prokaryotic diversity of a non-sulfide, low-salt cold spring sediment of shawan county, china

484 Journal of Basic Microbiology 2010, 50, 484–493

© 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.jbm-journal.com

Research Paper

Prokaryotic diversity of a non-sulfide, low-salt cold spring sediment of Shawan County, China

Jun Zeng1, 2, Hong-mei Yang1 and Kai Lou1

1 Institute of Microbiology, Xinjiang Academy of Agriculture Science, Urumqi, China 2 College of life science and technology of Xinjiang University, Urumqi, China

The prokaryotic diversity of a non-sulfide, low-salt cold spring sediment was investigated by constructing bacterial and archaeal clone libraries of the 16S rRNA gene. 241 bacterial clones were screened, which could be grouped into 86 ribotypes, based on restriction fragment length polymorphism (RFLP) analysis. These were divided into 11 phyla (Actinobacteria, Acidobacteria, Bacteroidetes, Chlorobi, Cyanobacteria, Firmicutes, Gemmatimonadetes, Nitrospirae, Proteo-bacteria, Planctomycetes and Verrucomicrobia). Of these, Acidobacteria and Proteobacteria were the most dominant, representing 48% and 25% of the total bacteria clone library, respectively. For the archaeal clone library, 121 positive clones were screened and 22 ribotypes were determined. BLAST analysis indicated that all ribotypes were affiliated with the phylum Crenarchaeota. Phylogenetic analysis classified them into three subgroups (Groups I–III). Groups I and III, belonging to the Soil–Freshwater-subsurface group and Marine group I, respectively, were the dominant groups, representing 50% and 47% of the library, respectively. Of them, 20% of ribotypes were related to the cold-loving Crenarchaeota. These findings show that bacteria in spring sediments are more diverse than are archaea; in addition, the spring harbors a large number of novel bacterial and archaeal species and maybe exist novel lineages.

Keywords: Prokaryotic diversity / Cold spring / Groundwater

Received: December 04, 2009; accepted: Aril 29, 2010

DOI 10.1002/jobm.200900411

Introduction*

Groundwater is an important global source of water and, in some locations, such as the arid and semi-arid areas of China, is the only source of water for daily or industrial use [1]. It not only covers deep subsurface habitats but also includes some surface aquatic envi-ronment, such as karstic systems and transition zones. Available studies revealed that groundwater microbes are well adapted to the habitat, despite of the systems characterized as oligotrophy and comparably low con-stant temperatures [2, 3]. However, most studies fo-cused on contaminated aquifer bioremediation and spatial distribution of bacteria in river bed sediments, microbial communities in surface aquatic environment,

Correspondence: Kai Lou, Institute of Microbiology, Xinjiang, Academy of Agriculture Science, No. 403, NanChang Road, Urumqi, Xinjiang, China E-mail: [email protected] Phone/Fax: 86-991-4521590

such as the transition zones, have been less commonly characterized [4]. The transition zone (ecotones) is an interfaces between surface running waters and the adjacent groundwater systems, which plays an essential role in biogeochemical cycling and the biodiversity of both ecosystems; and microorganisms inhabited in it were reported mostly distinct from aquifer microbial communities [5, 6]. Cold springs are representative for such ecotones, where water originating from deep aqui-fers or saturated subsurface rises to the surface, and some are considered as a continuum of ecosystems due to the hydrological connectivities with mountains [7, 8]. Therefore, they are a useful source for groundwater microbiological research [4]. To date, cold spring microbial studies have focused mainly on cold sulfur springs and have shown that sulfur compounds are a major energy source that sup-ports a diversity of phototrophic and sulfur-metaboliz-ing bacteria and archaea [9–12]. A string-of-pearls-like microbial community that was associated with novel

Journal of Basic Microbiology 2010, 50, 484–493 Prokaryotic diversity of a non-sulfide 485


archaea and sulfide-oxidizing bacteria was found in sulfur cold springs of Germany and Turkey [11]. Spring water and sediment from cold sulfur springs in the Canadian High Arctic were dominated by sulfur-meta-bolizing bacteria and archaea [13]. Similarly, phototro-phic sulfur-oxidizing bacteria and cyanobacteria were abundant in cold spring water from Ontario and Fuente Podrida [11, 15]. However, other than the study by Farnleitner and colleagues, which monitored seasonal changes in bacteria in alpine karst cold springs [16], little information about bacterial and archaeal diversity in non-sulfide cold springs, has been reported. The Shawan cold spring provides a non-sulfide cold spring environment and is one of many non-sulfide cold perennial springs that are typical in the arid and semi-arid areas of northwest China. The aim of the present study was to investigate the composition and diversity of bacteria and archaeal communities in this habitat, by using 16S rRNA clone libraries analysis.

