D, top, lung tumors permouse at 10 weeks (n ¼ 7 eachgenotype) post–urethaneinjection; bottom, quantification ofdWT and dKO tumor size at10 weeks post–urethane injection.Significance for all experimentswas determined using a 2-tailedStudent's t test.

Symonds et al.

Cancer Res; 71(6) March 15, 2011 Cancer Research2090




bronchial epithelial cells does not correlate per se with thepresence of, or dependence on, activated K-Ras (Supplemen-tary Fig. 2A).To determine the effect of PKCd depletion on growth of

NSCLC cells as monolayers, PKCd was transiently depletedby transfection of pooled targeted siRNAs. Assay of BrdUincorporation 72 hours after the addition of siRNA indicatedthat the proliferation of A549 cells was slightly, but signifi-cantly, increased by depletion of PKCd; however, PKCd

depletion had no effect on the proliferation of any of theother NSCLC cell lines (Fig. 2A). When PKCd was depletedwith shRNA and cell growth was assayed by counting cellson successive days, depletion of PKCd had no effect on cellproliferation (Supplementary Fig. 2B–D). Anchorage-inde-pendent growth of cancer cells is a marker of transformedgrowth in vitro and correlates with tumor aggressiveness andmetastatic potential in vivo (31). To assay the effect of PKCddepletion on anchorage-independent growth, we depleted

Figure 2. PKCd is required foranchorage-independent growth ofNSCLC cells that are K-ras–dependent for survival. A, BrdUincorporation in 8 NSCLC cells inwhich PKCd was transientlydepleted using siRNA oligos asindicated. Control cells (dsiRNA�)were treated with scrambledsiRNA oligos. Immunoblots forPKCd to show protein depletionare shown below; blots werestripped and probed for actin. Forall panels, data from arepresentative experiment areshown which were done intriplicate � SEM. B and C, controlNSCLC cells (scr), and cellsexpressing d193 or d203, weresuspended in soft agar and colonynumber was determined asdescribed in Materials andMethods. B, K-Ras–dependentNSCLC cell lines H2009, H727,and H441. C, K-Ras–independentNSCLC cell lines A549 and H460and H226 cells that have WT K-Ras. Graphs show triplicatemeasurements in 1 representativeexperiment � SEM; photographsof representative soft agarcolonies are included. *,significantly different from control(P < 0.05) by 2-tailed Student's ttest. Immunoblots showingexpression of PKCd and actin foreach cell line are shown below thegraphs. Each experiment wasrepeated 2 to 6 times.






PKCd in NSCLC cells by a lentiviral delivery of shRNAdirected to PKCd (d193 and d203) or a scrambled shRNAcontrol. d193 expression resulted in nearly completedepletion of PKCd in all cell lines, whereas d203 resultedin partial depletion of PKCd protein (Fig. 2B and C andSupplementary Fig. 2B). Neither of the shRNAs altered theexpression of other PKC isoforms (data not shown). Asshown in Figure 2B, depletion of PKCd suppressed colonyformation in soft agar by 60% to 80% in 3 K-Ras–dependentNSCLC cell lines (H2009, H441, and H727). A fourth K-Ras–dependent cell line, H358, showed a 55% decrease in ancho-rage-independent growth in cells expressing d193 shRNA ascompared with scrambled shRNA (data not shown). Incontrast, the K-Ras–independent cell lines (A549 andH460) and the K-Ras WT cells (H226) showed a small butsignificant increase in colony formation when PKCd wasdepleted, suggesting that PKCd suppresses anchorage-inde-pendent cell growth in this subset of NSCLC cell lines(Fig. 2B).

