RESEARCH ARTICLE

Production and secretion of Aspergillus nidulans catalase Bin filamentous fungi driven by the promoter and signal peptideof the Cladosporium fulvum hydrophobin gene hcf-1

Received: 12 May 2003 / Revised: 13 June 2003 / Accepted: 20 June 2003 / Published online: 4 September 2003� Springer-Verlag 2003

Abstract We describe here the use of sequences from thehydrophobin gene hcf-1 of Cladosporium fulvum toconstruct pCatBex, a vector for high-level expressionand secretion of CatB, a catalase from Aspergillusnidulans. Transformation of C. fulvum with pCatBexresults in a 60-fold increase in the mycelial activity in thefungus and the appearance of up to 5.4 mkat/l of cata-lase in the growth medium. The levels of catalase in thesupernatant increased dramatically following removal ofnitrogen from the medium. Conversely, the overall spe-cific activity of catalase in the cytoplasm did not changeappreciably. This indicates that nitrogen depletioninduces greater secretion of protein. The vector pCatBexalso directs the expression and secretion of CatB inMagnaporthe grisea and may be a useful vector for theexpression of genes in other filamentous fungi.

Keywords Catalase Æ Expression Æ Secretion

Introduction

Fungi have a well established potential for the produc-tion and secretion of recombinant proteins (Punt et al.2002). This fact is exploited in biotechnological appli-cations and in the investigation of fundamental aspects

of fungal biology. In order to express recombinantproteins, it is necessary to clone the required genedownstream of suitably active regulatory elements andto introduce these into the fungi by transformation. Ifsecretion is required, the genes need appropriate signalsto target the proteins to the secretory pathway and,ultimately, out of the cell (Radzio and Kuck 1997;Conesa et al. 2001).

Hydrophobins are proteins considered ubiquitous infilamentous fungi (Wessels 2000; Wosten 2001). Theirroles are diverse and they mediate interactions with thephysical environment and host animals or plants(Whiteford and Spanu 2002). In many of the beststudied cases, each fungus has various hydrophobingenes and the different genes can have dissimilar func-tions. All of the hydrophobins so far investigated aresecreted and some become integral components of thecell wall in the conidia and in multicellular structures,such as basidiomycete fruiting bodies (Wosten 2001;Whiteford and Spanu 2002). Hydrophobins are oftensome of the most abundant proteins produced by fungiand this is reflected by the abundance of their mRNA atdifferent stages in the life cycle (Spanu 1997; Segers et al.1999).

HCf-1 was the first hydrophobin to be isolated fromthe tomato pathogen Cladosporium fulvum (Spanu1997). It is present in the cell walls of hyphae and con-idia, where it contributes significantly to the formationof the typical rodlets commonly found on conidia. Thisprotein is also plentiful in the growth medium. We havedemonstrated that HCf-1 is important in the water-mediated dispersal of conidia (Whiteford and Spanu2001). hcf-1 mRNA is abundant at most stages ofdevelopment and this suggests a high level of geneexpression. The hcf-1 gene has a canonical N-terminalsignal peptide, as expected in a protein that is secreted(Segers et al. 1999).

In a related project, we are evaluating the function ofH2O2 in plant disease resistance (Johnson et al.,unpublished data). In order to do so, we wantedto enhance the tolerance of C. fulvum to H2O2 by

Curr Genet (2003) 44: 155–163DOI 10.1007/s00294-003-0421-4

Hannah Johnson Æ James R. Whiteford

Sabine E. Eckert Æ Pietro D. Spanu

Communicated by U. Kuck

H. Johnson Æ J. R. Whiteford Æ S. E. Eckert Æ P. D. Spanu (&)Department of Biological Sciences,Imperial College London,Sir Alexander Fleming Building,Imperial College Road,London, SW7 2AZ, UKE-mail: p.spanu@imperial.ac.ukTel.: +44-20-75945384Fax: +44-20-75842056

Present address: S. E. EckertDepartment of Biosciences,University of Kent at Canterbury,Canterbury, Kent, CT2 7NY, UK

increasing the overall levels of catalase. Catalases areenzymes that catalyse the conversion of H2O2 tomolecular oxygen and water. C. fulvum has a number ofcatalase isoforms, although no extracellular activity hasbeen detected (Bussink and Oliver 2001). We thereforereasoned that production and secretion of a re-combinant catalase might achieve the most effectiveenhancement of tolerance.

