ARTICLE IN PRESS

Int. J. Hyg. Environ.-Health 209 (2006) 521–526

1438-4639/$ - se

doi:10.1016/j.ijh

�Correspondfax: +91761 40

E-mail addr

www.elsevier.de/ijheh

Prevalence of virulence genes (ctxA, stn, OmpW and tcpA) among non-O1

Vibrio cholerae isolated from fresh water environment

Anjana Sharma�, Animesh Navin Chaturvedi

Department of Biosciences, Bacteriology laboratory, R.D. University, Jabalpur, 482001 (MP), India

Received 26 January 2006; received in revised form 11 June 2006; accepted 23 June 2006

Abstract

The virulence of a pathogen is reliant on the presence of a discrete set of genetic determinants and their expression inthe host. The virulence of Vibrio spp. is regulated by the ctxAB and tcpA genes. These genes are alleged to beexclusively associated with clinical strains of O1 and O139 serogroups. In the present study, we examined the presenceof virulence genes viz. stn, OmpW, ctxA and tcpA of classical and ElTor variants, in environmental strains of non-O1Vibrio cholerae cultured seasonally from four sampling stations of the river Narmada at Jabalpur (MP), India.Unexpectedly, the PCR analysis of the strains revealed the presence of these genes among environmental V. cholerae.The strains harboring the tcpA gene also carried the ctxA gene. Sequencing of the tcpA gene and ctxA gene carried byan environmental strain showed �97% homology with the previously sequenced genes submitted in the GenBank. Wereport here the prevalence of cholera toxin gene and the gene for toxin co-regulated pilus among non-O1 V. choleraestrains isolated from fresh water environment. This study supports the idea that cholera toxin has an environmentalderivation and that the intricate aquatic environment can give rise to pathogenic Vibrio organisms.r 2006 Elsevier GmbH. All rights reserved.

Keywords: V. cholerae non-O1; ctxA; tcpA; Stn; OmpW

Introduction

Vibrio cholerae is an autochthonous inhabitant ofaquatic systems and is the causative agent of severedehydrating diarrheal disease, cholera. Though thisorganism is conscientious for the several epidemics andpandemics, it is a universal conviction that most of theenvironmental strains do not produce cholera toxin(CT) and are therefore of trifling magnitude in epidemicpotential. In spite of copious studies over more than acentury, the epidemiology of cholera remains mysterious

e front matter r 2006 Elsevier GmbH. All rights reserved.

eh.2006.06.005

ing author. Tel.: +91761 2416667;

45625.

ess: anjoo_1999@yahoo.com (A. Sharma).

and challenging to investigators in the field. Until theemergence of V. cholerae O139 in 1992, toxigenic strainsof V. cholerae O1 were considered to be the solitarycausative agents of epidemic and pandemic cholera(Faruque et al., 2000b).

The knack of pathogenic Vibrio spp. to cause diseasedepends on the expression of virulence factors like apotent enterotoxin (CT), a pilus colonization factor(toxin co-regulated pilus; TCP). CT is encoded by atransferable filamentous phage (CTXf) and reportshave implied the acquisition of these CT genes underconditions analogous to those in the aquatic environ-ments (Faruque and Nair, 2002).

CtxAB operon, which encodes for the A and Bsubunits of CT, resides in the genomes of CTXf. All

ARTICLE IN PRESSA. Sharma, A.N. Chaturvedi / Int. J. Hyg. Environ.-Health 209 (2006) 521–526522

Vibrio strains proficient of causing cholera perpetuallycarry genes for TCP which is an adhesin that iscoordinately regulated with CT production (Tayloret al., 1987). TCP is the solitary V. cholerae pilusthat has been demonstrated to date to have a role incolonization of the gut mucosa of humans (Herringtonet al., 1988) and of infant mice (Taylor et al., 1987), thelatter being an experimental model.

It has been presumed that CT and TCP are exclusivelyassociated with clinical strains of V. cholerae, notablythose belonging to serogroups O1 and O139. Similarly,TCP has infrequently been allied with the environmentalstrains of V. cholerae (Nair et al., 1988). The majorstructural subunit of TCP is encoded by the tcpA gene,which is a part of a gene cluster comprising at least 15open reading frames (Kovach et al., 1996).

