WWW.RENTECHBOILERS.COM

BOILERS FOR PEOPLE WHO KNOW AND CARE

Heat Recovery Steam Generators | Waste Heat Boilers | Fired Packaged Watertube Boilers | Specialty Boilers

We’ve been around awhile. The RENTECH team has

a heap of experience – a total of more than 3,000 years – making boilers that operate efficiently

and safely on six continents. Our formula has been tested and perfected so you can be

assured that a boiler from RENTECH will perform reliably and earn your trust. So don’t be

tempted to saddle up with a greenhorn; insist that your boiler be built Texas-tough by the

skilled people at RENTECH.

RenBoi_PE_1011 1 10/26/10 4:13 PM

November 2013 • www.power-eng.com

CHEMICAL LOOPING A BREAKTHROUGH CLEAN COAL TECHNOLOGY

MATERIAL HANDLING DEALING WITH MOISTURE IN FLY ASH

EMISSIONS CONTROL KCP&L SOLVES FLY ASH ACCUMULATION IN SCR

the magazine of power generation

CLEAN COAL: Making Progress

117YEARS

1311pe_C1 1 11/11/13 11:43 AM

1311pe_C2 2 11/11/13 11:43 AM

www.power-eng.com 1

CLEARING THE AIR

auxiliary heating sources to heat the wa-

ter more quickly, allowing the unit to

reach higher loads rapidly.

Another approach is to allow certain

atypical operations. While normal op-

erating modes may restrict operations at

low temperatures, some period of modi-

fied operations can permit the unit to

achieve the required emissions while

managing the negative consequences. For

SCR operation, low temperature ammo-

nia injection can result in ABS formation,

but ABS can be volatilized at increased

temperatures. Working with catalyst sup-

pliers, operators can develop a plan to

allow a certain period of deposition and

then burning it off as the unit increases

in load.

Similarly, DFGD equipment can be

operated at low temperatures with a cer-

tain amount of solids accumulation, and

hence the associated potential for corro-

sion, tolerated. Fabric filters can be pre-

coated to obtain maximum SO2 and acid

gas control benefit if reagent/water use

has to be reduced for such concerns.

Dry injection systems, such as those

for powdered activated carbon or so-

dium/calcium based sorbents, can

be utilized at even very low tempera-

tures. This attribute provides alternate

options for SO2 and acid gas control.

B&W has utilized dry sorbent injection

systems specifically for start-up con-

trol and periods of lime slurry prepara-

tion equipment maintenance, proving

the concept.

It may take some years to write the

regulations, revise the State Imple-

mentation Plans, and include the new

requirements in the operating permits

of the plants. This time can be used

effectively to determine the most eco-

nomical compliance solution, whether

it be from changes to the boiler, AQCS

equipment or operations.

Earlier this year, in response to

a Sierra Club petition (Sierra

Club v. EPA 2008), the EPA pro-

posed to eliminate startup, shutdown

and malfunction (SSM) air emissions

exemptions in utilities’ operating per-

mits. The final rules are to be issued

May 15, 2014. Because the exemption

for startup, shutdown and malfunc-

tion was written into numerous federal

rules, State Implementation Plans and

individual permits, implementing this

change is a massive undertaking. With

the deadline fast approaching, utilities

should start investigating options for

compliance assuming that the normal

operating permit level must be main-

tained during all periods of operation.

It’s not known at this time what spe-

cific requirements the EPA will propose

to replace the general exemption. How-

ever, EPA regulations issued after the

2008 court decision provide some hints

of what we can expect.

The industrial boiler MACT and the

Mercury and Air Toxics Standard (MATS)

both provide for facilities to follow work

practice standards during periods of

startup and shutdown. During startup,

facilities must turn on any environmental

control equipment and inject any control

chemicals at the beginning of a startup,

or as soon as the unit attains the tempera-

ture or conditions making it practical to

operate the emissions controls, whichev-

er is earlier. These rules also provide that

in the case of a malfunction, the facility

can make an “affirmative defense” if it

has done everything practical to avoid

the malfunction. However, the facility

will need to document the affirmative

defense in more detail than was required

under the earlier general exemption, and

it must be for “unplanned” events only.

States and industry have expressed op-

position to the proposed rule, stating that

it is not advisable to operate air quality

control system (AQCS) equipment dur-

ing periods of SSM, making some emis-

sion limits unattainable. However, gener-

ally, the limitation to placing emissions

control equipment in service is tempera-

ture related. Until flue gas temperatures

meet certain minimum requirements, the

equipment is not operable in its normal

mode. For example, ammonia cannot be

injected in a selective catalytic reduction

system (SCR) at low temperatures with-

out the potential to form ammonium bi-

sulfate (ABS) that can mask the catalyst

and foul the airheater. Semi-dry flue gas

desulfurization (DFGD) systems do not

have sufficient temperature to support

the water injection required for optimal

performance.

For all equipment, management of the

set points may be all that is necessary to

achieve rolling averages. Minimal reduc-

tions can be maintained during start-up

and shutdown, with over-compliance

throughout the rest of the period to make

up the difference. Many, but not all, SCR

and FGD systems are designed to achieve

higher reductions that what is required

on a day-to-day basis, so increases in

emissions reductions may be possible.

If the simplest approach doesn’t meet

the requirements, one option is to raise

the flue gas temperature as quickly as

possible so that the AQCS train can be

placed into service within the bounds

of normal operation. The right solution

for each unit’s operations can be unique,

but generally the options include the use

of airheater or economizer bypasses, the

addition of supplemental heat, or man-

agement of the combustion process and

steam system during start up to bring the

unit to load more quickly than normal.

Examples include methods to distribute

heat from start-up burners more uni-

formly throughout the furnace, or using

Utilities Should Act Now on EPA Regs for Start-Up and Shut-DownBY MELANIE SCHMEIDA, PROJECT DEVELOPMENT MANAGER, BABCOCK & WILCOX POWER GENERATION GROUP

1311pe_1 1 11/11/13 11:40 AM

Power Engineering is the flagship media sponsor for

POWER ENGINEERING ONLINE : www.power-eng.com

Newsletter:Stay current on industry news, events, features and more.

Newscast:A concise, weekly update of all the top power generation news

Industry News:Global updates throughout the day

Power Engineering ®

CORPORATE HEADQUARTERS—PennWell Corp.

1421 South Sheridan Road • Tulsa, OK 74112P.O. Box 1260, Tulsa, OK 74101

Telephone: (918) 835-3161 • Fax: (918) 831-9834

E-mail: pe@pennwell.com

World Wide Web: http://www.power-eng.com

MANAGING EDITOR — Russell Ray

(918) 832-9368 russellr@pennwell.com

ASSOCIATE EDITOR — Justin Martino

(918) 831-9492 justinm@pennwell.com

ASSOCIATE EDITOR — Sharryn Dotson

(918) 832-9339 sharrynd@pennwell.com

ON-LINE EDITOR — Jennifer Van Burkleo

(918) 831-9269 jvanburkleo@pennwell.com

CONTRIBUTING EDITOR—Brad Buecker

CONTRIBUTING EDITOR—Brian Schimmoller

CONTRIBUTING EDITOR—Wayne Barber

(540) 252-2137 wayneb@pennwell.com

CONTRIBUTING EDITOR—Barry Cassell

(804) 815-9186 barryc@pennwell.com

GRAPHIC DESIGNER — Deanna Priddy Taylor

(918) 832-9378 deannat@pennwell.com

SUBSCRIBER SERVICEP.O. Box 3264, Northbrook, IL 60065

Phone: (847) 763-9540

E-mail: poe@halldata.com

MARKETING MANAGER — Wendy Lissau

(918) 832-9391 wendyl@pennwell.com

SENIOR VICE PRESIDENT, NORTH AMERICAN

POWER GENERATION GROUP — Richard Baker

(918) 831-9187 richardb@pennwell.com

NATIONAL BRAND MANAGER — Rick Huntzicker

(770) 578-2688 rickh@pennwell.com

CHAIRMAN — Frank T. Lauinger

PRESIDENT/CEO — Robert F. Biolchini

CHIEF FINANCIAL OFFICER/SENIOR

VICE PRESIDENT — Mark C. Wilmoth

CIRCULATION MANAGER — Linda Thomas

PRODUCTION MANAGER — Katie Noftsger

POWER ENGINEERING, ISSN 0032-5961, USPS 440-980, is published

12 times a year, monthly by PennWell Corp., 1421 S. Sheridan Rd., Tulsa,

OK 74112; phone (918) 835-3161. ©Copyright 2013 by PennWell Corp.