Materials and methods

Site description Shawan cold spring (43°50′30 N, 085°22′35 E) is 1500 m above sea level, with a mean subsurface temperature of 6.5 °C all year round, despite air temperature dropping below –20 °C. In September 2008, 1 l of water and 50 ml of composite sediment (top 10 cm) were collected from the spring and transported to the laboratory within 4 h to minimize changes in the microbial population. Sediment samples were stored at –70 °C to await mo-lecular analysis.

Physicochemical analyses of spring water Physicochemical analyses of the spring water were carried out according to the Chinese national standard agriculture water salt component analysis (GB5084-85). The major cations, anions, total Kjeldahl nitrogen and carbon content of the spring water were determined at Soil and Fertilizer Research Institute (Xinjiang Academy of Agricultural Science, China).

DNA extraction, PCR and cloning Environmental DNA was extracted from the spring sediment using the method described by Zhou et al. [17]. Briefly, 10 g sediment was grinded with liquid nitrogen freezing then mixed vigorously for 30 min at 37 οC with 13.5 ml DNA extraction buffer (100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl, 1% (wt/vol) cetyltri-methylammonium bromide (CTAB)) and 10 μl of pro-

teinase K (100 mg/ml). Subsequently, 1.5 ml of 20% [wt/vol] SDS was added, and incubated at 65 °C for 2 h with gentle mixing every 20 min. After 2 h of incuba-tion samples were centrifuged at 6,000 g for 10 min at room temperature. The obtained sediment pellet was re-extracted with 4.5 ml of DNA extraction buffer and 0.5 ml of 20% [wt/vol] SDS, vortexed (10 sec), and incu-bated at 65 °C. After 10 min, the samples were centri-fuged as described above. The resulting supernatants were pooled and mixed with an equal volume of chlo-roform: isoamylalcohol (24:1, vol/vol). The aqueous phase was transferred to a new tube after centrifuga-tion at 6,000 g for 10 min. To the aqueous phase, 0.7 vol of isopropanol was added and the mixture was left at 4 °C for overnight, followed by centrifugation (14,000 g, 20 min). Then, the DNA pellet was washed with ice-cold 70% (vol/vol) ethanol and resuspended in double-distilled water. The DNA was further purified by electrophoresis in a 0.8% (wt./vol) low-melting-point agarose gel. DNA fragments of ~23 kb were excised and recovered from the agarose by using a gel purification kit (Biotec, China) with Lambda/HindIII as the molecu-lar weight DNA ladder. A combination of bacterial-specific primers 27F (5′GAGAGTTTGATCCTGGCTCAG 3′) [18] and 1492R (5′CGGCTACCTTGTTACGAC3′) and of the archaea-spe-cific primers 21F (5′YGGTTG ATCCTGCCRG3′) and 958R (5′YCCGGCGTTGAMTCCAATT3′) [19] was used to am-plify the 16S rRNA genes of bacteria and archaea, re-spectively. PCR amplification was carried out using the protocol described by Reysenbach et al. [20] and Nasreen et al. [19] for bacteria and archaea, respectively. PCR products were purified by electrophoresis in 1% (wt/vol) agarose gel, and bands of ~1500 bp (bacteria) and ~900 bp (archaea) were excised and recovered using a gel extraction kit (Biotec, China). Purified PCR products were ligated into a PMD18-T Vector and transformed into CaCl2-competent Escherichia coli DH 5α. Transfor-mants were selected on LB medium supplemented with ampicilin (100 mg l–1), X-Gal (80mg l–1) and IPTG (50 μM).

RFLP (restriction fragment length polymorphism) and sequencing All the clones were PCR amplified using sequencing primers M13–47 and M13–48, and the products were digested using the restriction enzymes Hae III (bacterial clones) and Hha I (archaeal clones) (TaKaRa, China) overnight at 37 °C and then electrophoresed on a 2.5% agarose gel at 100 V for 1 h. The sequences of the rep-resentative RFLP clones were sequenced by the Shang-hai Sangon Biological Engineering Technology Com-pany (Shanghai, China).