PKCd regulates MAPK signaling in NSCLC cellsTo probe the mechanism by which PKCd regulates

transformed growth of K-Ras–dependent NSCLC cells, we

investigated activation of the mitogen-activated proteinkinase (MAPK) and Akt pathways, both of which are knownto drive proliferation downstream of oncogenic K-ras. Nosignificant differences were found in the amount of acti-vated Ras between the control cell lines and cell lines inwhich PKCd had been depleted (Fig. 3A). As PKCd haspreviously been implicated in regulation of PDK1 (32), anupstream activator of Akt, we next investigated whetherPDK1 and/or Akt activation was regulated by PKCd. Asshown in Figure 3B, although Akt activation varies betweenthe NSCLC cell lines, neither PDK1 nor Akt was regulated bydepletion of PKCd.

Analysis of the MAPK pathway revealed that depletion ofPKCd suppresses proliferative signaling via this pathwaydramatically in K-Ras–dependent H2009 and H441 cells(Fig. 4A). Phosphorylation of MEK was suppressed inH2009 and H441 cells depleted of PKCd, especially in cellsexpressing the d193 shRNA, as was phosphorylation of itsdownstream target, ERK (quantified in Fig. 4B and C).Depletion of PKCd in the H727 cells had only a slight effecton ERK activation and seemed to increased pMEK, perhapsreflecting the observation by our laboratory and that ofSingh and colleagues that these cells are intermediate

Figure 3. PKCd is not required foractivation of Ras or PDK1/Akt inNSCLC cells. A, Ras activation incontrol (scr), d193, and d203expressing A549, H2009, andH441 cells. Top, pull-down ofGTP-bound Ras; far left, GTPgS orGDP was added to cell lysatesbefore pull-down. Second, third,and fourth rows showimmunoblots for total Ras, PKCd,and actin. B, cell lysates preparedfrom control (scr), d193, and d203expressing K-Ras–independent(A549 and H460) and K-Ras–dependent (H2009 and H441)NSCLC cells were immunoblottedfor pPDK1 (S241), pAkt (S473),pMEK1/2 (S217/221) as indicated.Blots were stripped and probedfor total PDK1, Akt, PKCd, andactin, as indicated. Experimentswere repeated a minimum of 4times.

Symonds et al.





between K-Ras–dependent and K-Ras–independent NSCLCcells (Supplementary Fig. 1A; ref. 30). Phosphorylation ofRSK90, a downstream target of activated ERK, was alsoslightly suppressed in PKCd-depleted H727, H2009, andH441 cells, although this was some what variable, perhapsreflecting the fact that multiple pathways can regulateRSK90. In contrast to K-Ras–dependent cells, depletion ofPKCd in K-Ras–independent A549, H460, and SW1573 cellsresulted in an increase in phospho-MEK, which correlatedwith a more robust activation of ERK (Fig. 4A–C). Regulationof ERK activation by PKCd was verified by transducing A549,H460, H2009, and H441 cells with an adenovirus encoding akinase dead (dKD) PKCd which functions as dominantnegative (10). A decrease in pERK was found only in the

K-Ras–dependent H2009 and H441 cells, whereas a smallincrease in pERK was observed in the K-Ras–independentA549 cells. These studies indicate that PKCd positivelyregulates proliferative signaling through the MEK/ERK path-way in K-Ras–dependent NSCLC cells whereas in K-Ras–independent cells PKCd may suppress this proliferativepathway.

Depletion of PKCd suppresses invasion, migration, andtumor growth in nude mice

As PKCd has been shown to regulate motility and invasionof breast carcinoma cells through regulation of the ERKpathway (33), we next sought to determine whether deple-tion of PKCd suppresses the ability of A549 or H2009 cells to

