636 nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology

articlepublished online: 18 august 2013 | doi: 10.1038/nchembio.1321

Pregnenolone (Fig. 1a) is an endogenous steroid gener-ated from cholesterol by the action of P450scc (also known as CYP11A1; abbreviated as SCC throughout). Cyp11a1-

null mice die neonatally and have degenerated adrenal glands1. Besides being an intermediate for the synthesis of all steroids, P5 has diverse functions in different vertebrates. P5 is required for zebrafish embryonic cell movement and microtubule stability2. It may stimulate cancer growth3 and has been used as a backbone for the synthesis of anticancer agents4.

P5 is also a neurosteroid that enhances learning and memory5, promotes recovery after spinal cord injury6 and reverses depres-sive disorders in rodents7. In human beings, P5 decreases symp-toms of schizophrenia and schizoaffective disorder8,9. Many P5 derivatives are also functional neurosteroids. P5 sulfate enhances neuronal responses in both N-methyl-D-aspartate (NMDA) receptor–dependent and NMDA receptor–independent manners10,11, whereas the other P5 derivative, allopregnanolone, promotes the GABA receptor response12. 7α-Hydroxypregnenolone stimulates locomotor activity13. Thus, P5 and its derivatives have important physiological functions and clinical utility.

The mechanism by which P5 exerts its action is important but poorly understood. P5 binds microtubule-associated protein 2 (MAP2) in vitro and increases MAP2-dependent microtubule assembly through an unknown mechanism14. MAP2, however, is expressed only in neuronal cells at limited developmental stages, whereas P5 has a wider range of action in non-neuronal cells and during early embryogenesis. As MAP2 is not detectable in early zebrafish embryos (The Zebrafish Model Organism Database (ZFIN) ID: ZDB-PUB-040907-1), the action of P5 during embryogenesis must be mediated by factors other than MAP2. Therefore, the identification of additional P5 targets will further elucidate the diverse mechanisms of P5 action and its role in microtubule stabilization.

Microtubule stability is regulated by numerous microtubule-associated modulators. Among them, CLIP-170 (also known as CAP-Gly domain–containing linker protein 1 or cytoplasmic

linker protein 1 (CLIP1)) is a microtubule plus end–tracking pro-tein (+TIP) located at the growing plus end of microtubules15. It controls cell migration and mitosis by modulating microtubule linkage to the cell border or the kinetochore and by promoting microtubule assembly16–19. It modulates the localization of dynein-dynactin motor proteins to the microtubule by recruiting the dynactin subunit p150Glued and the dynein-binding protein LIS1 (refs. 20–22). CLIP-170 is also essential for neuronal polarization and development23–25 and enhances sensitivity of breast cancer cell toward taxol, the microtubule-targeting drug26.

CLIP-170 has two N-terminal microtubule-binding domains, a middle coiled-coil domain and two C-terminal zinc knuckles15. Its activities are determined by conformational changes27. CLIP-170 becomes folded when its microtubule-binding domain and zinc knuckles interact, which is facilitated by phosphorylaton27. The folded CLIP-170 dissociates from microtubule ends and its binding partners16,28. CLIP-170 in the open extended conforma-tion binds microtubule tips more readily. It will be important to find molecules that can activate CLIP-170.

In this report, we study the action of P5 and show that it modulates cell motility by controlling microtubule growth rate in cultured mammalian cells and zebrafish embryos. We have identified the P5-binding protein as CLIP-170 by using synthetic P5-photoaffinity probes. P5 bound and activated CLIP-170 by changing CLIP-170’s conformation, thus potentiating the ability of CLIP-170 to enhance microtubule assembly and interaction with microtubules and the microtubule-associated proteins p150Glued and LIS1. Moreover, we show that P5 and CLIP-170 coordinately regulated zebrafish embryonic cell movement during embryogen-esis by facilitating microtubule assembly.

RESULTSP5 sustains cell motility and migration directionalityTo dissect the effect of P5 (Fig. 1a) on cell migration, we first abolished P5 production by abrogating the expression of its bio-synthetic enzyme, SCC, from mouse adrenocortical Y1 cells.

1Institute of biochemistry and Molecular biology, National Yang-Ming University, taipei, taiwan. 2Institute of Molecular biology, Academia Sinica, taipei, taiwan. 3Department of chemistry, National taiwan University, taipei, taiwan. 4Agricultural biotechnology research center, Academia Sinica, taipei, taiwan. *e-mail: chenct@ntu.edu.tw or mbchung@sinica.edu.tw

pregnenolone activates clip-170 to promote microtubule growth and cell migrationJui-hsia Weng1,2, ming-ren liang3, chien-han chen3, sok-Keng tong2, tzu-chiao huang3, sue-ping lee2, yet-ran chen4, chao-tsen chen3* & bon-chu chung1,2*

Pregnenolone (P5) is a neurosteroid that improves memory and neurological recovery. It is also required for zebrafish embryonic development. However, its mode of action is unclear. Here we show that P5 promotes cell migration and micro­tubule polymerization by binding a microtubule plus end–tracking protein, cytoplasmic linker protein 1 (CLIP­170). We captured CLIP­170 from zebrafish embryonic extract using a P5 photoaffinity probe conjugated to diaminobenzophenone. P5 interacted with CLIP­170 at its coiled­coil domain and changed it into an extended conformation. This increased CLIP­170 interaction with microtubules, dynactin subunit p150Glued and LIS1; it also promoted CLIP­170–dependent microtubule polymerization. CLIP­170 was essential for P5 to promote microtubule abundance and zebrafish epiboly cell migration during embryogenesis, and over­expression of the P5­binding region of CLIP­170 delayed this migration. P5 also sustained migration directionality of cultured mammalian cells. Our results show that P5 activates CLIP­170 to promote microtubule polymerization and cell migration.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology 637

articleNaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

We tested five different short hairpin RNA (shRNA) sequences and found shRNAs 1 and 4 blocked Cyp11a1 (henceforth referred to as SCC) expression efficiently (Fig. 1b). The patterns of cell migration were recorded for 3 h by time-lapse confocal scanning microscopy (Fig. 1c). Although control cells infected with lenti-virus carrying shRNA against the luc sequence (shluc) migrated steadily in one direction, cells deficient in SCC due to the expres-sion of shRNA#1 against Cyp11a1 (shSCC#1) tumbled around the origins (Fig. 1c), traveled shorter total distances (Fig. 1d) and made directional changes more frequently, leading to shorter net translocation (Fig. 1e) and a defect in directional-ity defined as the ratio of net to total distance (Fig. 1f). These defects in cell migration were partially rescued by treatment with P5. Cells depleted of SCC by a different shRNA, shSCC#4, also had the same migration defect, which was partially rescued by P5 (Supplementary Results, Supplementary Fig. 1). Thus these experiments show that P5 promotes Y1 cell migration by sustaining migration directionality.

P5 promotes microtubule growthMicrotubule dynamics are essential for directional cell migra-tion29. To understand the effect of P5 in microtubule dynamics, we treated human adrenocortical H295 cells with the SCC inhibi-tor DL-aminoglutethimide, which reduced P5 production by 70% (from 100 ng mg−1 to 30 ng mg−1 protein), then measured microtu-bule growth events. We visualized microtubule growth by express-ing GFP protein fused to microtubule plus end–binding protein 1 (EB1), which is present at the plus end of growing microtu-bules, moving like a comet30. DL-aminoglutethimide–treated cells formed new microtubules normally (Supplementary Fig. 2a), but their EB1-GFP signals disappeared faster than those in con-trol cells, suggesting that these microtubules tend to stop growing (Supplementary Fig. 2b). Tracing the moving speed of EB1-GFP,

we found that the microtubule growth rate was greatly reduced in DL-aminoglutethimide–treated cells (Fig. 1g). These results indi-cate that P5 controls the speed of microtubule growth in vivo. Our data is consistent with an earlier hint that stimulation of ste-roidogenesis in Y1 cells causes the conversion of the granular form of tubulin to organized microtubules31.

To assay the mechanism by which P5 mediates microtu-bule growth, we induced microtubule polymerization in vitro. Although microtubule polymerization from pure tubulin was quickly induced by taxol, it was not affected by P5 (Supplementary Fig. 3a). When tubulin was supplemented with zebrafish embry-onic extract, P5 promoted microtubule polymerization, yet the P5 metabolite progesterone (P4) had no effect (Fig. 1h). This suggests that P5 cooperates with other proteins to promote microtubule polymerization. We also tested other P5 metabolites and found that 7α-hydroxypregnenolone (7-OH-P5) and pregnenolone sulfate also promoted microtubule polymerization, whereas 17α-hydroxypregnenolone and 17α-hydroxyprogesterone had little activity (Supplementary Fig. 3b).