The NAG-ST is a 17 amino acid peptide; encoded bythe stn gene, which exhibits remarkable similarity,especially in the carboxyl-terminal toxin domain, tothe heat-stable enterotoxins (STs) produced by enter-otoxigenic Escherichia coli (ETEC). The NAG-ST genehas been cloned and sequenced (Ogawa et al., 1990),which has enabled the construction of DNA probes fordetection of NAG-ST. Taking advantage of the avail-ability of these probes, we undertook a study to examinea large collection of V. cholerae non-O1 for the presenceof a NAG-ST-like enterotoxin.

The presence of OmpW in V. cholerae strains, coupledwith the fact that its nucleotide sequence remainedpractically unchanged among different V. cholerae

strains, makes it a highly suitable genetic marker forthe organism (Nandy et al., 2000).

The present investigation was undertaken on thevibrios isolated from the largest west flowing river of theIndian subcontinent. The total length of the river is1312 km, which before draining off into the gulf ofGambay passes through two states of India viz. MadhyaPradesh (MP) and Gujarat. River Narmada is animportant source of fresh water supply for Jabalpur(MP), where the sampling was carried out.

The intent of the present study was to monitor Vibrio

strains isolated from the river Narmada for virulencegenes (ctxA and tcpA Classical and tcpA ElTor, stn andOmpW), collected seasonally from Jabalpur (MP), anexpanse of non-epidemicity.

Materials and methods

Collection and processing of environmental samples

Water samples were collected from four stations(Gwarighat, Jelharighat, Lamhetaghat and Tilwara-ghat), over a 2-year period from January 2002 toDecember 2003, at monthly intervals. Four water

samples were collected from each station per month.Ca. 500ml water samples were collected, concentratedon 0.45 mm pore diameter filters, and enriched inalkaline peptone water (APW (1% peptone, 1% NaCl,pH 8.4–8.6)) for isolation of Vibrio spp. (Kaper et al.,1979). Bacterial colonies were isolated from the enrich-ment cultures by using thiosulfate-citrate-bile salt(TCBS) agar. The colonies on TCBS were confirmedto be Vibrio spp. by biochemical tests as describedpreviously (Alsina and Blanch, 1994). The identity of V.

cholerae was confirmed serologically as described pre-viously (Ramamurthy et al., 1993).

After identification the isolates were maintained in thebacteriology lab, Department of biological sciences,R.D. University, Jabalpur (MP), India, and weregiven BGCC (Bacterial Germplasm Collection Center)numbers.

DNA extraction

A modification of the scheme of Murray andThompson (1980) was used for DNA extraction. Inbrief, cells from an 18-h LB culture were collected andresuspended in TE buffer (10mM Tris–HCl, 1mMEDTA; pH 8.0), treated with 10% (w/v) sodium dodecylsulfate and freshly prepared proteinase K and incubatedat 37 1C for 1 h. After incubation, 10% cetyl trimethylammonium bromide in 0.7MNaCl was added andincubated at 65 1C for 10min. The aqueous phasewas treated with phenol-chloroform, and the pelletwas washed with 70% ethanol. The nucleic acid wassuspended in TE and treated with RNase at 37 1C for30min.

Uniplex PCR assay

Uniplex PCR assays (Nandy et al., 2000) each for stn

and ompW genes were performed in a reaction volumeof 25 ml. Each 25 ml of the reaction mixture contained thefollowing reagents: 2.5 ml of 10� PCR buffer, 2.5 ml of2.5mM dNTP’s, 10 pmol of each primer, 5U of TaqDNA polymerase (Takara, Shuzo Co. Ltd, Japan) and3 ml of the DNA. The reaction volume was adjusted to25 ml using sterile triple distilled water.

The cycling profile was as follows: initial denaturationat 94 1C for 5min, and 30 cycles of denaturation at 94 1Cfor 30 s, annealing at 64 1C for 30 s, extension at 72 1Cfor 30 s and final extension at 72 1C for 5min.

The PCR products were electrophoresed at 100V forapproximately 1 h on a 1.5% agarose gel in 0.5� TBE.

