protective effect of curcumin on tnbs-induced intestinal ... · curcumin reduced tnbs-induced...

Zhang et al. BMC Complementary and Alternative Medicine (2016) 16:299 DOI 10.1186/s12906-016-1273-z

RESEARCH ARTICLE Open Access

Protective effect of curcumin on TNBS-induced intestinal inflammation ismediated through the JAK/STAT pathway

Xingxing Zhang1†, Jian Wu2†, Bo Ye1, Qiong Wang3, Xiaodong Xie4 and Hong Shen1*

Abstract

Background: Curcumin displays a protective role in rat models of intestinal inflammation. However, the mechanismof how curcumin affects on intestinal inflammation is less known. The purpose of the current study is to explore thesignal pathway in which the curcumin protecting rat from intestinal inflammation.

Methods: The intestinal inflammation rat models were made by TNBS treatment. Curcumin was added to their diet5 days before the TNBS instillation. After that, body weight change, score of macroscopic assessment of disease activityand microscopic scoring were utilized to analyse the severity of the induced inflammation. In addition, thelevel of pro-inflammatory cytokines and anti-inflammatory were detected to determine the effect of curcuminon intestinal inflammation. The JAK/STAT pathway of pro-inflammation response was also evaluated. Finally,the impact of curcumin on apoptosis in intestinal inflammation was assessed by TUNEL staining.

Results: Rats pretreated with curcumin significantly reversed the decrease of body weight and increase ofcolon weight derived from TNBS-induced colitis. Histological improvement was observed in response to curcumin.In addition, curcumin attenuated TNBS-induced secretion of pro-inflammatory cytokines and M1/M2 ratio, whilestimulated the secretion of anti-inflammatory cytokines. The inhibition of pro-inflammation response was mediatedby SOCS-1, which could efficiently suppress JAK/STAT pathways. Furthermore, curcumin efficiently suppressed theTNBS-induced apoptosis, and reduced the accumulation of cytochrome C in cytosol.

Conclusion: The anti-inflammatory effect of curcumin is realized by enhancing SOCS-1 expression andinhibiting JAK/STAT pathways. Curcumin also plays an anti-apoptotic role in TNBS-induced intestinalinflammation. We propose that curcumin may have therapeutic implications for human intestinalinflammation.

Keywords: Curcumin, Intestinal inflammation, M1/M2, JAK/STAT pathways, Apoptosis

Abbreviations: COX, Cyclooxygenase; H&E, Hematoxylin And Eosin; IBD, Inflammatory Bowel Disease;IFNs, Interferons; iNOS, Inducible Nitric Oxide Synthase; JAK, Janus Kinase; MAPK, Mitogen-Activated ProteinKinase; MPNs, Myeloproliferative Neoplasms; qRT-PCR, Quantitative Real-Time Pcr; SOCS, Suppressor OfCytokine Signaling; STAT, Signal Transducers And Activators Of Transcription; TNBS, 2,4,6-TrinitrobenzeneSulfonic Acid; TNF-α, Tumor Necrosis Factor-Alpha

* Correspondence: [email protected]†Equal contributors1Department of gastroenterology, the affiliated hospital of Nanjing universityof Chinese medicine, Jiangsu province hospital of traditional Chinesemedicine, No 155 Hanzhong Road, Nanjing 210029, ChinaFull list of author information is available at the end of the article

© 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

http://crossmark.crossref.org/dialog/?doi=10.1186/s12906-016-1273-z&domain=pdfmailto:[email protected]://creativecommons.org/licenses/by/4.0/http://creativecommons.org/publicdomain/zero/1.0/

Zhang et al. BMC Complementary and Alternative Medicine (2016) 16:299 Page 2 of 11

BackgroundInflammatory bowel diseases (IBD), including ulcerativecolitis and Crohn’s disease, are caused by combined theeffect of associated genes with complicated environmen-tal factors [1]. From the point of biological processes,IBD susceptibility is derived from various physiologicalchanges, such as dysregulated immunoregulation, muco-sal barrier integrity and microbial recognition, clearanceand/or homeostasis [2]. No cure can be used for IBD atpresent, however, the inflammatory process involved inIBD can be attenuated through some therapies, so as toimprove the signs and symptoms in IBD and inducelong-term remission hopefully.Turmeric (also called Curcuma longa) is an Indian

spice and extracted from the rhizomes of the plant. Fora long history, turmeric has used as Ayurvedic medicineand a treatment for inflammatory conditions [3]. Themain ingredient in turmeric is curcumin, also calleddiferuloymethane. Previous studied have demonstratethat curcumin, as highly pleiotropic molecule can inter-act with an abundance of molecular targets involved ininflammation regulation [3].The mechanism of curcumin regulating the inflamma-

tory response is complex. Studies have shown that withcurcumin treatment, the activities of cyclooxygenase-2(COX-2), lipoxygenase, and inducible nitric oxide syn-thase (iNOS) enzymes decrease, the protein kinase(MAPK) signaling is inhibited and the levels of the in-flammatory cytokines, including tumor necrosis factor-alpha (TNF-α), interleukin (IL) −1, −2, −6, −8, and −12,monocyte chemoattractant protein (MCP), and migra-tion inhibitory protein are downregulated [3, 4]. It iswell known that global transcription factor NF-kB isresponse to various signaling pathways, especially theregulation of inflammation. Curcumin is thought todown-regulate COX-2 and iNOS expression mediatedby NF-kB, thus improving the inflammatory processand tumorigenesis [5, 6].Originally, Janus kinase (JAK)/signal transducers and