486 J. Zeng et al. Journal of Basic Microbiology 2010, 50, 484–493


Phylogenetic and cluster analyses The 16S rRNA gene sequences were submitted for com-parison to the GenBank databases using the BLAST algo-rithm [21]. Sequences with ≥97% (bacteria) and ≥98% (archaea) [14], similarity were assigned to the same phy-lotype. The occurrences of chimeric sequences were determined manually and with the CHECK_CHIMERA function from the Ribosomal Database Project-II release 8.1 (http://wdcm.nig.ac.jp/RDP/cgis/chimera). The remain-ing sequences were then aligned with their closest rela-tives using Clustal W. Phylogenetic trees (neighbor-joining algorithm with Kimura-2-parameter) were con-structed using MEGA 4.0 software [22]. The robustness of inferred topologies was tested by 1000 bootstrap resamplings of the neighbor-joining data [23]. In addi-tion, the phylogenetic classification was inferred by submitting the sequences to the RDP Classifier from the Ribosomal Database Project-II release 10.0 [24].

Diversity indices and statistical analysis The Shannon index (H′) and Simpson’s index (1/D) calcu-lations were performed using the freeware program EstimateS 8.0 [25]. The coverage was calculated using formula C = (1 – n/N) *100%, where n is the number of ribotypes appearing only once in a library and N is the library size [26]. Evenness (the relative abundance of each phylotype) was calculated using the formula E = eH′/N, where H′ is the Shannon index of diversity and N is the total number of ribotypes [27].

Nucleotide sequence accession numbers The 16S rRNA gene sequences of representative clones were deposited in the GenBank nucleotide sequence database using the following accession numbers: GQ302523–GQ302616.

Results

Physicochemical parameters of spring water The physicochemical parameters of the spring dis-charge waters are summarized in Table 1. Among the

analyzed anions and cations, SO42– and Na+ were most

abundant. Additionally, the spring water mineraliza-tion value is less than 3 and there was no detectable H2S and CH4. These results indicate that the water is of low salinity and aerobic [1].

Bacterial clone library The bacterial clone library comprised 241 positive clones that were grouped into 86 ribotypes based on RFLP analysis, and then further divided into 18 groups, including 11 phyla Acidobacteria (48% of total clones), Proteobacteria (25%), Cyanobacteria (6%), Nitrospirae (5%), Planctomycetes (3%), Actinobacteria (2%), Verru-comicrobia (2%), Firmicutes (1%), Bacteroidetes (<1%), Chlorobi (<1%), Gemmatimonadetes (<1%), and Candi-date division OD1(<1%)]. Four ribotypes (4%) could not be classified into known phylogenetic groups either by the RDP Classifier or by phylogenetic tree branching (Fig. 1; Table 2). Acidobacteria and Proteobacteria were the dominant groups, representing 73% of the total clone library.

Acidobacteria The most abundant group of clones was affiliated with the phylum Acidobacteria and comprised 31 ribotypes that were classified into eight lineages of uncultured species, including Gp3, Gp4, Gp5, Gp6, Gp7, Gp17, Gp22 and Unknown groups by RDP classifier (Fig. 1). Of these, Gp4, Gp6 and Gp7 were the dominant genera. Gp4, comprising seven ribotypes, was related to the abun-dant uncultured novel groups in the phylum and formed a large clade with the unknown genera in the phylogenetic tree. Gp6, comprising eight ribotypes, formed a clade with Gp3, Gp5 and Gp17, and the most similar sequences were derived from sediments from the Pearl River estuary (date from NCBI), with 96–99% similarity. Gp7 branched deeply within the phylum and consisted of six ribotypes; it was the least related to the other six lineages. Most ribotypes in Gp7 group were related to cold environment-derived clone sequences from polygonal tundra soils of Siberia [28].

Table 1. Physicochemical parameters of the waters from Shawan cold spring.

Sample concentration (g l–1)

Main anions Main cations

Temp. (°C) pH Total nitrogen (g l–1)

CO32– HCO3

– Cl– SO42– Ca2+ Na+ K+ Mg2+

5.5–7.5 5.0 4.490 0.0071 0.129 0.0226 0.2897 0.1148 1.663 ND ND

ND: not detected



Figure 1. Neighbor-joining phylogenetic tree based on bacterial 16S rRNA gene clone library from sediment from the Xinjiang Shawan cold spring. Numbers on the nodes are the bootstrap values (percentages) based on 1,000 replicates and values of above 50% were presented.



Table 2. The diversity indices and comparisons Shawan cold spring with Canadian sulfur springs.

Coverage Shannon index Simpson index Evenness Chao 1 Clone library Total no. of clones

No. of phylotypes

(%) (H′ ) (1/D ) (E )

Bacterial libraries

Shawan CP-1a GH-4a

241 174 155

86 30 46

93 91 84

3.74 2.16 3.17

62.02 4.25 14.82

0.49 0.33 0.52

90 50 71

Archaeal libraries

Shawan CP-1a GH-4a

124 164 156

22 29 18

96 92 96

2.78 2.77 2.12

14.28 12.18 5.94

0.73 0.61 0.47

21 68 23

a Data are from Nancy et al. [13].