In this paper, we report on the construction andcharacterisation of a novel cassette for the expressionand secretion of heterologous proteins in filamentousfungi, based on sequences derived from the hcf-1 gene, ahighly expressed hydrophobin from the plant pathogenicfungus C. fulvum (Spanu 1997). We produced the plas-mid vector pCatBex, which contains catB from Asper-gillus nidulans inserted into the hcf-1 cassette.Transformation of C. fulvum and Magnaporthe griseawith pCatBex resulted in strains with a large increase inthe overall activity and presence of catalase in thegrowth medium. This demonstrates that elements of hcf-1can be used efficiently for the expression and secretion ofheterologous proteins in C. fulvum. Functionality inM. grisea suggests that it might also be used in otherfilamentous Ascomycetes.

Materials and methods

Strains and growth conditions

Escherichia coli XL-1 Blue (Stratagene) was used throughout forcloning, maintenance and production of the recombinant plasmidDNA for fungal transformation. The bacteria were grown andmaintained on LB medium, using standard microbiological tech-niques (Sambrook et al. 1987). C. fulvum race 4 was donated by Dr.J. Scholes (Sheffield, UK) and maintained on solid potato/dextroseagar medium. Liquid cultures were grown in B5 medium (Gamborget al. 1968) as described by Segers et al. (1999). M. grisea (strainGuy-11) was obtained from Prof. N. Talbot (Exeter, UK) andmaintained on minimal medium (Talbot et al. 1993). Liquid cul-tures were grown in complete medium unless otherwise stated.

Nucleic acid manipulation and construction of pCatBex

DNA manipulations were carried out using standard techniques(Sambrook et al. 1987). pCatBex was constructed by combiningDNA sequences from hcf-1 (Spanu 1997), catB amplified fromgenomic DNA from A. nidulans, a hygromycin resistance cassettefrom pAN7-1 (Punt et al. 1987) and a plasmid backbone derivedfrom pBluescript KS()) (Stratagene). An overview of the genesisof pCatBex is shown in Fig. 1. A genomic DNA fragment con-taining the hcf-1 gene (ca. 3.8 kb/BamHI) from pHph-CosA

Fig. 1 Map of pCatBex and adiagrammatic summary of itsorigin. Details of plasmidconstruction and cloning aregiven in the Materials andmethods. catB is the catalasederived from Aspergillusnidulans. CatBRS-I, CatBRS-II,HcfRS-1 and HcfRS-II areoligonucleotides used for PCR-amplification. hcf-1 is ahydrophobin gene fromCladosporium fulvum. Phcf-1 andThcf-1 are the promoter andterminator sequences,respectively, of hcf-1. Pgdp, hygand TtrpC are the components ofthe hygromycin resistancecassette derived from pAN7-1(Punt et al. 1987). Sizes are notto scale but show the relativeposition of the components andthe restriction sites used incloning

156

(Spanu 1997) was cloned into pBluescript KS()) to yield pHCf1-3.8. From this plasmid, we used PCR to obtain a DNA fragmentcontaining the vector sequences, hcf-1 promoter, signal peptideand terminator sequences. The primers used for this purposeadded a BglII and a NdeI site (in italics) at the ends of the PCRproduct (HcfRS-I: GAAGATCTGTCATCACGGCG; HcfRS-II:GGAATTCCATATGGCCGCGCGATGC). The coding regionof catB was amplified by PCR, using two primers that included aBglII and an NdeI site (in italics) at the 5¢ and 3¢ end, respec-tively, of the sequence (CatBRS-I: GAAGATCTGTCTGTCCGTAT; CatBRS-II: GGAATTCCATATGCTATTCATCCGA).The two fragments were digested with BglII and NdeI and li-gated: this created an in-frame fusion between the signal sequenceof hcf-1 and the catB gene. The plasmid (pCatBHCfV) was se-quenced to confirm that the expected fusion was obtained(Fig. 2).

In order to insert a hygromycin selection cassette that is func-tional in filamentous fungi, we first cloned the BglII/HindIII frag-ment of pAN7-1 (Punt et al. 1987) into the BamHI/HindIII sites ofpBluescript KS()), creating the pBS-Hyg plasmid. pBS-Hyg wasdigested with NotI and StuI and this vector was then ligated intothe NotI/SmaI fragment from pCatBHCfV that included the hcf-1/catB chimaera. The resulting plasmid, pCatBex, was used fortransformation of C. fulvum and M. grisea.