activators of transcription (STAT) signaling is identifiedas the signaling pathway for interferons (IFNs). After-wards, it is identified to make contributions to inflam-mation mediated by the immune responses of a dozen ofcytokines, the actions of various growth factors and hor-mones [7]. As suppressor of cytokine signaling, SOCS-1,is an important negative regulators of JAK/STAT signal-ing shown in myeloproliferative neoplasms (MPNs) andleukemia [8]. The induction of SOCS-1 leads to sharplydownregulate JAK2/STAT signaling and the mRNAlevels of target genes which are directly regulated byJAK2 [9, 10]. Previous work has demonstrated the in-hibitory action of curcumin on JAK-STAT signaling con-tributes to its anti-inflammatory activity, and curcumincan markedly inhibit the phosphorylation of STAT1 in

brain microglia [11]. Furthermore, curcumin can also in-crease the expression of SOCS-1 through inhibiting classI histone deacetylases in myeloproliferative neoplasms[12]. However, whether the effect of curcumin on anti-inflammatory activities in TNBS-induced intestinal in-flammation is mediated by STAT1 and SOCS-1 is lessknown.In this work, the results of our study demonstrated

that curcumin had anti-inflammatory and anti-oxidativeeffects in TNBS-induced intestinal inflammation ratmodels, which inhibited the inflammation in colon, andcaused an attenuated M1/M2 ratio. We also clarifiedthat curcumin was involved in intestinal inflammationthrough elevating the expression of SOCS-1 and sup-pressing the phosphorylation of STAT1. Furthermore,curcumin reduced TNBS-induced apoptosis was throughthe mitochondrial pathway and declined the accumula-tion of cytochrome C in cytosol.

MethodsAnimal studiesSprague Dawley male rats (180–200 g) were maintainedin accordance with the guidelines of the Committee forAnimal Research of Nanjing University of Chinese Medi-cine. This experiment was manipulated in line with theRegulations for the Administration of Affairs Concern-ing Experimental Animals. All animal experiments wereapproved by Animal Ethics Committee in Nanjing uni-versity of Chinese medicine. A total number of 78 ratswere used. For body weight and colon tissue weightmeasurement, three groups (control group, TNBS group,and curcumin + TNBS group) of 18 rats in total wereused. 60 rats were randomly allocated into ten groups.Group 1: TNBS group, samples collected 6 h after treat-ment; Group 2: TNBS group, samples collected 12 hafter treatment; Group 3: curcumin + TNBS group, sam-ples collected 6 h after treatment; Group 4: curcumin +TNBS group, samples collected 12 h after treatment;Group 5: control group to Group 1 ~ 4; Group 6: TNBSgroup, samples collected 1 day after treatment; Group 7:TNBS group, samples collected 2 day after treatment;Group 8: curcumin + TNBS group, samples collected1 day after treatment; Group 9: curcumin + TNBS group,samples collected 2 day after treatment; Group 10: con-trol group to Group 6 ~ 9.To estabilish the colitis rats model, 20 mg/ml 2, 4, 6-

trinitrobenzene sulfonic acid (TNBS) (Sigma-Aldrich, St.Louis, MO, USA) was dissolved in 50 % ethano. A rub-ber infusion tube was positioned 8 cm from the anus toinstill TNBS into the lumen of the colon. Keep the ratsvertically for at least 1 min to ensure the TNBS enter en-tire colon. As control, the normal group also were deliv-ered 50 % ethanol with an equal volume. One of the ratstreated with TNBS were selected and sacrificed after


4 days treatment to evaluate the colitis. Curcumin(purity, 95 %) was purchased from BDH Company inEngland. For curcumin treatment groups, a concentra-tion of 0.25 % curcumin was added to their diet at 5 daysbefore the TNBS instillation. After death of the animals,the inflamed mucosa were harvest to do macroscopicdamage scores, hematoxylin and eosin (H&E) staining,Western Blot, and qRT-PCR analysis [13, 14].

Parameters utilized to analyse the severity of the inducedinflammationBody weight change: the weight of each animal was mea-sured, starting on the day before TNBS treatment, andthe change in weight was calculated as a percentage, thebaseline (marked as 100 %) being taken as the weight onthe day of the TNBS challenge.The method of macroscopic damage scores was de-

scribed previously [15]. Briefly, 1: no damage; 2: focalhyperemia no ulcers; 3: ulceration without hyperemia orbowel wall thickening; 4: ulceration with inflammationat one site, but not more than two sites of ulcerationand inflammation and not more than two major sites ofulceration and inflammation, or one site of ulcerationextending >1 cm along length of colon; 5: if damage cov-ered >2 cm along length of colon.The standard of microscopic scoring followed previous

method [16]. Colons were isolated and fixed with 4 %formalin. After embedded in paraffin, 4 μm thicksections were obtained. Following the H&E staining,microscopic scoring was performed by two differentpathologists blinded to evaluate. This score grades theseverity of the lesion from 0 to 6 on the basis of theextent of inflammatory infiltrate (superficial mucosal todeeper lesions into the muscularis propria), extent ofulceration, and the presence or absence of necrosis.Neutrophils were numbered in more than eight high-power fields in six rats in groups.