Proteobacteria The second dominant group in the clone library was the phylum Proteobacteria, comprising 21 ribotypes with representatives from four subclasses, including Alpha, Beta, Gamma and Delta Proteobacteria. Alpha Proteobacteria was the most abundant subclass, repre-senting 32% of all Proteobacteria and 8% of the clone library, which comprised nine ribotypes. All the ribo-types were classified into the order Rhizobiales. Of these, four ribotypes showed high sequence similarity to pure cultures: (i) Clone sw-xj62 (GQ302526) was re-lated to strain Pedomicrobium manganicum (X97691), with 98% sequence identity; (ii) Clone sw-xj95 (GQ30252) was distantly related to strain Methylocystis sp. (DQ852351), with 92% sequence identity (data from NCBI); (iii) Clone sw-xj111 (GQ302531) had 86% sequence similarity with strain Azospirillum sp. (AY118222); and (iv) Clone sw-xj175 (GQ302532) was deeply clustered in the subclass and the top BLAST hit was related to Bradyrhizobium elkanii (AB110484), with 90% sequence similarity. Beta-Proteobacteria (7% of the clone library) comprised six ribotypes that were classified into either the family Rhodocyclaceae or Nitrosomonadaceae by the RDP clas-sifier with 95% confidence intervals. Clone sw-xj209 (GQ302537) showed 98% 16S rRNA gene similarity to cultivable strain Rubrivivax gelatinosus (AB250625); Clone sw-xj94 (GQ302535) affiliated to the family Rhodocy-claceae, forming a clade that was related to uncultured beta proteobacterium (AB252928). The other four ribo-types, which were tightly clustered with a 96.5% se-quence identity with each other, were affiliated into the family Nitrosomonadaceae. Gamma-Proteobacteria (4%) comprised three ribotypes and clustered into two clades: Clone sw-xj501 (GQ302553) and sw-xj119 (GQ302551) formed one clade that was related to puta-tive cultures of Pseudomonas moorei (FM955889) with 99% and 83% sequence identity, respectively; and Clone sw-xj121 (GQ302551) was clustered into the Beta-Pro-

teobacteria clade by phylogenetic tree branching with a 99% sequence identity with uncultured bacteria (DQ984618); however, this clone was also classified as Gamma-Proteobacteria, with a 95% of Confidence in-tervals (CIs) by RDP classifier. Delta-Proteobacteria (6%) comprised three ribotypes, all of which were related to uncultured species and were only distantly related to each other with <85% sequence identity; they were identified as belonging to the order Myxococcales.

Cyanobacteria The third most dominant group in the clone library was the phylum Cyanobacteria. It comprised six tightly clustered ribotypes, none of which were related to pure cultures. Clone sw-xj93 (GQ302542), sw-xj3 (GQ302541) and sw-xj229 (GQ302544) were tightly clustered into a clade and branched deeply within the phylum, all of them were related to uncultured cyanobacteria (FJ516952) with 97–98% gene identity. Clone sw-xj279 (GQ302545) was distantly related to the other four ribo-types and formed its own clade, with a 92% rRNA gene identity to uncultured cyanobacteria (FJ516953).

Nitrospirae Phylum Nitrospirae comprised three ribotypes that were all affiliated to genus Nitrospira. Clone sw-xj11 (GQ302556) and the sw-xj171 (GQ302557) showed 99% and 95% sequence identity to an uncultured ferroman-ganous micronodule bacterium (AF293010) in the sedi-ment of Green Bay and 96% and 92% sequence identity to putative cultured strain Nitrospira sp. (Y14644), re-spectively.

Planctomycetes Clones affiliated to the phylum were classified into the Gemmata spp., Pirellula spp. and Planctomyces spp. genera of family Planctomycetaceae with high bootstrap val-ues. However, none of them were related to cultured strains.



Other phyla and unaffiliated groups In the clone library, six phyla, including Actinobacteria, Verrucomicrobia, Firmicutes, Bacteroidetes, Chlorobi and Gemmatimonadetes, were also detected. Most were classified down to a class level but few had pure cul-tures. In addition, 4% of clones were grouped in clus-ters that were distinct from the established affiliations and most of these had lower BLAST hits in relation to the sequences deposited in GenBank.

