project on molecular targeting against leukemia

8/6/2019 Project on Molecular Targeting Against Leukemia

1/122

MOLECULAR

TARGETING

AGAINST LEUKEMIA[GENOMICS, PROTEOMICS, INSILICO DRUG

DESIGN]

[BIOMED INFORMATICS]

DEBA PRASANNA SAHOO

B.TECH BIOTECHNOLOGY

AMITY UNIVERSITY

[2007]


2/122

MOLECULAR TARGETING AGAINST LEUKEMIA

Pre face

The preparation of this project was is in response to the summertraining after VI th semester. It is completely based onbioinformatics and chemiinformatics approach to design drugsagainst Chronic Myleoid Leukemia. The bioinformatics part consistsof Genomics and Proteomics portion to have a complete knowledgeabout the incorect or defective gene and defective proteinresponsible for the disease. The chemiinformatics part deals withdesigninig of drugs against the disease by using different modelingsoftwares and find the different properties of the drug.

The whole project is divided into various parts viz. Introduction,Genomics, Proteomics and Drug Desigining. Introduction givesinformation about bionformatics, its scope and its potential infuture. It also completes information about the occurrence ofdisease, its symptoms, mechanism involved and current therapyfor the disease. Genomics gives information about variousbiological databases, use of various on line tools to gather

information about the gene such as its ancestory relationship.Proteomics involves the analysis of primary , secondary andtertiary structure of the protein, and the use of protein modellingsoftware to fold a protein inorder to minimize its energy. Drugdesigining incorporates the docking software to have theappropriate ligand againd the defective protein. And also tocharacterize the properties of the drug such as its toxicity level.

DPS AIB 2


3/122


Acknowledgements

This project is the result of the collectve effort of Mr. S. Santhosh,project in charge and Mr Suba Rao, CEO of Biomed Informatics,who allowed me to carry out the research there.

Illustration and completion of this project would have beenimpossible without my parents Mr. Avaya Kumar Sahoo and Ms.Nalini Prava Sahoo, who beared all the expenses required for the

project and my friends at the institute who constantly helped meto clarify my doubts.

I thank in particular to Mr. Rajiv Dutta, Dy. Director and Head AIB,AMITY UNIVERSITY.

Lastly, I thank to my computer system, Internet, SoftwareDevelopers and MS Office, without which this project would have

been impossible.

DPS AIB 3


4/122


Biomed Informatics

Medwin hospitals, a multi speciality hospital with execellence inmodern health care, having state of art infrastructure facilities,ventures Biomed Informatics in the field of Clinical trials andchemi/bioinformatics by keeping in view of the tremendousapplications in improving the quality of the health care. They arepioneers in the emerging technologies since the year of 2000 andhave been involved in research projects related to variousdiseases.

They can be visited at www.biomedlifesciences.com or email [email protected].

DPS AIB 4
http://www.biomedlifesciences.com/http://www.biomedlifesciences.com/


5/122


Contents

1. Abstract

2. Introduction to project

3. Genomics

4. Proteomics

5. Drug design

DPS AIB 5


6/122


A bstract

CML is characterized by the philadelphia chromosome andBCR/ABL gene rearrangement which occurs in pluripotenthematopoetic progenitor cells expressing the c-kit receptortyrosine kinase. These abnormal tyrosine kinases are responsiblefor uncontrolable cell division resulting in the cancer. Thereforeappropriate control of their synthesis is required to assure thecomplex orchestration of cellular process. For this molecularlytargeted drugs that inhibit the action of pathogenic tyrosine kinase

are designed to treat cancer.

DPS AIB 6


7/122


DPS AIB 7


8/122


BIOINFORMATICS

Bioinformatics properly refers to the creation and advancement of algorithms, computational andstatistical techniques, and theory to solve formal and practical problems inspired from the

management and analysis of biological data.

Computational biology, refers to hypothesis-driven investigation of a specific biological problem

using computers, carried out with experimental or simulated data, with the primary goal of

discovery and the advancement of biological knowledge

DPS AIB 8


9/122


Sub-disciplines within bioinformatics

There are three important sub-disciplines within bioinformatics involving computational biology:

The development of new algorithms and statistics with which to assess relationships amongmembers of large data sets

The analysis and interpretation of various types of data including nucleotide and aminoacid sequences, protein domains, and protein structures and

The development and implementation of tools that enable efficient access and managementof different types of information

Activities in bioinformatics

we can split the activities in bioinformatics in two areas (1) the organization and (2) the analysis of

biological data

Organization activity in Bioinformatics

The creation of databases of biological information

The maintenance of these databases

Analysis activity in Bioinformatics

Development of methods to predict the structure and/or function of newly discovered

proteins and structural RNA sequences.

Clustering protein sequences into families of related sequences and the development ofprotein models.

Aligning similar proteins and generating phylogenetic trees to examine evolutionary

relationships

Aims of Bioinformatics:The aims of bioinformatics are basically three-fold. They are

Organization of data in such a way that it allows researchers to access existing information

& to submit new entries as they are produced. While data-creation is an essential task, the

information stored in these databases is useless unless analysed. Thus the purpose ofbioinformatics extends well beyond mere volume control.

To develop tools and resources that help in the analysis of data. For example, having

sequenced a particular protein, it is with previously characterized sequences. This requires

more than just a straightforward database search. As such, programs such as FASTA andPSI-BLAST much consider what constitutes a biologically significant resemblance.

Development of such resources extensive knowledge of computational theory, as well as a

thorough understanding of biology. Use of these tools to analyse the individual systems in detail, and frequently compared

them with few that are related.

Three levels of bioinformatics

DPS AIB 9


10/122


1. Analysis of a single gene (protein) sequence. For example:

Similarity with other known genes

Phylogenetic trees; evolutionary relationships

Identification of well-defined domains in the sequence

Sequence features (physical properties, binding sites, modification sites) Prediction of subcellular localization

Prediction of secondary and tertiary structure

2. Analysis of complete genomes. For example:

Which gene families are present, which missing?

Location of genes on the chromosomes, correlation with function or evolution

Expansion/duplication of gene families

Presence or absence of biochemical pathways

Identification of "missing" enzymes Large-scale events in the evolution of organisms

3. Analysis of genes and genomes with respect to functional data. For example:

Expression analysis; microarray data; mRNA conc. measurements

Proteomics; protein conc. measurements, covalent modifications

Comparison and analysis of biochemical pathways

Deletion or mutant genotypes vs. phenotypes

Identification of essential genes, or genes involved in specific processes

Bioinformatics and its scope

Bioinformatics uses advances in the area of computer science, information science, computer

and information technology, communication technology to solve complex problems in life

sciences and particularly in biotechnology.

Data capture, data warehousing and data mining have become major issuesfor biotechnologists and biological scientists due to sudden growth in quantitative

data in biology such as complete genomes of biological species including human

genome, protein sequences, protein 3-D structures, metabolic pathways databases,

cell line & hybridoma information, biodiversity related information. Advancements in information technology, particularly the Internet, are

being used to gather and access ever-increasing information in biology andbiotechnology. Functional genomics, proteomics, discovery of new drugs and

vaccines, molecular diagnostic kits and pharmacogenomics are some of the areas in

which bioinformatics has become an integral part of Research & Development.

The knowledge of multimedia databases, tools to carry out data analysis and

modeling of molecules and biological systems on computer workstations as well as in

DPS AIB 10


11/122


a network environment has become essential for any student of Bioinformatics.

Bioinformatics, the multidisciplinary area, has grown so much that one divides it into

molecular bioinformatics, organal bioinformatics and species bioinformatics.

Issues related to biodiversity and environment, cloning of higher animals

such as Dolly and Polly, tissue culture and cloning of plants have brought out that

Bioinformatics is not only a support branch of science but is also a subject that directsfuture course of research in biotechnology and life sciences

The importance and usefulness of Bioinformatics is realized in last few

years by many industries. Therefore, large Bioinformatics R & D divisions are beingestablished in many pharmaceutical companies, biotechnology companies and even in

other conventional industry dealing with biological. Bioinformatics is thus rated as

number one career in the field of biosciences.

In short, Bioinformatics deals with database creation, data analysis and

modeling. Data capturing is done not only from printed material but also from

network resources. Databases in biology are generally in the multimedia formorganized in relational database model. Modeling is done not only on single

biological molecule but also on multiple systems thus requiring a use of highperformance computing systems.

The Potential of Bioinformatics

The potential of Bioinformatics in the identification of useful genes leading to the development

of new gene products, drug discovery and drug development has led to a paradigm shift in

biology and biotechnology-these fields are becoming more & more computationally intensive.

The new paradigm, now emerging, is that all the genes will be known "in the sense of

being resident in database available electronically", and the starting point of biologicalinvestigation will be theoretical and a scientist will begin with a theoretical conjecture and

only then turning to experiment to follow or test the hypothesis.

With a much deep understanding of the biological processes at the molecular level, the

Bioinformatics scientist have developed new techniques to analyse genes on an industrial

scale resulting in a new area of science known as 'Genomics'.

The shift from gene biology has resulted in the development of strategies-from lab

techniques to computer programmes to analyse whole batch of genes at once. Genomics is

revolutionizing drug development, gene therapy, and our entire approach to health care and

human medicine.

The genomic discoveries are getting translated in to practical biomedical results through

Bioinformatics applications. Work on proteomics and genomics will continue using highlysophisticated software tools and data networks that can carry multimedia databases. Thus,

the research will be in the development of multimedia databases in various areas of life

sciences and biotechnology. There will be an urgent need for development of software

tools for datamining, analysis and modelling, and downstream processing. Security of data,data transfer and data compression, auto checks on data accuracy and correctness will also

be major research area of bioinformatics. The use of virtual Reality in drug design,

metabolic pathway design, and unicellular organism design, paving the way to design and

DPS AIB 11


12/122


modification of muticellular organisms, will be the challenges challenges, which

Bioinformatics scientist and specialist have to tackle. It has now been universally

recognized that Bioinformatics is the key to the new grand data-intensive molecularbiology that will take us into 21 century.