Synthetic P5­photoaffinity probes function as P5To identify proteins that mediate P5 action in microtubule growth, we designed photoaffinity probes equipped with reactive groups, which can explore ligand-receptor interactions32. The P5 photo-affinity probes consist of three elements: the ligand that recognizes the target, the diaminobenzophenone (NBPN) photoreactive group that covalently links P5 to its target upon photo irradiation and the biotin tag for the detection of P5-NBPN–protein complexes (Supplementary Fig. 4). Three P5-photoaffinity analogs were synthesized (P5-NBPN (1), P5β-NBPN (2), P5s-NBPN (3); Supplementary Notes 1–4). We also designed two probes, a cholesterol-photoaffinity probe (Cho-NBPN (4)) (Supplementary Note 5) and the entire photoaffinity backbone

ba d

SCC

Tub

shSCC

*55

MW(kDa)#1 #2 #3 #4 #5LucshRNA

c

–100

0

100

–100 0 100

–100

0

100

–100 0 100

shluc

–100

0

100

–100 0 100

shSCC#1 shSCC#1 + P5

Mig

ratio

n pa

th (µ

m)

0

40

80

120

25 31 31

Luc #1 #1– – P5

P = 0.03

P = 4 × 10–6

shRNA

Tota

l dis

tanc

e(µ

m)

h

– P4P5

MT

TotalTub

Embryo lysate

1 1.2 1.6 1.8 0.8

i

MT

TotalTub

1 0.9 0.9 1.6 1.2 1.2 1.7

Embryo lysate

OH

NBPN

Cho P5– P5β

P5s P5

f

0

0.2

0.4

0.6

0.8

P = 4 × 10–16

P = 2 × 10–8

Dire

ctio

nalit

y(n

et/t

otal

dis

tanc

e)

shRNA–

#1

31

P5#1

31

Luc–

25

g

Ctr AG

P = 3 × 10–8

0

0.2

0.4

0.6

MT

grow

th ra

te (µ

m s

–1)

15 15

e

0

30

60

90

Luc #1 #1– – P5

P = 7 × 10–12

P = 2 × 10–5

shRNA

Net

dis

tanc

e (µ

m)

25 31 31

j

40

50

60

70

Epib

oly

(%)

P = 1 × 10–9

P = 4 × 10–12

P = 9 × 10–7

+ ++–scc MO +P5 – –+– –

NBPN – P5–– Cho

28 36 28 32 28

O

HO

H

H H

Figure 1 | P5 regulates cell motility and promotes microtubule growth. (a) chemical structure of P5. (b) Analysis of the efficiencies of SCC-targeted shrNAs (shScc). Proteins from Y1 cells infected with lentivirus harboring different shrNA sequences were subject to immunoblot analysis. the asterisk refers to nonspecific cross-reacting material. tub, tubulin; luc, luciferase; MW, molecular weight. (c–f) the migration paths measured in μm (c), total migration distance (d), net migration distance (e) and directionality (f) of Y1 cells. each line represents the migration path of one cell in 3 h. the starting point of each cell was superimposed at coordinate 0,0. (g) Microtubule (Mt) growth rate is reduced after Scc is inhibited by Dl-aminoglutethimide (AG). ctr, DMSo control. (h,i) P5 (h) and NbPN-linked P5 (i) promote in vitro microtubule polymerization. the amounts of in vitro microtubule assembly from tubulin (tub) supplemented with zebrafish embryo lysate are shown in the immunoblot analysis, and the effects of NbPN-linked compounds were tested. the numbers under the panel are the relative amounts of microtubule. P4, progesterone; cho, cholesterol; P5β, NbPN in β configuration; P5s, P5 probe with a short linker to NbPN. Full blot images are shown in Supplementary Figure 17. (j) P5-NbPN promotes zebrafish epiboly movement. epiboly movements of embryos injected with control (−) or scc antisense morpholino oligonucleotides were analyzed upon DMSo (−), P5, P5-NbPN or cho-NbPN treatment. Data shown represent mean ± s.e.m. the numbers of the cells or embryos used in each measurement are shown inside each bar.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

638 nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology

article NaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

except the ligand (OH-NBPN (5)) (Supplementary Note 6) as negative controls. P5-NBPN, but not other photoaffinity probes, enhanced microtubule assembly as well as P5 in vitro, indicating that P5-NBPN is biologically active (Fig. 1i).

To evaluate the effect of P5-NBPN, we measured zebrafish epiboly movement, which is a process of embryonic cell migra-tion important for the formation of future body shape. During epiboly, the embryonic cells spread out to cover the underlying yolk. P5 and the intact microtubule structure are essential for this epiboly movement2. Embryonic cells injected with antisense scc morpholino oligonucleotide migrated more slowly than those in control embryos, and this was rescued by the addition of P5. P5-NBPN also had the same effect as P5 in rescuing zebrafish epiboly movement defects (Fig. 1j). Thus, P5-NBPN functions in the same way as P5 to promote microtubule polymerization and zebrafish epiboly movement.

P5 binds CLIP­170Using this P5-NBPN probe, we enriched P5-binding proteins from zebrafish embryonic extracts by streptavidin bead pulldown assays and identified them by LC/MS/MS (Supplementary Fig. 5). Aside from the major yolk protein vitellogenin, which also appeared in the control sample, the other protein labeled by P5-NBPN was CLIP-170.

To examine binding of P5 to CLIP-170, we purified Flag-tagged human CLIP-170 (F-CLIP-170) from 293T cells and tested its binding to P5-NPBN in vitro (Fig. 2a). P5-NBPN labeled F-CLIP-170 with high efficiency in a dose-dependent manner and reached 50% saturation labeling efficiency at 63 ± 10 nM (Supplementary Fig. 6a). At this concentration, about 20% of P5-NBPN was bound by F-CLIP-170 (Supplementary Fig. 6b), and at saturation, about 12% of F-CLIP-170 was labeled by P5-NBPN (Supplementary Fig. 6c). Therefore, the molar ratio of P5-NBPN to CLIP-170 was about 16 to 1 at 50% saturation labeling. The photoaffinity back-bone OH-NBPN and cholesterol-labeled NBPN (Cho-NBPN) did not label F-CLIP-170 (Supplementary Fig. 6d). P5-NBPN labeling was efficiently competed by P5 (Fig. 2a) and 7-OH-P5 (Supplementary Fig. 6e) but not by 22(R)-hydroxycholesterol (OH-Cho) or biotin. CLIP-170 was labeled by P5-NBPN not only as purified protein but also in whole-cell extracts (Fig. 2b). In addition, CLIP-170 was captured on P5-NBPN–bearing magnetic beads without UV irradiation (Fig. 2c).

We tested whether P5-NBPN could label other proteins. A microtubule-associated protein, tau, was not labeled by P5-NBPN (Supplementary Fig. 7). Another P5-binding protein,

MAP2c, was labeled by P5 as a purified protein but not in whole-cell extracts. The third protein is a CLIP-170 family member, CLIP-115, which could not be induced by P5 to promote micro-tubule polymerization and was nonspecifically labeled by both Cho-NBPN and P5-NBPN (Supplementary Fig. 8). These results suggest that P5 targets CLIP-170 specifically.

We further truncated CLIP-170 and tested the abilities of various truncated mutants to be labeled by P5-NBPN (Supplementary Fig. 9). A small region at the coiled-coil region of CLIP-170 (residues 920–970) was both required and sufficient for interaction with P5-NBPN but not Cho-NBPN (Fig. 3a). Therefore, we identified the P5-binding region of CLIP-170 in the middle of the coiled-coil domain.