Archaea clone library The 121 archaeal-positive clones represented 22 ribo-types that were all related to uncultured species of the

phylum Crenarchaeota. Phylogenetic analysis classified the 22 ribotypes into three subgroups, including Groups I–III. Of these, Group I and Group III, belonged to Soil-Freshwater-subsurface group and Marine group I, respectively, were the dominant groups, representing 50% and 47% of the library, respectively. Group II was classified into the class Thermoprotei by RDP classifier but with a confidence interval of 65% (Fig. 2). Group I: Group I, comprising 12 ribotypes, was clas-sified as a Soil-Freshwater-subsurface group. 11 ribo-types were tightly clustered with ~92–97% sequence similarity with each other. Clone sw-A398 (GQ302607) was related to an uncultured mesophilic ammonia-oxi-

Figure 2. Neighbor-joining phylogenetic tree based on partial archaeal 16S rRNA clones library from Xinjiang Shawan cold spring sediment samples. Uncultured Verrucomicrobia bacterium (FM253566) was used as outgroup. Numbers on the nodes are the bootstrap values (per-centages) based on 1,000 replicates and values of above 50% were presented.



oxidizing Crenarchaeota (AJ227941), with 99% sequen-ce similarity [29]. The clone sw-A342 (GQ302602) was branched from the 11 ribotypes and its closest relative was an uncultured archaeon with <85% sequence simi-larity. Group II: The clade of Group II has only one phylo-type, which represented 3% of the total archaeal clone library. The most similar relative was from a freshwa-ter environment, with 82% sequence similarity (date from NCBI, AF418935). Group III: Nine archaeal ribotypes were clustered into Group III, and were grouped into Marine group I by RDP classifier with a 95% confidence interval. Clone sw-A248 (GQ302597) has a 99% sequence identity with a Crenarchaeon clone (DQ19007) from Antarctic bathy-pelagic sediments [30]. Clone sw-A447 (GQ302614) was closely related to a cold-loving Crenarchaeon (AM055706) from streamlets of a cold sulfide spring in Germany, with a 99% of sequence identity [11].

Rarefaction analysis As can be see in Fig. 3, the archaeal rarefaction curve reaches clear saturation and its Coverage C value is 96%, indicating that most of the estimated archaeal diversity was sampled. By contrast, the bacterial curve did not reach clear saturation and the Coverage C was 93%, indicating that although further sampling of the clone library would have revealed additional diversity, the increase rate would have only been slight. In addi-tion, the high coverage values of the two groups sug-gest that most of the prokaryotic diversity of the sedi-ment was sampled.

Diversity indices The number of clones, ribotypes and biodiversity indi-ces of the bacterial and archaeal clone libraries was calculated and compared with results from Canadian sulfur spring (CP-1 and GH-4; summarized in Table 2). As can be seen, the Shawan bacterial diversity indices of Shannon index and Chao1 were higher than those for CP-1 and GH-4, indicated that the Shawan bacterial population was more diverse than that of the cold sul-fur springs. By contrast, Shawan has a higher Shannon index and Evenness values for archaeal diversity than did Cp-1, but fewer ribotypes and a lower Chao1 value. This suggests that the relative abundance of each phy-lotype is higher in Shawan, but that the total species richness of CP-1 was larger. The Shawan archaeal li-brary has the same percentage of coverage values as GH-4; however, different values for the Shannon index, Chao1 and Evenness estimate that the archaeal diver-sity of Shawan is lower than that of CP-1 and GH-4.

Figure 3. Rarefaction curves for Shawan cold spring sediment-derived bacteria and archaea clone library. (□) Bacteria (●) Archaea. Error bars indicate 95% confidence intervals.

Discussion

The present study provides the first overview of micro-bial diversity of the Shawan cold spring, a typical non-sulfide cold spring in the arid and semi-arid area of Xinjiang (China). The results support those from previ-ous groundwater microbial studies that showed that bacteria within the system are diverse in terms of their biomass and function [5, 31]. In this study, bacterial diversity in the Shawan cold spring was high and com-prised 18 groups of heterotrophs and autotrophs. The phylum Acidobacteria, which was the most dominant and diverse phylum is, by contrast, relatively infre-quent in the Canadian cold sulfidic springs, karst cold springs and groundwater ecosystems (Table 3). All the ribotypes grouped into eight clusters that are distinct from cultured species, indicating the presence of a large number of novel lineages in the phylum. In addi-tion, among the eight clustered clades, the Gp7 was different to others, which are tightly and deeply branched in the phylogenetic tree. Blast search results showed that sequences in the clade were all related to sequences derived from the polygonal tundra soil of Siberia, suggesting that the Gp7 group is well adapted to the low temperatures of the Shawan cold spring. Proteobacteria, which are ubiquitously and diversely distributed in groundwater ecosystems [4, 31], were the second most abundant group in the Shawan cold spring sediment, comprising four subclasses (Alpha, Beta, Gamma and Delta Proteobacteria). However, this result contradicts that from Canadian cold sulfur springs and other sulfide-rich spring [32], in which sulfur-meta-bolizing bacteria were dominant. For example, all alpha Proteobacteria (8% of total bacteria clones) were affili-



Table 3. The prokaryotic composition of Shawan cold spring and comparisons with other sulfur-containing or sulfur-absent cold springs.

