powerpoint presentationfacweb.northseattle.edu/estavney/bio260/… · ppt file · web view ·...

22
Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? The Need for Protein Making Instructions Phenotype = genotype (+ environment) 1 chromosome gene ---> 1 protein DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material Two polynucleotide strands with H bonds DNA + protein make up a chromosome RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions (gene) is copied Copy is complementary to the DNA gene In eukaryotes, the RNA copy is edited The Three Kinds of RNA mRNA: carries instructions for 1 protein rRNA: structural support in ribosomes tRNA: amino acid trucks with anticodons Steps of Translation (Protein Synthesis) DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Upload: doanhuong

Post on 27-Mar-2018

218 views

Category:

Documents


4 download

TRANSCRIPT

Page 1: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

• Steps of Translation (Protein Synthesis)

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Page 2: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Flow of Genetic Information

Figure 8.2

Page 3: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

DNA is a Double-Stranded Chain of Nucleotides

Page 4: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

DNA

Figure 8.4

Page 5: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Page 6: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

DNA Replication is Semiconservative

Figure 8.3

Page 7: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

• DNA replication is semiconservative

DNA

Figure 8.7

Page 8: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

DNA Replication Involves Several Enzymes

Figure 8.6

Page 9: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes

A segment of DNA (gene)

carries specific coded

instructions for the making

of a single proteins.

Genotype:The genes carried in a cell for a particular trait

Phenotype: The physical expression of genes for a particular trait

QuickTime™ and a decompressor

are needed to see this picture.

DNA Genes are Instructions for Making Specific Polypeptides

Page 10: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Page 11: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Transcription is Performed by RNA Polymerase

Page 12: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Translation or Protein Synthesis

Figure 8.2

Page 13: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Figure 10.17

Anatomy of a Messenger RNA

Leader

Trailer

mRNA is a Chain of Nucleotides

Page 14: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Page 15: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

=

3 Types of RNA – Each With a Different Job

Messenger RNA (mRNA)

Carries copy of gene informationto the ribosome to make protein

anticodon

Ribosomal RNA (rRNA)

Part of the structure ofthe ribosome; key component in aminoacid linking machinery

CUGC U G

Transfer RNA (tRNA)

Carries amino acids to the ribosome for linking; identified by anticodon “sign”

Page 16: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

How Gene Instructions are Communicated

Page 17: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

mRNA Codon Dictionary of the Genetic Code

Page 18: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

DNA template strand:

CGTTTACGACCGGCCTTAGATCCTGACG

Central Dogma: DNARNAProtein

mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC

Transcription by RNA polymerase

Translation by ribosome

Protein: Met -

Leu -Ala -

Gly -Ile

Page 19: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Translation in Prokaryotes Can Occur Simultaneously With Transcription

Figure 8.11

Page 20: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

A Ribosome Has Two Subunits and Three tRNA Binding Sites

Page 21: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Translation: Initiation, Elongation, Termination

Termination

Initiation

Elongation (3-4 steps)

Page 22: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created

Steps of Translation

Protein Synthesis Movie