ImmunohistochemistryBefore experiment, xylene was used to dewax paraffin-embedded colonic tissue every 5 min for twice. After-wards, the tissue was rehydrated in gradient concentrationof ethanol (100–70 %) every 5 min for three times. Andthen it was rehydrated in PBS for 30 min. The staining kit(Dako Real, Cat. K5001, Dako Cytomation) was usedaccording to manufacturer’s instructions.The primary antibodies were used as following: anti-

CD11c (ab52632, clone EP1347y, Abcam, Cambridge,UK), anti-CD163 (MAB1652, clone K20-T, Abnova,Taipei City, Taiwan). The biotinylated immunoglobulinswere used as secondary antibody and stained with 3,3’-diaminobenzidine (DAB) (Dako Cytomation) substratesolution. The hematoxylin (Dako Cytomation) was usedto counterstain the nucleus.

Myeloperoxidase activity assayA myeloperoxidase assay kit (HK210; Hycult biotechnol-ogy, Netherlands) was used to measure myeloperoxidaseactivity. Colon tissues were thoroughly washed with coldPBS to remove faeces and weighed in an Eppendorftube. The colon lysis buffer containing 200 mM NaCl,5 mM EDTA, 10 mM Tris, 10 % glycerol, 1 mM PMSF,1 μg/ml leupeptide, 28 μg/ml aprotinine, pH7.4 was pre-pared and kept cool on the ice before use. Every 10 mgof tissue added 200 μl colon lysis buffer, and homoge-nized in tissue homogenizer at 4 °C. The supernatantwas isolated by centrifuging and detected by using a mi-croplate reader (Biotek) in 450 nm.

Western blotThe homogenization buffer contained 20 mM MOPS,50 mM β-glycerophosphate, 5 mM EDTA, 1 mM DTT,1 mM sodium vanadate, 1 mM PMSF, and 50 mM NaF.Tissue was mixed in the homogenization buffer and son-icated on the ice. The protein concentration in thesupernatent isolated by centrifuging was determined bythe Bradford assay (Thermo). Proteins were separatedwith SDS-PAGE and then transferred to PVDF mem-branes on the ice (Bio-Rad). The membranes was incu-bated with appropriate primary antibody overnight at 4 °C. After three times washed, the appropriate secondaryantibody was added and incubated for 1 h at roomtemperature. After three times further washing, the en-hanced chemiluminescence detection buffer (Amer-sham) was dripped on the membrane. Signal wasdetected by Chemiluminescence Apparatus (Bio-Rad,CA). GAPDH was used as reference. All experimentswere repeated at least three times. The following anti-bodies were used: SOCS-1, STAT1 and p-STAT1 (CellSignaling Technology, Beverly, MA).

Isolation of RNA and qRT-PCRThe colon grinded with liquid nitrogen and RNA wasisolated with TRIzol (Life Technologies). The quality ofthe RNA was determined on a 1 % agarose gel for 2 h at60 V. Reverse transcription (RT) was operated with theSuper Script III First-Stand Synthesis System (Invitro-gen). To detect the mRNA level of the target genes,quantitative real-time PCR (qRT-PCR) was performedusing a SYBR Premix Ex TaqII (TaKaRa). The qRT-PCRprocedure was according to the manufacturer’s instruc-tions from TaKaRa and ran with ABI PRISM7500 FastReal-Time PCR System. The primers of iNOS, Fizz-1,STAT1, SOCS-1 and β-actin (control) were listed inTable 1.

ELISA for cytokinesSupernatants of biopsy cultures were used to ELISA de-tection after a transient centrifugation. The cytokines

Table 1 Rat primers for real-time PCR

Gene Forward Primer Reverse Primer

iNOS GATTTTTCACGACACCCT GGTCCTCTGGTCAAACTC

Fizz-1 CAACAGGATGAAGACTGCAACCT GGGACCATCAGCTAAAGAAG

STAT1 AGGTCCGTCAGCAGCTTAAA CGATCGGATAACAACTGCTT

SOCS-1 CCGTGGGTCGCGAGAAC AAGGAACTCAGGTAGTCACGGAGTA

β-actin TTCAACACCCCAGCCATGT CAGTGGTACGACCAGAGGCATA

Fig. 1 Curcumin protects colonic tissue from TNBS-induced damage.a The weight of rats were recorded daily after TNBS treatment. Thedata shown were representative. b The colons were weighed after5-day TNBS challenge. Pretreatment with curcumin significantlydecreases the weight of colons. c After curcumin pretreatment,the macroscopic damage was improved. *P < 0.05, **P < 0.01,***P < 0.001


including TNF-α, IFN-γ, TGF-β, IL-13 (R&D Systems,Abingdon, UK) and IL-10 (Immunotools, Friesoythe,Germany) were selected. Each sample was tested induplicate against the appropriate standard and opticaldensities measured by microplate reader (BioRad, HemelHempstead, UK).

Cytochrome C releasing assayTo detect mitochondria cytochrome C release, tissuewas homogenized, and supernatant cytosol fractionseparated by centrifugation. The detection method wasfollowing the manufacturer’s instructions (Abcam,AB65311).

TUNEL assayTUNEL staining was performed with an Apop Tag®Fluorescein in situ Apoptosis Detection kit (millipore)according to the manufacturer’s instructions. Briefly, thetissue cryosections were fixed with 1 % paraformalde-hyde for 10 min at room temperature. Afterwards, thesections were thoroughly rinsed with PBS. The terminaldeoxynucleotidyl transferase enzyme mixture was usedto treat sections at 37 °C for 1 h, and kept them in a hu-midified chamber without light. Next, the sections wereincubated with the anti-digoxigenin antibody conjugatedto fluorescein for 30 min without light. At last, sectionswere viewed with laser confocal microscopy.To identify the necrosis, the method was described

previously [17]. Briefly, a concentration of 0.1 μg/ml PIwere used to treat the 10 μm sections for 10 min. Thenuclei was counterstained with DAPI.