Fungal transformation

C. fulvum was transformed as described by Hamada and Spanu(1998). We used circular pCatBex to transform C. fulvum protop-lasts. M. grisea was transformed according to Talbot et al. (1993)with the following modifications: liquid cultures were set up byblending an agar plate culture (2.5 cm2) into 100 ml completemedium. These were grown for 2–3 days at 24 �C in the dark, on arotary shaker at 160 rpm. Protoplasting in OM buffer (1.2 MMgSO4, 10 mM sodium phosphate pH 5.8) was carried out at 30 �Cwith 10 mg/ml Glucanex (Novozymes, Dittingen, Switzerland),shaking at 120 rpm for 30 min and then at 60 rpm for 90 min. Fortransformations, approximately 2·107 protoplasts in 150 ll STCbuffer (1.2 M sorbitol, 10 mM Tris-HCl, pH 7.5, 10 mM CaCl2)were incubated with 10 lg circular plasmid for 20 min. Then 250 ll,250 ll and 500 ll polyethylene glycol (PEG; 40% PEG 4000, 1 Msorbitol, 10 mM Tris-HCl, pH 7.5, 10 mM CaCl2) were sequen-tially added and mixed with the protoplasts. After 20 min incuba-tion, protoplasts were collected by centrifugation at 1,000 g, thePEG solution was discarded and the cells were taken up in 1.5 mlYGS medium (0.5% yeast extract, 2% glucose, 1.2 M sorbitol).They were shaken overnight at room temperature and 15 rpm, thenmixed with 20 ml molten minimal medium agar containing 1.2 Msorbitol and poured into Petri dishes. After 24 h incubation, theywere overlaid with minimal medium containing 1.2 M sorbitol and200 lg/ml hygromycin (Calbiochem, LaJolla, Calif.). Transforma-tion plates were incubated at 24 �C in a 14 h light/10 h dark cyclefor 1–3 weeks. Single colonies were isolated onto minimal mediumcontaining 100 lg/ml hygromycin.

Extraction and analysis of nucleic acids

Total RNA was extracted from both C. fulvum andM. grisea, usingthe Qiagen RNeasy Kit according to the manufacturer¢s instruc-tions. RNA blots were prepared as described by Sambrook et al.(1987). Fungal genomic DNA was extracted as described by Fultonet al. (1995). The DNA was analysed by Southern hybridisation,using standard methods as described by Spanu (1997), except thatwe used the ‘‘PerfectHyb Plus’’ buffer (H-7033; Sigma) forhybridisation of the nucleic acids.

Enzyme assays

Cell extracts were prepared by grinding the fungi in 50 mMphosphate buffer (PB), pH 7.0. The extracts were then centri-fuged at 18,000 g for 20 min at 4 �C and the supernatants takenfor assay. In order to assay the catalase in the culture superna-tant, we harvested 25 ml liquid growth medium after culture on arotary shaker at 25 �C. The medium was filtered through onelayer of Miracloth (Calbiochem) and freeze-dried. The residueswere re-suspended in 3 ml PB and desalted through polyacryl-amide columns (Econo-Pac 732-2010; BioRad) equilibrated withPB.

Catalase activity was determined by adapting a protocoldescribed by Aebi (1984): 120 ll diluted extract was mixed with120 ll 30 mM H2O2 and the decrease in absorbance at 240 nmwas measured for 80 s (at 20 �C). The samples were diluted in PBto obtain a decrease in absorbance of not more than 0.25 units/min.

Protein concentrations in the fungal extracts were determinedusing the Bradford reagent protein assay (BioRad) using bovineserum albumin as a standard (Bradford 1976).

Gel electrophoresis and in-gel catalase assay

The fungal extracts were analysed by non-denaturing Tris-glycinepolyacrylamide gel electrophoresis, using a procedure modifiedfrom the one described by Sambrook et al. (1987). Electropho-resis was carried out through a stacking gel (5%, pH 6.8) and aseparating gel (6%, pH 8.8) in Tris (25 mM) and glycine(200 mM) buffer at pH 8.3. The electrophoresis was run forabout 15 h at 4 �C and 150 V in a Protean IIXi Cell (BioRad).The gels were then rinsed briefly with water, transferred to100 ml PB containing 5 mg horseradish peroxidase (39033-2L;Merck–BDH) and incubated at room temperature for 45 min.After this, 80 ll 30% H2O2 was added and the gel was incubatedfor another 10 min. The gel was then rinsed twice in water andincubated in 100 ml PB containing 50 mg 3,3’- diaminobenzidine(DAB) (D-5637; Sigma) until a brown colour developed in thegel. The presence of bands of catalase could be visualised byclear patches of gel with no oxidised diaminobenzidine product(Clare and Duong 1984).