DPS AIB 12


13/122


Leukemia

Leukemia is a malignant disease (cancer) of the bone marrow and blood. It is characterized by theuncontrolled accumulation of blood cells.

Types of leukemia

Leukemia is divided into four categories: myelogenous or lymphocytic, each of which can be acute

or chronic. The terms myelogenous or lymphocytic denote the cell type involved. Thus, the four

major types of leukemia are: Acute Lymphocytic Leukemia

Chronic Lymphocytic Leukemia

Acute Myelogenous Leukemia

Chronic Myelogenous Leukemia

DPS AIB 13


14/122


Chronic leukemiaEarly in the disease, the abnormal blood cells can still do their work,

and people with chronic leukemia may not have any symptoms. Slowly, chronic leukemiagets worse. It causes symptoms as the number of leukemia cells in the blood rises.

Acute leukemiaThe blood cells are very abnormal. They cannot carry out their normal

work. The number of abnormal cells increases rapidly. Acute leukemia worsens quickly.

Chronic Myelogenous Leukemia (CML)

CML patients have what is called the "Philadelphia Chromosome" (Ph chromosome).

Philadelphia chromosome or Philadelphia translocation is a specific chromosomalabnormality is due to a reciprocal translocation, an exchange of genetic material, between

chromosomes 9 and 22; [t(9,22)]. The presence of this translocation is a highly sensitive

test for CML, since 95% of people with CML have this abnormality (The remainder have

either a cryptic translocation that is invisible on G-banded chromosome preparations, or avariant translocation involving another chromosome or chromosomes as well as the long

arm of chromosomes 9 and 22).

Parts of two chromosomes, 9 and 22, swap places. The result is that part of the BCR

("breakpoint cluster region") gene from chromosome 22 (region q11) is fused with part of

the ABL gene on chromosome 9 (region q34).Ablstands for "Abelson", the name of aleukemia virus which carries a similar protein.

The fused "bcr-abl" gene is located on the resulting, shorter chromosome 22.

Molecular basis of translocation

The 3 part of the ABL gene is moved from chromosome 9 to chromosome 22 and is

juxtaposed to the proximal segment of the disrupted BCR gene on chromosome 22. Theresult is a chimeric BCR-ABL gene.

The breaks in the BCR gene on chromosome 22 vary.

DPS AIB 14
http://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=c#chronic%20leukemiahttp://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=s#symptomhttp://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=a#acute%20leukemiahttp://en.wikipedia.org/wiki/Chromosomehttp://en.wikipedia.org/wiki/Chromosomal_translocationhttp://en.wikipedia.org/wiki/BCR_genehttp://en.wikipedia.org/wiki/Abl_genehttp://en.wikipedia.org/wiki/Image:Philadelphia_transformation.jpghttp://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=c#chronic%20leukemiahttp://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=s#symptomhttp://www.nci.nih.gov/dictionary/db_alpha.aspx?expand=a#acute%20leukemiahttp://en.wikipedia.org/wiki/Chromosomehttp://en.wikipedia.org/wiki/Chromosomal_translocationhttp://en.wikipedia.org/wiki/BCR_genehttp://en.wikipedia.org/wiki/Abl_gene


15/122


The most often break occur centrally , that is , in between exons 12 and 16 (alsoknown as exons b1 to b5), in a region designated as the major break point cluster

region(M-bcr).

In a small subset of patients, a more distal region between exons 19 and 20, in a

region designated as miro-bcr(m-bcr). As a result of these variable break points as well as promiscuous alternative splicing

between BCR and ABL exons , different amounts of DNA from BCR are joined to

ABL exons 2 to 11.

Therefore breaks in the m-bcr join only the first exon of BCR to the entire ABL

gene from exon 2 to the end of the end of the gene (e1 a2 junction) ; breaks in M-

bcr join all of BCR up to exon 13 or 14 (b2 or b3) to ABL (again, the entire genefrom exon 2 to the end) (b2 a2 or b3 a2 junction) and breaks in micro-bcr join

all of BCR up to exon 19 to ABL exon (exons 2 to 11).

As a result , Bcr-abl proteins are sized at 190, 210 and 230 kDa respectively. Hence,the smallest Bcr- abl protein (p190bcr-abl) contains less of BCR than larger Bcr-

Abl protein p210bcr-abl; p230bcr-abl contains larger segment of BCR. All harbor the same amount of ABL.

DPS AIB 15


16/122


The ABL gene

There are two forms of ABL gene, viral and cellular.

The cellular form of Abl gene is homologue of viral ABL oncogene carried by the Abelsion

murine leukemia virus. Viral ABL gene originates from cellular ABL. Presumably, during some point evolution

the Abelsion murine leukemia virus incorporated the mammalian ABL gene.

ABL protein

Human Abl protein is expressed ubiquitously in two isoforms.

In hematopoietic cells, steady state levels of Abl decrease with myeloid maturation.

Abl functions as a nonreceptor tyrosine kinase enzyme with protean biological effects.

Subcellular location for Abl

While Bcr-Abl is found exclusively in cytoplasm, surprisingly (for a tyrosine kinase

enzyme), Abl can shuttle in between the nucleus, where it can bind to DNA, and thecytoplasm where it binds the actin cytoskeleton. In primary human hematopoietic cells andneurons , Abl is more cytoplasmic than nuclear.

Biology of ABL:- Cytoplasmic function of Abl include signaling and cytoskeletal molding;

nuclear Abl has implicated in regulation of the cell cycle and in genotoxicity.

Abl tyrosine kinase enzymatic activity

Tyrosine kinase enzymes that phosphorylate to a tyrosine in a substrate.

They have a catalytic domain, which promotes the the transfer of the terminal

phosphoryl group from ATP to tyrosine group amino acceptor in a substrate.

Normal Abl phosphorylation is tightly controlled, probably by the motifs in the N-

terminal. Loss of this region (as occurs in the formation of BCR-ABL ) results in

high constitutive kinase enzymatic activity, a key factor in oncogenic potential oftransforming Abl proteins.

Other properties:- (impact on cytoskeleton, cell cycle and DNA repair)

Abl influences the cytoskeleton locally, and, in turn, Abl kinase activity is modified by

outside in-cellular signals. Most cytoplasmic Abl is associated with filamentous actin ,

a building block of cellular cytoskeleton.

Abl interacts with cell cycle regulatory gene at several check points, there by affectingcellular proliferation.

A role for Abl in DNA repair has been suggested by its interaction with other molecules

involved is this process, such as the ATM gene product. Mutation of the gene productcauses ataxia telangeictasia, a disorder characterized by hypersensitivity to radiation

damage.

The BCR gene

DPS AIB 16


17/122


BCR is situated o the long arm of chromosome 22(22q11).

The Bcr protein

It is translated into major proteins that have molecular weights of 160000 and 130000 kDa.

Bcr protein levels decrease with myleoid maturation in hematopoetic cells.

Functional sites include a serine/threonine kinase domain in exon 1, a central GEF domain,

and a COOH-terminal GAP domain. SH2-binding sites are also present in exon 1. The two

Abl SH2-binding sites are noted in the figure and stretch from amino acids 192242 and293413. Interaction at these sites is mediated via phosphoserine and phosphothreonine.

The 14-3-3 protein (Bap-1) also interacts with the latter site. Grb2 associates with an

additional proximal SH2-binding site containing a phosphotyrosine at position 177. TheGEF domain interacts with the XPB DNA repair protein.

Subcellular location of Bcr

Bcr protein resides in both cytoplasmic and nuclear compartments.

In the nucleus Bcr associates with condensed DNA in metaphase.

Biology of Bcr

The BCR gene is a complicated molecule with many different functional motifs. It is

implicated in the two major signaling pathways in eukaryotes, phosphorylation and GTPbinding.

The first exon of BCR gene is pivotal to oncogenesis.

It is the first exon which is included in all of Bcr-Abl fusion proteins. Bcr has serine and threonine kinase enzymatic activity in its first exon. It can phosphorylate

itself as well as key substrates and hence propagate cellular signals.

Several Src homology-2 (SH2)binding domains are also in the first exon of BCR.

SH2 domains are highly conserved, non catalytic regions of 100 amino acids that bind

SH2-binding sites consisting of 3 to 5 amino acids, including a phosphotyrosine.This

interaction is important in the assembly of signal transduction complexes.

DPS AIB 17


18/122


Bcr also interacts with or has homology to G proteins at multiple levels.These proteins are

essential players in intracellular signaling, cytoskeletal organization , cell growth, andnormal development. G proteins cycle between an inactive guanosine diphosphate (GDP)-

bound state and an active GTP-bound state.

Homeostasis within this process is regulated by guanosine triphosphatase(GTPase)-

activating proteins (which turn off G proteins) and guanine nucleotide exchange factors(which turn on G proteins).

Bcr has both GTPase-activating protein and guanine nucleotide exchange factor functions ,

suggesting a dichotomous role for this molecule in G protein-associated signalingpathways.

Finally, Bcr (and p210Bcr-Abl) interact with the Xeroderma pigmentosum gene product.

Xeroderma pigmentosum is an inherited disorder whose hallmark is increased sensitivity tosunlight coupled with a defect in the DNA damage response process. Therefore, Bcr may

also participate in DNA repair.