Phylotypes in cold sulfidic spring sediment and Karst springs

Taxonomic group (phyla) Phylogenetic or taxonomic group No. of phylo-types

Sedimenta Karst spring waterb

Bacteria

Acidobacteria Gp3 Gp4 Gp5 Gp6 Gp7 Gp17 Gp22

3 7 1 8 6 1 1

+ – – – + – – –

+ – – – + – – –

Alpha Proteobacteria Rhizobiales (order) Pedomicrobium (genus) Rhodoplanes (genus)

4 1 4

+ – – –

+ + – –

Beta Proteobacteria Rhodocyclaceae Nitrosomonadaceae

2 4

+ – –

+ – +

Gamma Proteobacteria Pseudomonas (genus)

1

+ +

+ +

Delta Proteobacteria Myxococcales (order)

1

+ –

+ –

Cyanobacteria Bacillariophyta (genus)

5

+ +

– –

Nitrospira Nitrospira (genus)

3

+ +

+ +

Planctomycetes Pirellula (genus) Gemmata (genus) Planctomyces (genus)

1 1 1

+ – + –

– – – –

Actinobacteria Rubrobacteraceae (family) Actinobacteria (class)

1 1

+ + +

– – –

Verrucomicrobia Subdivision 3 Xiphinematobacteriaceae (family)

1 1

+ – +

– – –

Firmicutes Bacillus (genus)

1 + +

+ +

Bacteroidetes Terrimonas (genus)

1

+ –

+ –

Chlorobi Chlorobi 1 – – Gemmatimonadetes

Gemmatimonas (genus) WS3

1 1

+ + –

– – –

OD1 OD1 1 – – Archaea ND Crenarchaeota Thermoprotei (Class)

Marine group I Soil-Freshwater-subsurface group

1 12 9

+ + –

ND ND ND

a Data are from Nancy et al. [13]; bData are from Farnleitner et al. [12]; The phylogenetic affiliations were classified by RDP classifer with 95% confidence interval. ND: not determined.

ated to the order Rhizobiales, and four out of six ribo-types (4%) of beta Proteobacteria were classified into the family Nitrosomonadaceae. In addition, none of the ribotypes in the gamma and delta Proteobacteria sub-classes were related to sulfur oxidizers, in that all se-quences of delta Proteobacteria belonged to the order

Myxococcales, and two gamma Proteobacterial se-quences showed high sequence similarity to a putative cultured bacteria Pseudomonas moorei (FM955889). Sulfide is toxic to most oxygenic photosynthetic mi-croorganisms [34, 35], and many cyanobacteria do not tolerate it [15]. For example, Cyanobacteria accounted



for <1% of the total bacteria in Canadian cold sulfur springs. By contrast, the Shawan cold spring harbors a large number of photosynthetic bacteria (6% of total clones), suggesting that the phylum has an important role as the primary producers in the spring [13]. The archaeal populations of the Shawan cold water spring were not as diverse as the bacterial population or as the archaeal population in Canadian sulfur springs (Table 2). The physical characteristics of the Shawan spring, which include an aerobic environment, low salinity, no sulfur and a thin layer of sediment particles (Table 1), do not support the halophilic ar-chaea, methanogenic and sulfur metabolizers of the Euryarchaeota; therefore, only members of the phylum Crenarchaeota detected in the spring sediment. This differs from the findings in cold sulfur springs; for example, studies of Canadian and German cold springs have revealed a diversity of sulfur-metabolizing Euryar-chaeota and Crenarchaeota in both sediment and water samples [12, 13]. In addition, 40% of the Crenarchaeota samples found have a 93–99% 16S rRNA gene similar-ity to ammonia-oxidizing mesophilic Crenarchaeota which reported harbor some novel genes for nitrite reductase and Amo-related proteins [29]. Unfortunately, we cannot determine that functional groups only from the rRNA gene datas, however, it gives a clue to the search of novel nitrite oxidoreductase genes that oper-ate under low temperatures. Three ribotypes (almost 20% of the total number of clones) in the archaea group III were highly related to novel cold-loving Crenarchaeota first found in German cold sulfur springs [12]. In addition, when we compared the bacterial compositions of the Shawan spring with those from alpine and Canadian springs (Table 3), we found only two genera (GP6 of phylum Acidobacteria and Nitrospira of phylum Nitrospirae) were present in all three springs. Given similar archaeal ribotypes have been found in other non-sulfur-containing environ-ments [36] and the genera Nitrospira reported was a stable autochthonous community in alpine cold springs, regardless of any seasonal changes in the spring water [16]. We presume that those groups might well adjust themselves to cold springs or other types of cold water environments. In conclusion, the Shawan cold spring harbors a greater diversity of bacteria than do the cold sulfur springs of Canadian and karst cold springs in the Alps. A large number of novel acidobacterial lineages and potential cold spring indigenous species were detected in the spring sediment. This could lead to additional research into indigenous groundwater microbial popu-lations and the development of appropriate culturing