Fig. 2 Sequence of the junctionbetween the HCf-1 signalpeptide and propeptide (shaded)and the N-terminus of the CatBcatalase (dashed line). Cloningresults in a mutation (serine toarginine) of the third aminoacid in the predicted matureprotein, as shown by the arrow.The neural network programSignalP-predicted cleavage siteis marked by an asterisk

157

Results

The plasmid expression vector pCatBex was created bycombining elements from the hydrophobin gene hcf-1from C. fulvum, the coding region of the A. nidulans catBcatalase and a hygromycin selection cassette. An over-view of the cloning and plasmid construction is shown inFig. 1. The cloning strategy resulted in an in-frame genefusion of the catB gene immediately downstream of theputative hcf-1 signal sequence; and the mature re-combinant catalase was predicted to include four aminoacids at the N-terminus that were derived from hcf-1.The third amino acid mutated from a serine to anarginine, as shown in Fig. 2. The sequence of the plas-mid obtained was verified experimentally and matchedthe expected sequence. The N-terminal sequence of themature catalase was not determined experimentally.

pCatBex contains a hygromycin resistance cassettederived from pAN7-1 (Punt et al. 1987). This cassettehas been used extensively for transformation of C. ful-vum (Oliver et al. 1987; Spanu 1998). We introducedpCatBex into C. fulvum by DNA-mediated transforma-tion. A number of independent transformations werecarried out. Initially, hygromycin-resistant colonies werescreened for the presence of functional CatB by gelelectrophoresis and in-gel catalase assay (data notshown). Following the observation that, in the presenceof H2O2, the CatB-positive isolates displayed a notable‘‘Fizzy’’ phenotype, we then screened transgenic coloniesby placing small pieces (2–3 mm in diameter) of myce-lium into a 0.75% solution of H2O2. The catalase re-leased into the medium by some of the transformedstrains was sufficient to break down H2O2 and releasemolecular oxygen, which was then visible as abundantbubbles in the solution (data not shown). We named theC. fulvum isolates with the Fizzy phenotype Cfzz.

We characterised the strains of three separate trans-formations (D1–D4, F1–F6, G4). DNA from isolateswas analysed by Southern-blot hybridisation and theSouthern-blot was probed with a catB-specific probe(Fig. 3). This probe did not hybridise with any genepresent in the wild-type C. fulvum. Most of the hygro-mycin-resistant strains tested had DNA derived from thetransforming plasmid. Transformants showed hybridis-ing bands of different sizes. The majority of transfor-mants had only one DNA band that hybridised stronglyto the probe and a few bands of DNA that hybridisedweakly. One strain had two strongly hybridising bandsand two strains showed no positive signal.

The catalase activity extracted from mycelia grown inliquid cultures was assayed spectrophotometrically(Fig. 4A) and by non-denaturing gel electrophoresisfollowed by in-gel staining to detect catalase (Fig. 4B).The specific activity of catalase in wild-type C. fulvumwas about 0.1 nkat/lg protein. The activity of the Cfzz+

strains was up to 6 nkat/lg protein. The Cfzz) strainshad levels of activity that were comparable with wild-type C. fulvum. Preliminary electrophoretic analysis

followed by in-gel assays of mycelial activity suggestedthat the wild type has at least four different isoforms.One major band and three minor bands were visible inthe in-gel assays (data not shown). When 55 lg proteinwas loaded onto the non-denaturing gel (Fig. 4B), onlythe major band of activity could be observed at the topof the gel. A broad band of activity was evident in theextracts from the Cfzz+ strains; and this band had ahigher mobility than the endogenous catalase. An evenfaster-migrating band of activity (of lower intensity) wasevident in the Cfzz+ extracts.

We were able to measure very little or no activity inthe culture medium (supernatant) of wild-type C. fulvum(Fig. 5A). In contrast, the supernatants from Cfzz+

strains had catalase activities ranging from 25 nkat/lgprotein to about 160 nkat/lg protein. The supernatantsfrom Cfzz) strains had little or no activity. The gelelectrophoresis and in-gel assays showed that most ofthe activity was due to a single abundant band (Fig. 5B).Some supernatants from the Cfzz) had detectable levelsof a catalase with the same electrophoretic mobility asthat found in supernatants from the Cfzz+ isolates.