P5 activates CLIP­170 by changing CLIP­170 conformationCLIP-170 exists in two conformations, the folded inactive form and the open active conformation that binds microtubules and the microtubule-associated proteins p150Glued and LIS1 (ref. 27). CLIP-170’s conformation is changed from an open to a folded state upon phosphorylation at Ser311 and nearby residues, resulting in the inhibition of its activity and its dissociation from microtubules16,28. The conformations of purified wild-type CLIP-170 and its phos-phomimetic S311D mutant were examined by EM after negative staining (Supplementary Fig. 10). Most of the wild-type CLIP-170 molecules were linear, either straight or bent and more than 100 nm in length, whereas a few molecules were folded like a circular donut with a 50-nm diameter. This result was consistent with a previous observation using scanning force microscopy27. Pretreatment of cells with the phosphatase inhibitor okadaic acid before CLIP-170 purification increased the number of circular

b 293T WCL

CLIP

170130

170130

P5-CLIP

Input IP: FlagNBPN P5– Cho

MW(kDa)

a

P5-NBPN

Competitor

F-CLIP-170

170

170

P5-CLIP

CLIP

– + + + +

– – P5 OH-Cho Biotin

MW(kDa)

c

F-CLIP-170

170

MW(kDa)

CLIP

Input Pulldown

Bead P5– Cho

Figure 2 | P5 interacts with CLIP­170. (a) P5-NbPN labeling of purified F-clIP-170 and competition by DMSo (−), P5, 22(R)-hydroxycholesterol (oH-cho) or biotin. P5-clIP, clIP-170 labeled with P5-NbPN and detected by streptavidin-conjugated horseradish peroxidase; clIP, clIP-170 detected by immunoblot; MW, molecular weight. (b) labeling of clIP-170 in whole-cell extracts (Wcl) by DMSo (−), P5-NbPN (P5) or cho-NbPN (cho) before immunoprecipitation of F-clIP-170 by antibody to Flag. Input, immunoblot with clIP-170 without immunoprecipitation. (c) Analysis of P5–clIP-170 interaction without Uv crosslinking. Purified F-clIP-170 was allowed to react with DMSo (−), P5-NbPN (P5) or cho-NbPN (cho) immobilized on beads, and the amounts of pulled-down clIP-170 proteins were detected by immunoblot. Full blot images are shown in Supplementary Figure 17.

a

0

50

100

Perc

enta

ge o

f mol

ecul

es

CLIP-170 WT WT SD SD SD– OA – – –

164 147 205 198 240n 308 209

WTOA

WTOA

– P5 P4 – P5 P4–

Folded

Openb

P5-NBPNLabeling

CLIP890–990GFP-CLIP920–970

H1TT6T5T873T920T4T3TN970

CLIP-170

++

++++++––+

+1392348

644828

9711059

Coiled-coil

873920

920 970Zn

1

GFP–

348

MT-binding

Figure 3 | P5 changes the conformation of CLIP­170. (a) Detection of the P5-binding region in clIP-170. the protein structure of clIP-170 and its various deletion mutants are shown. the abilities of each peptide to bind to P5-NbPN are shown at the left. Mt-binding, microtubule-binding domain; Zn, zinc knuckle. (b) P5 changes the conformation of clIP-170. right, electron micrographs of clIP-170 in the open and folded conformations. the percentage of the open (gray bars) and the folded (black bars) molecules are shown in the bar graphs. Wt, wild-type clIP-170; SD, the phosphomimetic S311D mutant of clIP-170; oA, okadaic acid; P4, progesterone. Scale bar, 50 nm. n represents the number of molecules being examined for each condition.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology 639

articleNaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

CLIP-170 molecules (Fig. 3b), consistent with the results in the previous report that phosphorylation leads to CLIP-170 folding28. Incubation with P5, but not P4, increased the proportion of oka-daic acid–pretreated CLIP-170 in the open form. Similarly, P5 also increased the proportion of CLIP-170S311D mutant in the open form. It showed that P5, but not P4, promotes conformational change of CLIP-170 from a folded to an open state.

To investigate the consequence of conformational change upon P5 binding, we analyzed the binding of CLIP-170 to the micro-tubule and its associated proteins, such as p150Glued and LIS1. By the microtubule-pelleting assay, the association of CLIP-170 (Fig. 4a) or CLIP-170S311D (Supplementary Fig. 11a) to microtubules was increased by P5 but not by P4 or OH-Cho. The amounts of p150Glued precipitated by CLIP-170 (Supplementary Fig. 11b) or CLIP-170S311D (Supplementary Fig. 11c) were increased by P5 but not by P4 or OH-Cho. P5 also increased the interaction of CLIP-170 with LIS1 (Fig. 4b). Furthermore, P5 enhanced the ability of CLIP-170 to promote microtubule polymerization from pure tubulin (Fig. 4c). These results indicate that P5 opens up CLIP-170 to facilitate its binding to microtubules, p150Glued and LIS1 and to promote CLIP-170–dependent microtubule polymerization.

To examine the interaction between CLIP-170 and micro tubules in cells, we further examined their intracellular localization by immunofluorescence. In all of the control shluc cells, CLIP-170 was distributed throughout the cytoplasm, and some molecules colocalized with microtubule ends, forming filamentous struc-tures (Fig. 4d). After depleting SCC with shSCC#1, CLIP-170

staining appeared as dots that were not localized together with microtubules in most cells but were localized on filamentous microtubule strands in only 16 ± 2% of cells (n = 824 cells from three independent experiments). After P5 treatment of SCC-depleted cells, CLIP-170 staining was filamentous and localized together with microtubules in 90 ± 2% of cells (n = 815). P5 also increased the comet length of EGFP-CLIP-170S311D in U2OS cells (Supplementary Fig. 12a), supporting the notion that P5 changes the conformation of CLIP-170S311D. These results indicate that P5 activates CLIP-170.

P5 and CLIP­170 coordinately regulate microtubule assemblyTo further investigate the interaction between P5 and CLIP-170, we depleted CLIP-170 expression from Y1 cells using shRNA delivered by lentivirus (Fig. 5a). This greatly reduced the amount of CLIP-170 but did not affect CLIP-115 expression, confirming the specificity of shClip-170. To determine the effect of CLIP-170 on microtubule assembly, we measured microtubule growth after it was depolymerized by nocodazole. Microtubule regrowth was delayed in cells deficient in Clip1 (henceforth referred to as CLIP-170) (Fig. 5b,c and Supplementary Fig. 12b) and was restored by expressing exogenous CLIP-170. It indicates that CLIP-170, like P5, is required for microtubule assembly. We also examined the number of growing microtubules using the microtubule plus-end marker EB1 (Supplementary Fig. 13a). Depletion of SCC or CLIP-170 reduced the number of EB1 comets (Fig. 5d) but did not affect EB1 expression (Supplementary Fig. 13b). P5 treatment rescued

shSCC#1 + P5

Left Right

shSCC#1

Left Right

shluc

Left Right

d

CLI

P-17

0Tu

bC

LIP-

170

Tub

a

1

F-CLIP-170/293T WCL + 0.1 µM MTs

OH-Cho– P5 P4

CLIP

S P S P S P S P

Tub

1.9 1.1 1

b

0

1

2

3

Perc

enta

ge p

ulle

d do

wn

-P5

P4

OC

F-CLIP-170 F-CLIP-170S311D

p150 LIS1

–P5

P4

OC–

P5

P4

OC–

P5

P4

OC

0

0.6

1.2

1.8

0 40 80Time (min)

Bu�erF-CLIP-170

F-CLIP-170 + P5c

MT

(∆A

)

Figure 4 | P5 activates CLIP­170 and regulates its location on microtubules. (a) Detection of the association of microtubules (Mts) with F-clIP-170 in 293t whole-cell extract (Wcl) after microtubules (Mts) were precipitated and detected by immunoblotting. the numbers under the panels are the relative amounts of clIP-170. Full blot images are shown in Supplementary Figure 18. S, supernatant; P, pellet; tub, tubulin staining. (b) P5 increases binding of wild-type F-clIP-170 and phosphomimetic clIP-170S311D to p150 and lIS1. the amount of p150 or lIS1 precipitated by antibody to Flag after expression of F-clIP-170 or F-clIP-170S311D in cells was measured by immunoblotting. Data from three independent experiments are represented as mean ± s.e.m. (c) P5 enhances clIP-170–dependent microtubule polymerization measured by increased absorbance (∆A) reading. (d) P5 is required for the localization of clIP-170 to the microtubules. localization of clIP-170 and microtubules was detected by immunostaining with antibodies against clIP-170 and tubulin (tub), respectively. cells were infected with lentivirus carrying luc control or SCC-targeting shrNA in the presence or absence of P5. the boxed areas are magnified and shown at the right. Arrowheads point to colocalization of clIP-170 with microtubules. Scale bars, 10 μm.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

6 40 nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology

article NaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

the numbers of EB1 comets in SCC- but not CLIP-170–depleted cells, indicating that CLIP-170 is required for P5’s effect on micro-tubule assembly.

We have also studied the functional interaction of P5 and CLIP-170 in zebrafish. Two zebrafish CLIP-170 genes, clip1a and clip1b, exist in the Ensembl Genome Browser database and in ZFIN. The clip1a gene is located on zebrafish chromosome 5 and encodes a protein of 1,411 residues with high sequence identity with human CLIP-170 throughout the entire length (Supplementary Fig. 14). Zebrafish clip1b is on chromosome 10, encodes a smaller protein (787 residues) that is undetectable during embryonic development and is therefore less relevant to the current study. To understand the role of embryonic clip1, antisense morpholino oligonucleo-tide MO1 was designed to block clip1a expression in zebrafish embryos. Clip1a MO1 blocked the expression of clip1a-GFP in zebrafish embryos (Supplementary Fig. 15), and the embryo lysate could no longer support P5-induced microtubule assembly (Fig. 5e). Lysate from embryos injected with control morpholino oligonucleotide, however, supported more microtubule assembly when supplemented with P5 (Supplementary Fig. 16). These results confirm that in zebrafish embryos CLIP-170 is required for P5 to promote microtubule polymerization.