Figure 4. PKCd is required for theactivation of MEK/ERK in NSCLCcells that are K-ras–dependent forsurvival. A, cell lysates preparedfrom control (scr), d193, and d203expressing K-Ras–mutatedNSCLC cells were immunoblottedfor pMEK1/2 (S217/221), pERK1/2(T202/Y204), and pRSK90 (S380).Blots were stripped and probedfor total MEK1/2, ERK1/2, RSK90,PKCd, and actin, as indicated.Representative experiments areshown; experiments wererepeated a minimum of 4 times. B,pMEK1/2 levels from A werequantified by densitometry,normalized to total MEK1/2, andplotted relative to control (scr). C,pERK1/2 levels from A werequantified by densitometry,normalized to total ERK1/2, andplotted relative to control (scr). ForB and C: scr, white bars; d193,gray bars; d203, black bars. D,A549, H460, H2009, and H441cells were infected withadenovirus encoding eithercontrol (Ad-lacZ) or kinase dead(Ad-dKD). Cell lysates wereprepared and immunoblotted forpERK1/2, ERK, actin, and PKCd.Increased PKCd protein in dKDtransduced cells indicatesexpression of dKD. Thisexperiment was repeated 3 times;a representative blot is shown.






migrate in response to serum or to invade through aMatrigel cushion. As shown in Figure 5A, depletion of PKCdsignificantly suppressed cell migration (up to 50%) andinvasion (up to 70%) in H2009 cells as compared with cellsexpressing a scrambled shRNA. In contrast, no inhibition ofmigration or invasion was seen in PKCd–depleted A549 cells(Fig. 5B). This indicates that similar to anchorage-indepen-dent growth, PKCd regulates invasion and migration ofNSCLC cells only in the context of dependency on activatedK-Ras.

To investigate whether depletion of PKCd alters the tumor-igenicity of NSCLC cells in vivo, K-Ras–dependent H441 cellsexpressing scrambled shRNA, d193, or d203 were injected incontralateral flanks of nude mice and tumor size was mea-sured beginning at day 9 postinjection. Tumors from H441cells expressing the d193 construct were smaller than thoseexpressing the scrambled control at all time points (40%–80%), but this difference was not significant until day 19.Tumors derived fromH441 cells expressing the d203 constructalso showed reduced growth compared with the scrambled

Figure 5. Depletion of PKCdsuppresses invasion, migration,and tumor growth in nude mice.Migration and invasion of control(scr), d193-, or d203-expressingH2009 (A) and A549 (B) cells wasassayed as described in Materialsand Methods. Five fields werecounted for each filter, and eachexperimental condition wasassayed on triplicate filters. Eachexperiment was repeated 3 ormore times. C, top, nude micewere injected with control H441cells (diamonds; n ¼ 10) in the leftflank or H441 cells expressingeither d193 (triangles; n ¼ 5) ord203 (squares; n ¼ 5) in the rightflank. Tumors were measuredstarting on day 9. Graphs showaverage of measurements� SEM.*, significantly different from d203(P < 0.05); þ, significantly differentfrom d193 (P < 0.05). C, bottom,tumor lysates wereimmunoblotted for pERK andstripped and reprobed for totalERK or immunoblotted for PKCdand stripped and reprobed foractin. Representative images areshown. D, model for PKCdregulation of apoptosis andsurvival pathways in K-Ras–dependent NSCLC. Ras can alsoactivate proliferation via the PI3K/AKT pathway, although ourstudies indicate this is notdependent on PKCd. See the textfor more details. RTK, receptortyrosine kinase; PI3K,phosphoinositide 3-kinase.

Symonds et al.





shRNA control (40%–60%); however, in this case, the differ-ence was only significant until day 17 (Fig. 5C, top). To verifythat PKCd depletion is sustained in the tumors, tumor lysateswere prepared when mice were sacrificed at day 27 andprobed for PKCd expression (Fig. 5C, bottom). Analysis ofpERK in these tumor lysates indicated that the reduction inERK activation observed in vitro was also maintained duringtumor growth in vivo (Fig. 5C, bottom), suggesting thatreduced tumor growth is coupled to reduced proliferativesignaling via this pathway.