Association of Bcr with Normal Abl and with Bcr-Abl

Bcr binds to SH2 domains of normal Abl and can form complexes with Bcr-Abl. The resultof interaction between Bcr and Bcr-Abl may be functional feedback regulation.

The Biology of BCR-ABL

P210Bcr-Abl and p190 Bcr-Abl are pleiotropic molecules with many qualitatively similar

activities; their differences are still being unraveled.

Of interest, current studies suggest that not only is p210Bcr-Abl critical to the developmentof the chronic phase of CML, but its effect on the DNA repair process may also be

responsible for genomic instability and, hence, disease progression.

Kinase Activation Tyrosine kinase enzymatic activity is central to cellular signaling and growth, and

constitutively elevated kinase activity has been associated with transformation in several

systems.

The Abl protein is a nonreceptor tyrosine kinase whose enzymatic activity is under closephysiologic control.

In contrast, Bcr-Abl proteins are constitutively active tyrosine kinases.The degree oftransforming activity of Bcr-Abl correlates with the degree of tyrosine kinase activity .

P190Bcr-Abl, which has higher tyrosine kinase activity ,is therefore associated with the

development of the more aggressive acute leukemia phenotype, while p210Bcr-Abl plays a

role in the more indolent chronic leukemia phenotype.

Ras Signaling

p210Bcr-Abl and p190Bcr-Abl execute their transforming capabilities at least in part viaactivation of Ras, a vital protein in the intracellular signaling pathway.

Ras can also be aberrantly activated by mutation , a common event in tumorigenesis.

The mechanisms by which Bcr-Abl interact with the Ras pathway are complex and includevarious adaptor and docking proteins.

DPS AIB 18


19/122


Adhesion Molecules

Chronic myelogenous leukemia is clinically characterized by premature bone marrow

release of progenitor cells, a phenomenon that may be attributed to defects in the adhesion

properties of these cells.

The effects Bcr-Abl on specific intracellular substrates may cause an alteration incytoskeletal structure, with subsequent inside-to-outside perturbation of adhesion

molecules.

Programmed Cell Death(Apoptosis)

Bcr-Abl-induced survival enhancement may be medicated by modulating proteins , such as

Bcl-2,which suppresses programmed cell death , or Bad, which promotes programmed celldeath.

Of note, several studies show that BCR-ABL-positive cell lines are resistant to

programmed cell death induced by DNA damage.

Growth Factor Independence Bcr-Abl can abrogate growth factor independence .

Several mechanisms may be operative, including activation of intracellular signalingmolecules (such as signal transducer and activator of transcription), interaction with growth

factor receptors(for example, receptors for interleukin-3 and stem- cell factor), and

enhanced expression of growth factors themselves (interleukin-3 or granulocyte colony-stimulating factor ).

DNA Repair

Bcr-abl affects the DNA damage response process in diverse ways. It interacts with

Xeroderma pigmentosum B gene product and increases radiosensitivity.

It also enhances DNA double strand break repair and, hence resistance after drug therapy.Altered DNA repair ay lead to subtle genetic errors, which manifest as clonal evolution andprogression to blast crisis.

Mechanism of disease / Molecular events

There is a little evidence of any acquired molecular abnormalities preceding the t(9;22)

translocation. Instead, it seems more likely that the generation of a classic BCR-ABLfusion gene in a specific type of cell (namely, a pluripotential hematopoietic stem cell),

possibly under the condition of reduced immunologic surveillance, is sufficient to initiate

the expansion of a hematopoietic clone that is leads to CML

. In the translocation that forms the fusion gene, abreak point occurs in ABL some where up

stream of exon a2, and simultaneously a breakpoint occurs in the M-bcr region of the BCR

gene. As a result, a 5 portion of BCR and a 3 portion of ABL are juxtaposed on ashortened chromosome 22.

DPS AIB 19


20/122


The mRNA molecules transcribed from this hybrid gene usually contain one of two BCR-

ABL junctions, designated e13a2 and e14a2.There is no evidence the type of junction hasany prognostic significance.

Both BCR-ABL mRNA are translated into an 210-kD oncoprotein, usually referred to as

p210BCR-ABL. Other variant breakpoints and fusions can give rise to full length,functionally oncogenic BCR-ABL proteins, notably p190BCR-ABL (associated with an

e1a2 mRNA junction) and p230BCR-ABL (associated with an e19a2 mRNA junction), but

they are rare in classic CML.

The leukemogenic potential of p210BCR-ABL resides in the fact that the normally

regulated tyrosine kinase activity of the ABL protein is constitutively activated by thejuxtaposition of alien BCR sequences. BCR acts by promoting dimerization of the

oncoprotein, such that te two adjacent BCR-ABL molecules phosphorylate each other on

tyrosine residues in their kinase-activation loops.

The uncontrolled kinase activity of BCR-ABL then usurps the physiologic function of the

normal ABL enzyme by interacting with a variety of effector proteins, the net result of

which is deregulated cellular proliferation, decreased adherence of leukemia cells to thebone marrow stroma, and a reduced apoptosis response to mutagenic stimuli.

This oncoprotein is a hybrid containing functional domains from the N-terminal end ofBCR (dimerization [DD], SRC-homology 2 [SH2]binding, and the Rho GTPGDP

exchange-factor [GEF] domains) and the C-terminal end of ABL. (Only SRC-homology

regions 2, 3, and 1 [SH2, SH3, and SH1, respectively], and the DNA- and actin-bindingdomains are shown.) Tyrosine 177 (Y177) in the BCR portion of the fusion gene and

tyrosine 412 (Y412) in the ABL portion are important for the docking of adapter proteins

and for BCR-ABL autophosphorylation, respectively. P-S/T denotes phosphoserine andphosphothreonine.

DPS AIB 20


21/122


The enzymatic (tyrosine kinase) activity of the normal ABL protein (p145ABL), encoded

by its SRC homology 1 (SH1) domain, is kept under tight control, probably by the

intramolecular binding of an N-terminal cap region encompassed by its first exon (1b or1a) and the first part of exon a2.

In the fusion protein, lack of the ABL cap region and a dimerization domain encoded by

the first exon of BCR are responsible for constitutive activation of the ABL SH1 domain,

resulting in uncontrolled signal transduction and an abnormal cellular phenotype. Thevarious functional domains of the ABL protein include the SRC-homology 3 and 2

regulatory domains, the SH1 domain with its ATP binding site, the nuclear localization

signal motif, the nuclear-export signal motif, the DNA binding domain, and the G-actin andF-actin DNA-binding domains. The last are important for the control of cytoskeletal

organization, cell adherence, cell motility, and integrin receptor mediated signal

transduction.

Numerous substrates have been found to bind to BCR-ABL and be tyrosine phosphorylated

by it.

DPS AIB 21


22/122


Signal transduction pathways affected by BCR-ABL:- the cellular effects of BCR-ABL are

exerted through interactions with various proteins that transduce the oncogenic signals

responsible for the activation or repression of gene transcription, of mitochondrial

processing of apoptotic responses, of cytoskeletal organization, and of the degradation ofinhibitory proteins. The key pathways implicated so far are those involving RAS, mitogen

activated protein(MAP) kinases, signal transducers and activators of transcription(STAT),phosphatidylinositol 3-kinase(P13K), and MYC. Most of the interactions are mediatedthrough tyrosine phosphorylation and require the binding of BCR-ABL to adapter proteins

such as GRB-2, DOK, CRK, CRKL, SHC and CBL.

DPS AIB 22


23/122


Molecular targeting

Since tyrosine kinase is the effector part of the oncoprotein, it was obviously the mostattractive target for inhibition. The aim was to design a small chemical compound that

would compete with ATP for its binding site in the kinase domain.

Whereas the normal binding of ATP allows BCR-ABL to phosphorylate selected tyrosine

residues on its substrates, an ATP mimic occupying the binding pocket would not provide

any phosphate group for transfer to the substrate.

DPS AIB 23


24/122


With its tyrosine residues residues in the unphosphorylated form, the substrate protein

would not then undergo the required conformational change to allow it to associate with itsdownstream effector.

The entire chain of downstream reaction would then be impeded, interrupting transmission

of the oncogenic signal to the nucleus.

Risk factors

Very high levels of radiation.

High dose radiation therapy used to treat other cancers.

Signs and symptoms

Tiredness

Shortness of breath doing activities

Pale looking skin

Enlarged spleen

Night sweats

Weight loss

Diagnosis

Lab tests are used to make a CML diagnosis. They are also used to check a patient's response totreatment.

DPS AIB 24


25/122


Blood and Bone Marrow Tests

Blood and bone marrow tests are done to look for leukemia cells to find out if a person has CML.

In CML, the white cellcountincreases, often to very high levels. Platelet counts may also be high.Levels of hemoglobin go down.

A CML diagnosis is usually clear from an exam of blood cells. A bone marrow aspirateand a bonemarrow biopsyare two tests that are done to look at the marrow cells for changes that can't be seen

in cells in the blood. These tests may help the doctor to choose the best treatment for the patient.The tests also help the doctor to follow the effects of therapy.

Cytogenetic Analysis

Cytogenetic analysis is a lab test to examine the chromosomes of the leukemia cells. This test

helps the doctor to find out if the patient's type of leukemia is CML.

FISH is alab test used to measure the patient's percent of CML cells.

PCR is a very sensitive test that is used when there are no CML cells found by FISH.

Phases of CML

CML can have three phases:

The chronic phase

The accelerated phase

The blast crisis phase

Most patients are in the chronic phase of the disease when their CML is found. During this phase,

CML symptoms are less intense. White cellscan still fight infection. Once patients in the chronic

phase are treated, red cellsand platelets can do their jobs. Most patients can go back to their ususalactivites.