P5 and CLIP­170 coordinately regulate cell movementTo investigate the physiological role of P5 and CLIP-170, we ana-lyzed zebrafish epiboly movement. Severe and mild epiboly delays were detected after clip1a expression was blocked by clip1a MO1 or MO2, and the injection of human CLIP-170 mRNA rescued the delay (Fig. 6a). The amount of endogenous microtubule was

also reduced in embryos injected with scc or clip1a morpholino oligo nucleotides (Fig. 6b), and thus depletion of CLIP-170 pheno-copies cyp11a1 (henceforth scc) deficiency.

We investigated the interaction of clip1a and scc in epiboly migration. Suboptimal amounts of scc morpholino oligonucleotide and clip1a MO1 had no effect on epiboly migration when injected individually, but together they retarded epiboly synergistically (Fig. 6c). Moreover, though P5 facilitated epiboly migration in embryos injected with scc morpholino oligonucleotide, it did not rescue epiboly when clip1a and scc morpholino oligonucleotides were injected together (Fig. 6d). P5 also failed to promote micro-tubule assembly when lysate was prepared from embryos injected together with scc and clip1a morpholino oligonucleotides (Fig. 6e). These results show that CLIP-170 mediates P5 functions in microtubule assembly and embryonic movement. As P5 inter-acts with CLIP-170 at residues 920–970, we overexpressed GFP-CLIP-170890–990 in zebrafish embryos to compete with endogenous clip1a for P5 binding, and this overexpression led to epiboly delay (Fig. 6f). These results collectively indicate that P5 binds CLIP-170 to promote embryonic cell movement and microtubule growth, and the disruption of the P5–CLIP-170 interaction leads to the defect in embryonic epiboly migration.

DISCUSSIONIn this study, we demonstrated that P5 bound CLIP-170, a +TIP, and changed its conformation. P5 and CLIP-170 coordinately controlled the speed of microtubule growth and cell migration persistence.

a

0

2550

75

100

Perc

enta

geof

em

bryo

s

Ctr #1 #1 #2 #2clip1a MO– +–+hCLIP-170 –

34 32 26 30 42n

Mild delaySevereNormal b

scc

Tub-f

Tub-t

CtrMO

– +MT

clip

1a

– –Taxol

e

MT

Tub-f

Tub-t

sccclip1asccMO

– + – +P5

f

40

50

60

70

80

Epib

oly

(%)

GFP GFP-CLIP890–990

P = 1 × 10–24

23 46

– ––+Ctr MO

c

clip1a MO1 – LowLow–

50

60

70

80

Epib

oly

(%)

P = 2 × 10–53

P = 2 × 10–35

P = 4 × 10–76

Low Low––scc MO

42 50 72 89

d

+ ++– –clip1a MO1 – +–– +

P5 – ++– –

50

55

60

65

70

Epib

oly

(%)

P = 1 × 10–34

4 × 10–27 9 × 10–35

P = 2 × 10–41

P = 8 × 10–41

Ctr MO – ––+ –scc MO

67 48 35 53 61

Figure 6 | P5 and CLIP­170 coordinately regulate microtubule assembly and epiboly movement during zebrafish development. (a) clIP-170 promotes zebrafish epiboly movement. the degree of zebrafish embryonic cell migration at 9 h.p.f. can be categorized as normal, mild or severe epiboly delay. the bar graph shows the distribution of embryos at these stages after being injected with control (ctr), clip1a Mo1 or Mo2, with or without human CLIP-170 mrNA (hclIP-170). (b) Detection of microtubule from zebrafish injected with control (ctr), scc or clip1a Mo1. taxol is a positive control. Mt, microtubule; tub-f, free tubulin; tub-t, total tubulin; Mo, morpholino oligonucleotide. Full blot images are shown in Supplementary Figure 18. (c) scc and clip1a synergistically promote zebrafish epiboly. the extent of epiboly movement of embryos injected with control, scc or clip1a Mo1 is shown as mean ± s.e.m. low, suboptimal amounts of Mos. (d,e) P5 depends on clip1a in promoting zebrafish epiboly (d) and increasing microtubule amounts (e). (f) overexpression of the GFP-clIP890–990 delays zebrafish epiboly movement. Data shown represent mean ± s.e.m.

ba

shC

lip-1

70sh

luc

shC

lip-1

70F-

CLI

P-17

0

0 min

0 min

0 min

1 min 3 min

1 min 3 min

1 min 3 min

Clip-170Luc

Tub

170

130

55

Clip-170

Clip-115

F-hCLIP-170 – – +

shRNA

F-CLIP-170

c

0

7

14

0 3 6 9Time (min)

shluc

shClip-170

shClip-170/F-CLIP-170

MT

leng

th (µ

m)

00.51.51.5

2.02.5

MT

amou

nt (A

U)

–P5

e

clip1aMO1

CtrMO

d

0

4

8

12

Luc SCC– – P5

ClipshRNA SCC Clip– P5

P = 2 × 10–11

4 × 10–115 × 10–12

P = 4 × 10–11

EB1 c

omet

s(n

o. p

er 10

0 µm

2 )

Figure 5 | P5 and CLIP­170 coordinately regulate microtubule assembly. Y1 cells were infected with lentivirus harboring luc control, Clip-170–targeting shrNA and/or lentivirus harboring human F-clIP-170 cDNA. (a) Immunoblotting shows efficient depletion of clip-170. Full blot images are shown in Supplementary Figure 18. (b) After nocodazole treatment, microtubules were allowed to regrow. Microtubule morphology was monitored by immunostaining. Scale bars, 10 μm. (c) clIP-170 was required for the growth of microtubules (Mt). the lengths of microtubule filaments are shown as mean ± s.e.m. (d) P5 controls microtubule assembly through clIP-170. eb1 comets were visualized after immunostaining in control, SCC- or Clip-170–deficient cells. the numbers of eb1 comets per 100 μm2 are shown as mean ± s.e.m. (e) P5 enhances microtubule polymerization after embryo lysates were injected with control (ctr) but not clip1a Mo1. Data shown are mean ± s.e.m. AU, arbitrary units.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology 6 41

articleNaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

This P5–CLIP-170 machinery was conserved in zebrafish embryos and mammalian cells. Our results reveal a new steroid signaling pathway and a new activator for the +TIP network.

We have identified CLIP-170 as the P5-binding protein by designing biologically active P5 photoaffinity probes that can pen-etrate the cell membrane and mimic P5 functions. P5 was deriva-tized at the C7 position to preserve the hydroxyl group at C3 and the acetyl group at C17, which may be important for P5 to interact with its receptor. P5-NBPN was the most effective probe and func-tioned equally well as endogenous P5, whereas other probes did not stabilize microtubules well. Among these less effective probes, P5s-NBPN has a shorter linker from C7 to NBPN, thus increasing its steric perturbation, and P5β-NBPN is the epimer of P5-NBPN with the β configuration at C7. The use of these probes indicated that spatial arrangement at the C7 position of P5 was essential for the probe to work well. Indeed 7-OH-P5, a natural P5 derivative with an α configuration at C7, also functioned in our photoaffinity labeling and microtubule assembly assay. 7-OH-P5 is an active neurosteroid13, although its mode of action is still unknown. Our result indicates that 7-OH-P5 may also activate neuronal activities via CLIP-170. Thus, our studies have exemplified a success-ful application of photoaffinity labeling to the understanding of steroid or neurosteroid signaling.

We calculated that P5-NBPN labeled F-CLIP-170 at a half-maximal concentration of 60 nM. This finding is comparable with our previous data showing that 100 nM of P5 is sufficient to res-cue P5-deficient embryos2. The concentration of P5 in the circula-tion is low (~14 nM)33. In steroidogenic cells, P5 is a substrate for the enzymes CYP17 and HSD3B, which have Km values of 5 μM and 0.2–1.6 μM toward P5, respectively34,35. These high Km values suggest that the local concentration of P5 in steroidogenic cells should be much higher than that in the circulation. In the brain, P5 is quite abundant, with concentrations at 150–400 nmol per kg tissue36, suggesting that there is a high chance that P5 can interact with CLIP-170 to carry out its biological functions.