Discussion

The development of new therapeutics to target the K-Raspathway depends on the identification of specific mediators ofK-Ras–dependent tumorigenesis. Although a number oflaboratories have defined oncogenic K-ras gene signatures(34–36), the molecular effectors of K-Ras that drive transfor-mation and proliferation in NSCLC are still largely unknown.Our studies suggest that PKCd functions as a tumor promoterin the context of oncogenic K-ras, as it is required forurethane-induced lung tumorigenesis and for transformedgrowth of a subset of NSCLC cell lines that are dependenton activated K-Ras for survival. Conversely, PKCd may sup-press tumorigenesis through other oncogenic pathways, asurethane-induced tumors with WT KRAS arise in the absenceof PKCd and transformed growth of K-Ras–independentNSCLC cells is enhanced when PKCd is depleted.Our studies suggest that in the urethane-induced tumor

model, PKCd is required for the progression of K-Ras–drivenlung tumors and hence functions as a tumor promoter. Like-wise, depletion of PKCd suppresses growth of K-Ras–depen-dent NSCLC cells in soft agar and inhibits migration andinvasion, confirming that this kinase is functionally importantfor the malignant phenotype. On the basis of our observationthat urethane-induced tumors are decreased dramatically indKOmice, togetherwith the finding that 31%of the tumors thatarise do not haveKRASmutations, the probability of oncogenicK-ras driving tumorigenesis in dKO mice seems to be reducednearly 5-fold. This is consistent with a recent study by Mauroand colleagues, which shows that overexpression of PKCd canpromote tumorigenesis in amousemodel of human pancreaticcancer, the majority of which harbor oncogenic KRAS (37).Studies from Xia and colleagues likewise show that PKCd isrequired for survival signaling of 3T3 cells expressing activatedK-Ras, albeit in these cells PKCd seems to regulate AKTsignaling downstream of activated K-Ras, whereas our studiessuggest that PKCd regulation of MEK/ERK may be morecritical for NSCLC cells (32, 38). Of note, Fields and colleagueshave shown that atypical PKCi is an oncogene in humanNSCLC cells. Interestingly, amplification of PKCi seems tooccur primarily in squamous cell carcinomas, a subtype ofNCSLC that do not typically have activated K-Ras (39).A particularly novel outcome of our studies is the finding

that 31% of the urethane tumors in dKO mice do not haveactivating mutations in KRAS. We propose that in this group oftumors PKCd functions as a tumor suppressor. Similarly, ourstudies suggest that in K-Ras–independent NSCLC cell lines,

loss of PKCd enhances transformed growth and proliferativesignaling, again suggesting a role as a tumor suppressor. Takentogether, this suggests that alternative proliferative pathwaysthat are normally suppressed by PKCd may sustain growth inK-Ras–independent NSCLC cell lines and in the subset ofurethane tumors that do not have mutated KRAS. In thisregard, preliminary data from our laboratory indicates thatabout 10% of this later group of tumors have mutations incodon 20 of PIK3CA (data not shown). Future studies areneeded to characterize these mutations and to understandwhy they are seen only in the context of the dKO mouse.Activating mutations in components of the PTEN/Aktpathway have recently been reported in a small subset ofhuman lung cancers (40). Curiously, in some cells these muta-tions occur in conjunctionwithmutation ofKRAS, suggesting amechanism by which K-Ras–dependent cancer cells maybecome K-Ras independent for proliferation and survival.Singh and colleagues report that in pancreatic cancer cell lineswith oncogenic KRAS, K-Ras independence correlates withincreased activation of Akt; however, this correlation doesnot hold true for the subset of NSCLC cell lines examined inthis study (36). Instead, in the K-Ras–independent NSCLC celllines, depletion of PKCd increases the activation of MEK/ERK.Several mechanisms, including regulation of the ERK phos-phataseMKP3 or interaction of PKCd with the adaptor proteinSprouty 2 (41, 42), have been suggested for PKCd regulation forMEK/ERK.