Multiplex PCR assay

A multiplex PCR assay (Keasler and Hall, 1993) forctxA and tcpA (both Classical and ElTor variants) was

ARTICLE IN PRESS

Table 1. PCR primers used in this study

Primer Primer sequence (50–30) Target gene Amplicon (bp) Reference

NST-F CCTATTCATTGCATTAATG Stn 215 Ogawa et al. (1990)

NST-R CCAAAGCAAGCTGGATTGC

CtxA-F CTCAGACGGGATTTGTTAGGCACG ctxA 301 Keasler and Hall (1993)

CtxA-R TCTATCTCTGTAGCCCCTATTACG

TcpA-F CACGATAAGAAAACCGGTCAAGAG tcpA 617 Keasler and Hall (1993)

(Classical) (Classical)

TcpA-R ACCAAATGCAACGCCGAATGGAGC

(Classical)

TcpA-F GAAGAAGTTTGTAAAAGAAGAACAC tcpA 417 Ogawa et al. (1990)

(El Tor) (El Tor)

TcpA-R GAAAGGACCTTCTTTCACGTTG

(El Tor)

OmpW-F CACCAAGAAGGTGACTTTATTGTG OmpW 588 Nandy et al. (2000)

OmpW-R GAACTTATAACCACCCGCG

Fig. 1. Multiplex PCR analysis for ctxA, tcpA classical and

tcpA ElTor gene of V. cholerae non-O1 used in this study.

A. Sharma, A.N. Chaturvedi / Int. J. Hyg. Environ.-Health 209 (2006) 521–526 523

performed. The multiplex PCR was performed in areaction volume of 25 ml. Each 25 ml of the reactionmixture contained the following reagents: 2.5 ml of 10�PCR buffer (500mMKCl, 100mM Tris HCL, 15mMMgCl2; pH 8.3), 2.5 ml of a solution containing each ofthe deoxynucleoside triphosphates at concentration of2.5mM, 10 pmol of each primer, 1U of Taq DNApolymerase (Takara Shuzo co. Ltd., Japan) and 3 ml ofthe DNA. The reaction volume was adjusted to 25 mlusing sterile triple distilled water.

The cycling profile was as follows: initial denaturationat 94 1C for 2min., and 30 cycles of denaturation at94 1C for 1min 30 s, annealing at 60 1C for 1min 30 s,extension at 72 1C for 1min 30 s and final extension at72 1C for 5min.

The PCR products were electrophoresed at 100V forapproximately 1 h on a 1.5% agarose gel in 0.5� TBE.The primers used in this study are listed in the Table 1.

Gene sequencing

For sequencing analysis, PCR amplicons were gelexcised and purified using a QIA quick gel purifica-tion kit (Qiagen Inc., Valencia, CA), following theinstructions of the manufacturer and sequenced bidir-ectionally using an ABI BigDye Terminator CycleSequencing Ready Reaction Kit (Applied Biosystems,Foster City, CA).

Nucleotide sequence accession number

The sequences determined in this work were depositedinto the National Center for Biotechnological Informa-

tion (GenBank) under the following accession numbers:DQ 132784 and DQ132785.

Results

A total of 115 environmental isolates of the genusVibrio were analyzed in the present study. The resultsshow that the CT gene (ctxA) and the gene for toxin co-regulated pili (tcpA of classical variants) was present in14 isolates (�13%) by PCR detection (Fig. 1). Theidentity of the V. cholerae was confirmed by screeningwith the OmpW gene, which showed 100% specificityfor all V. cholerae strains tested (Fig. 2). These strainsconstitute a reservoir of virulence genes in the environ-ment. The gene for the heat stable toxin (NAG-ST), i.e.,stn, was found to be absent in all the V. cholerae isolatestested. The nucleotide sequence of the tcpA and ctxA

ARTICLE IN PRESS

Fig. 2. Uniplex PCR analysis for OmpW gene of V. cholerae

non-O1 used in this study.

A. Sharma, A.N. Chaturvedi / Int. J. Hyg. Environ.-Health 209 (2006) 521–526524

gene has revealed an amplicon of 758 and 564 base. Thenucleotide sequences were compared with other se-quences at the GeneBank using BLAST.

Discussion

V. cholerae is a well-defined species on the basis ofbiochemical test activity and DNA homology, but thespecies is not homogenous with regards to its pathogenicpotential (Baumann et al., 1984). Among the 193currently recognized somatic ‘O’ serogroup of V.

cholerae, only O1 and O139 strains are capable ofcausing epidemic cholera, but these two serogroups arerarely found in the environment except during anepidemic.

TCP has been shown to be essential for colonizationin the infant mouse model as well as in humanvolunteers (Tacket et al., 1998). The absence of thetcpA El Tor gene is interesting to note since thecontemporary cholera pandemic is caused by the ElTorbiotype.