(Registered in U.S. Patent Trademark Office). Authorization to photocopy

items for internal or personal use, or the internal or personal use of

specific clients, is granted by POWER ENGINEERING, ISSN 0032-5961,

provided that the appropriate fee is paid directly to Copyright Clearance

Center, 222 Rosewood Drive, Danvers, MA 01923 USA 508-750-8400.

Prior to photocopying items for educational classroom use, please

contact Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers,

MA 01923 USA 508-750-8400. Periodicals postage paid at Tulsa, OK

and additional mailing offices. Subscription: U.S.A. and possessions,

$88 per year; Canada and Mexico, $98 per year; international air mail,

$242 per year. Single copies: U.S., $14, Outside U.S. $23. Back issues

of POWER ENGINEERING may be purchased at a cost of $14 each in

the United States and $16 elsewhere. Copies of back issues are also

available on microfilm and microfiche from University Microfilm, a Xerox

Co., 300 N. Zeeb Rd., Ann Arbor, MI 48103. Available on LexisNexis, Box

933, Dayton, OH 45402; (800) 227-4908. POSTMASTER: Send change

of address, other circulation information to POWER ENGINEERING, PO

Box 3271, Northbrook, IL 60065-3271. “POWER ENGINEERING” is a

registered trademark of PennWell Corp. Return undeliverable Canadian

addresses to P.O. Box 122, Niagara Falls, ON L2E 6S4.

MemberAmerican Business Press

BPA International

PRINTED IN THE U.S.A. GST NO. 126813153Publications Mail Agreement No. 40052420

117VOLUME

38 Effects of Coal-Fired Boiler Flue Gas Conditioning on Fly Ash Conveying and Storage Systems

The presence of dry scrubber byproducts in fly ash can make the handling process even more difficult in the presence of moisture – find out more about the effects in this article.

30 Combined-Cycle Water/Steam Monitoring

Power Engineering examines the importance of accurate sampling for heat recovery

steam generators, which can help prevent corrosion, failures and unit shutdowns.

46 Airflow Problems Lead to Fly Ash Accumulation

Kansas City Power & Light provides recommendations after a project at its

La Cygne Generating Station to reduce SCR pluggage caused by poor airflow.

22 Revolutionary Chemical Looping Technology Advances Clean Coal

Learn about a new process for coal-fired power generation being

developed by Alstom that would capture 90 percent of CO2 emissions at

a cost of less than $20 per ton of CO2 avoided.

DEPARTMENTS

1 Clearing the Air

4 Opinion

6 Industry News

10 Gas Generation

12 View on Renewables

14 Energy Matters

16 Nuclear Reactions

18 Power Plant Profile

68 Ad Index

No. 11, November 2013FEATURES

54 How to Keep Nuclear Plants Safe? Let Me Count the Ways

Nuclear Power International Editor Sharryn Dotson looks at safety enhancements being implemented at U.S. nuclear power plants, which has continued to be a focus of operators.

1311pe_2 2 11/11/13 11:40 AM

The new Fluke 434 Series II: Analyze power quality and calculate energy loss.Energy lost is money wasted. Fortunately, there’s the new Fluke 434 Series II Energy Analyzer. It calculates how much money you’re losing to wasted energy, so you can identify and implement solutions. You save energy. And money too.

Learn more: fl uke.com/energysavings

For info. http://powereng.hotims.com RS#1

1311pe_3 3 11/11/13 11:40 AM

www.power-eng.com4

OPINION

In what is expected to be a record year

for new solar installations in the U.S., an

estimated 4,400 MW of solar PV capac-

ity will be installed this year, up 30 per-

cent compared with 2012, according to

the Solar Energy Industries Association.

Meanwhile, advances in battery storage

and micro wind turbines are expected to

lower the costs of those technologies.

“As the cost curve for these technolo-

gies improves, they could directly threat-

en the centralized utility model,” the

EEI report stated. “While we would

expect customers to remain on the

grid until a fully viable and economic

distributed non-variable resource is

available, one can imagine a day when

battery storage technology or micro

turbines could allow customers to be

electric grid independent.”

That day is far away, but it may be clos-

er than most people think.

Most utilities are fighting the shift to

distributed solar with campaigns to end

or slash net metering programs that pay

homeowners for the power they produce.

In addition to lost revenue, utilities are

concerned a high penetration of intermit-

tent distributed solar will create voltage

and reliability problems.

Other utilities, however, are getting in

It wasn’t that long ago when making

a phone call required a massive net-

work of copper wire. But advances

in wireless technology and a torrent of

new competitors allowed customers to

“cut the cord” affordably.

A similar transformation of America’s

century-old business model for electric

utilities may be on the horizon.

The rapid growth of distributed

generation – power from rooftop

solar panels, micro wind turbines,

geothermal systems, and energy

storage technologies – is a “disrup-

tive challenge” that poses an immi-

nent threat to the regulatory model

that has long been used by utilities

to generate a return on their invest-

ments, according to a report from

the Edison Electric Institute (EEI).

“The threat to the utility model

from disruptive forces is now increasingly

viable,” the report stated.

The growth of distributed solar pho-

tovoltaic (PV) capacity, in particular, has

led utilities across the nation to reexam-

ine policies, incentives and net metering

programs as more homes and businesses

produce their own power. The growing

use of distributed generation is cutting

into utilities’ profits and their ability to

pay for the up-keep of power lines, sub-

stations and generation equipment.

Earlier this year, David Crane, chief ex-

ecutive officer of NRG Energy, described

the shift to distributed generation as a

“mortal threat” to utilities. “They can’t

cut costs, so they will try to distribute

costs over fewer and fewer customers,”

Crane said. As a result, electric bills will

rise, which will drive more customers to

invest in distributed generation at their

homes and businesses, he said.

front of this change, embracing distrib-

uted generation by building solar panels

on top of buildings and enacting feed-in

tariffs, which guarantee stable prices for

the developers of renewable projects. By

buying solar rooftop arrays and other

sources of distributed generation, utilities

can avoid costly investments in new pow-

er lines and power purchase contracts.

So which way should the indus-

try go? Should it embrace distribut-

ed generation? Or, should it fight to

preserve a long-standing business

model that fosters financial health

for investor-owned utilities?

The rules for net metering pro-

grams and solar incentives should

be revisited and reassessed due

to vastly different circumstances

caused by the solar revolution.

Net metering programs were never

meant to be permanent. Regulators have

a responsibility to consider the rapid

growth of distributed generation and the

subsequent cost to utilities and their cus-

tomers.

But stopping the transition to distribut-

ed generation is highly unlikely, because

it is a lifestyle change that resonates with

consumers. At some level, utilities must

adapt their business model to account for

rooftop solar panels, efficient applianc-

es, better battery storage and residential

wind power.

Right now, the industry isn’t sure how

it should react to these “disruptive tech-

nologies” that are threatening its long-

standing business traditions. The in-

dustry is at a crossroads. The question is

which way will it go?

If you have a question or a comment,

contact me at russellr@pennwell.com.

Follow me on Twitter @RussellRay1.

Disruptive ForcesBY RUSSELL RAY, MANAGING EDITOR

1311pe_4 4 11/11/13 11:40 AM

Fresh look. Trusted name. Proven technology.

RUGGEDCOM is now a Siemens product line. All

RUGGEDCOM products will soon look different but the

technology inside will remain unchanged, ensuring the

best performance for the demanding communication

needs of our customers.

Fresh Look: The cases for the RUGGEDCOM product

family have been redesigned, consistent with the

Siemens product portfolio.

Trusted Name: The name “RUGGEDCOM” won’t go away

and will continue to represent rugged communications

equipment designed for mission critical applications in

harsh environments.

Proven Technology: At heart, the RUGGEDCOM products

will remain unchanged – the functionality, technical

specifications, and 5 year warranty that has forged our

reputation as the leading provider of rugged network

infrastructure solutions will not be affected by the

branding change.

As your partner, we understand your requirements for

fast, reliable, and standardized communication. We are

one of the world’s most tightly meshed service and

support providers always with an eye on your needs.

Innovation and our passion for communication will help

you to be competitive now and in the future!