ResultsCurcumin improves macroscopic tissue damage in TNBS-induced IBDBody weight is an important marker for IBD in rats. Thebody weight of DNB (dinitrobenzene sulfonic acid) - in-duced IBD rats were lower than normal rats [13]. Thenormal rats had a normal diet and their body weightincreased during experiments. However, TNBS causedstagnated body weight of rats in contrast with the weightgain in control group (Fig. 1a). Moreover, TNBS treatmentgroup showed significant phenotypes of colitis in rats,

including bloody diarrhea, wasting conditions, and dull re-action. We further measured the weight of colon tissueafter 5-day TNBS challenge which located 5 cm proximalto the rectum. The weight of colon tissue gained withTNBS treatment (Fig. 1b). However, rats pretreated withcurcumin significantly improved the decrease of bodyweight and gain of colon weight associated with TNBS-induced colitis (Fig. 1a and b). The increase weight ofcolon was a consequence of apparent mucosal thickening[18], therefore, curcumin can efficiently decrease thethickening derived from inflammation.

Fig. 2 Histological improvement in response to curcumin in TNBS-induced IBD. a After TNBS treatment at indicated time, colons wereisolated and harvested. With H&E staining, the histological changeswere observed. The damage including mucosal ulceration, thickenedwall, and inflammatory cells infiltration occurred in the TNBS-treatedgroup, however, the damage was reduced with curcumin pretreatment.b Histological damage score were evaluated with time course.There were 20 rats were evaluated for each score. *P < 0.05,**P < 0.01, ***P < 0.001


Next, macroscopic score was performed to assess thedamage degree. As indicated in Fig. 1c, an increasedinflammation in response to TNBS-induced colitis for5 days. In contrast, attenuated inflammation with curcu-min pretreatment. Thus, from these data, it wouldappear that at experimental concentrations, curcumincan effectively attenuate the damage in TNBS-inducedcolitis.

Histological improvement in response to curcuminThe colons were isolated and sectioned. After fixing,sections were stained with H&E. The representative sec-tions were selected and shown in Fig. 2a, as expected,curcumin pretreatment could alleviate inflammatorycellular infiltrate, mucosal ulceration, as well as wallthickening which were usually observed in TNBS-induced colitis. In addition, the effect of curcumin onhistological damage was shown in Fig. 2b, and clearlyrevealed that colonic inflammation was dramaticallyreduced with curcumin treatment, but remained severelyinflamed in TNBS-induced colitis 2 days postinductionof colitis. After 4 and 8 days induction of colitis, incurcumin + TNBS group, there appeared to be a trendtoward totally improvement as control group. Therefore,histological analysis indicates that curcumin plays acritical role in improving histological phenotype inTNBS- induced colitis.

Reduced pro-inflammatory markers/cytokines and in-creased anti-inflammatory cytokines with curcuminpretreatmentAs we known, myeloperoxidase activity is an establishedmarker for inflammatory cell (mainly neutrophils) infil-tration and activity in murine models of colitis. TNBSgroup showed severe neutrophils infiltration at 4 dayspostinduction of colitis. In contrast, an obviously re-duced colonic myeloperoxidase activity with curcuminpretreatment (Fig. 3a), indicating that curcumin inhibitsinflammatory response.Besides, we detected the level of cytokines in periph-

eral blood which are involved in pro-inflammatory andanti-inflammatory function, including TNF-α, IFN-γ, IL-10, IL-13, TGF-β. TNBS could induce the increase ofpro-inflammatory factors TNF-α, IFN-γ, however, therewas a significant reduction of TNF-α, IFN-γ in curcu-min + TNBS group (Fig. 3b) in a time- dependent man-ner. It suggests that curcumin has an inhibition effect oninflammation. For the anti-inflammatory cytokines,including IL-10, IL-13, TGF-β, a slight increase wasobserved in TNBS-induced colitis, which was consistentwith previous work [19]. However, in curcumin + TNBSgroup, the levels of IL-10, IL-13, TGF-β in peripheralblood were significantly elevated (Fig. 3c), implyingcurcumin is benefit for anti-inflammatory activity.

Therefore, these results further confirm the curcuminappears anti-inflammatory effect in TNBS-induced IBD.

Curcumin declined M1/M2 macrophage ratio in colonM1, termed as classically activated macrophages, havebeen associated with inflammatory products such as

Fig. 3 curcumin pretreatment reduced the levels of pro-inflammatory markers/ cytokines but increased the levels of anti-inflammatory cytokines.a Curcumin pretreatment inhibited the TNBS-induced increase of MPO activity. b The levels of pro-inflammatory cytokines TNF-α and IFN-γ wereassessed by ELISA. Curcumin pretreatment inhibited the levels of TNF-α and IFN-γ. c The levels of anti-inflammatory cytokines IL-13, TGF-β andIL-10 were assessed by ELISA. Curcumin pretreatment elevated the levels of IL-13, TGF-β and IL-10. *P < 0.05, **P < 0.01, ***P < 0.001