In the accelerated phase, the patient may develop anemia, the number of white cells may go up or

down. The number of platelets may drop.

The number of blast cells increases. The spleenmay swell and the patient may feel ill.

During the blast crisis phase:

The number of blast cells grows in the marrowand blood

The number of red cells and platelets drops

The patient may have infections

The patient may be tired and have shortness of breath, stomach pain, bone pain or bleeding.

DPS AIB 25


26/122


DPS AIB 26


27/122


GENOMICS

Genomics is the study of an organisms genome and the use of the genes. It deals with the

systematic use of genome information, associated with other data, to provide answers in biology,medicine, and industry. It has the potential of offering new therapeutic methods for the treatment

of some diseases, as well as new diagnostic methods. The major tools and methods to genomics

are bioinformatics, genetic analysis, measurement of gene expression and determination of geneexpression.

Comparative genomics

Comparison of genomes has resulted in some surprising biological discoveries. If a particular

DNA sequence or pattern is present among many members of clade, that sequence is said to have

been conserved among the species. Evolutionary conservation of a DNA sequence may imply thatit confers a relative selective advantage to the organism that posses it. Conservation also suggests

that sequence has functional significance.

Structural genomics

Structural genomics consists in the determination of the three dimensional structure of all proteins

of a given organism, by experimental methods such as X-ray crystallography, NMR spectroscopy

DPS AIB 27


28/122


or computational approaches such as homology modeling. this raise new challenges in structural

bioinformatics consisting in determining a protein function from its 3D structure. One of the

important aspects of structural genomics is the emphasis on high throughput determination ofprotein structures.

Thrust areas of genomics

Study of gene expression

Sequence analysis

Genes and diseases

Molecular markers

Polymorphisms analysis

Genotyping and mapping

Phylogenetic analysis

DNA microarrays

Mutations

DATABASES

Biological databases

Biological research today depends on a wide range of software interacting with a large number of

disparate data sources. Several hundred relevant sources currently exist, varying in both size andscope. Numerous groups are maintaining and publishing these biological data in a variety of

different formats. It is vitally important that an effective mechanism is adopted which is capable of

utilizing data from these different sources. The WWW is presently the most popular mechanismused provide access to collections of data.

Necessity of biological databases Make biological data available to scientist.

As much as possible of a particular type of information should be available in one single

place. Published data may be difficult to find or access, and collecting it from the literature

is very time consuming.

To make biological data available in computer- readable form. Since analysis of biological

data almost always involves computers, having the data in computer redable form is

necessary.

DPS AIB 28


29/122


Types of biological databases

One may characterize the available biological databases by several different properties.

Type of data

Nucleotide sequences

Protein sequences Macromolecular 3D structure

Gene expression data

Metabolic pathways

Protein sequence patterns or motifs

Examples of biological databases

Nucleotide databases:- EMBL, GenBank, DDBJ, dbSTS

Protein databases:- Swiss-Prot, TrEMBL, Proteome Analysis, PDB

Structure database:- PDB, DALI, FSSP

Microarray database:- Array express

Literature database:- MEDLINE, Software Biocatalog

Alignment databases:- BALIBASE, FSSP

National Center for Biotechnology Information (NCBI)

The NCBI provides a comprehensive website for biologists that includes biology related databases,and tools for viewing and analyzing the data inherent in the databases. A division of the National

Library of Medicine at the National Institute of Health, NCBI is the agency responsible for

creating automated system for storing and analyzing the rapidly growing profusion of genetic andmolecular data.

NCBI DatabaseNCBI database contains literature database, Entrez database, Nucleotide Database, Genomespecific resources, Tools for data mining, Tools for sequence analysis, Tools for 3D structure

Display and Similarity Searching Maps, Collaborative Cancer Research and Resource Statistics.

Literature databases

Pubmed

Pubmed central

Books

Journals

OMIM

Entrez databases

Entrez is a search and retrieval system that integrates information from databases at NCBI. These

databases include nucleotide sequences, protein sequences, macromolecular structures, wholegenomes, and MEDLINE, through pubmed.

CDD

DPS AIB 29


30/122


Conserved Domain Database, a collection of sequence alignments and profiles representing protein

domains conserved in molecular evolution. Proteins often contain several modules or domains,

each with a distinct evolutionary origin and function. NCBIs CDD is a collection of multiplesequence alignments for ancient domains and full length proteins. The CD-search service may be

used to identify the conserved domains present in a protein query sequence.

Genome

The Genome database provides views for a variety of genomes, complete chromosomes, sequence

maps with contigs, and integrated genetic and physical maps. Genomes of over 800 organisms canbe found in this database, representing both completely sequenced organisms and those for which

sequencing is in progress.

GENSAT:

Gene expression atlas of the mouse central nervous system. The GENSAT database contains a

gene expression atlas of the central nervous system of the mouse based on bacterial artificial

chromosomes. In each of the BAC transgenic vectors, endogenous protein coding sequences have

been replaced by sequences encoding the EGFP reporter gene. As in any gene replacementexperiment, the stability of the reporter gene can vary somewhat from the endogenous gene. Thus

these results measure the relative rates of transcription for each gene; they are not the directmeasure of mRNA accumulation or of protein abundance for the endogenous gene products.

GENEGene responsible for CML in Homo sapiens is ABL and BCR. Information regarding both the

genes is available in NCBI, which is given below:

ABL

DPS AIB 30


31/122


ABL1 v-abl Abelson murine leukemia viral oncogene homolog1 [Homo sapiens]

GeneID: 25 updated 06-Jun-2007

Summary

Official Symbol ABL1provided by HGNC

Official Full Name v-abl Abelson murine leukemia viral oncogene homolog 1provided by HGNC

Primary sourceHGNC:76

See related Ensembl:ENSG00000097007; HPRD:01809; MIM:189980

Gene type protein coding

RefSeq status Reviewed

OrganismHomo sapiens

Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria;

Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo

Also known as ABL; JTK7; p150; c-ABL; v-abl; bcr/abl

Summary

The ABL1 protooncogene encodes a cytoplasmic and nuclear protein tyrosine kinase thathas been implicated in processes of cell differentiation, cell division, cell adhesion, and

stress response. Activity of c-Abl protein is negatively regulated by its SH3 domain, and

deletion of the SH3 domain turns ABL1 into an oncogene. The t(9;22) translocation resultsin the head-to-tail fusion of the BCR (MIM:151410) and ABL1 genes present in many

cases of chronic myelogeneous leukemia. The DNA-binding activity of the ubiquitously

expressed ABL1 tyrosine kinase is regulated by CDC2-mediated phosphorylation,suggesting a cell cycle function for ABL1. The ABL1 gene is expressed as either a 6- or 7-

kb mRNA transcript, with alternatively spliced first exons spliced to the common exons 2-

11.

Genomic regions, transcripts, and products

DPS AIB 31
http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/get_data.pl?hgnc_id=76http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000097007http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/get_data.pl?hgnc_id=76http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000097007http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606


32/122


Genomic context

chromosome: 9; Location: 9q34.1

BCR

BCR breakpoint cluster region [Homo sapiens]

GeneID: 613 updated 06-Jun-2007

Summary

Official Symbol BCR provided by HGNC

Official Full Name breakpoint cluster region provided by HGNC

Primary sourceHGNC:1014See related Ensembl:ENSG00000186716; HPRD:01044; MIM:151410

Gene type protein coding

RefSeq status Reviewed

OrganismHomo sapiens

Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria;

Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo

Also known as ALL; CML; PHL; BCR1; D22S11; D22S662; FLJ16453

Summary

A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia

chromosome, which is often found in patients with chronic myelogenous leukemia. The

chromosome 22 breakpoint for this translocation is located within the BCR gene. Thetranslocation produces a fusion protein which is encoded by sequence from both BCR and

ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has

been extensively studied, the function of the normal BCR gene product is not clear. The

DPS AIB 32
http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/get_data.pl?hgnc_id=1014http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000186716http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.hprd.org/protein/01044http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=151410http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=151410http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/nomenclature/http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/get_data.pl?hgnc_id=1014http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000186716http://www.ncbi.nlm.nih.gov/entrez/utils/fref.fcgi?http://www.hprd.org/protein/01044http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=151410http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606


33/122


protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac.

Two transcript variants encoding different isoforms have been found for this gene.

Genomic regions, transcripts, and products

Genomic context

chromosome: 22; Locations: 22q11; 22q11.23

Nucleotide sequence of ABL

Gen bank format

LOCUS NM_007313 5881 bp mRNA linear PRI 03-JUN-2007DEFINITION Homo sapiens v-abl Abelson murine leukemia viral oncogene homolog 1(Atranscript variant b, mRNA.ACCESSION NM_007313VERSION NM_007313.2 GI:62362411KEYWORDSSOURCE Homo sapiens (human)ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; VertebrataEuteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates;Haplorrhini;Catarrhini; Hominidae; Homo.

REFERENCE 1 (bases 1 to 5881)AUTHORS Jiang,X., Saw,K.M., Eaves,A. and Eaves,C.TITLE Instability of BCR-ABL gene in primary and cultured chronic myeloid

leukemia stem cellsJOURNAL J. Natl. Cancer Inst. 99 (9), 680-693 (2007)PUBMED 17470736REMARK GeneRIF: Primary and cultured chronic myeloid leukemia stem

cellsdisplay instability of the BCR-ABL fusion gene both in vivoand in vitro.