For info. http://powereng.hotims.com RS#2

1311pe_5 5 11/11/13 11:40 AM

www.power-eng.com6

INDUSTRY NEWS

Utility plans to demolish 3 coal-fred plants

Consumers Energy has asked the state

to approve a bond issue that will allow

it to close and demolish three coal-fred

power plants in Michigan.

The request to the Michigan Public Ser-

vice Commission would allow it to close

and demolish the B.C. Cobb plant begin-

ning in April 2016. The request comes

amid stricter federal regulations.

The same closure and demolition

plans are being made for coal-fred

units at Consumers Energy’s J.R. Whit-

ing near Luna Pier in Monroe County

and J.C. Weadock near Bay City on the

Saginaw Bay.

Plans will move forward if the $454

million bond issue gets approval, said

company spokesman Dan Bishop.

Consumers Energy offcials have said

the company won’t invest new environ-

mental technology into its aging coal

plants during a time that electrical use

in Michigan has stabilized and the com-

pany is preparing to build a new natural

gas-fred plant.

Turbine cracking caused Sherco 3 shutdown

Northern States Power on Oct. 21

submitted a long-promised Root Cause

Analysis Report to the Minnesota Public

Utilities Commission about the primary

cause of the catastrophic outage that oc-

curred in November 2011 at the coal-fred

Sherburne County Unit 3 (Sherco 3).

Nearly two years of Sherco 3 restora-

tion work has been completed and the

repaired unit was synchronized to the

electric grid on Sept. 4, taken off-line days

says senior reactor operator Michael J.

Buhrman planned to rob an armored

car in May 2012 and recruited another

senior reactor operator, Landon E. Brit-

tain, to assist. Buhrman instead pointed

a gun at a woman in a store parking lot

and stole her vehicle. Buhrman was ap-

prehended for aggravated vehicular car-

jacking and fed the country when he

was released on bail. He was tried and

sentenced to 40 years in absentia in

May, but was caught in Texas on Nov. 1.

Brittain had fed to Venezuela but was

caught and extradited back to the U.S.

to face several criminal charges pending

against him.

Microsoft signs 20-year PPA for Texas wind power project

Microsoft Corp. has entered a 20-year

power purchase agreement with RES

Americas to buy 100 percent of the elec-

tricity generated from a wind power proj-

ect in Texas. The project, Keechi Wind

Farm Project, will begin construction in

December and is expected to be opera-

tional by June 2015.

The 110-MW project will use 55 tur-

bines and is located 70 miles northwest

of Fort Worth.

Kemper IGCC costs inch higher with delay

Southern Co. continues to see the

total price for the Kemper County coal

gasifcation power plant inch higher in

Mississippi while major milestones are

being met on new nuclear generation

in Georgia.

Southern reported 3Q13 earnings of

$852 million, or 97 cents per share, com-

pared with earnings of $976 million, or

$1.11 per share, in 3Q12.

The increased rainfall across the South-

ern territory might be one reason that

Southern saw its share of hydroelectric

and other non-fossil, non-nuclear electric

generation double from 2 percent during

the frst nine months of 2012 to 4 percent

later to address post-restoration items and

returned again to service Oct. 10, with

testing continuing at various load levels.

PA must set deadline for coal ash regulations

A federal district court judge issued a

memorandum opinion in October stat-

ing the EPA has 60 days to inform the

court of when the agency plans to com-

plete a review and revision of its regula-

tions concerning coal ash.

The memorandum was written in re-

sponse to a lawsuit fled by multiple en-

vironmental and public health groups in

the U.S. District Court for the District of

Columbia.

After the EPA informs the court of

when a review will be complete, the plain-

tiffs in the lawsuit may fle a response to

the agency’s proposal.

Nuclear power plant workers banned from sites after attempted carjacking

Two former workers at the Dresden nu-

clear power plant in Illinois are banned

from working in nuclear power plants.

NRC staff issued a confrmatory order

to Exelon Generating Co. for an incident

involving violations of the Behavioral

Observation Program at the plant. NRC

B.C. Cobb plant

Sherco

Dresden nuclear power plant

1311pe_6 6 11/11/13 11:40 AM

For info. http://powereng.hotims.com RS#3

1311pe_7 7 11/11/13 11:40 AM

www.power-eng.com8

INDUSTRY NEWS

Pakistan begins work on new nuclear power plant

Pakistan has started work on a 1,000

MW nuclear power plant in Karachi that

will be built with Chinese help, according

to Energy Business Review.

The KANUPP-2 plant is part of the $4

billion, 2,000 MW Karachi Coastal pow-

er project, which involves construction

of two 1,000 MW nuclear reactors, the

article said. The plant is expected to take

seven years to complete and will be lo-

cated near the 137 MW KANUPP-1 plant,

which has been in operation since 1970.

The government has reportedly allo-

cated the frst payment from the $1 bil-

lion to the Pakistan Atomic Energy Com-

mission to begin development work on

the plant. The country expects to ramp up

nuclear capacity to 8,000 MW by 2025.

Installed generation lagging far behind 2012

The amount of new electric generating

capacity installed during the frst nine

months of 2013 is lagging well behind

the pace set in 2012, according to fgures

released recently by the Federal Energy

Regulatory Commission (FERC).

Capacity installation for January

through September of 2013 is 10,717

MW, compared to 14,217 MW installed

through September 2012, according to

the Energy Infrastructure Update for Sep-

tember issued by FERC’s Offce of Energy

Projects.

So far the biggest difference between

2012 and 2013 has been the 2012 wind

energy boom. In the frst nine months of

2012, 87 wind units were installed for a

total of 5,043 MW.

By contrast, in the frst three quarters of

2013, only nine new wind units have been

commissioned for a total of 961 MW.

help site renewable energy and an effort

to protect key caribou habitat at the Na-

tional petroleum Reserve in Alaska while

also making more than 72 percent of the

estimated economically recoverable oil

available.

Court denies OGE’s request for regional haze rehearing

A three-judge panel from the 10th

Circuit Court of Appeals has denied a

request by OG&E, Oklahoma Attorney

General Scott Pruitt and the Oklahoma

Industrial Energy Consumers asking for

the full court to review a previous deci-

sion upholding the U.S. Environmental

Protection Agency’s regional haze plan

for Oklahoma.

The EPA’s plan to address emissions

would call for installing scrubbers in

OG&E power plants, while Oklahoma

offcials and agency have supported a

state plan that would use low-sulfur coal

and give utilities in the state the fexibility

to burn less coal and more natural gas to

achieve the goals of the rule.

According to OG&E, the EPA’s plan

will result in higher electricity rates for

its customers, while the state plan would

achieve the goals of the rule while limit-

ing costs.

The 10th Circuit had stayed implemen-

tation of the federal plan in June 2012,

but a three-judge panel ruled 2-1 in favor

of the EPA last summer.

Swiss nuclear power plant to close by 2019

A nuclear power plant in Switzerland is

scheduled to close in 2019.

State-owned power company BKW

said it would shut down the Muehleberg

nuclear power plant due to high operat-

ing costs and scrutiny following the 2011

disaster at Japan’s Fukushima Daiichi

nuclear power plant.

BKW said it would spend approxi-

mately 200 million Swiss francs

($222.67 million) to maintain and up-

grade the plant over the next six years.

during the frst nine months of 2013.

The share of gas-and-oil generation in

the Southern feet has decreased from

45 percent in the frst nine months of

2012 to 42 percent during the frst three

quarters of 2013. Coal power output has

increased slightly from 37 percent to 38

percent while nuclear energy stayed fat at

16 percent.

Jewell discusses developing renewable energy on public lands

U.S. Secretary of the Interior Sally

Jewell discussed initiatives to place re-

newable energy on public lands in a re-

cent speech at the National Press Club

luncheon.

“We are already seeing this approach

work as we seek to meet President

Obama’s goal of approving 20,000 mega-

watts of renewable energy on public

lands by 2020,” Jewell said. “It’s a goal to-

ward which my predecessor, Ken Salazar,

made huge strides.”

Jewell also discussed specifc exam-

ples, such as the Interior Department

working with California on a plan to

Kemper County coal gasifcation power plant

Sally Jewell and President Barack Obama

Karachi Coastal

1311pe_8 8 11/11/13 11:40 AM

©2013 Fluke Corporation. All trademarks are the

property of their respective owners. AD 6000850D_EN

Uptime or Downtime.