In addition to its well-established role in apoptosis, ourcurrent studies support a role for PKCd in cell survival andtransformation and begin to define the molecular context forthese seemingly disparate functions of PKCd. An importantquestion is what "switches" PKCd from its proapoptotic role toits prosurvival/transformation role. We propose that in K-Ras–dependent cells, PKCd function to integrate cell prolif-eration and survival signals through regulation of MEK/ERKsignaling (Fig. 5D). In other cells, particularly in nontrans-formed cells, and in K-Ras–independent NSCLC cells, PKCdmay functions primarily to regulate apoptosis and suppressproliferation. The plasticity of PKCd signaling in lung cancercells illustrates the need to understand the genetic context ofspecific cancer subtypes so as to more accurately targettherapies.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed. The contents are theauthors' sole responsibility and do not necessarily represent official NIH views.

Grant Support

This publication was supported by NIH/NCRR Colorado CTSI grant numberTL1 RR025778 (J.M. Symonds), the Colorado SPORE in Lung Cancer, NIH NCIp50-CA58187 (W.A. Franklin and M.E. Reyland), and the Colorado CancerLeague (M.E. Reyland).

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received May 2, 2010; revised December 23, 2010; accepted January 17, 2011;published OnlineFirst February 18, 2011.






References1. Schiller JH. Current standards of care in small-cell and non-small-cell

lung cancer. Oncology 2001;61Suppl 1:3–13.2. Beau-Faller M, Legrain M, Voegeli AC, Guerin E, Lavaux T, Ruppert

AM, et al. Detection of K-Ras mutations in tumour samples of patientswith non-small cell lung cancer using PNA-mediated PCR clamping.Br J Cancer 2009;100:985–92.

3. Reyland ME. Protein kinase C isoforms: multi-functional regulators ofcell life and death. Front Biosci 2009;14:2386–99.

4. DeVries TA, Kalkofen RL, Matassa AA, Reyland ME. Protein kinaseCdelta regulates apoptosis via activation of STAT1. J Biol Chem2004;279:45603–12.

5. Humphries MJ, Limesand KH, Schneider JC, Nakayama KI, Ander-son SM, Reyland ME. Suppression of apoptosis in the proteinkinase Cdelta null mouse in vivo. J Biol Chem 2006;281:9728–37.

6. Kharait S, Dhir R, Lauffenburger D, Wells A. Protein kinase Cdeltasignaling downstream of the EGF receptor mediates migration andinvasiveness of prostate cancer cells. BiochemBiophys Res Commun2006;343:848–56.

7. Leitges M,Mayr M, Braun U, Mayr U, Li C, Pfister G, et al. Exacerbatedvein graft arteriosclerosis in protein kinase Cdelta-null mice. J ClinInvest 2001;108:1505–12.

8. Majumder PK, Mishra NC, Sun X, Bharti A, Kharbanda S, Saxena S,et al. Targeting of protein kinase C delta to mitochondria in theoxidative stress response. Cell Growth Differ 2001;12:465–70.

9. Majumder PK, Pandey P, Sun X, Cheng K, Datta R, Saxena S, et al.Mitochondrial translocation of protein kinase C delta in phorbol ester-induced cytochrome c release and apoptosis. J Biol Chem2000;275:21793–6.

10. Matassa AA, Carpenter L, Biden TJ, Humphries MJ, Reyland ME.PKCdelta is required for mitochondrial-dependent apoptosis in sali-vary epithelial cells. J Biol Chem 2001;276:29719–28.

11. Allen-Petersen BL, Miller M, Neville M, Anderson S, Nakayama K,Reyland ME. Loss of protein kinase C delta alters mammary glanddevelopment and apoptosis. Cell Death Dis 2010;1:e17.

12. Ryer EJ, Sakakibara K, Wang C, Sarkar D, Fisher PB, Faries PL, et al.Protein kinase C delta induces apoptosis of vascular smooth musclecells through induction of the tumor suppressor p53 by both p38-dependent and p38-independent mechanisms. J Biol Chem2005;280:35310–7.

13. Yamaguchi T, Miki Y, Yoshida K. Protein kinase C delta activatesIkappaB-kinase alpha to induce the p53 tumor suppressor inresponse to oxidative stress. Cell Signal 2007;19:2088–97.