DPS AIB 33
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470736http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470736


34/122


REFERENCE 2 (bases 1 to 5881)AUTHORS Rodrigues,M.S. and Sattler,M.TITLE Chronic myelogenous leukemia progenitors display a genetically

unstable personalityJOURNAL J. Natl. Cancer Inst. 99 (9), 662-663 (2007)PUBMED 17470729REMARK GeneRIF: Acute myelogenous leukemia patients respond to imatinib

mesylate only when BCR-ABLE kinase is inhibited.REFERENCE 3 (bases 1 to 5881)AUTHORS Sherbenou,D.W., Wong,M.J., Humayun,A., McGreevey,L.S., Harrell,P.,

Yang,R., Mauro,M., Heinrich,M.C., Press,R.D., Druker,B.J. andDeininger,M.W.

TITLE Mutations of the BCR-ABL-kinase domain occur in a minority ofpatients with stable complete cytogenetic response to imatinib

JOURNAL Leukemia 21 (3), 489-493 (2007)PUBMED 17252009REMARK GeneRIF: BCR-ABL-kinase domain mutations in patients with a stable

CCR are infrequent, and their detection does not consistentlypredict relapse. Alternative mechanisms must be responsible fordisease persistence in the majority of patients.

REFERENCE 4 (bases 1 to 5881)AUTHORS Wissing,J., Jansch,L., Nimtz,M., Dieterich,G., Hornberger,R.,Keri,G., Wehland,J. and Daub,H.

TITLE Proteomics analysis of protein kinases by target class-selectiveprefractionation and tandem mass spectrometry

JOURNAL Mol. Cell Proteomics 6 (3), 537-547 (2007)PUBMED 17192257

REFERENCE 5 (bases 1 to 5881)AUTHORS Bartos,J.D., Gaile,D.P., McQuaid,D.E., Conroy,J.M., Darbary,H.,

Nowak,N.J., Block,A., Petrelli,N.J., Mittelman,A., Stoler,D.L. andAnderson,G.R.

TITLE aCGH local copy number aberrations associated with overall copynumber genomic instability in colorectal cancer: coordinateinvolvement of the regions including BCR and ABL

JOURNAL Mutat. Res. 615 (1-2), 1-11 (2007)PUBMED 17196995REMARK GeneRIF: a system akin to the BCR-ABL translocation of CML may be

involved in genomic instability in about one-third of colorectalcarcinomas

COMMENT REVIEWEDREFSEQ: This record has been curated by NCBIstaff. The reference sequence wasderived from CA335983.1, AL707819.1, AB209456.1 and AA524892.1.

On Apr 7, 2005 this sequence version replaced gi:6382057.Summary: The ABL1 protooncogene encodes a cytoplasmic and nuclear

protein tyrosine kinase that has been implicated in processes of

cell differentiation, cell division, cell adhesion, and stressresponse. Activity of c-Abl protein is negatively regulated by itsSH3 domain, and deletion of the SH3 domain turns ABL1 into anoncogene. The t(9;22) translocation results in the head-to-tailfusion of the BCR (MIM:151410) and ABL1 genes present in many casesof chronic myelogeneous leukemia. The DNA-binding activity of theubiquitously expressed ABL1 tyrosine kinase is regulated byCDC2-mediated phosphorylation, suggesting a cell cycle function forABL1. The ABL1 gene is expressed as either a 6- or 7-kb mRNAtranscript, with alternatively spliced first exons spliced to the

DPS AIB 34
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470729http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17252009http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17192257http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17196995http://www.ncbi.nlm.nih.gov/RefSeq/http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=CA335983.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AL707819.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AB209456.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AA524892.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=6382057http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470729http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17252009http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17192257http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17196995http://www.ncbi.nlm.nih.gov/RefSeq/http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=CA335983.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AL707819.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AB209456.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AA524892.1http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=6382057


35/122


common exons 2-11.

Transcript Variant: Transcript variant b includes exon 1b, but notexon 1a, resulting in a different N-terminus. This variant containsan N-terminal glycine which could be myristylated and is thuspostulated to be directed to the plasma membrane.

Publication Note: This RefSeq record includes a subset of thepublications that are available for this gene. Please see theEntrez Gene record to access additional publications.COMPLETENESS: full length.

FEATURES Location/Qualifierssource 1..5881

/organism="Homo sapiens"/mol_type="mRNA"/db_xref="taxon:9606"/chromosome="9"/map="9q34.1"

gene 1..5881/gene="ABL1"

/note="v-abl Abelson murine leukemia viraloncogenehomolog 1; synonyms: ABL, JTK7, p150, c-ABL, vabl,bcr/abl"/db_xref="GeneID:25"/db_xref="HGNC:76"/db_xref="HPRD:01809"/db_xref="MIM:189980"

misc_feature 1..566/gene="ABL1"/note="exon 1b"

CDS 440..3889/gene="ABL1"/EC_number="2.7.10.1"/GO_component="nucleus [pmid 8242749]"/GO_function="ATP binding; DNA binding [pmid 8242749];

nucleotide binding; protein C-terminus binding [pmid 11971963]; protein-tyrosine kinase activity [pmid 10391249]; transferase activity"

/GO_process="DNA damage response, signal transduction resulting in induction of apoptosis [pmid 10391249]; intracellular signaling cascade; mismatch repair [pmid 10391249]; protein amino acid phosphorylation; regulation of progression through cell cycle [pmid 8242749]; regulation of transcription, DNA-dependent [pmid 8242749]; S-phase-specific transcription in mitotic cell cycle [pmid 8242749]"

/note="isoform b is encoded by transcript variant b;

Abelson murine leukemia viral (v-abl) oncogene homolog 1;proto-oncogene tyrosine-protein kinase ABL1; bcr/c-abloncogene protein; BCR/ABL (major breakpoint) fusionpeptide"/codon_start=1/product="v-abl Abelson murine leukemia viral oncogenehomolog 1 isoform b"/protein_id="NP_009297.2"/db_xref="GI:62362412"/db_xref="CCDS:CCDS35165.1"

DPS AIB 35
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=1&to=5881&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=full_report&list_uids=25http://www.gene.ucl.ac.uk/nomenclature/data/get_data.php?hgnc_id=76http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=1&to=566&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=440&to=3889&view=gbwithpartshttp://www.expasy.org/cgi-bin/nicezyme.pl?2.7.10.1http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0005634http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0005524http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0003677http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000166http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008022http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=11971963http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0004713http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0016740http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008630http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008630http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0007242http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006298http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006468http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000074http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000074http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006355http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000115http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_009297.2http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&DATA=CCDS35165.1http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=1&to=5881&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=full_report&list_uids=25http://www.gene.ucl.ac.uk/nomenclature/data/get_data.php?hgnc_id=76http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=1&to=566&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=440&to=3889&view=gbwithpartshttp://www.expasy.org/cgi-bin/nicezyme.pl?2.7.10.1http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0005634http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0005524http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0003677http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000166http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008022http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=11971963http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0004713http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0016740http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008630http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0008630http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0007242http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006298http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=10391249http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006468http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000074http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000074http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0006355http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&depth=1&query=0000115http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=8242749http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_009297.2http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&DATA=CCDS35165.1


36/122


/db_xref="GeneID:25"/db_xref="HGNC:76"/db_xref="HPRD:01809"/db_xref="MIM:189980"/translation="MGQQPGKVLGDQRRPSLPALHFIKGAGKKESSRHGGPHCNVFVEHEALQRPVASDFEPQGLSEAARWNSKENLLAGPSENDPNLFVALYDFVASGDNTLSITKGEKLRVLGYNHNGEWCEAQTKNGQGWVPSNYITPVNSLEKHSWYHGPVSRNAAEYLLSSGINGSFLVRESESSPGQRSISLRYEGRVYHYRINTASDGKLYVSSESRFNTLAELVHHHSTVADGLITTLHYPAPKRNKPTVYGVSPNYDKWEMERTDITMKHKLGGGQYGEVYEGVWKKYSLTVAVKTLKEDTMEVEEFLKEAAVMKEIKHPNLVQLLGVCTREPPFYIITEFMTYGNLLDYLRECNRQEVNAVVLLYMATQISSAMEYLEKKNFIHRDLAARNCLVGENHLVKVADFGLSRLMTGDTYTAHAGAKFPIKWTAPESLAYNKFSIKSDVWAFGVLLWEIATYGMSPYPGIDLSQVYELLEKDYRMERPEGCPEKVYELMRACWQWNPSDRPSFAEIHQAFETMFQESSISDEVEKELGKQGVRGAVSTLLQAPELPTKTRTSRRAAEHRDTTDVPEMPHSKGQGESDPLDHEPAVSPLLPRKERGPPEGGLNEDERLLPKDKKTNLFSALIKKKKKTAPTPPKRSSSFREMDGQPERRGAGEEEGRDISNGALAFTPLDTADPAKSPKPSNGAGVPNGALRESGGSGFRSPHLWKKSSTLTSSRLATGEEEGGGSSSKRFLRSCSASCVPHGAKDTEWRSVTLPRDLQSTGRQFDSSTFGGHKSEKPALPRKRAGENRSDQVTRGTVTPPPRLVKKNEEAADEVFKDIMESSPGSSPPNLTPKPLRRQVTVAPASGLPHKEEAGKGSALGTPAAAEPVTPTSKAGSGAPGGTSKGPAEESRVRRHKHSSESPGRDKGKLSRL

KPAPPPPPAASAGKAGGKPSQSPSQEAAGEAVLGAKTKATSLVDAVNSDAAKPSQPGEGLKKPVLPATPKPQSAKPSGTPISPAPVPSTLPSASSALAGDQPSSTAFIPLISTRVSLRKTRQPPERIASGAITKGVVLDSTEALCLAISRNSEQMASHSAVLEAGKNLYTFCVSYVDSIQQMRNKFAFREAINKLENNLRELQICPATAGSGPAATQDFSKLLSSVKEISDIVQR"