YOUR RESULTS MATTER.Only the new infrared cameras from

Fluke have LaserSharpTM Auto Focus

for consistently in-focus images.

EVERY. SINGLE. TIME.

See LaserSharp Auto Focus in action: fluke.com/lasersharp

©2013 Fluke Corporation. All trademarks are the

proproproproproperperperperpertytytyty yy of of of of thethethetheiriririr resresresrespecpecpecpecpectivtivtivtive oe oe oe ownewnewnewners.rs.rs.rs. ADADADAD 60 60 60 6000800800800850D50D50D50D_EN_EN_EN_EN_EN

UUpppptttiiiimmmmeeee oooorrrr DDDDDoooooowwwwwwwwnnnnnnnntttttttiiiiiiimmmmmmmmmmeeeeeeeeeee.......

OOOOnnnnllllyyyyyy tttthhhhhhhheeeeeeeee nnnnnnnnneeeeeeeewwwwwww iiiiiiinnnnnnnnffffffffffrrrrrrrrraaaaaaaaarrrrrrrrreeeeeeeeddddddddddd cccccccccaaaaaaammmmmmmeeeeeeerrrrrrrraaaaaaassssss fffffffrrrrrrrooooooommmmmm FFFllluuuukkkkkkkeeeeeee hhhhhhhaaaaaaaaavvvvvvvvvveeeeee LLLLLLLaaaaaaaaasssssssssseeeeeeeeeerrrrrrrrSSSSSSSSSShhhhhhhhhaaaaaaarrrrrrrppppppppTMTMTMTMTMTMTMM AAAAAAAAuuuuuuuttttttoooooooo FFFFFFFFFoooooooccccccccuuuuuuusssssss ffffooooorrrrrr cccccccooooooonnnnnnnnnnsssssssssiiiiiiiisssssssstttttteeeeeeeennnnnnnnntttttttttlllllllyyyyyyy iiiiiiinnnnnnnnnnn----ffffffffffoooooccccccuuuuuuusssssssss iiiiiiiimmmmmmmmmaaaaaaaagggggggeeeeeeeessssssss....EEEEEEEEVVVVVVVVVVEEEEEEEERRRRRRRYYYYYYYY... YYYY SSSSSSSSSIIIIIIIIINNNNNNNNGGGGGGGGGLLLLLLLLLLEEEEEEEEEE...... TTTTTTTTTTTTIIIIIIIIIIMMMMMMMMMMEEEEEEEEEE....

SSSSSSSeeeeeeeeeeeeeeeeeee LLLLLLLLLLasasasasasasasasasasasererererererereerererere SSSSSSSSSSShahahahahahahahahahaharprprprprprprrprpp AAAAAAAAAututututututo o o o o o o o FoFoFoFoFoFoFoF cucucucucuussssininininininini a a a a a actctctctctctctctcctioioioioioioioioion:n:n:n:n:n:n:n: fl fl fl fl flukukukukukukukke.e.e.e.e.e.ee.cococococococococ m/m/m/m/m/m/m/m/m/lalalalalalaasesesesesesersrsrsrsr hahahahahahahahah rprprprprprprprp

For info. http://powereng.hotims.com RS#4

1311pe_9 9 11/11/13 11:40 AM

www.power-eng.com10

GAS GENERATION

coal-fired plant, natural gas-fired

power plants utilize much smaller

staffs. There is frequently a lack of

experienced manpower available at

the plant to focus on heat rate moni-

toring or improvement.

• Heat rate improvement, or achiev-

ing the best possible heat rate, is

not required by law, not required

for safe operation and not required

for equipment protection. Further,

there is no NERC or OSHA counter-

part for heat rate. Typically, resources

are necessarily allocated to environ-

mental, safety and NERC compli-

ance first.

• Often there are no apparent or im-

mediate consequences for neglect-

ing thermal performance. This is

especially true for new plants oper-

ating at peak thermal performance

– the return on any time or money

invested for thermal performance

may seem negligible or nonexistent.

•  As a plant ages and the thermal per-

formance and components of the

plant degrade, staff may be unaware

of the extent and continuing cost of

such degradation if they have not

been tracking thermal performance

all along. Being unaware, it is easy

for the staff to continue doing what

they’ve always done – neglecting

thermal performance.

It isn’t difficult to justify a thermal

performance tracking program for a

natural gas power plant. Even with gas

at $3/MMBtu, the annual fuel bill for a

500-MW combined cycle plant with a 60

percent capacity factor will exceed $55

million. A quarter of a percent improve-

ment in the heat rate will shave nearly

Our nation’s history has been

marked by discovering large

troves of energy, harnessing

that energy from nature and then utiliz-

ing it without apprehension. Shale gas is

the rising energy star of this era. With the

emergence of this latest low-cost energy

source, we have a chance to write a new

chapter in our history – one that utiliz-

es this fuel with care and vigilance. We

have an opportunity to embrace energy

efficiency as a core value in the electric

production industry and make it a daily

practice in our power plants.

In the past, much of the power indus-

try’s effort, training and experience re-

garding plant heat rate has been focused

on coal-fired plants, and with good rea-

son: the coal plants were baseloaded

and represented the majority of power

production in this country. But the dash

to gas is bringing gas turbine technol-

ogy and combined cycle plants to promi-

nence in two ways. First is an increase in

new construction. The U.S. Energy Infor-

mation Administration estimates 26,000

MW of new natural gas power production

in the U.S. by 2015. Second is a shift that

has occurred in the dispatch curve where

combined cycle plants are now increas-

ingly baseloaded. Now is the time for nat-

ural gas power plants to catch up to their

coal-fired counterparts in the area of heat

rate and thermal performance. Baseload

operation, higher capacity factors and

additional steady state operation provide

the perfect opportunity to optimize ther-

mal efficiency.

What are the challenges facing the nat-

ural gas fleet as it moves closer to domi-

nance in the power market and thermal

performance becomes more important?

•  Compared to a similarly sized

$150,000 from the annual fuel bill. So in

spite of some of the lowest fuel prices in

the last decade and the continuing chal-

lenges that natural gas plant operators

face, now is the perfect time to move your

plant thermal performance off the back

burner and into the core values and daily

practices in place at your plant. Some

considerations:

•  Take advantage of higher capacity

factors and additional base load op-

eration to calculate and trend ther-

mal performance parameters.

• Don’t try to do it all alone, especially

if your staff is small and thermal

performance experience is limited.

There are lots of options for support-

ing a variety of thermal performance

needs, from limited support to turn-

key programs.

• Understand that the payback on

thermal performance monitoring

investments may take time to be

realized, especially for a new, clean

plant.

•  Again, small improvements in ther-

mal performance can yield six-fig-

ure gains. But don’t overlook the

fact that improving thermal perfor-

mance also positively impacts most

major goals in power plants includ-

ing availability, reliability, capac-

ity factor, fuel costs, variable costs,

emissions and chemical usage.

• Don’t wait — the thermal perfor-

mance history you build now will

pay off in the future.

As the majority of U.S. power produc-

tion continues to shift toward natural gas

and away from coal, the natural gas fleet

must move thermal performance to the

forefront of its goals to ensure we utilize

this inexpensive source wisely.

Using Our Natural Gas WiselyBY KATIE CHENEY, POWER PLANT OPERATIONS ENGINEER, NAES CORP.

1311pe_10 10 11/11/13 11:40 AM

flexibleAre you

enough for today’s energy demands?

ge-fl exibility.com

You will be, with the FlexEffi ciency* Portfolio from GE. It’s one of the most fl exible

power portfolios on the planet. And it is specifi cally engineered to meet the energy

challenges of today’s grid, given the increased reliance on renewables. So regardless

of your region, or the unique energy challenges you face, this one portfolio can help.

And we’ll bend over backwards to make sure of it.

GE Power & Water

+ + + = FlexEfficiency Portfolio

+ +plants steam

turbinesgas

turbinescontrol

systemsservicesgenerators

*Trademark of General Electric Company.

For info. http://powereng.hotims.com RS#5

1311pe_11 11 11/11/13 11:40 AM

www.power-eng.com12

VIEW ON RENEWABLES

C

and 10 years. This delay is why some

argue that development in state waters

will take off at a much quicker pace, and

it already has in some areas. While off-

shore developments within state nauti-

cal boundaries might progress at a faster

pace, their close proximity to shoreline

will limit their size and capacity, and the

state and federal governments will have

to collaborate if the U.S. is going to suc-

ceed in its renewable energy efforts via

offshore wind energy.