TNF-α and inducible nitric oxide synthase (iNOS) [20].By contrast, alternative activated macrophages (M2) in-hibit the production of pro-inflammatory cytokines andmake contributions to wound healing and tissue repair,which were associated with high arginase 1 (Arg1), Fizz-1 expression [21]. Colon from TNBS group had anextremely high level of iNOS, but with curcumin pre-treatment, the increased level was inhibited. In contrast,the level of Fizz-1 in colon in TNBS + curcumin groupwas higher than in TNBS group (Fig. 4a). Analysis of theratio of iNOS/Fizz-1 mRNA levels can be as an indicatorof the M1/M2 activity balance [22]. As shown in Fig. 4b,curcumin pretreatment skewed this ratio toward Fizz-1expression, but in TNBS group, cells tended to expressmore iNOS. Since iNOS and Fizz-1 are the well knownmarkers of M1 and M2, these results suggest curcuminpromotes the M2 macrophage polarization.Similarly, the levels of CD11c and CD163 as an index

of M1 and M2 surface marker [23] were also observedby immunostaining, in consistent with the level of iNOSand Fizz-1, there were decreased infiltration of CD11c(M1 macrophage marker) - positive cells, but the similarinfiltration of CD163 (M2 macrophage marker) - posi-tive cells were shown in colon in TNBS + curcumingroup (Fig. 4c), compared with TNBS group. Take to-gether, it suggests that curcumin declines M1/M2macrophage ratio in colon, trends toward M2 macro-phage polarization, and finally has anti-inflammationeffect in colitis.

The effect of curcumin on anti-inflammation mediated bySOCS-1The suppressor of cytokine signaling-1 (SOCS-1) is apotent negative regulator of various cytokines and it has

been implicated in the regulation of immune responses[24]. Previous work has demonstrated that SOCS-1 playsan important role in preventing murine colitis byrestricting the cytokine signals [25], however, whetherthe effect of curcumin on anti-inflammation in TNBS-induced IBD is mediated by SOCS-1 has not been clari-fied. To this end, we detected the mRNA and proteinlevel of SOCS-1 in colon. An efficiently stimulative effectof curcumin was observed on SOCS-1 in a time-dependent manner (Fig. 5a, b), suggesting SOCS-1 isinvolved in the improvement of curcumin on TNBS-induced IBD.SOCS-1 has been identified as a negative feedback

regulator of JAK-STAT signaling [26], while IFN-γinduces the phosphorylation of STAT1 so as to acti-vate the signal pathway. We have validated thatcurcumin can suppress the level of IFN-γ (Fig. 3b),as expected, phosphorylation of STAT1 was indeeddecreased with curcumin pretreatment in colon,especially after 12 h TNBS stimulation (Fig. 5c).Furthermore, the mRNA level of STAT1 and totalSTAT1 proteins were both declined with curcumintreatment in colon (Fig. 5c and d). Taken together,curcumin promote the SOCS-1 expression, the in-creased SOCS-1 and decreased IFN-γ coordinatelyimpaire the JAK-STAT signaling.

Curcumin reduces cell apoptosis in colonPrevious study has demonstrated that curcumin can in-duce a p53-dependent apoptosis in human carcinomacells [27]. To validate the positive or negtive effect ofcurcumin on apoptosis in TNBS-induced IBD, TUNELstaining was performed. When frozen sections of colonsfrom rat without TNBS-induced were stained by

Fig. 4 Curcumin pretreatment declined M1/M2 macrophage ratio in colon. a The mRNA levels of iNOS and Fizz-1 were detected by qRT-PCR.iNOS and Fizz-1 are the markers of M1 and M2. b Curcumin led to the ratio of iNOS/Fizz-1 declined. c Representative images of CD11c staining(left sections) and CD163 staining (right sections) in colonic tissue from each group. Curcumin pretreatment decreased the areas of CD11c andCD163 staining


TUNEL, nearly no signal were detected (Fig. 6a), indi-cating apoptotic cells was less in normal colon. How-ever, after TNBS treatment, large amounts ofTUNEL-positive cells were detected in the crypts andlamina propria of colons. In addition, granulocytes in-filtrated into lamina propria (Fig. 6a). Colons from ratpretreatment with curcumin contained abundantTUNEL-stained cells after 6 h induction, but at 12 hpostinduction less TUNEL-stained cells were ob-served, suggesting curcumin can reduce cell apoptosisin TNBS-induced IBD.In addition, induction of apoptosis by curcumin is

through cytochrome C release and activation of caspasesin human leukemia HL-60 cells [28]. To clarify thisprocess also occurs in TNBS-induced colitis, the amountof cytochrome C, a mitochondrial apoptogenic protein,in cytosol was detected. Rats treated with TNBS ap-peared to be cytosolic accumulation of cytochrome C,while the release of cytochrome C was declined in colonin curcumin-pretreated rat (Fig. 6b). These results indi-cate the antagonistic effect of curcumin on apoptosis inTNBS-induced colitis is through mitochondrial pathway.