To test whether carbon- or nitrogen-limitationdetermines changes in the production of CatB, we grewthe Cfzz+ strain F4 in B5 liquid medium for 2 days andthen transferred the mycelium to carbon-, nitrogen-, orcarbon- and nitrogen-depleted medium. We thenmeasured catalase activity in the mycelium and thesupernatant (Fig. 6). In wild-type mycelium, endoge-nous catalase activity was only marginally higherfollowing transfer to nutrient-poor medium and levelswere similar to those measured in previous experiments(0.1–0.15 nkat/lg). Very low total levels of catalaseactivity were measured in wild-type culture supernatant(0.4 nkat/lg), a similar specific activity to that found inthe mycelial fractions. In the strain F4, starvation re-sulted in a slight increase in the catalase activity of themycelium. In the culture supernatant from F4, very little

Fig. 3 Southern analysis of C. fulvum transformed with pCatBex.Genomic DNA from wild-type (Wt) and transformed strains (D1–D4, F1–F6, G4) was digested with BglII, fractionated in an agarosegel and blotted onto a membrane. The blot was probed with a 700-bp catB fragment generated by PCR. The position of molecularmass markers is shown on the left. The Fizzy phenotype of eachisolate is shown below the lane, with the strain name shown above it

158

activity was measured in full B5 medium (0.09 nkat/lg),or in B5 medium lacking carbon (2.89 nkat/lg). Therewas, however, catalase activity in culture supernatantlacking nitrogen (130 nkat/lg) and that lacking bothcarbon and nitrogen (40 nkat/lg). There was no changein the total protein content in the medium followingnutrient limitation.

We used pCatBex to transform M. grisea and testedhygromycin-resistant colonies for the presence of theFizzy phenotype, as described for C. fulvum. Nine iso-lates were selected for further characterisation of their

catalase activity (Fig. 7). The specific activity of wild-type M. grisea mycelium was 0.049 nkat/lg protein. Theactivity of the transgenic strains generally reflected thedegree of Fizzy phenotype. Three transgenic strains withno Fizzy phenotype had similar activity to the wild-type.Six strains with a Fizzy phenotype had catalase activityof 0.16–3.70 nkat/lg. The catalase in culture superna-tants of M. grisea had to be measured in minimalmedium, as the brown pigment present in the completemedium was not removed by desalting and interferedwith the enzyme assay. We selected five strains to test theactivity in the culture supernatant. We measured0.25 nkat/lg in the supernatant of the wild type. Theactivity in the culture supernatants of transgenic strainsreflected what we measured in the mycelium. Strain 17,

Fig. 4A, B Catalase activity in the mycelium of C. fulvumtransformed with pCatBex. Wild-type and transgenic C. fulvumwere grown for 3 days in 100 ml B5 medium (see Materials andmethods) on rotary platforms at 25 �C. The activity of whole cellextracts was assayed. A The values represent the mean andstandard error of the specific enzyme activity measured in twoindependent measurements. B The extracts were analysed by non-denaturing gel electrophoresis; and in-gel catalase assays wereperformed. The image is a computer-generated negative of the 3,3¢-diaminobenzidine (DAB)-stained gel. The arrow indicates themajor endogenous catalase

Fig. 5A, B Catalase secreted in the growth medium. Wild-type andtransgenic C. fulvum were grown for 3 days in 100 ml B5 mediumon rotary platforms at 25 �C. The growth medium was harvestedand prepared for assay as described in the Materials and methods.A The values represent the mean and standard error of the specificenzyme activity measured in three independent measurements.B The extracts were analysed by non-denaturing gel electrophore-sis; and in-gel catalase assays were performed. The inverted colourimage shows the DAB-stained gel

159

which displayed no Fizzy phenotype, had activity of0.09 nkat/lg. Three strains with Fizzy phenotype hadactivity of 2.2–3.7 nkat/lg and one strain (36) had amuch higher specific activity (21 nkat/lg). The RNAblot analysis showed that the strain that produced thehighest amounts of catalase also had the highest levels ofcatB RNA. No RNA from the wild-type M. grisea hy-bridised to the catB probe. The band hybridising withthe catB probe for strain 7 migrated faster than the otherbands; and, although this may indicate that the mRNAis truncated, it did not appear to affect the overall levelsof catalase activity measured in this isolate.