Even with its paramount benefit of

being green and clean, offshore wind

development is not without its critics.

Most objections stem from its high cost

and the likelihood that much of the ex-

pertise needed to develop the essential

technology would come from overseas.

Additional objections focus on concern

for the marine habitat, visual effects and

noise pollution. Similar concerns existed

when land-based wind projects were be-

ing developed, which gave way to certain

diligence and mitigation requirements

related to animal life that will certainly

be applied in similar fashion to the off-

shore developments.

The development of offshore wind

projects will no doubt be directly impact-

ed by the advances, or lack thereof, of the

coal and natural gas industries. When

compared to these “established” forms of

energy, wind can look much less attrac-

tive. Wind is inherently intermittent and

lacks consistency in generation, partly

due to the difficulty in efficiently storing

the energy generated. However, develop-

ment of offshore wind energy as an af-

fordable and viable energy source will be

necessary if the U.S. is going to expand

and diversify its energy portfolio.

Just over a decade ago, the men-

tion of a “wind farm” in western

Oklahoma would have raised more

than a few eyebrows. Today, a number

of these “farms” have sprung up across

open spaces where buffalo once roamed,

and more are on the horizon. Similar

scenarios have played out across the U.S.

since the onset of the modern wind era

beginning in the 1980s. Fueled by eco-

nomic incentives and a growing desire

for cheaper and cleaner energy, the U.S.

is the leader in land-based wind energy

capacity. However, more than 50 per-

cent of the population of the U.S. lives

in coastal areas, a reality that has been

one of the primary catalysts for recent ef-

forts by the U.S. Department of Energy

to develop an offshore wind industry in

the U.S. If these efforts are successful,

will the land-based wind farms become

a thing of the past?

Having stood mostly on the sidelines

during the last decade, the U.S. is getting

serious about adding wind to its energy

portfolio. Renewables currently make up

about 5 percent of the electricity gener-

ated in the U.S., with natural gas and

coal leading in overall generation. While

land-based wind farms will provide a

good template, the offshore turbines will

operate in a much different environment

and be subject to elements not found on

land. This will require modifications to

the subsystems of the turbine, port up-

grades, transmission planning and the

maneuvering through an infant regula-

tory system. These challenges will likely

result in higher costs and difficulty se-

curing financing. However, once the

mold is created, achieving economies of

scale should be a matter of time.

Many of the land-based wind farms

in the U.S. are located in the heart of the

wind corridor of the central plains, but

the wind resources available offshore are

more abundant. The U.S. coastlines are

extensive, and the wind blows stronger

and more consistently offshore. Projec-

tions indicate that offshore generating

capacity is four times what is currently

coming on the U.S. grid, and many of the

cities that require large amounts of elec-

tricity are located near coastal regions so

transmission issues will be reduced con-

siderably. Offshore development could

inject billions of dollars in economic ac-

tivity into the U.S. through professional

manufacturing, construction and engi-

neering jobs.

The offshore wind industry is still in

the early stages of development, which

makes the government’s goal of having

54 GW of offshore capacity by 2030 seem

pretty lofty. Currently, there are about

20 offshore projects and approximately

2,000 MW in the planning and permit-

ting stages. The Bureau of Ocean Energy

Management, Regulation and Enforce-

ment is overseeing developments in fed-

eral waters and has recently conducted

two wind lease auctions — one off the

coast of Massachusetts and Rhode Island

and one off the coast of Virginia. Togeth-

er, these lease areas are projected to pro-

duce enough power to provide electricity

to more than one million homes. Lease

auctions are expected in the near future

for areas off the coasts of Maryland and

New Jersey.

The turbines planned for these areas

will not be operational for another five

to 10 years, largely due to the permitting

process, which will take between seven

Will Advances in Offshore Wind Development Result in Onshore Wind Graveyards?BY JENNIFER L. IVESTER BERRY, ESQ., DIRECTOR, CROWE & DUNLEVY

1311pe_12 12 11/11/13 11:40 AM

MegaSeal™ is the industry’s mostreliable high-voltage rewind.

WITHOUT FAIL.

25+ years. Hundreds of rewinds. Zero winding failures.

MegaSeal, our VPI engineered insulation system for stator rewinds from 6.6 kV to 15 kV,

MegaSeal™ is a registered trademark of Integrated Power Services. All Rights Reserved.

www.ips.us/rewind-technologies

To learn more about MegaSeal and other IPS premium rewind technologies,

visit www.ips.us/rewind-technologies or contact us at (864) 451-5600.

provides guaranteed reliability, longer service life and lower cost of ownership for your

motor or generator.

Come s

ee us a

t

PowerG

en 2013

Booth #

3579

For info. http://powereng.hotims.com RS#6

1311pe_13 13 11/11/13 11:40 AM

www.power-eng.com14

ENERGY MATTERS

the units down in 2015 until MISO ex-

pressed concern about reliability.

It’s true that electricity generation is

the largest source of GHG emissions

in the U.S. from stationary sources, but

it is only a third of all sources, almost

equivalent to the third of emissions

from transportation. We can no better

maintain our society without electric-

ity than without transportation (cars,

trucks, buses, trains and planes); both

are needed, and neither are currently

replaceable. Coal continues to be the

largest source of electricity in the U.S.,

even amid the challenge from increased

natural gas production.

I honestly feel sorry for EPA. This is

a no-win regulation if there ever was

one. But the danger is creating a second

problem while trying to solve the frst

one. States want customized fexibility

and control over any carbon tax reve-

nues; FERC wants a stable electric grid;

the people demand stable, affordable

electricity; and the environmentalists

simply want fossil fuels to disappear.

The only certainty is the litigation and

delays that will immediately follow the

issuance of regulations covering GHG

emissions from existing power genera-

tion. In a morass that is almost certain

to end up at the Supreme Court, there

are no winners.

Coal is simultaneously part of the

problem of GHG emissions and part of

the solution of meeting the country’s

electricity needs. Coal is neither good

nor evil. Coal is an important part of

power generation history, a vital afford-

able resource for today’s power needs,

and coal does have a role in our future

energy mix.

Carbon regulation is coming.

Both anxiously anticipated

and intuitively feared, EPA’s

rules for controlling greenhouse gases

(GHG) from existing power plants

are expected to be proposed in 2014.

Meanwhile, the recently proposed rules

for new utility boilers are already gen-

erating concern in the power industry.

Coal combustion is at the center of

both of these regulations.

EPA’s proposed rules for new pow-

er plants limit carbon dioxide (CO2)

emissions from a new natural gas-fred

plant to 1,000-1,100 pounds of CO2

per megawatt-hour (MWh), depend-

ing on the size of the generator, and

from a new coal-fred unit to 1,100 lb

CO2/MWh. Essentially, no new coal

combustion-based power plant can be

constructed unless carbon capture and

sequestration (CCS) is implemented.

While technically feasible, CCS is not

economically viable or even physical-

ly possible in all parts of the country

without extensive new infrastructure

and pipelines. The catch-22 is that the

lack of new coal-fred boilers decreas-

es the demand for CCS research that

could in turn improve CCS technology

and economics. Of course, one major

unwritten purpose of the regulation

is to prevent new coal-fred boiler con-

struction. By that measurement, the

rule is a success.

The regulation of GHG emissions

from existing power plants is immi-

nent. President Obama directed the

EPA to propose GHG standards for

existing power plants by June 1, 2014

and to fnalize these standards by June

1, 2015. State implementation plans

would then be required to be fnalized

12 months later.

In an August 21, 2013 letter to the EPA

administrator, the National Association

of Clean Air Agencies (NACAA), a “na-

tional, non-partisan, non-proft asso-

ciation of air pollution control agencies

in 43 states, the District of Columbia,

four territories and 116 metropolitan

areas,” offered EPA several guiding

principles to consider when drafting

the regulations. The NACAA’s sugges-

tions speak to the states’ concerns that

since each state has a different mix of

energy resources and needs, no one

regulation can ft all. Their suggestions

include a plea for fexibility, economy

and effciency along with an under-

standing that states may have already

set up their own GHG programs, such

as California’s AB32 and the North-

east and Mid-Atlantic States’ Regional

Greenhouse Gas Initiative (RGGI). The

NACAA understands that evaluation,

measurement and verifcation are im-

portant, but also take up time and re-

sources. States that choose to use their

own programs should maintain control

over their GHG allowance proceeds.