P5 also binds MAP2. MAP2 promotes microtubule assembly by binding the surface of microtubules, but it is unclear how P5 enhances MAP2 function. MAP2 is present in dendrites of the brain but is not expressed in early zebrafish embryos until neural differentiation at 19 h post fertilization (h.p.f.) (ZFIN ID: ZDB-PUB-040907-1). In contrast, P5 is present in early embryos from fertilization, and defects caused by P5 deficiency are observed in 6-h.p.f. zebrafish embryos2. As P5 affects the development of early embryos, P5 has to accomplish its functions through additional targets other than MAP2. CLIP-170 was maternally and universally expressed like P5, activated by P5 and required for P5-promoted microtubule assembly and embryonic epiboly movement. Thus CLIP-170 is perhaps a more relevant P5 receptor in many cells.

CLIP-170 is dynamically localized to the growing ends of microtubules, and its affinity for microtubules, tubulin and +TIPs determines the dynamic localization of CLIP-170 (refs. 37–40). Phosphorylation dissociates CLIP-170 from microtubules16,27,28. However, the activator that facilitates CLIP-170 localization to microtubules has not been discovered until now. Here we dem-onstrated that P5 increases CLIP-170 affinity to +TIPs (p150Glued and LIS1) and promotes the activity of CLIP-170 in microtubule polymerization. P5 stimulated CLIP-170 functions regardless of its phosphorylation status as P5 promoted the interaction of wild-type and phosphomimetic CLIP-170 with +TIPs. Moreover, by cooperating with p150Glued and LIS1, CLIP-170 modulates the localization of the dynein–dynactin complex to microtubules and might regulate cargo-microtubule capture20,27. The activation of CLIP-170 by P5 implies that P5 is involved in this process by pro-moting the formation of the CLIP-170–p150Glued–LIS1 complex.

CLIP-170 consists of the N-terminal microtubule-binding domain, the C-terminal zinc knuckle and the middle coiled-coil

domain. The coiled-coil domain usually provides an oligomeriza-tion interface that modulates protein-protein interaction or ligand binding41; it can also control protein conformation. The long coiled coil is usually composed of several discontinuous α-helical coiled coils linked by kinks or loops; it is flexible and bends relatively easily42,43. The coiled coil is stabilized when the structure becomes more hydrophobic, whereas hydrophilicity contributes to curva-ture. Increasing hydrophobility by replacing Asp137 with leucine creates a straighter tropomyosin molecule44; conversely, phospho-rylation causes CLIP-170 to fold28. P5 is a hydrophobic compound that increases the hydrophobility of CLIP-170 when bound. P5 may recognize the hydrophobic core inside the heptad repeat of the coiled coil, helping the arrangement of the hydrophobic side chain, thus contributing to its stability. P5 binding would trigger the transition of kinks (or loops) to α-helices, thus extending the α-helix in the coiled coil of CLIP-170. This mode of conforma-tional change would be similar to that of influenza hemagglutinin, which changes its conformation from discontinuous short coiled coils linked by loops to long extended coiled coils42,43. P5 binding would reduce the curvature of the coiled coil, thus preventing the two ends of CLIP-170 to come together.

We showed here that P5 controlled the migration directional-ity of mouse adrenocortical Y1 cells. In zebrafish, P5 exerted its function through CLIP-170, which sets the front-rear polarity of a cell16,19. Thus P5 not only increased microtubule polymerization and cell migration but also set up cell polarity through its interac-tion with CLIP-170. Furthermore, P5 effects have been detected in both cultured mouse adrenocortical Y1 cells and zebrafish embryos, indicating functional conservation of P5 and CLIP-170 action from fish to mammals.

P5 has been explored as a drug candidate for the treatment of schizophrenia and depressive disorders9, and MAP2 has been hypothesized as a P5 target7. We demonstrated here that P5 bound and activated CLIP-170, which was required for P5 action. Therefore, CLIP-170 can be considered another P5 target besides MAP2. CLIP-170 establishes neuronal polarity, controls axon and dendrite for-mation and mediates neuronal motility23–25. P5 may act through CLIP-170 in the treatment of mental disorders and neurodegenera-tive diseases. The clinical application of P5 and CLIP-170 action may not be limited to neuronal disorders as CLIP-170 enhances taxol sensitivity in breast cancer26. This implies P5 that may be explored in combination therapies together with taxol for cancer treatment.

received 24 May 2013; accepted 24 July 2013; published online 18 august 2013

mETHODSMethods and any associated references are available in the online version of the paper.

Accession codes. Swiss-Prot Ensembl Genome Browser. Details for clip1a and clip1b are listed under accession codes ENSDARG00000078722 and ENSDARG00000079483, respectively.

references1. Hu, M.C. et al. Steroid deficiency syndromes in mice with targeted disruption

of Cyp11a1. Mol. Endocrinol. 16, 1943–1950 (2002).2. Hsu, H.J., Liang, M.R., Chen, C.T. & Chung, B.C. Pregnenolone stabilizes

microtubules and promotes zebrafish embryonic cell movement. Nature 439, 480–483 (2006).

3. Grigoryev, D.N., Long, B.J., Njar, V.C. & Brodie, A.H. Pregnenolone stimulates LNCaP prostate cancer cell growth via the mutated androgen receptor. J. Steroid Biochem. Mol. Biol. 75, 1–10 (2000).

4. Iqbal Choudhary, M. et al. Pregnenolone derivatives as potential anticancer agents. Steroids 76, 1554–1559 (2011).

5. Flood, J.F., Morley, J.E. & Roberts, E. Memory-enhancing effects in male mice of pregnenolone and steroids metabolically derived from it. Proc. Natl. Acad. Sci. USA 89, 1567–1571 (1992).

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

6 42 nature chemical biology | vol 9 | october 2013 | www.nature.com/naturechemicalbiology

article NaTURE CHEmICaL bIOLOGy doi: 10.1038/nchembio.1321

6. Guth, L., Zhang, Z. & Roberts, E. Key role for pregnenolone in combination therapy that promotes recovery after spinal cord injury. Proc. Natl. Acad. Sci. USA 91, 12308–12312 (1994).

7. Bianchi, M. & Baulieu, E.E. 3β-Methoxy-pregnenolone (MAP4343) as an innovative therapeutic approach for depressive disorders. Proc. Natl. Acad. Sci. USA 109, 1713–1718 (2012).

8. Marx, C.E. et al. Proof-of-concept trial with the neurosteroid pregnenolone targeting cognitive and negative symptoms in schizophrenia. Neuropsychopharmacology 34, 1885–1903 (2009).

9. Ritsner, M.S. et al. Pregnenolone and dehydroepiandrosterone as an adjunctive treatment in schizophrenia and schizoaffective disorder: an 8-week, double-blind, randomized, controlled, 2-center, parallel-group trial. J. Clin. Psychiatry 71, 1351–1362 (2010).

10. Irwin, R.P. et al. Pregnenolone sulfate augments NMDA receptor mediated increases in intracellular Ca2+ in cultured rat hippocampal neurons. Neurosci. Lett. 141, 30–34 (1992).

11. Sabeti, J., Nelson, T.E., Purdy, R.H. & Gruol, D.L. Steroid pregnenolone sulfate enhances NMDA-receptor–independent long-term potentiation at hippocampal CA1 synapses: role for L-type calcium channels and σ-receptors. Hippocampus 17, 349–369 (2007).

12. Kavaliers, M. & Wiebe, J.P. Analgesic effects of the progesterone metabolite, 3 α-hydroxy-5 α-pregnan-20-one, and possible modes of action in mice. Brain Res. 415, 393–398 (1987).

13. Matsunaga, M., Ukena, K., Baulieu, E.E. & Tsutsui, K. 7α-Hydroxypregnenolone acts as a neuronal activator to stimulate locomotor activity of breeding newts by means of the dopaminergic system. Proc. Natl. Acad. Sci. USA 101, 17282–17287 (2004).

14. Fontaine-Lenoir, V. et al. Microtubule-associated protein 2 (MAP2) is a neurosteroid receptor. Proc. Natl. Acad. Sci. USA 103, 4711–4716 (2006).

15. Galjart, N. CLIPs and CLASPs and cellular dynamics. Nat. Rev. Mol. Cell Biol. 6, 487–498 (2005).

16. Nakano, A. et al. AMPK controls the speed of microtubule polymerization and directional cell migration through CLIP-170 phosphorylation. Nat. Cell Biol. 12, 583–590 (2010).

17. Li, H. et al. Phosphorylation of CLIP-170 by Plk1 and CK2 promotes timely formation of kinetochore-microtubule attachments. EMBO J. 29, 2953–2965 (2010).