Discussion

HCf-1 is an abundant hydrophobin found in the med-ium of C. fulvum grown in liquid culture. The high levelsof HCf-1 protein correlate with high levels of expressionof hcf-1 mRNA (Spanu 1997; Segers et al. 1999). Theregulatory sequences driving hcf-1 transcription andprocessing are therefore likely to be suitable candidatesfor creating novel expression and secretion vectors activein C. fulvum and other filamentous Ascomycetes. Wefused sequences from the hcf-1 gene to the coding por-tion of the catB gene from A. nidulans. We chose to use aheterologous catalase as opposed to one of the catalasesidentified in C. fulvum as this facilitates screening forpositive transformants with little or no interference by

the endogenous genes. The recombinant gene obtainedin pCatBex includes the promoter of hcf-1, with itscognate transcription initiation sites (Spanu 1997) andthe signal sequence, which presumably targets HCf-1 tothe general secretory pathway and into the extracellularmilieu (Segers et al. 1999). The neural network programSignalP (Nielsen et al. 1997) predicted cleavage of thesignal peptide is between ASA and RV. The experi-mentally determined N-terminus of the mature HCf-1protein is five amino acids downstream of this position(Spanu 1997). In order to ensure correct targeting andprocessing, we included four amino acids of the matureHCf-1 protein. As a result of the cloning procedure, thethird amino acid was mutated from serine to arginine.The neural network program SignalP predicted that thismutation would not cause any significant alteration inthe processing of the signal peptide (data not shown).The CatB sequence begins with a valine, i.e. five aminoacids after the N-terminus of the mature protein. Asthere is a large heterogeneity in catalases in this region(Fowler et al. 1993), we did not expect that these minoralterations to the catalase enzyme would cause signifi-cant disruptions to the enzymatic activity. pCatBexcontains a hygromycin resistance cassette; and thisenabled us to select transformants using the antibiotic.

Southern hybridisation analysis of DNA showed thatall of the transgenic strains have single insertions ofpCatBex at different positions in the genomic DNA,with the exception of strain G4 which appears to have

Fig. 6 Effect of starvation onsecretion of CatB. Liquidcultures were grown for 2 daysin B5 medium. The myceliumwas then washed andtransferred to fresh B5, B5lacking carbon source (no C),B5 lacking nitrogen source (noN), or B5 lacking both carbonand nitrogen (no C N). After16 h, the catalase activity wasmeasured in the mycelium andculture supernatant. The valuesrepresent the mean andstandard error of the specificenzyme activity measured infour independent measurements

160

two DNA bands which hybridise to the probe. We dis-regarded the presence of DNA bands in some of thetransformants that hybridise to a much weaker extent tothe probe. We are not sure what the origin of thesemight be, but we believe this does not affect the inter-pretation of the results. We developed a rapid assay totest whether the hygromycin-resistant transformantshad increased catalase activity. Small portions of the

mycelium from some of these isolates grown on solidmedium catalysed the breakdown of H2O2, which re-sulted in an easily observable effervescence (¢¢fizz¢¢) of thesolution. We therefore named the transformants dis-playing the phenotype Cfzz (for C. fulvum Fizzy). TheFizzy phenotype correlated very well with elevated levelsof catalase in the mycelium: the overall activity was upto about 60-fold higher, compared with the endogenousactivity of the wild-type C. fulvum. In-gel assays of thecatalase showed clearly that a new enzyme is producedby the Cfzz+ transformants which does not influencesignificantly the levels of the endogenous catalase. Theactivity of the transgenic catalase is visible as a domi-nant band that migrates more rapidly than the mainendogenous catalase of C. fulvum. A band of highermobility but of lower intensity is visible in all the ex-tracts from Cfzz+ strains. We speculate that this couldbe the result of a secondary modification or a partialproteolytic degradation of CatB in C. fulvum. Furtherexperiments, including comparative analysis of wild-typeCatB from A. nidulans, might be required to clarify thispoint.

Previous results showed that C. fulvum has a numberof catalase genes (Bussink and Oliver 2001). None ofthese appear to be secreted, as they do not havecanonical signal peptides/secretion signals (R.P. Oliver,personal communication). This finding is corroboratedby our observations: we were unable to find any evi-dence of extracellular catalase under any of the condi-tions tested. Sometimes we detected catalase activity inthe supernatants of wild-type C. fulvum, but the very lowlevels had specific activities similar to cytoplasmic frac-tions. This enzyme activity is probably due to smallamounts of cell lysis during culture or harvesting ofsamples. We show here that the introduction of pCatBexresults in effective secretion of the catalase into thegrowth medium. The specific enzymatic activity in theCfzz+ strains was up to 160 nkat/lg protein. Thisequates to about 0.4 mg catalase/l supernatant. Thespecific activity in Cfzz+ culture supernatant was50 times higher than that measured in the mycelium.This observation confirms that the enzyme is beingactively secreted rather than released into the medium bybreakdown and lysis of the hyphae. There is agood correlation between the levels of catalase in the