methodologies for the isolation of novel bacteria. In addition, the molecular information obtained from the study may contribute to the further research of func-tional groups of bacteria and archaea and discovery of novel low temperature enzymes.

Acknowledgements

This work was supported by the 973 Pre-research Program of Key Project of China National Programs for Fundamental Research and Development (2008CB417214), and the Open Project of the Key Lab of Microorganisms in Xinjiang Specific Environment (XJYS0203-2009-02); we also thank Tao Zhang, Jian Sun and Zhong-Hong Wu for assistance in sampling.

References

[1] Shi, X.Y., Zhang, Y.X., 1997. Ground water Hydrology. Waterpub press, Beijing.

[2] Danielopol, D.L., Pospisil, P., Rouch, R., 2000. Biodiversity in groundwater: a large scale view. Trends in Ecology and Evolution, 15, 223–224.

[3] Humbert, J.F., Dorigo, U., 2005. Biodiversity and aquatic ecosystem functioning: a mini review. Aquatic Ecosystem Health and Management., 8, 367–374.

[4] Griebler, C., Lueder, T., 2008. Microbial biodiversity in groundwater ecosystems. Freshwater Biology, 10, 136 5–2427.

[5] Gibert, J., Dole-Olivier, M.J., Marmonier, P., Vervier, P., 1990. Surface water – groundwater ecotones. In: The Ecol-ogy and Management of Aquatic-Terrestrial Ecotones (R.J. Naiman, H. De’camps, eds.), pp. 199–225. UNESCO Paris and Parthenon Publishing Group, Carforth.

[6] Wall, F.D., Blackburn, T.H., Brussaard, L., Hutchings P., Palmer, M.A., Snelgrove, P.V.R., 1997. Linking biodiversity and ecosystem functioning of soils and sediments. Am-bio., 26, 556–562.

[7] Gibert, J., Malard, F., Turquin, M.J., Laurent, R., 2000. Karst ecosystems in the Rhone River basin. In: Subterra-nean Ecosystems – Ecosystems of the World (H.Wilkens, D.C. Culver, W.F. Humphreys, eds.), pp. 533–558. Else-vier, Amsterdam.

[8] Danielopol, D.L., Griebler, C., Gunatilaka, A., Notenboom, J., 2003. Present state and future prospects for groundwa-ter ecosystems. Environmental Conservation, 30, 104–130.

[9] Phelps, T.J., Fliermans, C.B., Garland, T.R., 1989. Methods for recovery of deep terrestrial subsurface sediments for microbiological studies. J. Microbiol. Methods, 9, 267–279.

[10] Moissl, C., Rudolph, C., Huber, R., 2002. Natural commu-nities of novel archaea and bacteria with a string-of- pearls-like morphology. Appl. Environ. Microbiol., 68, 933–937.



[11] Christian, R., Christine, M., Ruth, H., Robert, H., 2004. Ecol-ogy and microbial structures of archaeal/bacterial strings-of-pearls communities and archaeal relatives thriving in cold sulfidic springs. FEMS Microbiol. Ecol., 50, 1–11.

[12] Marcus, K., Christian, R., Christine, M., Robert, H., 2006. A cold-loving crenarchaeon is a substantial part of a novel microbial community in cold sulphidic marsh water. FEMS Microbiol. Ecol., 57, 55–66.

[13] Nancy, N.P., Dale, T.A., Wayne, H.P., Charles, W.G., Lyle, G.W., 2007. Characterization of the prokaryotic diversity in cold Saline perennial springs of the canadian high Arc-tic. Appl. Environ. Microbiol., 5, 1532–1543.

[14] Mostafa, S., Elshahed, F.Z., Najar, B.A., Roe, ??., 2004. Survey of archaeal diversity reveals an abundance of ha-lophilic archaea in a low-salt, sulfide- and sulfur-rich spring. Appl. Environ. Microbiol., 70, 2230–2239.