DiscussionIn this study, we evaluated the effects of curcumin ina TNBS-induced rats model of IBD. The results illus-trated that curcumin could efficiently inhibit pro-inflammatory cytokines secretion and reduce M1/M2ratio. The anti-inflammatory effect of curcumin effect-ively inhibited the increase in iNOS level and theextent of infiltrating neutrophils. In addition, we vali-dated that the inhibition of inflammatory activity wasmediated by SOCS-1 as well as suppressing the phos-phorylation of STAT-1.The negative regulation of SOCS-1 on JAK2/STAT

phosphorylation was mediated a lot of cytokines [9].Previous study has demonstrated that curcumin caneffectively induce the expression of SOCS-1 throughinhibiting the activity of class I histone deacetylasesin myeloproliferative neoplasms [12]. We also clari-fied that curcumin can induce SOCS-1 in TNBS-induced intestinal inflammation. SOCS-1 can directlybinds JAK2 [10], and finally degrade JAK2 throughE3 ubiquition ligase ECS complex. We detected thedecreased phosphorylation of STAT-1 as expected in

Fig. 5 The effect of curcumin on anti-inflammation was mediated by SOCS-1. a The mRNA levels of SOCS-1 were detected by qRT-PCR. Curcuminpretreatment increased the transcription of SOCS-1. b The protein levels of SOCS-1 were detected by Western Blot at 6 and 12 h postinduction.Curcumin pretreatment increased the protein level of SOCS-1. c The total STAT1 proteins and p-STAT1 were detected by Western Blot. The levelof p-STAT1 was declined with curcumin treatment. d The mRNA levels of STAT1 were detected by qRT-PCR. Curcumin pretreatment suppressedthe transcription of STAT1


our model. Therefore, we propose that the repressiveeffect of curcumin on JAK/STAT signaling is medi-ated by SOCS-1 in TNBS-induced intestinal inflam-mation. However, other study has shown curcuminsuppresses JAK-STAT signaling via activation ofSHP-2 in brain microglial cells [11]. Based on thesestudies, the inhibition of curcumin on JAK-STAT sig-naling maybe complex and differently regulated indifferent cells. Frequent apoptosis is usually observedin colitis which is accompanied by loss of epithelialcells. In an experimental study of colitis in rats,compared with the control group, caspase-3 activityin colon was higher in TNBS treatment group [29].The relationship between curcumin and apoptosis iscontroversial. It is said that curcumin can inhibit theapoptosis in human and rat T lymphocytes [30],however, others have an opposite result happened inHL60 cell lines [31] and in vivo in colon tumors[32]. The controversy may due to the difference ofincubation periods, the curcumin concentrations,

and cell lines. In our experiment, with curcuminpretreatment, we observed a significant attenuatedapoptosis in colons, this available data indicate thatthe protective effects of curcumin against TNBS- in-duced colitis might be, at least in part, mediated byits anti-apoptotic effects. Moreover, we confirmedthat curcumin inhibits TNBS-mediated apoptosis inintestinal inflammation by mitochondrial cytochromec release.TNF-α is an important cytokine produced mainly by

activated monocytes and macrophages. It has beenshown that curcumin can attenuate TNF-α-induced oxi-dative stress, colitis in rats [33]. The administration ofTNF-α antibodies can effectively treat experimental ratcolitis [34, 35]. Our results also supported the idea thatcurcumin causes lower serum level of TNF-α, and thereduced colonic tissue oxidative stress. At last, we ob-served less apoptosis with curcumin treatment.Melatonin (5-methoxy-N-acetyltryptamine), a derivative

of the essential amino acid tryptophan, is also useful in

Fig. 6 Cell apoptosis reduced with curcumin pretreatment in TNBS-induced colitis. a Representative TUNEL stains in colon tissues obtained fromrats in each group. Curcumin pretreatment showed fewer areas of TUNEL stains compared with the only TNBS induction. b The level of cytochrome Cwas detected as described in MATERIALS AND METHODS. Cytochrome C declined in curcumin-pretreated rats



the treatment of IBD patients. This agent has been identi-fied to have anti-inflammatory and anti-apoptotic effectson IBD, which is the same as curcumin. Therefore, wemay propose that the substance which has anti-inflammatory and anti-apoptotic effect may be a potentialdrug to treat IBD.

ConclusionsCurcumin has an anti-inflammatory effect which isfulfilled by enhancing SOCS-1 expression and inhibitingJAK/STAT pathways. Curcumin also plays an anti-apoptotic role in TNBS-induced intestinal inflammation.Curcumin may supply potential therapeutic implicationsfor human intestinal inflammation.

AcknowledgmentsWe gratefully thank Dr. Xiang Gao at Montana State University for helpfuldiscussions and critical comments on the manuscript.

FundingThis work was supported by grants from the foundation of the PriorityAcademic Program Development of Jiangsu Higher Education Institutions(PAPD), the National Natural Science Foundation of China (No. 81473605,No. 81202580), and the Clinical Medicine Science and TechnologyProjects in Jiangsu Province (BL2014100). The funders had no rolein study design, data collection and analysis, decision to publish, orpreparation of the manuscript.

Availability of data and materialsAll the data supporting the findings is contained within the manuscript.

Authors’ contributionsAuthorship statement: Submission guarantor: HS. HS, XXZ and JW designedthe study; XXZ and JW analyzed the data and performed the calculations;XXZ and JW wrote the article in discussion with HS and XDX; BY and QWgave suggestions with each version of the article to improve the text andcontributed to the discussion of the data. All authors approved the finalversion of the manuscript.

Competing interestThe authors declare that they have no competing interests.

Consent for publicationNot applicable.

Ethics approval and consent to participateAnimal studies were approved by the Committee for Animal Research ofNanjing University of Chinese Medicine.