Fig. 7A–C Catalase activity of Magnaporthe grisea strains trans-formed with pCatBex. A Mycelium. M. grisea was grown in liquidculture for 3 days in 100 ml complete medium on rotary platformsat 25 �C. The activity of whole-cell extracts was assayed. Thevalues represent the mean and standard error of the specific enzymeactivity measured in two independent measurements. B Superna-tant. Mycelium of five transgenic strains was grown for 3 days incomplete medium and then transferred to minimal medium for16 h, after which the catalase activity in the supernatant wasmeasured. The values represent the mean and standard error of thespecific enzyme activity measured in two independent measure-ments. C The RNA blot (top) was probed with a 700-bp catBfragment generated by PCR. The total amount of RNA loaded ineach lane was monitored by ethidium bromide staining of the RNAin the gel (bottom)

b

161

mycelium and the culture supernatant. This is notabsolute: for example, strain G4 had the highest levels ofcatalase in the mycelium but its secreted activity ap-peared to be not very different from D1 or F3. Thesemeasurements were supported by the in-gel assays: asingle strong band was evident in the Cfzz+ strains anda weaker, but clear band was visible also in the extractsfrom D2, F2 and F5, the Cfzz) strains with very lowlevels of extracellular catalase. There was a significantvariation in the overall catalase activities between dif-ferent experiments. This variation is reflected in therelatively large error bars shown in the figures.

Carbon- and nitrogen-starvation had previously beenshown to increase expression of hcf-1 (Segers et al.1999); and we therefore tested whether CatB productionwould increase under similar conditions. Carbon- andnitrogen-limitation made a small difference to theendogenous catalase and CatB levels measured in themycelium. The levels of CatB in the mycelium correlatewith the response of hcf-1 mRNA expression to nutrientlimitation (Segers et al. 1999). In contrast to this,nitrogen-starvation resulted in a striking increase inCatB activity in F4 culture supernatant. The levels weresimilar to those measured for F4 in previous experiments(Fig. 5). The CatB activity in the mycelium did not varymore than 2-fold in all conditions tested, but the amountof secreted CatB was dramatically higher in mediumlacking nitrogen. We interpret this to mean that nitro-gen-starvation causes an increase in the secretion ofCatB and that the modest increase in the expression ofcatB might be only a minor component of this. Thereason that we measured such high catalase activity inthe supernatants of liquid cultures (Fig. 5) could bebecause the available nitrogen is significantly reduced inthe medium after 3 days culture . A study of the secre-tion of glucoamylase in A. niger showed that carbon-starvation leads to the accumulation of this enzyme inthe vacuoles (Khalaj et al. 2001). The authors suggestedthis is due to the re-routing of the general secretorypathway to the vacuoles in response to starvation. Ourresults imply that the secretory pathway might havedifferent responses to different kinds of nutrient limita-tion. Thus, in C. fulvum, nitrogen-starvation greatlyenhances secretion, whereas carbon-starvation reducessecretion, possibly by redirecting the secretory vesicles tothe intracellular vacuoles, as shown in A. niger. It will beinteresting to follow-up these results, to see how generalthis phenomenon might be in other filamentous fungiand whether this is limited to the secretion of CatB or isa more general phenomenon affecting secretion.

pCatBex also functions in M. grisea. Mycelium fromM. grisea transformants generally had about ten timesmore catalase than the wild type. One transformant(strain 36) showed a 75-fold increase in mycelial activity.The increases measured in culture supernatant weresimilar: three strains showed an 11-fold increase andstrain 36 showed an 85-fold increase over wild-typecatalase levels.

The RNA-blot analysis revealed that there is a cor-relation between catalase activity in the supernatant andmycelium of the transgenic strains and the abundance ofcatB mRNA. There is a strong band hybridising to thecatB probe for strain 17, but this strain has similarcatalase activity to the wild type. It is possible that amutation in catB occurred during genome integrationand the gene product is not functional. The correlationbetween catalase activity and catB mRNA lends furtherevidence that the increase in catalase activity in trans-genic strains is the consequence of recombinant catBexpression. The level of catalase activity in transgenicstrains is similar to that measured in transgenic C. ful-vum and shows that the expression cassette works inanother ascomycete.

In conclusion, we demonstrated here the utility of ahighly abundant hydrophobin gene to construct vectorsfor the expression and secretion of recombinant proteinsin filamentous fungi. Production and secretion of therecombinant proteins can be further enhanced by areduction in the available nitrogen during the exponen-tial growth phase of the fungus.