14. Liu H, Lu ZG, Miki Y, Yoshida K. Protein kinase C delta inducestranscription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. MolCell Biol 2007;27:8480–91.

15. Johnson CL, Lu D, Huang J, Basu A. Regulation of p53 stabilization byDNA damage and protein kinase C. Mol Cancer Ther 2002;1:861–7.

16. Paugh BS, Paugh SW, Bryan L, Kapitonov D, Wilczynska KM, Gopa-lan SM, et al. EGF regulates plasminogen activator inhibitor-1 (PAI-1)by a pathway involving c-Src, PKCdelta, and sphingosine kinase 1 inglioblastoma cells. FASEB J 2008;22:455–65.

17. Zhao Y, He D, Saatian B, Watkins T, Spannhake EW, Pyne NJ, et al.Regulation of lysophosphatidic acid-induced epidermal growth factorreceptor transactivation and interleukin-8 secretion in human bron-chial epithelial cells by protein kinase C delta, Lyn kinase, and matrixmetalloproteinases. J Biol Chem 2006;281:19501–11.

18. Iwabu A, Smith K, Allen FD, Lauffenburger DA, Wells A. Epidermalgrowth factor induces fibroblast contractility and motility via aprotein kinase C delta-dependent pathway. J Biol Chem2004;279:14551–60.

19. Riobo NA, Haines GM, Emerson CP Jr. Protein kinase C-delta andmitogen-activated protein/extracellular signal-regulated kinase-1control GLI activation in hedgehog signaling. Cancer Res2006;66:839–45.

20. Santiago-Walker AE, Fikaris AJ, Kao GD, Brown EJ, Kazanietz MG,Meinkoth JL. Protein kinase C delta stimulates apoptosis by initiating

G1 phase cell cycle progression and S phase arrest. J Biol Chem2005;280:32107–14.

21. Jackson DN, Foster DA. The enigmatic protein kinase C delta:complex roles in cell proliferation and survival. FASEB J 2004;18:627–36.

22. D’Costa AM, Robinson JK, Maududi T, Chaturvedi V, Nickoloff BJ,Denning MF. The proapoptotic tumor suppressor protein kinase C-delta is lost in human squamous cell carcinomas. Oncogene2006;25:378–86.

23. Langzam L, Koren R, Gal R, Kugel V, Paz A, Farkas A, et al. Patterns ofprotein kinase C isoenzyme expression in transitional cell carcinomaof bladder. Relation to degree of malignancy. Am J Clin Pathol2001;116:377–85.

24. Reno EM, Haughian JM, Dimitrova IK, Jackson TA, Shroyer KR,Bradford AP. Analysis of protein kinase C delta (PKC delta) expressionin endometrial tumors. Hum Pathol 2008;39:21–9.

25. Evans JD, Cornford PA, Dodson A, Neoptolemos JP, Foster CS.Expression patterns of protein kinase C isoenzymes are character-istically modulated in chronic pancreatitis and pancreatic cancer. AmJ Clin Pathol 2003;119:392–402.

26. Balasubramanian N, Advani SH, Zingde SM. Protein kinase C iso-forms in normal and leukemic neutrophils: altered levels in leukemicneutrophils and changes during myeloid maturation in chronic mye-loid leukemia. Leukoc Res 2002;26:67–81.

27. Tsai JH, Hsieh YS, Kuo SJ, Chen ST, Yu SY, Huang CY, et al.Alteration in the expression of protein kinase C isoforms in humanhepatocellular carcinoma. Cancer Lett 2000;161:171–5.

28. Miyamoto A, Nakayama K, Imaki H, Hirose S, Jiang Y, Abe M, et al.Increased proliferation of B cells and auto-immunity in mice lackingprotein kinase C delta. Nature 2002;416:865–9.

29. Marek L, Ware KE, Fritzsche A, Hercule P, Helton WR, Smith JE, et al.Fibroblast growth factor (FGF) and FGF receptor-mediated autocrinesignaling in non-small-cell lung cancer cells. Mol Pharmacol2009;75:196–207.