Topical studies have revealed that virulence genes ortheir homologs are discrete among environmental V.

cholerae strains belonging to sundry serogroups,whereas previously it was considered that virulencegenes are carried only by the clinical isolates (Colwelland Spira, 1992). The basis for this possibility was maybe due to the fact that the studies do not consider theprospect of genetic variations within the virulent genesto the extent that the variants might escape detectionwith PCR or probes that were designed strictly based onthe sequence of the corresponding genes found in theclinical isolates (Mukhopadhyay et al., 2001).

In a similar study by Jiang et al. (2003) on theNewport Bay, the CT gene (of a defective prophage) wasfound in 17% of the V. cholerae non-O1 strains. To ourknowledge, this is the first evidence of the presence oftoxin genes in non-O1 V. cholerae from the riverineenvironment in India.

OmpW primers differentiating between V. cholerae

and V. mimicus strains assume considerable significancein view of the report that these two groups of organismsshare common biochemical properties and serologicalmarkers (Davis et al., 1981). Therefore, the presence ofOmpW in V. cholerae strains, coupled with the fact thatits nucleotide sequence remained practically unchangedamong different V. cholerae strains, makes it a highlysuitable genetic marker for the organism.

A literature survey showed that genes partiallyhomologous to OmpW of V. cholerae are present incertain other bacteria, e.g., E. coli, Aeromonas spp., etc.(Jeanteur et al., 1992). Several functions were proposedfor the OmpW-related proteins in these bacteria,including their pore- or channel-forming and colicinreceptor properties (Pilsl et al., 1999). Although theprecise function of the OmpW protein in V. cholerae isnot yet known, it may play a role in the adherenceprocess, which is likely to facilitate the survival of theorganism within the host or in the environment or both.Preliminary genome data available (Trucksis et al.,1998) demonstrate the presence of two chromosomes inV. cholerae. It is important to note that while the OmpW

gene is present in the smaller chromosome, the toxR

gene is located in the larger chromosome of theorganism.

Molecular characterization of the genes provideinformation about the ecology of V. cholerae, which isan autochthonous inhabitant of aquatic environment aswell as pathogenic for humans. The results of this studywere unanticipated since it is held that environmentalisolates lack the virulence genes. It could be concludedthat the genes are discrete among the environmentalisolates and may ferry about, given the fact that most ofthe virulence genes are located on mobile elements(Chakraborty et al., 2000) and hence the prospective of‘mixing and matching’ of genes in the environment or inthe human intestine, leading to new pathogenic variants,should be addressed sooner than later.

Studies have shown that there is an adaptable systemof acquisition of genes from other organisms. Thissystem consists of an idiosyncratic set of integrons,which are gene expression elements that may captureORFs and switch them to functional genes (Mazel et al.,1998). Moreover, the spread of ctx gene in theenvironment can be facilitated by the exposure ofCTXF- positive strains to sunlight (Faruque et al.,2000a). It is currently ambiguous whether the CT genesamong these environmental isolates are expressed orwhat their biological and ecological efficacy is in theaquatic environment.

Multiple alignments with ctxA genes of environmen-tal isolates of South Korea (Gene Bank accession AD175708) and India (AF414369) showed high degree ofsimilarity, with differences ranging from 8 to 16 bp.These results suggest that the ctxA genes in the

ARTICLE IN PRESSA. Sharma, A.N. Chaturvedi / Int. J. Hyg. Environ.-Health 209 (2006) 521–526 525

environment are conserved and share similarities withthose of the clinical V. cholerae strains. The nucleotidesequence data of the tcpA amplicon shared �97%similarity with the classical tcpA (Faast et al., 1989). Theclose similarity of the tcpA gene found in the environ-mental strains of V. cholerae to the classical V. cholerae

tcpA is concerning, due to the fact that the contempor-ary cholera pandemic is caused by the ElTor biotype.However, the data obtained in this study indicate that atcpA gene is present in non-O1 V. cholerae strains,which strongly suggests the possibility of reemergence ofthe classical biotype via gene transfer events in theenvironment. Samadi et al. (1983) reported a transientreemergence of classical biotype as a predominantstrain, about 10 years after its apparent replacementby the ElTor biotype.

The results of the present study parallels those of aprevious study using a high-resolution DNA fingerprint-ing method to show that clinical toxigenic V. cholerae

isolates are closely related to the so-called non-toxigenicenvironmental strains (Jiang et al., 2000) and furthersuggests that the toxin genes are mobile amongenvironmental isolates. However, it is still not clearhow these genes spread in an aquatic environment in anarea of non-epidemicity. It is possible that a differentmechanism of gene transfer operates for V. cholerae inaquatic environments.