Acknowledgements We thank Julie Scholes and Nick Talbot forproviding the strains of C. fulvum and M. grisea. H.J., J.W. andS.E. gratefully acknowledge financial support by the BBSRC.

References

Aebi H (1984) Catalase in vitro. In: Colowick SP, Kaplan NO (eds)Methods in enzymology. Academic Press, London, pp 121–126

Bradford MM (1976) A rapid and sensitive method for the quan-titation of microgram quantities of protein utilizing the prin-ciple of protein–dye binding. Anal Biochem 72:248–254

Bussink H-J, Oliver R (2001) Identification of two highly divergentcatalases in the fungal tomato pathogen, Cladosporium fulvum.Eur J Biochem 267:1–11

Clare DA, Duong MN (1984) Effects of molecular oxygen ondetection of superoxide radical with nitroblue tetrazolium andon activity stains for catalase. Anal Biochem 140:532–537

Conesa A, Punt PJ, Luijk N van, Hondel C van den (2001) Thesecretion pathway in filamentous fungi: a biotechnological view.Fungal Genet Biol 33:155–171

Fowler T, Rey MW, Vahavahe P, Power SD, Berka RM (1993)The CatR gene encoding a catalase from Aspergillus niger:primary structure and elevated expression through increasedgene copy number and use of a strong promoter. Mol Microbiol9:989–998

Fulton TM, Chunwongse J, Tanksley SD (1995) Microprep pro-tocol for extraction of DNA from tomato and other herbaceousplants. Plant Mol Biol Rep 13:207–209

Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirementsof suspension cultures of soybean root cells. Exp Cell Res50:148–151

Hamada W, Spanu P (1998) Cosuppression of the hydrophobingene HCf-1 is correlated with antisense RNA biosynthesis inCladosporium fulvum. Mol Gen Genet 259:630–638

Khalaj V, Bookman JL, Robson GD (2001) A study of the proteinsecretory pathway of Aspergillus niger using a glucoamylase–GFP fusion protein. Fungal Genet Biol 32:55–65

Nielsen H, Engelbrecht J, Brunak S, Heijne G von (1997) Identi-fication of prokaryotic and eukaryotic signal peptides andprediction of their cleavage sites. Protein Eng 10:1–6

162

Oliver RP, et al (1987) Transformation of Fulvia fulva, a fungalpathogen of tomato, to hygromycin-b resistance. Curr Genet12:231–233

Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, HondelCAMJJ van den (1987) Transformation of Aspergillus based onthe hygromycin-b resistance marker from Escherichia coli. Gene56:117–124

Punt PJ, Biezen N van, Conesa A, Albers A, Magnus J, HondelCAMJJ van den (2002) Filamentous fungi as cell factories forheterologous protein production. Trends Biotechnol 20:200–206

Radzio R, Kuck U (1997) Synthesis of biotechnologically relevantheterologous proteins in filamentous fungi. Plant Mol Biol Rep

Sambrook J, Fritsch EF, Maniatis T (1987) Molecular cloning.Cold Spring Harbor Laboratory Press, Cold Spring Harbor,N.Y.

Segers GC, Hamada W, Oliver RP, Spanu PD (1999) Isolation andcharacterisation of five different hydrophobin-encoding cDNAsfrom the fungal tomato pathogen Cladosporium fulvum. MolGen Genet 261:644–652

Spanu P (1997) HCf-1, a hydrophobin from the tomato pathogenCladosporium fulvum. Gene 193:89–96

Spanu P (1998) Deletion of HCf-1, a hydrophobin gene of Cla-dosporium fulvum, does not affect pathogenicity in tomato.Physiol Mol Plant Pathol 52:323–334

Talbot NJ, Ebbole DJ, Hamer JE (1993) Identification and char-acterization of MPG1, a gene involved in pathogenicity fromthe rice blast fungus Magnaporthe grisea. Plant Cell 5:1575–1590

Wessels JGH (2000) Hydrophobins, unique fungal proteins.Mycologist 14:153–159

Whiteford JR, Spanu PD (2001) The hydrophobin HCf-1 of Cla-dosporium fulvum is required for efficient water-mediated dis-persal of conidia. Fungal Genet Biol 32:159–168

Whiteford JR, Spanu PD (2002) Hydrophobins and the interac-tions between fungi and plants. Mol Plant Pathol 3:391–400

Wosten HAB (2001) Hydrophobins: multipurpose proteins. AnnuRev Microbiol 55:625–646

163