[15] Antonio, C., Carlos, R., Juan, J.S., Eduardo,V., Martin, W.H., 2005. Spatial dominance and inorganic carbon as-similation by conspicuous autotrophic biofilms in a phy-sical and chemical gradient of a cold sulfurous spring: The role of differential ecological strategies. Microbial Ecology, 50,172–184.

[16] Farnleitner, A.H., Wilhartitz, Ines., Gabriela, R., Kirsch-ner, A. K. T. et al., 2005. Bacterial dynamics in spring wa-ter of alpine karst aquifers indicates the presence of stable autochthonous microbial endokarst communities. Environ Microbiol., 7, 1248–1259.

[17] Zhou, J. Bruns, M. Tiedje, J., 1996. DNA recovery from soils of diverse composition. Appl. Environ. Microbiol., 62, 316–322.

[18] Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study.J Bacteriol., 173, 697–703.

[19] Nasreen, B., Shomari, R., Briana, R., 2004. Phylogenetic composition of arctic ocean archaeal assemblages and comparison with Antarctic assemblages. Appl. Environ. Microbiol., 70, 781–789.

[20] Reysenbach, L., Giver, L., Wickham, G., 1992. Differential amplification of rRNA genes by polymerase chain reacti-on. Appl. Environ. Microbiol., 58, 3417–3418.

[21] Altschul, S., Gish, W.W., Miller, E., Myers, W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol., 215, 403–410.

[22] Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) soft-ware version 4.0. Molecular Biology and Evolution, 24, 1596–1599.

[23] Saitou, N., Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mo-lecular Biology and Evolution, 4, 406–425.

[24] Wang, Q., Garrity, G. M., Tiedje, J.M., Cole, J. R., 2007. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Envi-ron. Microbiol., 73, 5261–5267.

[25] Colwell, R., 2005. EstimateS: statistical estimation of spe-cies richness and shared species from samples. Version 8.0. User’s guide and application. http://viceroy.eeb. uconn.edu/EstimateS.

[26] Good, I., 1953. The population frequencies of species and the estimation of population of parameters. Biometrika, 40, 237–264.

[27] Krebs, C., 1989. Ecological Methodology. Harper and Row, New York, NY.

[28] Liebner, S., Harder, J., Wagner, D., 2008. Bacterial diver-sity and community structure in polygonal tundra soils from Samoylov Island, Lena Delta, and Siberia. J. Micro-biol., 11, 195–202.

[29] Treusch, H., Leininger, S., Kletzin, A., 2005. Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling. Appl. Environ. Microbiol., 12, 1985–1995.

[30] Gillan, D.C., Danis,B., 2007. The archaebacterial commu-nities in Antarctic bathypelagic sediments. Deep Sea Res. Part II Top. Oceanogr., 54, 1682–1690.

[31] Madsen, E.L., Ghiorse, W.C., 1993. Groundwater microbiol-ogy: subsurface ecosystem processes. In: Aquatic Microbi-ology – An Ecological Approach (T.E. Ford, ed.), pp. 167–213. Blackwell Scientific Publication, Oxford.

[32] Elshahed, M.S., Senko J.S., Najar F.Z., Kenton S.M., Roe B.A. et al., 2003. Bacterial diversity and sulfur cycling in a mesophilic sulfide-rich spring. Appl. Environ. Microbiol., 69, 5609–5621.

[33] Jonasson, S., Havstrom, M., Jensen, M. et al. 1993. In situ mineralization of nitrogen and phosphorus of arctic soils after perturbations simulating climate change. Oecologia, 95, 179–186.

[34] Castenholz, R.W., Utkilen, H.C., 1984. Physiology of sul-fide tolerance in a thermophilic Oscillatoria. Arch. Micro-biol., 138, 299–305.

[35] Oren, A., Padan, E., Malkin, S., 1979. Sulfide inhibition of photosystem II in cyanobacteria (blue-green algae) and tobacco chloroplasts. Biochem. Biophys. Acta, 546, 270–279.

[36] McGregor, B.J., Moser, D.P., Alm, E.W., Nealson, K.H., Stahl, D.A., 1997. Crenarchaeota in lake Michigan sedi-ment. Appl. Environ. Microbiol., 63, 1178–1181.

((Funded by • 973 Pre-research Program of Key Project of China National Programs for Fundamental Research and Develop-ment; grant number: 2008CB417214 • Open Project of the Key Lab of Microorganisms in Xinjiang Specific Environment; grant number: XJYS0203-2009-02))

prokaryotic diversity of a non-sulfide, low-salt cold spring sediment of shawan county, china

Documents