18. Arnal, I., Heichette, C., Diamantopoulos, G.S. & Chretien, D. CLIP-170/tubulin-curved oligomers coassemble at microtubule ends and promote rescues. Curr. Biol. 14, 2086–2095 (2004).

19. Fukata, M. et al. Rac1 and Cdc42 capture microtubules through IQGAP1 and CLIP-170. Cell 109, 873–885 (2002).

20. Coquelle, F.M. et al. LIS1, CLIP-170’s key to the dynein/dynactin pathway. Mol. Cell Biol. 22, 3089–3102 (2002).

21. Watson, P. & Stephens, D.J. Microtubule plus-end loading of p150Glued is mediated by EB1 and CLIP-170 but is not required for intracellular membrane traffic in mammalian cells. J. Cell Sci. 119, 2758–2767 (2006).

22. Lomakin, A.J. et al. CLIP-170–dependent capture of membrane organelles by microtubules initiates minus-end directed transport. Dev. Cell 17, 323–333 (2009).

23. Kholmanskikh, S.S. et al. Calcium-dependent interaction of Lis1 with IQGAP1 and Cdc42 promotes neuronal motility. Nat. Neurosci. 9, 50–57 (2006).

24. Swiech, L. et al. CLIP-170 and IQGAP1 cooperatively regulate dendrite morphology. J. Neurosci. 31, 4555–4568 (2011).

25. Neukirchen, D. & Bradke, F. Cytoplasmic linker proteins regulate neuronal polarization through microtubule and growth cone dynamics. J. Neurosci. 31, 1528–1538 (2011).

26. Sun, X. et al. Microtubule-binding protein CLIP-170 is a mediator of paclitaxel sensitivity. J. Pathol. 226, 666–673 (2012).

27. Lansbergen, G. et al. Conformational changes in CLIP-170 regulate its binding to microtubules and dynactin localization. J. Cell Biol. 166, 1003–1014 (2004).

28. Lee, H.S. et al. Phosphorylation controls autoinhibition of cytoplasmic linker protein-170. Mol. Biol. Cell 21, 2661–2673 (2010).

29. Small, J.V., Geiger, B., Kaverina, I. & Bershadsky, A. How do microtubules guide migrating cells? Nat. Rev. Mol. Cell Biol. 3, 957–964 (2002).

30. Mimori-Kiyosue, Y., Shiina, N. & Tsukita, S. The dynamic behavior of the APC-binding protein EB1 on the distal ends of microtubules. Curr. Biol. 10, 865–868 (2000).

31. Clark, M.A. & Shay, J.W. The role of tubulin in the steroidogenic response of murine adrenal and rat Leydig cells. Endocrinology 109, 2261–2263 (1981).

32. Heal, W.P., Dang, T.H. & Tate, E.W. Activity-based probes: discovering new biology and new drug targets. Chem. Soc. Rev. 40, 246–257 (2011).

33. Romeo, E. et al. Effects of antidepressant treatment on neuroactive steroids in major depression. Am. J. Psychiatry 155, 910–913 (1998).

34. Grigoryev, D.N. et al. Cytochrome P450c17-expressing Escherichia coli as a first-step screening system for 17α-hydroxylase-C17,20-lyase inhibitors. Anal. Biochem. 267, 319–330 (1999).

35. Rhéaume, E. et al. Structure and expression of a new complementary DNA encoding the almost exclusive 3 β-hydroxysteroid dehydrogenase/∆5-∆4-isomerase in human adrenals and gonads. Mol. Endocrinol. 5, 1147–1157 (1991).

36. Schumacher, M. et al. Steroid hormones and neurosteroids in normal and pathological aging of the nervous system. Prog. Neurobiol. 71, 3–29 (2003).

37. Komarova, Y. et al. EB1 and EB3 control CLIP dissociation from the ends of growing microtubules. Mol. Biol. Cell 16, 5334–5345 (2005).

38. Peris, L. et al. Tubulin tyrosination is a major factor affecting the recruitment of CAP-Gly proteins at microtubule plus ends. J. Cell Biol. 174, 839–849 (2006).

39. Dragestein, K.A. et al. Dynamic behavior of GFP-CLIP-170 reveals fast protein turnover on microtubule plus ends. J. Cell Biol. 180, 729–737 (2008).

40. Bieling, P. et al. CLIP-170 tracks growing microtubule ends by dynamically recognizing composite EB1/tubulin-binding sites. J. Cell Biol. 183, 1223–1233 (2008).

41. Burkhard, P., Stetefeld, J. & Strelkov, S.V. Coiled coils: a highly versatile protein folding motif. Trends Cell Biol. 11, 82–88 (2001).

42. Hamdi, M., Ferreira, A., Sharma, G. & Mavroidis, C. Prototyping bio-nanorobots using molecular dynamics simulation and virtual reality. Microelectron. J. 39, 190–201 (2008).

43. Carr, C.M. & Kim, P.S. A spring-loaded mechanism for the conformational change of influenza hemagglutinin. Cell 73, 823–832 (1993).

44. Moore, J.R., Li, X., Nirody, J., Fischer, S. & Lehman, W. Structural implications of conserved aspartate residues located in tropomyosin’s coiled-coil core. BioArchitecture 1, 250–255 (2011).

acknowledgmentsWe thank S. Takashima (Osaka University) and N. Galjart (Erasmus Medical Center) for CLIP-170 plasmids, S. Tsukita (Kyoto University) for the EB1-GFP plasmid, S. Halpain (University of California–San Diego) for the MAP2c plasmid and Y. Mimori-Kiyosue (RIKEN) for the GFP-CLIP-115 plasmid, generated by A. Akhmanova (Utrecht University). We thank W.-y. Ku and C.-w. Hsu for help in drawing the graphical abstract. RNAi reagents were obtained from the National RNAi Core Facility Platform at Academia Sinica (NSC 97-3112-B-001-016). The wild-type zebrafish were from Taiwan Zebrafish Core Facility at Academia Sinica (NSC 100-2321-B-001-030). C.-T.C. was supported by the National Science Council (NSC 97-2113-M-002-002-MY3 and NSC99-3112-B-001-002) and the National Taiwan University, and B.-c.C. was supported by the National Science Council (NSC101-2321-B-001-001, NSC 102-2311-B-001-013-MY3), the National Health Research Institute (NHRI-EX102-10210SI) and Academia Sinica.

author contributionsJ.-H.W. designed the study, performed most of the experiments and wrote the manu-script; M.-R.L. synthesized P5s-NBPN, OH-NBPN and Cho-NBPN; C.-H.C. synthesized P5-NBPN and 7-OH-P5; S.-K.T. examined zebrafish clip1 expression patterns; T.-C.H. synthesized P5β-NBPN; S.-P.L. stained CLIP-170 for EM analysis; Y.-R.C. performed LC/MS/MS identification; C.-T.C. devised P5-photoaffinity probes and supervised syntheses of P5 derivatives; B.-c.C. designed the study, oversaw its execution and wrote the manuscript.

competing financial interestsThe authors declare no competing financial interests.

additional informationSupplementary information and chemical compound information is available in the online version of the paper. Reprints and permissions information is available online at http://www.nature.com/reprints/index.html. Correspondence and requests for materials should be addressed to C.-T.C. or B.-c.C.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

nature chemical biologydoi:10.1038/nchembio.1321

ONLINE mETHODSPreparation and characterization of photoaffinity probes and their inter-mediates are described in detail in Supplementary Notes 1–6. The synthesis and characterization of 7-OH-P5 is described in Supplementary Note 7.

