presentation on leishmaniasis
DESCRIPTION
TRANSCRIPT
![Page 1: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/1.jpg)
“PCR for diagnosis and characterization of Leishmania in
clinical samples from Kala Azar and Post Kala-azar Dermal Leishmaniasis patients”
At National institute of Pathology, Safdarjung Hospital
Campus ,New delhi
Submitted by:- Upma
Gandhi
7251616222 B.tech
biotech
![Page 2: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/2.jpg)
Institute of Pathology, New delhi is a premier research institute which was established in 1965 under ICMR. Its areas of reasearch are.
1. Metabolic syndromes(diabetes,obesity), chronic diseases biology fibrosis liver/ lung/)
2. Idiopathic skin diseases (Breast Cancer,
Lymphoma,3.infectiousdiseases(Tuberculosis,Leis
hmaniasis,)4.adult stem cell biology 5. environmental toxicology.
I
![Page 3: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/3.jpg)
Leishmaniasis is a protozoan parasitic disease transmitted by the bite of sand flies.
Endemic in more than 88 countries and affecting 12 million people worldwide.
The majority of human cases occur in a small number of countries:
90% of visceral leishmaniasis cases occur in parts of India, Bangladesh, Nepal, Sudan, Ethiopia and Brazil
90% of cutaneous leishmaniasis cases occur in parts of Afghanistan, Algeria, Iran, Saudi Arabia, Syria, Brazil, Colombia, Peru and Bolivia
![Page 4: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/4.jpg)
Three main forms of Leishmaniasis
Cutaneous: affects the skin and mucus membranes. Skin sores usually start at the site of the sandfly bite.
Visceral: involving liver, spleen, and bone marrow
Mucocutaneous:involvingmucous membranes of the mouth and nose after spread from a nearby cutaneous lesion (very rare)
![Page 5: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/5.jpg)
PhylumPhylum
OrderOrder
FamilyFamily
GenusGenus
SarcomastigophoraSarcomastigophora
KinetoplastidaKinetoplastida
TrypanosomatidaeTrypanosomatidae
LeishmaniaLeishmania
![Page 6: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/6.jpg)
In India, states of Bihar, Uttar Pradesh and West Bengal are highly endemic foci of Kala azar where periodic epidemics are common.
The most common type of Leishmaniasis present in india is Visceral leishmaniasis or kala azar and Post kala azar dermal leishmaniasis.
![Page 7: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/7.jpg)
Visceral leishmaniasis, also known in Asia as ' black fever/ 'kala azar', It is characterized by:-
1. Irregular fever,2. Loss of weight, 3.Splenomegaly, 4.Hepatomegaly 5. Thrombocytopenia.
VL is caused by L. donovani in the Indian subcontinent
in East Africa, by L. infantum L. chagasi in the in Brazil,
Peru and Paraguay
![Page 8: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/8.jpg)
Post kala-azar dermal leishmaniasis (PKDL) is a dermatosis, caused as a sequel to KA.
Characterized by a macular, maculopapular and nodular rash in a patient who has recovered from VL and is otherwise well
PKDL is also caused by L. donovani
![Page 9: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/9.jpg)
![Page 10: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/10.jpg)
These include: Meglumine antimonate Sodium stibogluconate Other drugs that may be used include: Amphotericin B Fluconazole Pentamidine
A. Plastic surgery may be needed to correct the disfigurement caused by sores on the face (Cutaneous Leishmaniasis).
B. Patients with drug-resistant viral Leishmaniasis may need to have their spleen removed (splenectomy).
![Page 11: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/11.jpg)
As the symptoms of Leishmaniasis can vary and may be confused with other etiologic agents, diagnostic confirmation of the parasite is mandatory.
Methods of diagnosis of Leishmaniasis 1. Microscopy 2. Culture 3. Serodiagnosis (IFAT, ELISA ,DAT)4. PCR ( polymerase Chain reaction )
![Page 12: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/12.jpg)
PCR will be used as a sensitive and
specific technique for diagnosis of KA and PKDL.
PCR-RFLP assay based on internal transcribed spacer-1 (ITS-1) and PCR based on Kinetoplast DNA (kDNA) will be applied for diagnosis and species identification of parasite.
![Page 13: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/13.jpg)
![Page 14: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/14.jpg)
Leishmania spp. parasites will be used for this study.