It is presently unclear whether CT and TCP genesamong the environmental isolates are expressed or whattheir ecological and biological function is in the aquaticenvironment.

Since the river Narmada is a very significant source offresh water for Jabalpur (MP) sustaining millions ofpopulace, and also used for recreational purposes, theoccurrence of toxigenic V. cholerae raises a questionregarding potential risk of human exposure; hence it isindispensable to monitor the river water recurrently tocheck the possibility of any epidemic.

Acknowledgments

Authors are thankful to the Head, Department ofBiosciences, R.D. University, Jabalpur, for providinglab facilities, Dr. T. Ramamurthy, Assistant Director,National Institute of Cholera and Enteric Diseases,Kolkata, India, for molecular studies and to the UGCfor giving financial assistance.

References

Alsina, M., Blanch, A.R., 1994. Improvement and update of a

set of keys for biochemical identification of Vibrio species.

J. Appl. Bacteriol. 77, 719–772.

Baumann, P., Furniss, A.L., Lee, J.V., 1984. Genus I. Vibrio

Pacini 1854. In: Kreig, N.R., Holt, J.G. (Eds.), Bergey’s

Manual of Systematic Bacteriology. The Williams &

Wilkins Co., Baltimore, MD, pp. 518–538.

Chakraborty, S., Mukhopadhyay, A.K., Bhadra, R.K.,

Ghosh, A.N., Mitra, R., Shimada, T., Yamasaki, S.,

Faruque, S.M., Takeda, Y., Colwell, R.R., Nair, G.B.,

2000. Virulence genes in environmental strains of Vibrio

cholerae. Appl. Environ. Microbiol. 66, 4022–4028.

Colwell, R.R., Spira, W.M., 1992. The ecology of Vibrio

cholerae. In: Barua, D., Greenough, W.B. (Eds.), Cholera.

Plenum, New York, pp. 107–127.

Davis, B.R., Fanning, G.R., Madden, J.M., Steigerwalt, A.G.,

Bradford Jr., H.B., Smith Jr., H.L., Brenner, D.J., 1981.

Characterization of biochemically atypical Vibrio cholerae

strains and designation of a new pathogenic species Vibrio

mimicus. J. Clin. Microbiol. 14, 631–639.

Faast, R., Ogierman, M.A., Stroeher, U.H., Manning, P.A.,

1989. Nucleotide sequence of the structural gene, tcpA, for

a major pilin subunit of Vibrio cholerae. Gene 85, 227–231.

Faruque, S.M., Nair, G.B., 2002. Molecular ecology of

toxigenic Vibrio cholerae. Microbiol. Immunol. 46, 59–66.

Faruque, S.M., Asadulghani, Rahman, M.M., Waldor, M.K.,

Sack, D.A., 2000a. Sunlight–induced propagation of the

lysogenic phage encoding cholera toxin. Infect. Immun. 68,

4795–4801.

Faruque, S.M., Saha, M.N., Asadulghani, Sack, D.A., Sack,

R.B., Takeda, Y., Nair, G.B., 2000b. The O139 serogroup

of Vibrio cholerae comprises diverse clones of epidemic and

non-epidemic strains derived from multiple V. cholerae O1

or non-O1 progenies. J. Infect. Dis. 182, 1161–1168.

Herrington, D.A., Hall, R.H., Losonsky, G.A., Mekalanos,

J.J., Taylor, R.K., Levine, M.M., 1988. Toxin, toxin-

coregulated pili, and the toxR regulon are essential for

Vibrio cholerae pathogenesis in humans. J. Exp. Med. 168,

1487–1492.

Jeanteur, D., Gletsu, N., Pattus, F., Buckley, J.T., 1992.

Purification of Aeromonas hydrophila major outer mem-

brane proteins: N-terminal sequence analysis and channel-

forming properties. Mol. Microbiol. 22, 3355–3363.

Jiang, S., Weiping, C., Fu, W., 2003. Prevalence of cholera

toxin genes (ctxA and zot) among non-O1/O139 Vibrio

cholerae strains from Newport bay, California. Appl.

Environ. Microbiol. 69, 7541–7544.