Reagent, antibody and plasmid. Pregnenolone, progesterone, okadaic acid, 20α-hydroxycholesterol, 22(R)-hydroxycholesterol, DL-aminoglutethimide, Flag pep-tide, anti-Flag (Clone M2, 500× dilution), anti–α-tubulin (Clone DM1A, 5,000× and 1,000× dilution for western blotting and immunofluorescence detection, respectively) and taxol were from Sigma. The polyclonal CYP11A1 antibody has been described previously45. Monoclonal anti-p150Glued (BD Biosciences Clone #1/p150Glued) was used at 1,000× dilution, anti-CLIP-115 (BD Biosciences Clone #14/CLIP-115) was used at 200× dilution, and anti-EB1 (BD Biosciences Clone #5/EB1) was used at 2,000× and 100× dilution for western blotting and immunofluorescence, respectively. Polyclonal anti-LIS1 (Abcam #ab2607) was used at 1,000× dilution, and Streptavidin-HRP (BioLegend #405210) was used at 1,000× dilution. Mouse CLIP-170 (Santa Cruz, Clone #F-3) antibodies were diluted 100× for immunoblotting, and rabbit CLIP-170 antibodies (Santa Cruz, Clone #H-300) were diluted 1,000× for immunostaining. Truncated CLIP-170 fragments were generated by PCR using the follow-ing primer sets. Forward primers: ATGAGTATGCTAAAGCCAAGT (H1), TCCGGTACCACTGCCCTC (T), AAAGAGATGGAAGCCTTGAG (T6), CAAGAAACTGTAAATAAGTT (T5), CTGATAAAGGCAAAGGAAAAAC (T873), ACAAAGGCTAATGAAAATGCAA (T920), ACAAGCCACAACC AGTGTC (T4), ACTCTGGCCTCCTTGGAG (T3). Reverse primers: GATCTTCCTGGCGTAACG (H1) and TCAGAAGGTTTCGTCGTCAT (all T fragments). These PCR fragments as well as pEGFP-CLIP-170, pEGFP-CLIP-170S311D (ref. 16), pEGFP-CLIP-115 (ref. 46) and pEGFP-MAP2c47 were subcloned into pCMV-Tag2 for protein expression in 293T cells. H295 cells were pretreated with 400 μM DL-aminoglutethimide for 24 h to block P450scc activity. The amount of P5 in the culture medium were measured by ELISA (ALPCO) after preincubation in 10 μM trilostane for 30 min followed by incub ation in 12.5 μM 20α-hydroxycholesterol for 4 h.

Cell culture and lentivirus-mediated RNAi. Adrenocortical Y1 and H295 cells were grown in DMEM-F12, whereas 293T and 293FT cells were grown in DMEM medium; both were supplemented with 10% FBS and maintained at 5% CO2 and 37 °C. For the packaging of recombinant lentivirus, 293FT cells were transfected together with packaging vector psPAX2, the envelope- expressing plasmid pMD2.G plus plasmids for shRNA sequence or for Flag-human CLIP-170 expression, as previously described48. The sequences of the shRNAs are as follows: shluc, CCTAAGGTTAAGTCGCCCTCG; shSCC#1, TGACCTGGTGCTTCGTAATTA; shSCC#2, TGGCGACAATGGTTGGCTA AA; shSCC#3, GGTGGCCTATCACCAGTATTA; shSCC#4, GTCCATCAG CAGTGTTATATT; shSCC#5, GAAAGACCGAATCGTCCTAAA; shClip-170, CGCTGAATTTGCTGAGTTAAA.

Time-lapse tracking for cell migration and microtubule growth. To track cell migration, 2 d after infection with shRNA-carrying lentivirus, Y1 cells were seeded in a 12-well plate and incubated overnight before serum starvation for 24 h. Cell images were taken at 5-min intervals over 180 min after the sup-plementation with 2% FBS ± 1μM P5 in a temperature- and CO2-controlled chamber attached to a confocal microscope (ZEISS LSM 510 META NLO). For microtubule detection, H295 cells were transfected with pEB1-EGFP30, and 24 h later they were treated with DMSO or DL-aminoglutethimide in serum-free medium for 24 h before stimulation with 2% FBS and immediate imaging. Photos were acquired by the DeltaVision Core Microscope equipped with an EMCCD Cascade II/512 Camera (Applied Precision). Images were analyzed by the Metamorph Image Analysis Software (Molecular Devices).

Microtubule polymerization assay. Proteins for in vitro microtubule polym-erization were prepared by homogenizing 400 embryos (6 h.p.f.) using a Bioruptor (Diagenode) in 1 mL isotonic buffer (0.32 M sucrose, 1 mM EGTA, 1 mM MgCl2, 10 mM phosphate buffer, pH 7) followed by centrifugation for 30 min at 15,000 r.p.m. at 4 °C. The supernatant (150 μL) was mixed with 10 μM test steroids in 150 μL 2× microtubule polymerization buffer (200 mM MES, pH 6.7, 4 mM EGTA, 2 mM MgCl2, 50% glycerol, 2 mM GTP) and incu-bated at 37 °C for 1 h. The mixture was ultracentrifuged at 100,000g for 45 min, and proteins in the supernatant and pellet were analyzed by SDS-PAGE. The microtubule absorption assay was performed by taking the absorbance

of 50 μL microtubule mixture containing 100 μg tubulin plus 100 ng purified Flag-CLIP-170 in the presence or absence of H2O, DMSO, 1 μM P5 or 3 μM taxol according to the instructions provided in the Tubulin Polymerization Assay Kit (Cytoskeleton). For the detection of endogenous microtubule abun-dance, 50 embryos were homogenized in 200 μL lysis buffer (100 mM PIPES, pH 6.9, 5 mM MgCl2, 1 mM EGTA, 30% glycerol, 0.1% NP-40, 0.1% TX-100, 0.1% β-mercaptoethanol, 0.001% Antifoam, 0.1 mM GTP and 1 mM ATP) (Cytoskeleton), followed by centrifugation for 30 min at 100,000 r.p.m. at 37 °C. The supernatant and pellet were analyzed by SDS-PAGE. For the micro-tubule regrowth assay, cells were preincubated with 10 μg/ml nocodazole for 1 h to depolymerize microtubules, followed by culture in drug-free medium at 37 °C for the indicated time periods. Cells were then fixed with ice-cold methanol, and newly formed microtubules were detected by immunostaining and immunofluorescence microscopy.

Microtubule-pelleting assay. For the detection of polymerized microtubule, 293T cell extract that transiently expressed F-CLIP-170 or F-CLIP-170S311D was prepared by passing cells through a 26-G needle at 4 °C. The extract was then incubated with 20 μM taxol at 37 °C for 30 min to ensure complete polymeri-zation of microtubule, which was subsequently removed by centrifugation at 150,000g at 4 °C for 90 min. The cell extract (250 μg) in the supernatant was preincubated with 1 μM test steroids for 30 min at 37 °C before addition to the microtubule, which was preformed by stepwise addition of 1 μM, 10 μM and 100 μM taxol into 1 mg/mL pure porcine brain tubulin (Cytoskeleton). After incubating for 15 min at 37 °C, the mixture was centrifuged at 30,000g at 37 °C for 30 min and analyzed by SDS-PAGE.

Photoaffinity labeling. Purified full-length or deleted Flag-CLIP-170 (100 ng) or 250 μg whole-cell lysate from Flag-CLIP-170–expressing 293T cells were incubated with 25 nM photoaffinity probes in 50 μL or 500 μL TEDG buffer (10 mM Tris-HCl, pH 8.5, 1.5 mM EDTA, 1 mM DTT, 10% glycerol) at 37 °C for 30 min. The mixture was irradiated at 365 nm using UV Stratalinker 1800 (Stratagene) for 30 min on ice before analysis by SDS-PAGE. For competi-tion analysis, 1,000-fold excess steroid or biotin was added to the mixture. For pull-down assays, 10 μL Streptavidin Mag Sepharose Beads (GE) were prein-cubated with 1 μM photoaffinity probe in 1 mL TEDG buffer for 1 h, pre-cipitated and washed before incubation with 100 ng pure Flag-CLIP-170 in 1 mL TEDG buffer at 37 °C for 1 h. The materials on the beads were washed and eluted with gel sample buffer. Probe-labeled protein in the gel was rec-ognized by streptavidin-conjugated horseradish peroxidase and visualized by chemiluminescence assays.

To characterize photoaffinity labeling, a standard photoaffinity labeling reaction contains 100 ng purified CLIP-170 and 1 nM to 10 μM P5-NBPN, which were incubated at 37 °C for 30 min before UV irradiation. About 60 nM P5-NBPN was calculated to reach 50% saturation labeling efficiency. P5-NBPN–labeled CLIP-170 was purified by streptavidin magnetic beads (GE), followed by gel electrophoresis and detection by silver staining. The amount of protein in the gel was determined by comparing the band intensity with those of CLIP-170 standards at 30 ng, 15 ng and 7.5 ng. About 12 ng of CLIP-170 was calculated to be labeled by saturating amounts of P5-NBPN using this method. To detect P5-NBPN labeled CLIP-170, 1 μL mixture was dropped on NC membrane (GE) and reacted with streptavidin-conjugated horseradish peroxidase, followed by visualization with chemiluminescence. The amount of P5-NBPN on the membrane was determined using biotinated IgG as the standard. At half-maximal labeling, we detected 5.7 × 10−13 mol P5-NBPN bound to 6 ng (3.5 × 10−14 mol) CLIP-170. The molar ratio of P5-NBPN to CLIP-170 was about 16 to 1.