STS 662..946/gene="ABL1"/standard_name="PMC20354P4"/db_xref="UniSTS:271937"

STS 3301..4066/gene="ABL1"/standard_name="ABL1_685.2"/db_xref="UniSTS:466093"

STS 3897..4118/gene="ABL1"/standard_name="G29321"/db_xref="UniSTS:26708"

STS 5549..5727/gene="ABL1"/standard_name="RH69429"/db_xref="UniSTS:34678"

STS 5602..5849/gene="ABL1"/standard_name="RH80013"/db_xref="UniSTS:84753"

polyA_signal 5858..5863/gene="ABL1"

polyA_site 5881/gene="ABL1"ORIGIN

1 ggttggtgac ttccacagga aaagttctgg aggagtagcc aaagaccatc agcgtttcct61 ttatgtgtga gaattgaaat gactagcatt attgaccctt ttcagcatcc cctgtgaata121 tttctgttta ggtttttctt cttgaaaaga aattgttatt cagcccgttt aaaacaaatc181 aagaaacttt tgggtaacat tgcaattaca tgaaattgat aaccgcgaaa ataattggaa241 ctcctgcttg caagtgtcaa cctaaaaaaa gtgcttcctt ttgttatgga agatgtcttt301 ctgtgattga cttcaattgc tgacttgtgg agatgcagcg aatgtgaaat cccacgtata361 tgccatttcc ctctacgctc gctgaccgtt ctggaagatc ttgaaccctc ttctggaaag

DPS AIB 36
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=full_report&list_uids=25http://www.gene.ucl.ac.uk/nomenclature/data/get_data.php?hgnc_id=76http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=662&to=946&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=271937http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=3301&to=4066&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=466093http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=3897&to=4118&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=26708http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5549&to=5727&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=34678http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5602&to=5849&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=84753http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5858&to=5863&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&itemID=4&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=full_report&list_uids=25http://www.gene.ucl.ac.uk/nomenclature/data/get_data.php?hgnc_id=76http://www.hprd.org/protein/01809http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=189980http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=662&to=946&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=271937http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=3301&to=4066&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=466093http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=3897&to=4118&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=26708http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5549&to=5727&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=34678http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5602&to=5849&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=84753http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&from=5858&to=5863&view=gbwithpartshttp://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=62362411&itemID=4&view=gbwithparts


37/122


421 gggtacctat tattacttta tggggcagca gcctggaaaa gtacttgggg accaaagaag481 gccaagcttg cctgccctgc attttatcaa aggagcaggg aagaaggaat catcgaggca541 tgggggtcca cactgcaatg tttttgtgga acatgaagcc cttcagcggc cagtagcatc601 tgactttgag cctcagggtc tgagtgaagc cgctcgttgg aactccaagg aaaaccttct661 cgctggaccc agtgaaaatg accccaacct tttcgttgca ctgtatgatt ttgtggccag721 tggagataac actctaagca taactaaagg tgaaaagctc cgggtcttag gctataatca781 caatggggaa tggtgtgaag cccaaaccaa aaatggccaa ggctgggtcc caagcaacta841 catcacgcca gtcaacagtc tggagaaaca ctcctggtac catgggcctg tgtcccgcaa901 tgccgctgag tatctgctga gcagcgggat caatggcagc ttcttggtgc gtgagagtga961 gagcagtcct ggccagaggt ccatctcgct gagatacgaa gggagggtgt accattacag1021 gatcaacact gcttctgatg gcaagctcta cgtctcctcc gagagccgct tcaacaccct1081 ggccgagttg gttcatcatc attcaacggt ggccgacggg ctcatcacca cgctccatta1141 tccagcccca aagcgcaaca agcccactgt ctatggtgtg tcccccaact acgacaagtg1201 ggagatggaa cgcacggaca tcaccatgaa gcacaagctg ggcgggggcc agtacgggga1261 ggtgtacgag ggcgtgtgga agaaatacag cctgacggtg gccgtgaaga ccttgaagga1321 ggacaccatg gaggtggaag agttcttgaa agaagctgca gtcatgaaag agatcaaaca1381 ccctaacctg gtgcagctcc ttggggtctg cacccgggag cccccgttct atatcatcac1441 tgagttcatg acctacggga acctcctgga ctacctgagg gagtgcaacc ggcaggaggt1501 gaacgccgtg gtgctgctgt acatggccac tcagatctcg tcagccatgg agtacctgga1561 gaagaaaaac ttcatccaca gagatcttgc tgcccgaaac tgcctggtag gggagaacca

1621 cttggtgaag gtagctgatt ttggcctgag caggttgatg acaggggaca cctacacagc1681 ccatgctgga gccaagttcc ccatcaaatg gactgcaccc gagagcctgg cctacaacaa1741 gttctccatc aagtccgacg tctgggcatt tggagtattg ctttgggaaa ttgctaccta1801 tggcatgtcc ccttacccgg gaattgacct gtcccaggtg tatgagctgc tagagaagga1861 ctaccgcatg gagcgcccag aaggctgccc agagaaggtc tatgaactca tgcgagcatg1921 ttggcagtgg aatccctctg accggccctc ctttgctgaa atccaccaag cctttgaaac1981 aatgttccag gaatccagta tctcagacga agtggaaaag gagctgggga aacaaggcgt2041 ccgtggggct gtgagtacct tgctgcaggc cccagagctg cccaccaaga cgaggacctc2101 caggagagct gcagagcaca gagacaccac tgacgtgcct gagatgcctc actccaaggg2161 ccagggagag agcgatcctc tggaccatga gcctgccgtg tctccattgc tccctcgaaa2221 agagcgaggt cccccggagg gcggcctgaa tgaagatgag cgccttctcc ccaaagacaa2281 aaagaccaac ttgttcagcg ccttgatcaa gaagaagaag aagacagccc caacccctcc2341 caaacgcagc agctccttcc gggagatgga cggccagccg gagcgcagag gggccggcga2401 ggaagagggc cgagacatca gcaacggggc actggctttc acccccttgg acacagctga2461 cccagccaag tccccaaagc ccagcaatgg ggctggggtc cccaatggag ccctccggga2521 gtccgggggc tcaggcttcc ggtctcccca cctgtggaag aagtccagca cgctgaccag2581 cagccgccta gccaccggcg aggaggaggg cggtggcagc tccagcaagc gcttcctgcg2641 ctcttgctcc gcctcctgcg ttccccatgg ggccaaggac acggagtgga ggtcagtcac2701 gctgcctcgg gacttgcagt ccacgggaag acagtttgac tcgtccacat ttggagggca2761 caaaagtgag aagccggctc tgcctcggaa gagggcaggg gagaacaggt ctgaccaggt2821 gacccgaggc acagtaacgc ctccccccag gctggtgaaa aagaatgagg aagctgctga2881 tgaggtcttc aaagacatca tggagtccag cccgggctcc agcccgccca acctgactcc2941 aaaacccctc cggcggcagg tcaccgtggc ccctgcctcg ggcctccccc acaaggaaga3001 agctggaaag ggcagtgcct tagggacccc tgctgcagct gagccagtga cccccaccag3061 caaagcaggc tcaggtgcac cagggggcac cagcaagggc cccgccgagg agtccagagt3121 gaggaggcac aagcactcct ctgagtcgcc agggagggac aaggggaaat tgtccaggct3181 caaacctgcc ccgccgcccc caccagcagc ctctgcaggg aaggctggag gaaagccctc

3241 gcagagcccg agccaggagg cggccgggga ggcagtcctg ggcgcaaaga caaaagccac3301 gagtctggtt gatgctgtga acagtgacgc tgccaagccc agccagccgg gagagggcct3361 caaaaagccc gtgctcccgg ccactccaaa gccacagtcc gccaagccgt cggggacccc3421 catcagccca gcccccgttc cctccacgtt gccatcagca tcctcggccc tggcagggga3481 ccagccgtct tccaccgcct tcatccctct catatcaacc cgagtgtctc ttcggaaaac3541 ccgccagcct ccagagcgga tcgccagcgg cgccatcacc aagggcgtgg tcctggacag3601 caccgaggcg ctgtgcctcg ccatctctag gaactccgag cagatggcca gccacagcgc3661 agtgctggag gccggcaaaa acctctacac gttctgcgtg agctatgtgg attccatcca3721 gcaaatgagg aacaagtttg ccttccgaga ggccatcaac aaactggaga ataatctccg3781 ggagcttcag atctgcccgg cgacagcagg cagtggtcca gcggccactc aggacttcag

DPS AIB 37


38/122


3841 caagctcctc agttcggtga aggaaatcag tgacatagtg cagaggtagc agcagtcagg3901 ggtcaggtgt caggcccgtc ggagctgcct gcagcacatg cgggctcgcc catacccgtg3961 acagtggctg acaagggact agtgagtcag caccttggcc caggagctct gcgccaggca4021 gagctgaggg ccctgtggag tccagctcta ctacctacgt ttgcaccgcc tgccctcccg4081 caccttcctc ctccccgctc cgtctctgtc ctcgaatttt atctgtggag ttcctgctcc4141 gtggactgca gtcggcatgc caggacccgc cagccccgct cccacctagt gccccagact4201 gagctctcca ggccaggtgg gaacggctga tgtggactgt ctttttcatt tttttctctc4261 tggagcccct cctcccccgg ctgggcctcc ttcttccact tctccaagaa tggaagcctg4321 aactgaggcc ttgtgtgtca ggccctctgc ctgcactccc tggccttgcc cgtcgtgtgc4381 tgaagacatg tttcaagaac cgcatttcgg gaagggcatg cacgggcatg cacacggctg4441 gtcactctgc cctctgctgc tgcccggggt ggggtgcact cgccatttcc tcacgtgcag4501 gacagctctt gatttgggtg gaaaacaggg tgctaaagcc aaccagcctt tgggtcctgg4561 gcaggtggga gctgaaaagg atcgaggcat ggggcatgtc ctttccatct gtccacatcc4621 ccagagccca gctcttgctc tcttgtgacg tgcactgtga atcctggcaa gaaagcttga4681 gtctcaaggg tggcaggtca ctgtcactgc cgacatccct cccccagcag aatggaggca4741 ggggacaagg gaggcagtgg ctagtggggt gaacagctgg tgccaaatag ccccagactg4801 ggcccaggca ggtctgcaag ggcccagagt gaaccgtcct ttcacacatc tgggtgccct4861 gaaagggccc ttcccctccc ccactcctct aagacaaagt agattcttac aaggcccttt4921 cctttggaac aagacagcct tcacttttct gagttcttga agcatttcaa agccctgcct4981 ctgtgtagcc gccctgagag agaatagagc tgccactggg cacctgcgca caggtgggag