Author details1Department of gastroenterology, the affiliated hospital of Nanjing universityof Chinese medicine, Jiangsu province hospital of traditional Chinesemedicine, No 155 Hanzhong Road, Nanjing 210029, China. 2CentralLaboratory, the affiliated hospital of Nanjing university of Chinese medicine,Jiangsu province hospital of traditional Chinese medicine, No 155 HanzhongRoad, Nanjing 210029, China. 3Pharmacology laboratory, the affiliatedhospital of Nanjing university of Chinese medicine, Jiangsu province hospitalof traditional Chinese medicine, No 155 Hanzhong Road, Nanjing 210029,China. 4Department of surgery, the affiliated hospital of Nanjing university ofChinese medicine, Jiangsu province hospital of traditional Chinese medicine,No 155 Hanzhong Road, Nanjing 210029, China.

Received: 15 July 2016 Accepted: 9 August 2016

References1. Noble C, Nimmo E, Gaya D, Russell RK, Satsangi J. Novel susceptibility

genes in inflammatory bowel disease. World J Gastroenterol. 2006;12(13):1991–9.

2. Sartor RB. Mechanisms of disease: pathogenesis of Crohn’s disease andulcerative colitis. Nat Clin Pract Gastroenterol Hepatol. 2006;3(7):390–407.

3. Jurenka JS. Anti-inflammatory properties of curcumin, a major constituent ofCurcuma longa: a review of preclinical and clinical research. Altern Med Rev.2009;14(2):141–53.

4. Goel A, Kunnumakkara AB, Aggarwal BB. Curcumin as “Curecumin”: fromkitchen to clinic. Biochem Pharmacol. 2008;75(4):787–809.

5. Plummer SM, Holloway KA, Manson MM, Munks RJ, Kaptein A, Farrow S,Howells L. Inhibition of cyclo-oxygenase 2 expression in colon cells bythe chemopreventive agent curcumin involves inhibition of NF-kappaBactivation via the NIK/IKK signalling complex. Oncogene. 1999;18(44):6013–20.

6. Han SS, Keum YS, Seo HJ, Surh YJ. Curcumin suppresses activation ofNF-kappaB and AP-1 induced by phorbol ester in cultured humanpromyelocytic leukemia cells. J Biochem Mol Biol. 2002;35(3):337–42.

7. Dell’Albani P, Santangelo R, Torrisi L, Nicoletti VG, de Vellis J, Giuffrida Stella AM.JAK/STAT signaling pathway mediates cytokine-induced iNOS expression inprimary astroglial cell cultures. J Neurosci Res. 2001;65(5):417–24.

8. Greenhalgh CJ, Hilton DJ. Negative regulation of cytokine signaling.J Leukoc Biol. 2001;70(3):348–56.

9. Eyles JL, Metcalf D, Grusby MJ, Hilton DJ, Starr R. Negative regulation ofinterleukin-12 signaling by suppressor of cytokine signaling-1. J Biol Chem.2002;277(46):43735–40.

10. Ungureanu D, Saharinen P, Junttila I, Hilton DJ, Silvennoinen O. Regulationof Jak2 through the ubiquitin-proteasome pathway involvesphosphorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol CellBiol. 2002;22(10):3316–26.

11. Kim HY, Park EJ, Joe EH, Jou I. Curcumin suppresses Janus kinase-STATinflammatory signaling through activation of Src homology 2 domain-containing tyrosine phosphatase 2 in brain microglia. J Immunol. 2003;171(11):6072–9.

12. Chen CQ, Yu K, Yan QX, Xing CY, Chen Y, Yan Z, Shi YF, Zhao KW, Gao SM.Pure curcumin increases the expression of SOCS1 and SOCS3 inmyeloproliferative neoplasms through suppressing class I histonedeacetylases. Carcinogenesis. 2013;34(7):1442–9.

13. Salh B, Assi K, Templeman V, Parhar K, Owen D, Gomez-Munoz A, JacobsonK. Curcumin attenuates DNB-induced murine colitis. Am J PhysiolGastrointest Liver Physiol. 2003;285(1):G235–43.

14. Jacobson K, McHugh K, Collins SM. The mechanism of altered neuralfunction in a rat model of acute colitis. Gastroenterology. 1997;112(1):156–62.

15. Appleyard CB, Wallace JL. Reactivation of hapten-induced colitis and itsprevention by anti-inflammatory drugs. Am J Physiol. 1995;269(1 Pt 1):G119–25.

16. Ameho CK, Adjei AA, Harrison EK, Takeshita K, Morioka T, Arakaki Y, Ito E,Suzuki I, Kulkarni AD, Kawajiri A, et al. Prophylactic effect of dietaryglutamine supplementation on interleukin 8 and tumour necrosis factoralpha production in trinitrobenzene sulphonic acid induced colitis. Gut.1997;41(4):487–93.

17. Kelly KJ, Sandoval RM, Dunn KW, Molitoris BA, Dagher PC. A novel methodto determine specificity and sensitivity of the TUNEL reaction in thequantitation of apoptosis. Am J Physiol Cell Physiol. 2003;284(5):C1309–18.

18. Li H, Wu WK, Li ZJ, Chan KM, Wong CC, Ye CG, Yu L, Sung JJ, Cho CH,Wang M. 2,3′,4,4′,5’-Pentamethoxy-trans-stilbene, a resveratrol derivative,inhibits colitis-associated colorectal carcinogenesis in mice. Br J Pharmacol.2010;160(6):1352–61.

19. Jian YT, Wang JD, Mai GF, Zhang YL, Lai ZS. Modulation of intestinalmucosal inflammatory factors by curcumin in rats with colitis. Di Yi JunYi Da Xue Xue Bao. 2004;24(12):1353–8.