Promastigotes will be cultured at 26C in M199 medium with 25mM HEPES (pH7.4) supplemented with 10% FBS, 100 IU and 100 g/ml each of penicillin G and streptomycin, respectively.
![Page 15: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/15.jpg)
Blood sample will be collected from KA patient in heparinized tubes. Skin scrapings were collected in NET buffer from PKDL Patients. (150mM NaCl, 15mM Tris- HCl[pH 8.30], 1mM EDTA). Then DNA isolation
is done using QIAamp DNA blood minikit (Qiagen).
![Page 16: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/16.jpg)
![Page 17: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/17.jpg)
![Page 18: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/18.jpg)
Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)
Gene Specific Primers :(Leishmania donovani specific primers, Salotra et al, JCM 2001)
Forward Primer-5`CTGGATCATTTTCCGATG3’ Reverse Primer- 5`TGCATACCACTTATCGCACT
3’ Buffer (usually 10X supplied along with Taq
polymerase) MgCl2 (1.5 mM) Taq DNA polymerase (1.25 Units) dNTPs (2.5 mM stock)
![Page 19: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/19.jpg)
All the components Template DNA,Forward Primer, Reverse Primer,Buffer 10X
MgCl2,Taq DNA polymerase and dNTPs
A master mix is prepared with all thecomponents of PCR reaction.
24μL of the master mix is added into all aliquots , then DNA sample is added , mixed properly & centrifuged
![Page 20: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/20.jpg)
PCR conditions- 40 cycles of Denaturation : 95°C for 4 min, Annealing : 95°C for 20
sec, Extension : 53°C for 30
secInitial Denaturation : 72°C for 1 minFinal extension : 72°C for 3 min
![Page 21: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/21.jpg)
![Page 22: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/22.jpg)
![Page 23: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/23.jpg)
An excellent target for a sensitive and rapid detection method of Leishmania donovani is the Kinetoplast DNA PCR. It can detect DNA upto conc. of 1 fg
This DNA from cultured parasites (1 ng) and from KA and PKDL patients will be taken for amplification using KDNA specific primers
![Page 24: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/24.jpg)
Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)
Gene Specific Primers :(Leishmania donovani specific primers, Salotra et al, JCM 2001)
Forward Primer-5`-CTGGATCATTTTCCGATG-3’ Reverse Primer- 5`-
TGCATACCACTTATCGCACTT -3’ Buffer (usually 10X supplied along with Taq
polymerase) MgCl2 (1.5 mM) Taq DNA polymerase (1.25 Units) dNTPs (2.5 mM stock)
![Page 25: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/25.jpg)
PCR conditions- 40 cycles of Denaturation : 94°C for 1
min, Annealing : 45°C for
30 sec, Extension : 72°C for
60 sec Initial Denaturation : 94°C for 2
min Final extension : 72°C for 3
min
![Page 26: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/26.jpg)
Detection and analysis of the reaction
product
PCR product is loaded with 6X loading dye , along with appropriate molecular-weight markers which is 1Kb Ladder , onto an agarose gel (1 %) containing EtBr. DNA bands on the gel can then be visualized under ultraviolet trans-illumination.
![Page 27: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/27.jpg)
Identification of Leishmania species in clinical material using ITS-1 PCR and restriction enzyme analysis was done. DNA (1ng) was subjected to pcr and analyzed. Lane1, 100bp ladder; lane 2 , L.donovani ; Lane 3, Sample DNA, Lane 4 L. tropica ; lane 5 L.major .
![Page 28: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/28.jpg)
Identification of Leishmania species in clinical material using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; Lane2 , L.donovani positiive control, lane 3, negative control ; lane 4, control blood; Lane 5 -8 KA sample.
![Page 29: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/29.jpg)
Identification of Leishmania species in clinical samples using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; lane 2, L.donovani positive control; Lane 3, negative control Lane 4 -6 PKDL sample
![Page 30: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/30.jpg)
Current diagnostic methods based on parasite
detection are invasive and have poor sensitivity,
while immunological methods have limited specificity,
This method is rapid and reproducible, it can be used for the reliable identification and characterization of cultured parasites.
The test has other potential values in detecting and typing parasites in vectors for epidemiological surveys
![Page 31: Presentation on leishmaniasis](https://reader038.vdocuments.mx/reader038/viewer/2022102616/5477a0d0b4af9f271b8b460c/html5/thumbnails/31.jpg)