30. Singh A, Greninger P, Rhodes D, Koopman L, Violette S, Bardeesy N,et al. A gene expression signature associated with "K-Ras addiction"reveals regulators of EMT and tumor cell survival. Cancer Cell2009;15:489–500.

31. Mori S, Chang JT, Andrechek ER, Matsumura N, Baba T, Yao G, et al.Anchorage-independent cell growth signature identifies tumors withmetastatic potential. Oncogene 2009;28:2796–805.

32. Xia S, Chen Z, Forman LW, Faller DV. PKCdelta survival signaling incells containing an activated p21Ras protein requires PDK1. CellSignal 2009;21:502–8.

33. Lin CW, Hou WC, Shen SC, Juan SH, Ko CH, Wang LM, et al.Quercetin inhibition of tumor invasion via suppressing PKC delta/ERK/AP-1-dependent matrix metalloproteinase-9 activation inbreast carcinoma cells. Carcinogenesis 2008;29:1807–15.

34. Luo J, Emanuele MJ, Li D, Creighton CJ, Schlabach MR, West-brook TF, et al. A genome-wide RNAi screen identifies multiplesynthetic lethal interactions with the Ras oncogene. Cell 2009;137:835–48.

35. Sweet-Cordero A, Mukherjee S, Subramanian A, You H, Roix JJ,Ladd-Acosta C, et al. An oncogenic KRAS2 expression signatureidentified by cross-species gene-expression analysis. Nat Genet2005;37:48–55.

36. Singh A, Settleman J. Oncogenic K-ras "addiction" and syntheticlethality. Cell Cycle 2009;8:2676–7.

37. Mauro LV, Grossoni VC, Urtreger AJ, Yang C, Colombo LL,Morandi A,et al. PKC Delta (PKCdelta) promotes tumoral progression of humanductal pancreatic cancer. Pancreas 2010;39:e31–41.

38. Xia S, Forman LW, Faller DV. Protein kinase C delta is required forsurvival of cells expressing activated p21RAS. J Biol Chem2007;282:13199–210.

39. Regala RP,Weems C, Jamieson L, Khoor A, Edell ES, Lohse CM, et al.Atypical protein kinase C iota is an oncogene in human non-small celllung cancer. Cancer Res 2005;65:8905–11.

Symonds et al.





40. Yamamoto H, Shigematsu H, Nomura M, Lockwood WW, Sato M,Okumura N, et al. PIK3CAmutations and copy number gains in humanlung cancers. Cancer Res 2008;68:6913–21.

41. Lonne GK, Masoumi KC, Lennartsson J, Larsson C. Protein kinaseCdelta supports survival of MDA-MB-231 breast cancer cells by

suppressing the ERK1/2 pathway. J Biol Chem 2009;284:33456–65.

42. Chow SY, Yu CY, Guy GR. Sprouty2 interacts with protein kinase Cdelta and disrupts phosphorylation of protein kinase D1. J Biol Chem2009;284:19623–36.






2011;71:2087-2097. Published OnlineFirst February 18, 2011.Cancer Res Jennifer M. Symonds, Angela M. Ohm, Cristan J. Carter, et al. Lung Tumors

Is a Downstream Effector of Oncogenic K-ras inδProtein Kinase C

Updated version

10.1158/0008-5472.CAN-10-1511doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2011/02/18/0008-5472.CAN-10-1511.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/71/6/2087.full#ref-list-1

This article cites 42 articles, 18 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/71/6/2087.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/71/6/2087To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-10-1511http://cancerres.aacrjournals.org/content/suppl/2011/02/18/0008-5472.CAN-10-1511.DC1http://cancerres.aacrjournals.org/content/71/6/2087.full#ref-list-1http://cancerres.aacrjournals.org/content/71/6/2087.full#related-urlshttp://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/71/6/2087http://cancerres.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

protein kinase c d is a downstream effector of oncogenic k ......molecular and cellular pathobiology...

Documents