The bottom line is NACAA’s acknowl-

edgement that this is a complex issue

that will be diffcult to legislate.

On a different regulatory front,

maintaining a stable transmission grid

factors into deciding which coal-fred

assets can be shutdown. In Michigan,

Consumers Energy received permis-

sion from MISO and the Michigan De-

partment of Environmental Quality

to delay the retirement of seven older

coal-fred units (950 MW) until April

2016. The original plan was to shut

Coal is Not a Four-Letter WordBY ROBYNN ANDRACSEK, P.E., BURNS & MCDONNELL

1311pe_14 14 11/11/13 11:40 AM

siemens.com/energy

Siemensí 8000H series gas turbines are legendary for

their efficiency. In 2011, the SGT5-8000H 50Hz set a

combined-cycle efficiency record in Irsching, Germany

at 60.75%. And now the SGT6-8000H 60Hz turbine is

proving itself after product launch in Cape Canaveral,

Florida. As the most powerful commercially operating

gas turbine in the world, the SGT6-8000H also delivers

extreme reliability, operational flexibility, faster start-ups

and minimal life-cycle costs; all while using less fuel with

lower emissions. So it not only improves your plantís

overall efficiency, but also helps save our planetÖ

and thatís a step in the right direction.

The first gas turbine to achieve over 60% efficiency is now available in a 60Hz versionóa giant leap, indeed.

Being first can leave a lasting impression.

For info. http://powereng.hotims.com RS#7

1311pe_15 15 11/11/13 11:40 AM

www.power-eng.com16

NUCLEAR REACTIONS

accomplishment earlier this year. In

conferring the award, the NEI noted

that because the operational efficien-

cies achieved through the process also

yield cost savings, the innovation has the

added potential of saving electric utili-

ties—and their customers—hundreds of

millions of dollars in future uses.

“We considered several options for

this issue, including vessel replacement

and lower hemisphere repair,” said Len-

nie Daniels, senior project manager at

CENG. “After detailed analysis, our plant

configuration made the repair option

more viable.”

CENG devised a first-of-a-kind weld

repair. The new tooling and the processes

had to be developed and proven to meet

ASME requirements. The tooling – which

included weld heads, machining equip-

ment, and nondestructive evaluations

(NDE) equipment — had to be built to

work inside small-bore piping, with the

ability to function reliably 30 feet off the

floor. NDE consisted of remote visual in-

spection via cameras mounted directly

on the weld head.

Stress corrosion cracking in nuclear

power plants has resulted in sig-

nificant maintenance expenses

for repair and replacement, and it contin-

ues to challenge materials management

programs across the industry. Much can

be done through materials selection and

water chemistry to avoid such

cracking, and proactive phys-

ical mitigation with welding

is also a viable option.

Pressurizer heaters are

used in pressurized water re-

actors to provide the heat re-

quired to maintain pressure

during transient conditions.

These heaters are inserted in

pipe penetrations into the

vessel called heater sleeves.

The sleeves are welded to the

vessel during original fabrica-

tion, and the heater is welded

to the sleeves. The two welds

comprise the pressure boundary for the

system and are susceptible to stress cor-

rosion cracking. If cracking occurs in the

welds, the heater sleeves can leak, poten-

tially leading to unplanned unit down-

time.

Over the past several years, Constella-

tion Energy Nuclear Group (CENG) has

pioneered the development, testing, and

application of a proactive welding process

to repair heater sleeves. Initial application

of the process occurred in 2012 at CENG’s

Calvert Cliffs nuclear plant in Maryland.

The process reduces welding time by 80

percent and weld volume by 90 percent;

it also enhances worker safety through

improved radiation protection.

CENG received the Nuclear Energy

Institute’s “Best of the Best” Top In-

dustry Practice (TIP) Award for this

“Process control was extremely impor-

tant,” said Daniels. “Each weld head had

to be placed in a specific location, and a

specific number of weld layers had to be

made to be ensure compliance with the

codes and to meet the required thickness

for the repair process.” Once the welds

were deposited, they had to

be machined to meet the

surface finish requirements

for the NDE inspections. The

entire process was controlled

to ensure proper alignment of

the heater sleeve to the sup-

port plates. If alignment was

not maintained, the heater

could not be inserted into the

pressurizer.

In all, CENG repaired 119

heater sleeve locations at

Calvert Cliffs, and no leak-

age occurred. The project was

completed a day ahead of

schedule and at less cost than the other

options considered.

One of the main benefits, according

to Daniels, was that the tooling was de-

signed to be operated remotely, which

means that both the welding and NDE

could be perfomed from outside the pro-

tected area. This minimizes the need for

workers to be directly exposed to radia-

tion. In fact, the project came in far below

planned dose levels, about 35 percent

lower than the project goal. Personnel

contamination incidents were 75 percent

lower than project goals.

The first-of-a-kind weld process is not

expected to be a “one and done” appli-

cation. Daniels believes the technique

could be adapted to other components in

a nuclear plant, such as bottom-mounted

nozzles.

Innovation Up My SleeveBY BRIAN SCHIMMOLLER, CONTRIBUTING EDITOR

Calvert Cliffs Nuclear Plant

1311pe_16 16 11/11/13 11:41 AM

For info. http://powereng.hotims.com RS#8

1311pe_17 17 11/11/13 11:41 AM

www.power-eng.com18

POWER PLANT PROFILE

the contracting didn’t come in as low as

we thought, so pretty quickly, we had to

revise our cost estimate to $2.35 billion.”

Commissioners approved that request,

and work was allowed to continue. How-

ever, Duke Energy had to go back to the

commission to ask for more money for

the project because GE and Bechtel in-

creased the cost of materials and quanti-

ties.

“One of the criticisms we received is

that the estimate went up, but it went up

because the folks with the proprietary

technology came back and said it would

cost more than they initially thought,”

Esamann said. “We were well into con-

struction, so we had to go back and ask

for another increase that was another

$500 million plus, so the cost estimate

was now $2.88 billion. They ultimately

approved it in 2010.”

GE created a model of the power plant

to test its performance through a range

of scenarios to identify any potential

Duke Energy’s 618-MW Edward-

sport Integrated Gasifcation

Combined Cycle (IGCC) Sta-

tion in Knox County, Ind. is already mak-

ing history as the largest IGCC plant in

operation in the U.S.

The technology works like this: Coal

reacts with pure oxygen and steam to

produce synthetic gas, or syngas, that

burns cleaner than the traditional means

of burning coal and stripping the pollut-

ants out of the exhaust gas.

But the Edwardsport project did not

come without its setbacks, as the project

faced several regulatory obstacles over

eight years before entering operations.

IN THE BEGINNING

The utility performed a feasibility study

in 2005 to determine if the project was

necessary. Duke wanted to replace the

160-MW Edwardsport coal-fred plant,

which was built in the 1940s and was

shut down in March

2011.

Doug Esamann,

president of Duke En-

ergy Indiana, said the

company was interest-

ed in using the IGCC

technology.

“We have a lot of coal in the region, so

it has long been an economic source of

energy for our customers,” Esamann said.

“We produced over 90 percent of our en-

ergy from coal historically.”

Duke also had to consider load growth,

the retirement of older coal-fred power

plants and the capacity that needed to

be replaced. The utility fled the feasibil-

ity study with the Indiana Public Utilities

Commission and requested regulators

to fund a Front End Engineering Design

(FEED) study. Once completed, Duke En-

ergy fled for a Certifcate of Public Con-

venience and Necessity permit, which

also included an approval for project cost

estimates of $1.985

billion, Esamann

said.

Once the util-

ity received approval

around late 2007,

construction offcially

began in March 2008.

Duke then selected the equipment and

contractors, picking General Electric (GE)

to provide the syngas turbines, radiant

syngas cooler and gasifers. In turn, GE

formed an alliance with Bechtel, which

performed the engineering and design

work for Edwardsport.

“We‘re out securing contracts pre-reces-

sion, so the companies were pretty robust

and commodity prices were higher than

we thought,” Esamann said. “Some of

Edwardsport Power Plant Makes HistoryBY SHARRYN DOTSON, ASSOCIATE EDITOR

Two heat recovery steam generators

help to power the Edwardsport coal

gasifcation plant in Knox County, Inc.