Jiang, S.C., Matte, M., Matte, G., Huq, A., Colwell, R.R.,

2000. Genetic diversity of clinical and environmental

isolates of Vibrio cholerae determined by amplified frag-

ment length polymorphism fingerprinting. Appl. Environ.

Microbiol. 66, 148–153.

Kaper, J., Lockman, H., Colwell, R.R., Joseph, S.W., 1979.

Ecology, serology, and enterotoxin production of Vibrio

cholerae in Chesapeake Bay. Appl. Environ. Microbiol. 37,

91–103.

Keasler, S.P., Hall, R.H., 1993. Detecting and biotyping Vibrio

cholerae O1 with multiplex polymerase chain reaction.

Lancet 341, 1661.

Kovach, M.E., Shaffer, M.D., Peterson, K.M., 1996.

A putative integrase gene defines the distal end of a large

cluster of Tox R- regulated colonization genes in Vibrio

cholerae. Microbiology 142, 2165–2174.

ARTICLE IN PRESSA. Sharma, A.N. Chaturvedi / Int. J. Hyg. Environ.-Health 209 (2006) 521–526526

Mazel, D., Dychinco, B., Webb, V.A., Davies, J., 1998.

A distinctive class of integron in the Vibrio cholerae

genome. Science 280, 605–608.

Mukhopadhyay, A.K., Chakraborty, S., Takeda, Y., Nair,

G.B., Berg, D.E., 2001. Characterization of VPI patho-

genicity island and CTXf prophage in environmental

strains of Vibrio cholerae. J. Bacteriol. 183, 4737–4746.

Murray, M.G., Thompson, W.F., 1980. Rapid isolation of

high molecular weight plant DNA. Nucl. Acid Res. 8,

4321–4325.

Nair, G.B., Oku, Y., Takeda, Y., Ghosh, A., Ghosh, R.K.,

Chattopadhyay, S., Pal, S.C., Kaper, J.B., Takeda, T.,

1988. Toxin profiles of Vibrio cholerae non-O1from

environmental sources in Calcutta, India. Appl. Environ.

Microbiol. 54, 3180–3182.

Nandy, B., Nandy, R.K., Mukhopadhyay, S., Nair, G.B.,

Shimada, T., Ghosh, A.C., 2000. Rapid method for species-

specific identification of Vibrio cholerae using primers

targeted to the gene of outer membrane protein OmpW.

J. Clin. Microbiol. 38, 4145–4151.

Ogawa, A., Kato, J., Watanabe, H., Nair, G.B., Takeda, T.,

1990. Cloning and nucleotide sequence of a heat stable

enterotoxin gene from Vibrio cholerae non-O1 isolated from

a patient with traveler’s diarrhea. Infect. Immun. 58,

3325–3329.

Pilsl, H., Smajs, D., Braun, V., 1999. Characterization of

colicin S4 and its receptor, OmpW, a minor protein of the

E. coli outer membrane. J. Bacteriol. 181, 3578–3581.

Ramamurthy, T., Bag, P.K., Pal, A., Bhattacharya, S.K.,

Bhattacharya, M.K., Sen, D., Shimada, T., Takeda, T.,

Takeda, Y., Nair, G.B., 1993. Virulence patterns of Vibrio

cholerae non-O1 strains isolated from hospitalized patients

with acute diarrhoea in Calcutta, India. J. Med. Microbiol.

39, 310–317.

Samadi, A.R., Shahid, N., Eusuf, A., Yunus, M., Huq, M.I.,

Khan, M.U., 1983. Classical Vibrio cholerae biotype

displaces ElTor in Bangladesh. Lancet I, 805–807.

Tacket, C.O., Taylor, R.K., Losonsky, G., Lim, Y., Nataro,

J.P., Kaper, J.B., Levine, M.M., 1998. Investigation of the

role of toxin-coregulated pili and mannose-sensitive he-

magglutinin pili in the pathogenesis of Vibrio cholerae O139

infection. Infect. Immun. 66, 692–695.

Taylor, R.K., Miller, V.L., Furlong, D.B., Mekalanos, J.J.,

1987. The use of phoA gene fusions to identify a pilus

colonization factor coordinately regulated with cholera

toxin. Proc. Natl. Acad. Sci. USA 84, 2833–2837.

Trucksis, M., Michalski, J., Deng, Y.K., Kaper, J.B.,

1998. The Vibrio cholerae genome contains two unique

circular chromosomes. Proc. Natl. Acad. Sci. USA 95,

14464–14469.