5041 gaaagggcct ggccagtcct ggtcctggct gcactcttga actgggcgaa tgtcttattt5101 aattaccgtg agtgacatag cctcatgttc tgtgggggtc atcagggagg gttaggaaaa5161 ccacaaacgg agcccctgaa agcctcacgt atttcacaga gcacgcctgc catcttctcc5221 ccgaggctgc cccaggccgg agcccagata cgggggctgt gactctgggc agggacccgg5281 ggtctcctgg accttgacag agcagctaac tccgagagca gtgggcaggt ggccgcccct5341 gaggcttcac gccgggagaa gccaccttcc caccccttca taccgcctcg tgccagcagc5401 ctcgcacagg ccctagcttt acgctcatca cctaaacttg tactttattt ttctgataga5461 aatggtttcc tctggatcgt tttatgcggt tcttacagca catcacctct ttgcccccga5521 cggctgtgac gcagccggag ggaggcacta gtcaccgaca gcggccttga agacagagca5581 aagcgcccac ccaggtcccc cgactgcctg tctccatgag gtactggtcc cttccttttg5641 ttaacgtgat gtgccactat attttacacg tatctcttgg tatgcatctt ttatagacgc5701 tcttttctaa gtggcgtgtg catagcgtcc tgccctgccc cctcgggggc ctgtggtggc5761 tccccctctg cttctcgggg tccagtgcat tttgtttctg tatatgattc tctgtggttt5821 tttttgaatc caaatctgtc ctctgtagta ttttttaaat aaatcagtgt ttacattaga5881 a

//

FASTA format

>gi|62362411|ref|NM_007313.2| Homo sapiens v-abl Abelson murine leukemia oncogene homolog 1 (ABL1), transcript variant b, mRNAGGTTGGTGACTTCCACAGGAAAAGTTCTGGAGGAGTAGCCAAAGACCATCAGCGTTTCCTTTATGTGTGAGAATTGAAATGACTAGCATTATTGACCCTTTTCAGCATCCCCTGTGAATATTTCTGTTTAGGTTTTTCTTCTTGAAAAGAAATTGTTATTCAGCCCGTTTAAAACAAATCAAGAAACTTTTGGGTAACATTGCAATTACA

TGAAATTGATAACCGCGAAAATAATTGGAACTCCTGCTTGCAAGTGTCAACCTAAAAAAAGTGCTTCCTTTTGTTATGGAAGATGTCTTTCTGTGATTGACTTCAATTGCTGACTTGTGGAGATGCAGCGAATGTGAAATCCCACGTATATGCCATTTCCCTCTACGCTCGCTGACCGTTCTGGAAGATCTTGAACCCTCTTCTGGAAAGGGGTACCTATTATTACTTTATGGGGCAGCAGCCTGGAAAAGTACTTGGGGACCAAAGAAGGCCAAGCTTGCCTGCCCTGCATTTTATCAAAGGAGCAGGGAAGAAGGAATCATCGAGGCATGGGGGTCCACACTGCAATGTTTTTGTGGAACATGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAG

DPS AIB 38


39/122


TATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGCCAGAGGTCCATCTCGCTGAGATACGAAGGGAGGGTGTACCATTACAGGATCAACACTGCTTCTGATGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCTGGACTACCTGAGGGAGTGCAACCGGCAGGAGGTGAACGCCGTGGTGCTGCTGTACATGGCCACTCAGATCTCGTCAGCCATGGAGTACCTGGAGAAGAAAAACTTCATCCACAGAGATCTTGCTGCCCGAAACTGCCTGGTAGGGGAGAACCACTTGGTGAAGGTAGCTGATTTTGGCCTGAGCAGGTTGATGACAGGGGACACCTACACAGCCCATGCTGGAGCCAAGTTCCCCATCAAATGGACTGCACCCGAGAGCCTGGCCTACAACAAGTTCTCCATCAAGTCCGACGTCTGGGCATTTGGAGTATTGCTTTGGGAAATTGCTACCTATGGCATGTCCCCTTACCCGGGAATTGACCTGTCCCAGGTGTATGAGCTGCTAGAGAAGGACTACCGCATGGAGCGCCCAGAAGGCTGCCCAGAGAAGGTCTATGAACTCATGCGAGCATGTTGGCAGTGGAATCCCTCTGACCGGCCCTCCTTTGCTGAAATCCACCAAGCCTTTGAAACAATGTTCCAGGAATCCAGTATCTCAGACGAAGTGGAAAAGGAGCTGGGGAAACAAGGCGTCCGTGGGGCTGTGAGTACCTTGCTGCAGGCCCCAGAGCTGCCCACCAAGACGAGGACCTCCAGGAGAGCTGCAGAGCACAGAGACACCACTGACGTGCCTGAGATGCCTCACTCCAAGGGCCAGGGAGAGAGCGATCCTCTGGACCATGAGCCTGCCGTGTCTCCATTGCTCCCTCGAAAAGAGCGAGGTCCCCCGGAGGGCGGCCTGAATGAAGATGAGCGCCTTCTCCCCAAAGACAAAAAGACCAACTTGTTCAGCGCCTTGATCAA

GAAGAAGAAGAAGACAGCCCCAACCCCTCCCAAACGCAGCAGCTCCTTCCGGGAGATGGACGGCCAGCCGGAGCGCAGAGGGGCCGGCGAGGAAGAGGGCCGAGACATCAGCAACGGGGCACTGGCTTTCACCCCCTTGGACACAGCTGACCCAGCCAAGTCCCCAAAGCCCAGCAATGGGGCTGGGGTCCCCAATGGAGCCCTCCGGGAGTCCGGGGGCTCAGGCTTCCGGTCTCCCCACCTGTGGAAGAAGTCCAGCACGCTGACCAGCAGCCGCCTAGCCACCGGCGAGGAGGAGGGCGGTGGCAGCTCCAGCAAGCGCTTCCTGCGCTCTTGCTCCGCCTCCTGCGTTCCCCATGGGGCCAAGGACACGGAGTGGAGGTCAGTCACGCTGCCTCGGGACTTGCAGTCCACGGGAAGACAGTTTGACTCGTCCACATTTGGAGGGCACAAAAGTGAGAAGCCGGCTCTGCCTCGGAAGAGGGCAGGGGAGAACAGGTCTGACCAGGTGACCCGAGGCACAGTAACGCCTCCCCCCAGGCTGGTGAAAAAGAATGAGGAAGCTGCTGATGAGGTCTTCAAAGACATCATGGAGTCCAGCCCGGGCTCCAGCCCGCCCAACCTGACTCCAAAACCCCTCCGGCGGCAGGTCACCGTGGCCCCTGCCTCGGGCCTCCCCCACAAGGAAGAAGCTGGAAAGGGCAGTGCCTTAGGGACCCCTGCTGCAGCTGAGCCAGTGACCCCCACCAGCAAAGCAGGCTCAGGTGCACCAGGGGGCACCAGCAAGGGCCCCGCCGAGGAGTCCAGAGTGAGGAGGCACAAGCACTCCTCTGAGTCGCCAGGGAGGGACAAGGGGAAATTGTCCAGGCTCAAACCTGCCCCGCCGCCCCCACCAGCAGCCTCTGCAGGGAAGGCTGGAGGAAAGCCCTCGCAGAGCCCGAGCCAGGAGGCGGCCGGGGAGGCAGTCCTGGGCGCAAAGACAAAAGCCACGAGTCTGGTTGATGCTGTGAACAGTGACGCTGCCAAGCCCAGCCAGCCGGGAGAGGGCCTCAAAAAGCCCGTGCTCCCGGCCACTCCAAAGCCACAGTCCGCCAAGCCGTCGGGGACCCCCATCAGCCCAGCCCCCGTTCCCTCCACGTTGCCATCAGCATCCTCGGCCCTGGCAGGGGACCAGCCGTCTTCCACCGCCTTCATCCCTCTCATATCAACCCGAGTGTCTCTTCGGAAAACCCGCCAGCCTCCAGAGCGGATCGCCAGCGGCGCCATCACCAAGGGCGTGGTCCTGGACAGCACCGAGGCGCTGTGCCTCGCCATCTCTAGGAACTCCGAGCAGATGGCCAGCCACAGCGCAGTGCTGGAGGCCGGCAAAAACCTCTACACGTTCTGCGTGAGCTATGTGGATTCCATCCAGCAAATGAGGAACAAGTTTGCCTTCCGAGAGGCCATCAACAAACTGGAGAATAATCTCCGGGAGCTTCAGATCTGCCCGGCGACAGCAGGCAGTGGTCCAGCGGCCACTCAGGACTTCAGCAAGCTCCTCAGTTCGGTGAAGGAAATCAGTGACATAGTGCAGAGGTAGCAGCAGTCAGGGGTCAGGTGTCAGGCCCGTCGGAGCTGCCTGCAGCACATGCGGGCTCGCCCATACCCGTGACAGTGGCTGACAAGGGACTAGTGAGTCAGCACCTTGGCCCAGGAGCTCTGCGCCAGGCAGAGCTGAGGGCCCTGTGGAGTCCAGCTCTACTACCTACGTTTGCACCGCCTGCCCTCCCGCACCTTCCTCCTCCCCGCTCCGTCTCTGTCCTCGAATTTTATCTGTGGAGTTCCTGCTCCGTGGACTGCAGTCGGCATGCCAGGACCCGCCAGCCCCGCTCCCACCTAGTGCCCCAGACT