Photo courtesy of Duke Energy

“We produced over 90 percent of our energy from coal historically.”- Doug Esamann, Duke Energy

1311pe_18 18 11/11/13 11:41 AM

Motors | Automation | Energy | Transmission & Distribution | Coatings

© 2013 WEG Electric Corp.

Transforming Energy into Solutions

���Upgrades and re-rating to increase output

���Rotor and Stator repairs at factory or at customer site

���Inspection and troubleshooting by highly-trained service engineers

���Failure analysis backed by full engineering department

���Diode wheel retrofit to next generation design

���Full-service OEM parts and expediting available

���High speed factory balancing and in-situ trim balancing

���Customized training available at your location

Trust your Turbo Generator Service to the Manufacturer with more than 100 years experience.After decades of dependable service, it’s time to call Electric Machinery to give your Turbo

Generator new life. We’ve been designing, servicing, and manufacturing the most reliable Turbo

Generators and Synchronous motors in the world for over 100 years. Trust the experienced team at

our 425,000 ft2 Minneapolis facility to keep your Turbo Generator performing for decades to come.

Electric Machinery offers total customer support for every step in the life of your generator:

Electric Machinery Company

800 Central Avenue NE, Minneapolis, MN 55413

Main Phone:�� �������������������Main Fax: (612) 378-8051

Emergency Service Phone: ������������������Emergency Parts Phone: (612) 718-7589

������������������ �������������������������� For info. http://powereng.hotims.com RS#9

1311pe_19 19 11/11/13 11:41 AM

www.power-eng.com20

expense of capturing carbon emissions,

Duke Energy customers did not want the

technology installed until it was deemed

necessary.

“There’s space left on the site near

equipment purposely left for carbon cap-

ture equipment,” said Edwardsport Sta-

tion Manager Jack Stultz said. “When the

regulation comes forward, we can get it

designed and hooked in.”

Crew agrees. “The plant is ready for

the future of carbon capture,” he said.

“We think the performance of the

plant shows that (coal) is viable

and the technology has been dem-

onstrated.”

FEEDBACK

Tampa Electric’s Polk Power Sta-

tion in Florida uses single train IGCC

technology. GE said they wanted to

improve on that system when they

were building Edwardsport.

“Edwardsport is the evolution

of the technology,” GE’s Crew

said. “Polk is a single train tech-

nology. We wanted to take it fur-

ther with Edwardsport.”

Duke Energy’s Stultz said that the

community has been behind the plant

since the beginning.

“The community has been an amaz-

ing support from the time we began

efforts to get regulatory approval and

air permits. They have been behind us

100 percent and that’s much appreci-

ated,” Stultz said. “That support comes

from local community as well as the

state.”

Duke’s Esamann said that even

though there were challenges in build-

ing the plant, it was well worth it.

“I’m proud to be the frst to do this,”

Esamann said. “The further we go out

in time, the more it will pay off in the

long run.”

problem areas, said Delome Fair, general

manager of GE’s Gasifcation business.

The plant entered commercial opera-

tions on June 10, 2013, more than eight

years from the frst feasibility study and

with a fnal cost of $3.5 billion, including

construction costs and interest-carrying

costs, Esamann said. Duke is only al-

lowed to pass on $2.6 billion to custom-

ers as part of an agreement with state

regulators. Due to the distinct technol-

ogy used at the plant, Duke Energy said

it would take 15 months for the plant to

build up to its long-term level of avail-

ability, but the plant is providing electric-

ity to the grid.

RELIABILITY AND FLEXIBILITY

Although the plant is in commercial

operation, there are still a few things that

need to be fnished on GE’s part, includ-

ing plant validation and performance

testing, GE’s Fair said. The date for the

performance test has not yet been set.

The Edwardsport plant is expected to

emit 33 percent fewer nitrogen oxides,

75 percent fewer SOx emissions, 62 per-

cent less carbon monoxide. What’s more,

it will use less water than a traditional

supercritical coal-fred power plant, ac-

cording to Jason Crew, general manager

of GE’s Gasifcation business. In addition

to fewer emissions, the plant was also de-

signed for improved reliability and opera-

tions.

“Availability is money in the operators’

pockets,” Crew said. “We wanted an un-

derstanding of how the components op-

erate, how the plant works during trips,

how does it manage itself overall.”

Fair said the plant was also designed to

produce power from both power islands.

“But to achieve availability, we built

in fexibility,” Fair said. “In the plant,

the syngas can go to either generator, the

steam can go to either power island.”

Having two power trains in the plant

also means better coordination during

maintenance outages or non-peak times.

Traditional power plants that use syngas

can only run at 85 percent availability,

while Edwardsport runs both power is-

lands at 50 percent.

“We are able to coordinate the out-

ages so it is always going to make some

power,” Fair said. “You can shut down

one and run the other at 100 percent.

You get the same total amount of pow-

er produced, but the availability is al-

ways there.”

Esamann said the plant was built to

eventually capture carbon. Due to the

The integrated gasifcation combined cycle

technology on site. Photo courtesy of Duke Energy

1311pe_20 20 11/11/13 11:41 AM

©2012 Diamond Power International, Inc. All rights reserved.

www.a-s-h.com 1.888.ASH.PARTS

Introducing Allen-Sherman-Hoff’s

Call us to learn more about material handling solutions!

RSC2™remote submerged chain conveyor system

….game changing technology for bottom ash handling

For wet to dry bottom ash conversions

� Eliminates bottom ash storage ponds� Low particulate carryover in return water� Collection and settling of bottom ash in one tank� Simple design for ease of maintenance� Flexible design allows multiple ash disposal options� Low operating costs� No outage required for installation

For info. http://powereng.hotims.com RS#10

1311pe_21 21 11/11/13 11:41 AM

www.power-eng.com22

1311pe_22 22 11/11/13 11:41 AM

www.power-eng.com 23

solid oxygen carrier to provide oxygen

to either a combustion or gasification

process. This advanced process is trans-

formational in terms of its overall ef-

ficiency and cost. Chemical Looping

Combustion (CLC) for steam-power is

one of the lowest potential cost (cost-of-

electricity) technical approaches that

Alstom has identified to date for coal

power with carbon capture.

Alstom has been developing chemi-

cal looping technology over the last

decade, starting with small laboratory

scale technical feasibility testing, com-

pleting techno-economic analyses, ref-

erence plant studies, process models

and developing design tools. Alstom

has recently achieved a self-sustained

operation of limestone-based CLC pro-

cess at our 3-MWth pilot-scale test facil-

ity in Windsor, Conn. This is the first of

SHIN G. KANG AND JOHN L. MARIONALSTOM POWER INC.

For hundreds of years, coal

has been an essential,

abundant and low-cost

energy source that has

been a major contributor

to global prosperity and energy inde-

pendence. The development of chemi-

cal looping technology is motivated

by the need to maintain coal’s contri-

bution to electricity production in a

clean, economic and environmentally

sustainable manner. Alstom, a lead-

ing provider of energy solutions for

all these generation sources, is actively

investing in research and development

to improve these technologies to help

customers meet growing demands in

a cost–effective and environmentally

sustainable way.

Chemical looping is a breakthrough

clean coal technology. It utilizes a

Alstom has made significant progress in proving the feasibility of

the chemical looping concepts, including completing the first self-

sustained operation of a chemical looping combustion unit. Photo

courtesy of Alstom.

Revolutionary Chemical Looping Technology Advances

CLEAN COAL

1311pe_23 23 11/11/13 11:41 AM

www.power-eng.com24

particles are then transported to a fuel

reactor. Once here, they release oxy-

gen and convert the coal stream in the

fuel reactor into combustion gases. The

solid carrier also carries heat needed for

fuel conversion. This oxygen separation

and supply step occurs at a tempera-

ture close to the fuel

reduction tempera-

ture. As a result, this

reduces thermody-

namic penalty.

After the release of

heat and oxygen in

the fuel reactor, the

solid oxygen carrier

is recycled back to

the air reactor for re-

generation. The solid carrier continues

to circulate in the two-reactor loop, re-

peating an oxidation-reduction cycle,

or a “chemical loop.”