Isolation of P5-binding protein. About 5,000 6-h.p.f. zebrafish embryos were homogenized in 2 mL TEDG buffer by Bioruptor and labeled with 1 μM P5-NBPN by irradiation at 365 nm for 30 min. P5-NBPN–labeled proteins were enriched via their microtubule association by incubation for 30 min in PEM buffer (100 mM PIPES, 1 mM EGTA, 1 mM MgSO4) with microtubule that was polymerized from pure porcine brain tubulin as described above. Microtubule-bound P5-NBPN–labeled proteins were precipitated by ultra centrifugation and further purified using streptavidin Sepharose beads. Proteins were eluted from streptavidin Sepharose beads with gel sample buffer (50 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.1% Bromophenol blue, 100 mM DTT), separated by SDS-PAGE and stained with SYPRO Ruby (Molecular Probes). Candidate bands were cut, digested and analyzed by LC-MS/MS.

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.

nature chemical biology doi:10.1038/nchembio.1321

Transmission electron microscopic analysis. Purified CLIP-170 or CLIP-170S311D (100 ng each) was incubated with 1 μM test steroids in 50 μL PEM buffer at 37 °C for 30 min before staining in 20 μL 1% uranyl acetate for 1 min and examination using Tecnai G2 Spirit TWIN Electron Microscope (FEI) and photography with a CCD Camera (Gatan).

Measurement of comet length and numbers. U2OS cells that transiently expressed GFP-CLIP-170S311D were incubated with P5 or DMSO for 2 h, and GFP fluorescence was monitored by AxioImager Z1 (Zeiss). The lengths of GFP comets were quantified by Metamorph software (Molecular Devices). The beginning of a GFP comet was defined as the point at which the GFP signal intensity rose rapidly and the end of a comet was the point at which the GFP signal was similar to that in the background. Only cells express-ing similar amounts of GFP-CLIP-170S311D were scored for the measurement of comet length. For EB1 comets, Y1 cells were stained with EB1 antibodies (BD Biosciences Clone #5/EB1, 100× dilution) and monitored by AxioImager Z1. The comet numbers were quantified by the Metamorph software.

Data analysis. Quantification data, including cell migration, epiboly move-ment, microtubule polymerization, microtubule length, comet number, comet length and protein precipitation were analyzed by Excel software (Microsoft) and are shown as mean ± s.e.m. Two-tailed Student’s t-tests were used for statis-tical analysis. The results of P5-NBPN binding affinity were analyzed by Prism software (GraphPad).

LC/MS/MS analysis. For in-gel protein digestion, proteins in the gel was washed with 25 mM ammonium bicarbonate (ABC), pH 8.2, containing 50% acetonitrile (ACN), followed by dehydration with 100% ACN and digestion with trypsin. After digestion, the tryptic peptides were extracted by 25 mM ABC, 0.02% trifluoroacetic acid (TFA), 0.02% TFA in 50% ACN and 100% ACN sequentially. For LC/MS/MS analysis, a nanoUHPLC system (nanoAC-QUITY UPLC, Waters, Millford, MA) coupled online to the nanoelectrospray source of a hybrid quadrupole time-of-flight mass spectrometer (SYNAPT HDMS G2, Waters, Manchester, UK) was used. The sample was injected into a trap column (Symmetry C18, 5 μm, 180 μm × 20 mm, Waters, Milford, MA), and separated online with a reverse-phase column (BEH C18, 1.7 μm, 75 μm × 250 mm, Waters, Milford, MA) at a flow rate of 300 nl/min using 70-min gradi-ent with 5–90% ACN/water. The mobile phase was water with 0.1% formic acid (FA) and acetonitrile (ACN) with 0.1% FA. The MS instrument was operated in the positive ion mode, and data-dependent acquisition method was applied. All of the molecules were initially scanned over the entire m/z range of 400 to 1,600 with a scan time of 0.6 s to select precursor ions with the charge of 2+, 3+ or 4+ and with intensity higher than 2,000 counts. These selected precur-sors were fragmented and scanned over a range of 100 to 1,900 m/z with 0.45-s scan time.

Processing of mass spectra. The spectra were first converted into the mzXML format using massWolf (version 4.3.1) then processed using the UniQua software49. The UniQua parameters were: smoothing = 7, centroiding high = 80%, maximum resolution = 25,000, baseline cutoff = 30 counts. The processed MS/MS spectra were converted into a Mascot generic format (.mgf) by mzXML2Search in trans Proteomics Pipeline (TPP) version 4.4 rev. 1, and then searched against the IPI DANRE protein database version 367 using Mascot version 2.3 (Matrix Science, London, UK) search engine to protein identification. The mass tolerance for the peptide and MS/MS fragment were ± 0.3 Da and ± 0.3 Da, respectively. Only one missing cleavage was allowed for tryptic peptides. Cysteine methylthiolation was set as a fixed modification, and oxidation of methionine was set as a variable modification. Peptides were con-sidered as identified when their individual Mascot ion score was higher than

32 (P < 0.05). The protein was considered as identified when the overall Mascot protein score > 64 and two unique peptides were identified.

Recombinant protein purification. 293T cells in a 15-cm dish were trans-fected with 30 μg plasmids for the overexpression of CLIP-170, CLIP-170S311D, CLIP-115 and MAP2c in pCMV-Tag2 vector using Lipofectamine 2000 (Invitrogen). Two days after transfection, cells were lysed with 3 mL lysis buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 300 mM NaCl, 1% Triton X-100) for 30 min on ice, and the cell lysate was incubated with 40 μL anti-Flag– conjugated protein-G beads. The beads were washed with RIPA buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% NP-40, 1% sodium deoxycholate) five times and PEM buffer five times. Proteins were eluted with 50 μL 200 μg/mL Flag peptides for three times. To avoid CLIP-170 dephosphoryla-tion, cells were treated with 0.3 μM okadaic acid for 2 h before lysis.

Fish maintenance, microinjection, phylogenetic analysis and RT-PCR. The laboratory zebrafish strain TL was maintained following the guidelines set forth by the Academia Sinica Institutional Animal Care and Utilization Committee. Embryos were injected with morpholinos (Gene Tools) at the 1-cell stage, followed by incubation with or without 1 μM steroid or NBPN probes from the 8-cell stage until harvest. Phylogenetic analysis was conducted using the method of maximum likelihood run in the MEGA software, version 5 (ref. 50). The sequences of the morpholino oligonucle-otides are as follows: scc MO, GCCATCACACTCTCTCTCTCTACTT; scc mismatched MO; GCGATGACACTCTGTCTCTGTAGTT; clip1a MO#1, TT TTCCTCTAAAATGGCTGTCAGTC; clip1a mismatched MO#1, TTATGC TGTAAAATGCCTCTCAGTC; clip1a MO#2, TATACTTGCAGTTGTCCT CTCCAAC; clip1a mismatched MO#2, TATAGTTCCACTTCTCCTGTCC AAC. The following primers were used: for clip1a, GGCCTGTTGCAGG AAAAGAG and TTCTCCTGTAGGTTGGCAAG; for clip1b, TTCAGAAG AGCAGAAAACAT and GCTCAACAGTTGTGTCTTCT; for actin, TCACA CCTTCTACAACGAGC TGCG and GAAGCTGTAGCCTCTCTCGGTCAG.

Measurement of the extent of epiboly. The blastomeres in zebrafish embryos were fixed in 4% paraformaldehyde before visualization by staining with NBT/BCIP (Roche) using its endogenous alkaline phosphatase and were photo graphed with a CCD Camera (Zeiss Axiocam HRC) attached to a Z16 APO Microscope (Leica). The distance between the animal pole and the edge of blastomeres as well as the distance between the animal and the vegetable poles were measured, and their ratio represents the extent of epiboly.

45. Hu, M.C., Guo, I.C., Lin, J.H. & Chung, B.C. Regulated expression of cytochrome P-450scc (cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody against bacterially expressed human protein. Biochem. J. 274, 813–817 (1991).

46. Hoogenraad, C.C., Akhmanova, A., Grosveld, F., De Zeeuw, C.I. & Galjart, N. Functional analysis of CLIP-115 and its binding to microtubules. J. Cell Sci. 113, 2285–2297 (2000).

47. Ozer, R.S. & Halpain, S. Phosphorylation-dependent localization of microtubule-associated protein MAP2c to the actin cytoskeleton. Mol. Biol. Cell 11, 3573–3587 (2000).

48. Lai, P.Y. et al. Steroidogenic Factor 1 (NR5A1) resides in centrosomes and maintains genomic stability by controlling centrosome homeostasis. Cell Death Differ. 18, 1836–1844 (2011).

49. Chang, W.H. et al. UniQua: a universal signal processor for MS-based qualitative and quantitative proteomics applications. Anal. Chem. 85, 890–897 (2013).

50. Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739 (2011).

npg

© 2

013

Nat

ure

Am

eric

a, In

c. A

ll rig

hts

rese

rved

.