GAGCTCTCCAGGCCAGGTGGGAACGGCTGATGTGGACTGTCTTTTTCATTTTTTTCTCTCTGGAGCCCCTCCTCCCCCGGCTGGGCCTCCTTCTTCCACTTCTCCAAGAATGGAAGCCTGAACTGAGGCCTTGTGTGTCAGGCCCTCTGCCTGCACTCCCTGGCCTTGCCCGTCGTGTGCTGAAGACATGTTTCAAGAACCGCATTTCGGGAAGGGCATGCACGGGCATGCACACGGCTGGTCACTCTGCCCTCTGCTGCTGCCCGGGGTGGGGTGCACTCGCCATTTCCTCACGTGCAGGACAGCTCTTGATTTGGGTGGAAAACAGGGTGCTAAAGCCAACCAGCCTTTGGGTCCTGGGCAGGTGGGAGCTGAAAAGGATCGAGGCATGGGGCATGTCCTTTCCATCTGTCCACATCCCCAGAGCCCAGCTCTTGCTCTCTTGTGACGTGCACTGTGAATCCTGGCAAGAAAGCTTGAGTCTCAAGGGTGGCAGGTCACTGTCACTGCCGACATCCCTCCCCCAGCAGAATGGAGGCAGGGGACAAGGGAGGCAGTGGCTAGTGGGGTGAACAGCTGGTGCCAAATAGCCCCAGACTGGGCCCAGGCAGGTCTGCAAGGGCCCAGAGTGAACCGTCCTTTCACACATCTGGGTGCCCTGAAAGGGCCCTTCCCCTCCCCCACTCCTCTAAGACAAAGT

DPS AIB 39


40/122


AGATTCTTACAAGGCCCTTTCCTTTGGAACAAGACAGCCTTCACTTTTCTGAGTTCTTGAAGCATTTCAAAGCCCTGCCTCTGTGTAGCCGCCCTGAGAGAGAATAGAGCTGCCACTGGGCACCTGCGCACAGGTGGGAGGAAAGGGCCTGGCCAGTCCTGGTCCTGGCTGCACTCTTGAACTGGGCGAATGTCTTATTTAATTACCGTGAGTGACATAGCCTCATGTTCTGTGGGGGTCATCAGGGAGGGTTAGGAAAACCACAAACGGAGCCCCTGAAAGCCTCACGTATTTCACAGAGCACGCCTGCCATCTTCTCCCCGAGGCTGCCCCAGGCCGGAGCCCAGATACGGGGGCTGTGACTCTGGGCAGGGACCCGGGGTCTCCTGGACCTTGACAGAGCAGCTAACTCCGAGAGCAGTGGGCAGGTGGCCGCCCCTGAGGCTTCACGCCGGGAGAAGCCACCTTCCCACCCCTTCATACCGCCTCGTGCCAGCAGCCTCGCACAGGCCCTAGCTTTACGCTCATCACCTAAACTTGTACTTTATTTTTCTGATAGAAATGGTTTCCTCTGGATCGTTTTATGCGGTTCTTACAGCACATCACCTCTTTGCCCCCGACGGCTGTGACGCAGCCGGAGGGAGGCACTAGTCACCGACAGCGGCCTTGAAGACAGAGCAAAGCGCCCACCCAGGTCCCCCGACTGCCTGTCTCCATGAGGTACTGGTCCCTTCCTTTTGTTAACGTGATGTGCCACTATATTTTACACGTATCTCTTGGTATGCATCTTTTATAGACGCTCTTTTCTAAGTGGCGTGTGCATAGCGTCCTGCCCTGCCCCCTCGGGGGCCTGTGGTGGCTCCCCCTCTGCTTCTCGGGGTCCAGTGCATTTTGTTTCTGTATATGATTCTCTGTGGTTTTTTTTGAATCCAAATCTGTCCTCTGTAGTATTTTTTAAATAAATCAGTGTTTACATTAGAA

Protein sequence of ABL

Gen bank format

LOCUS NP_009297 1149 aa linear PRI 03-JUN-2007DEFINITION v-abl Abelson murine leukemia viral oncogene homolog 1 isoform b

[Homo sapiens].ACCESSION NP_009297VERSION NP_009297.2 GI:62362412DBSOURCE REFSEQ: accession NM_007313.2KEYWORDS .SOURCE Homo sapiens (human)ORGANISM Homo sapiens

Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;Catarrhini; Hominidae; Homo.

REFERENCE 1 (residues 1 to 1149)AUTHORS Jiang,X., Saw,K.M., Eaves,A. and Eaves,C.TITLE Instability of BCR-ABL gene in primary and cultured chronic myeloid

leukemia stem cellsJOURNAL J. Natl. Cancer Inst. 99 (9), 680-693 (2007)PUBMED 17470736REMARK GeneRIF: Primary and cultured chronic myeloid leukemia stem

cellsdisplay instability of the BCR-ABL fusion gene both in vivoand in vitro.

REFERENCE 2 (residues 1 to 1149)AUTHORS Rodrigues,M.S. and Sattler,M.

TITLE Chronic myelogenous leukemia progenitors display a geneticallyunstable personalityJOURNAL J. Natl. Cancer Inst. 99 (9), 662-663 (2007)PUBMED 17470729REMARK GeneRIF: Acute myelogenous leukemia patients respond to imatinib

mesylate only when BCR-ABLE kinase is inhibited.REFERENCE 3 (residues 1 to 1149)AUTHORS Sherbenou,D.W., Wong,M.J., Humayun,A., McGreevey,L.S., Harrell,P.,

Yang,R., Mauro,M., Heinrich,M.C., Press,R.D., Druker,B.J. andDeininger,M.W.

DPS AIB 40
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_007313.2http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470736http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470729http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_007313.2http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470736http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&query_hl=1&list_uids=17470729


41/122


TITLE Mutations of the BCR-ABL-kinase domain occur in a minority ofpatients with stable complete cytogenetic response to imatinib

JOURNAL Leukemia 21 (3), 489-493 (2007)PUBMED 17252009REMARK GeneRIF: BCR-ABL-kinase domain mutations in patients with a stable

CCR are infrequent, and their detection does not consistentlypredict relapse. Alternative mechanisms must be responsible fordisease persistence in the majority of patients.

REFERENCE 4 (residues 1 to 1149)AUTHORS Wissing,J., Jansch,L., Nimtz,M., Dieterich,G., Hornberger,R.,

Keri,G., Wehland,J. and Daub,H.TITLE Proteomics analysis of protein kinases by target class-selective

prefractionation and tandem mass spectrometryJOURNAL Mol. Cell Proteomics 6 (3), 537-547 (2007)PUBMED 17192257

REFERENCE 5 (residues 1 to 1149)AUTHORS Bartos,J.D., Gaile,D.P., McQuaid,D.E., Conroy,J.M., Darbary,H.,

Nowak,N.J., Block,A., Petrelli,N.J., Mittelman,A., Stoler,D.L. andAnderson,G.R.

TITLE aCGH local copy number aberrations associated with overall copy

number genomic instability in colorectal cancer: coordinateinvolvement of the regions including BCR and ABLJOURNAL Mutat. Res. 615 (1-2), 1-11 (2007)PUBMED 17196995REMARK GeneRIF: a system akin to the BCR-ABL translocation of CML may be

involved in genomic instability in about one-third of colorectalcarcinomas

COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. Thereference sequence was derived from CA335983.1, AL707819.1,

AB209456.1 and AA524892.1.On Apr 7, 2005 this sequence version replaced gi:6382058.

Summary: The ABL1 protooncogene encodes a cytoplasmic and nuclearprotein tyrosine kinase that has been implicated in processes ofcell differentiation, cell division, cell adhesion, and stressresponse. Activity of c-Abl protein is negatively regulated by itsSH3 domain, and deletion of the SH3 domain turns ABL1 into anoncogene. The t(9;22) translocation results in the head-to-tailfusion of the BCR (MIM:151410) and ABL1 genes present in many casesof chronic myelogeneous leukemia. The DNA-binding activity of theubiquitously expressed ABL1 tyrosine kinase is regulated byCDC2-mediated phosphorylation, suggesting a cell cycle function forABL1. The ABL1 gene is expressed as either a 6- or 7-kb mRNAtranscript, with alternatively spliced first exons spliced to thecommon exons 2-11.

Transcript Variant: Transcript variant b includes exon 1b, but not

exon 1a, resulting in a different N-terminus. This variant containsan N-terminal glycine which could be myristylated and is thuspostulated to be directed to the plasma membrane.

Publication Note: This RefSeq record includes a subset of thepublications that are available for this gene. Please see theEntrez Gene record to access additional publications.

FEATURES Location/Qualifierssource 1..1149

/organism="Homo sapiens"

DPS AIB 41
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pu

project on molecular targeting against leukemia

Documents