20. Mosser DM. The many faces of macrophage activation. J Leukoc Biol. 2003;73(2):209–12.

21. Menzies FM, Henriquez FL, Alexander J, Roberts CW. Sequential expressionof macrophage anti-microbial/inflammatory and wound healing markersfollowing innate, alternative and classical activation. Clin Exp Immunol.2010;160(3):369–79.

22. Zhang H, Han G, Liu H, Chen J, Ji X, Zhou F, Zhou Y, Xie C. Thedevelopment of classically and alternatively activated macrophages has


different effects on the varied stages of radiation-induced pulmonary injuryin mice. J Radiat Res. 2011;52(6):717–26.

23. Brown BN, Valentin JE, Stewart-Akers AM, McCabe GP, Badylak SF.Macrophage phenotype and remodeling outcomes in response to biologicscaffolds with and without a cellular component. Biomaterials. 2009;30(8):1482–91.

24. Song MM, Shuai K. The suppressor of cytokine signaling (SOCS) 1 andSOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral andantiproliferative activities. J Biol Chem. 1998;273(52):35056–62.

25. Chinen T, Kobayashi T, Ogata H, Takaesu G, Takaki H, Hashimoto M, YagitaH, Nawata H, Yoshimura A. Suppressor of cytokine signaling-1 regulatesinflammatory bowel disease in which both IFNgamma and IL-4 areinvolved. Gastroenterology. 2006;130(2):373–88.

26. Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A,Nishimoto N, Kajita T, Taga T, Yoshizaki K, et al. Structure and functionof a new STAT-induced STAT inhibitor. Nature. 1997;387(6636):924–9.

27. Jee SH, Shen SC, Tseng CR, Chiu HC, Kuo ML. Curcumin induces ap53-dependent apoptosis in human basal cell carcinoma cells. J InvestDermatol. 1998;111(4):656–61.

28. Pan MH, Chang WL, Lin-Shiau SY, Ho CT, Lin JK. Induction of apoptosis bygarcinol and curcumin through cytochrome c release and activation ofcaspases in human leukemia HL-60 cells. J Agric Food Chem. 2001;49(3):1464–74.

29. Wang H, Xu DX, Lv JW, Ning H, Wei W. Melatonin attenuateslipopolysaccharide (LPS)-induced apoptotic liver damage in D-galactosamine-sensitized mice. Toxicology. 2007;237(1–3):49–57.

30. Cipriani B, Borsellino G, Knowles H, Tramonti D, Cavaliere F, Bernardi G,Battistini L, Brosnan CF. Curcumin inhibits activation of Vgamma9Vdelta2T cells by phosphoantigens and induces apoptosis involving apoptosis-inducing factor and large scale DNA fragmentation. J Immunol. 2001;167(6):3454–62.

31. Kuo ML, Huang TS, Lin JK. Curcumin, an antioxidant and anti-tumorpromoter, induces apoptosis in human leukemia cells. Biochim BiophysActa. 1996;1317(2):95–100.

32. Samaha HS, Kelloff GJ, Steele V, Rao CV, Reddy BS. Modulation of apoptosisby sulindac, curcumin, phenylethyl-3-methylcaffeate, and 6-phenylhexylisothiocyanate: apoptotic index as a biomarker in colon cancerchemoprevention and promotion. Cancer Res. 1997;57(7):1301–5.

33. Mouzaoui S, Rahim I, Djerdjouri B. Aminoguanidine and curcuminattenuated tumor necrosis factor (TNF)-alpha-induced oxidative stress, colitisand hepatotoxicity in mice. Int Immunopharmacol. 2012;12(1):302–11.

34. Worledge KL, Godiska R, Barrett TA, Kink JA. Oral administration of aviantumor necrosis factor antibodies effectively treats experimental colitis inrats. Dig Dis Sci. 2000;45(12):2298–305.

35. Triantafillidis JK, Papalois AE, Parasi A, Anagnostakis E, Burnazos S, Gikas A,Merikas EG, Douzinas E, Karagianni M, Sotiriou H. Favorable response tosubcutaneous administration of infliximab in rats with experimental colitis.World J Gastroenterol. 2005;11(43):6843–7.

• We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal• We provide round the clock customer support • Convenient online submission• Thorough peer review• Inclusion in PubMed and all major indexing services • Maximum visibility for your research

Submit your manuscript atwww.biomedcentral.com/submit

Submit your next manuscript to BioMed Central and we will help you at every step:

AbstractBackgroundMethodsResultsConclusion

BackgroundMethodsAnimal studiesParameters utilized to analyse the severity of the induced inflammationImmunohistochemistryMyeloperoxidase activity assayWestern blotIsolation of RNA and qRT-PCRELISA for cytokinesCytochrome C releasing assayTUNEL assay

ResultsCurcumin improves macroscopic tissue damage in TNBS-induced IBDHistological improvement in response to curcuminReduced pro-inflammatory markers/cytokines and increased anti-inflammatory cytokines with curcumin pretreatmentCurcumin declined M1/M2 macrophage ratio in colonThe effect of curcumin on anti-inflammation mediated by SOCS-1Curcumin reduces cell apoptosis in colon

DiscussionConclusionsAcknowledgmentsFundingAvailability of data and materialsAuthors’ contributionsCompeting interestConsent for publicationEthics approval and consent to participateAuthor detailsReferences

protective effect of curcumin on tnbs-induced intestinal ... · curcumin reduced tnbs-induced...

Documents