The chemical looping process is

analogous to the cycle our blood

stream (oxygen carrier in CLC) goes

through in our body — red blood

cells in blood absorbing oxygen from

the lungs (air reactor) and then deliv-

ering it to muscles (fuel reactor) for

such achievements for chemical loop-

ing process in the world. Alstom is also

active in the development of a metal-

oxide (ilmenite) system, at the stage of

proving the concept and oxygen carrier

at a 1-MWth test facility in Germany,

with several European partners.

WHAT IS CLC?

Various carbon capture and storage

(CCS) technologies are under develop-

ment. They include pre-combustion,

oxy-combustion and post-combustion

capture technologies. Among these,

oxy-combustion is one of the most

promising and cost-competitive CCS

technologies for new coal plants.

In this process, a high purity carbon

dioxide stream is produced which fa-

cilitates CO2 storage or utilization by

burning fuel in an atmosphere free of

nitrogen. Conventional oxy-combus-

tion processes rely on pure oxygen sup-

plied by air separation units (ASUs).

These are typically based upon cryo-

genic distillation of air, a process that

requires the air to be chilled down to

-280° F. These extreme operating con-

ditions make ASU systems relatively

costly to build and operate

CLC is an advanced technical ap-

proach that aims complete elimination

of cryogenic ASUs while still realiz-

ing oxy-combustion for a high purity

stream of CO2. Solids in powder form

are used to separate oxygen from air

and supply it to a

reactor for combus-

tion (or gasification)

of fuels such as coal,

petcoke, biomass or

natural gas. In addi-

tion, the solid oxy-

gen carrier transfers

the heat required for

some of the fuel con-

version reactions.

Figure 1 shows a schematic diagram

of a simplified coal-fired CLC process,

where two circulating fluidized bed

(CFB) reactors are interconnected to

form a loop. In the air reactor, a solid

oxygen carrier picks up oxygen from air

through an oxidation reaction to form a

solid oxide and leaves nitrogen behind.

This chemical reaction is exothermic

and releases heat into the air reactor.

The hot oxygen-carrying solid

The chemical looping process allows for the use of coal

for power while capturing carbon dioxide emissions.

Courtesy of Alstom.

Oxy-combustion is one of the most promising and cost competitive CCS technologies for new coal plants.

1311pe_24 24 11/11/13 11:41 AM

Power Plant Parts to go.

Fully designed as a nominal 600 MW GE steam turbine, this Unit 1 power block

is a coal-fred electric generating unit in waiting — making it or its equipment a

perfect solution for a utility that projects demand and demands effciency.

Ready for re-siting and permitting, this plant design comes with complete

documentation of the power block specifcations and calculations — and its

major equipment is 100% delivered. If you have interest in either the entire plant

design or the equipment, they are priced to move. Quickly.

For information, contact John Dills, Santee Cooper, at 843-761-8000, ext. 5772

or visit www.santeecooper.com/wpsale.

Engineered, Procured and Ready to Construct.

Download the MS Tag Reader App at http://gettag.mobi

to scan for design details and available equipment.

For info. http://powereng.hotims.com RS#11

1311pe_25 25 11/11/13 11:41 AM

VISIT BABCOCKPOWER.COM to learn more about our TEi companies:

Thermal Engineering International (USA) Inc. (TEi), which includes

divisions TEi Services and Struthers Wells, uses innovative heat

transfer technology to set the bar for quality across the power

industry at the international levelóin a world where integrated

products and services are a necessity.

As the leading supplier of heat transfer technology to the power

generation industry, TEi designs and fabricates surface condensers,

feedwater heaters, power plant heat exchangers and moisture

separator reheaters (MSRs).

TEi Services has a long history in the design, manufacture and

repair of condensers, feedwater heaters and heat exchangers to

not just treat symptoms, but to solve problems for ALL your heat

transfer equipment, regardless of make or model.

Struthers Wells has built an unparalleled reputation in

�������������������������������������������� ���������� ���

recovery equipment for the extraction of heat from high-temperature

��������������������������

We draw on the strengths of industry-recognized companies

to supply technology, equipment and engineering services for

������������������������� ������������������������������

Weíre your single-source solutions provider for all boiler and related

equipment and service needs.

Thermal Engineering International (USA) Inc (TEi),

For info. http://powereng.hotims.com RS#12

development of coal gasification. A

120-ton per day pilot plant (equivalent

to 12-15 MW) was built and operated

for three and a half years at Alstom’s

Connecticut site. This technology was

further refined and used in a number

of demonstration plants in the world.

Subsequently, in the mid-1980s, Al-

stom pioneered the introduction of

Circulating Fluid Bed (CFB) technol-

ogy. Since then, CFB unit sizes have

increased from demonstration scale (15

MW) in the 1980’s to nearly 400 MW

today, and efforts are underway to sup-

ply 600 MWe+ CFB units with ultra-su-

percritical steam conditions. This tech-

nology shares many of the same solids

handling, circulation and control chal-

lenges found within chemical looping

technology. Alstom initiated a new ef-

fort in gasification in the mid-1990s

with the aim of leveraging existing CFB

consuming sugar (fuel).

The concept is powerful and flexible,

and can be developed further for other

high value-added products. By chang-

ing the amount of solid oxygen carriers

relative to the coal fed to the fuel reactor,

high quality syngas (CO, H2, and other

light hydrocarbons) can be produced as

feedstock for petrochemical/refinery,

as well as power generation processes.

Further processing of the syngas in the

CLC process produces high purity H2

(hydrogen), which can be used for am-

monia synthesis, petroleum refining,

fuel cells or other applications.

INNOVATIVE

BREAKTHROUGHS

Alstom has

significant expe-

rience in study-

ing and devel-

oping advanced

combustion and

gasification pro-

cesses for coal

based power

generation. In

the mid-1970s,

Alstom was in-

volved in the

Alstom has constructed a pilot-scale test facility to

demonstrate using chemical looping and is planning on

building larger facilities. Photo courtesy of Alstom.

1311pe_26 26 11/11/13 11:41 AM

www.power-eng.com 27

Railserve, Inc. | 800-345-7245 | www.RailserveLEAF.biz

SustainabilityReliability

PowerRailserve LEAF Gen-Set Locomotives do more than help you meet compliance requirements. They work. And they work hard.

Proven in service for more than four years, the Railserve LEAF and Dual LEAFlocomotives have the pulling power to efficiently switch 60 or more loaded cars while cutting emissions and fuel consumption.

Rely on the Railserve LEAF for 84% lower emissions; 50% savings on fuel; 90% savings on lubricants; and dramatic savings on greenhouse gases.

A Better Way to Switch.

For info. http://powereng.hotims.com RS#13

locations a CLC power plant might be

built. Based on these considerations,

Alstom is focusing mainly on two: il-

menite and limestone-derived calcium

sulfate.

The ilmenite (iron-titanium ox-

ide ore)-based CLC process is being

technology. The objective was to de-

velop a process that could produce syn-

gas for gas turbines without an oxygen

plant. The conceptualized process used

a solids recycle loop to transfer the nec-

essary oxygen to the system as well as

an oxidizer and fuel reactor, a version

of chemical looping. In the late 1990s

Alstom launched a subsequent effort to

investigate what we now call the chemi-

cal looping process and discovered

its potential to be the lowest-cost coal

power generation with carbon capture.

Based on this early evaluation and sup-

porting reaction experiments, Alstom

has been pursuing the chemical loop-

ing process through a systematic devel-

opment approach that has culminated

recently in the achievement of auto-

thermal operations. This achievement

is only possible in a suitably-sized pilot

facility which can generate enough heat

from reactions to overcome thermal en-

ergy loss to the environment. Alstom’s

commitment to pilot testing is based

on a sound technical foundation from

smaller-scale reacting and non-reacting

experiments and on the company’s

commitment to an innovative, cost ef-

fective and environmentally sustain-

able use of coal.

Through our innovation, we recog-

nized that the choice of solid oxygen

carriers dictates the design, perfor-

mance and, most importantly, the

economics of the overall CLC pro-

cess. Recognizing this, Alstom has

thoroughly evaluated and screened a

number of oxide/sub-oxide systems in

terms of their cost, commercial avail-

ability, oxygen carrying capacity, attri-

tion behavior, toxicity, transport prop-

erties and attrition behavior. Many

highly-engineered materials currently

being designed by researchers are

costly and require a dedicated supply

chain system, whereas other materi-

als are abundant, naturally occurring

and, therefore, available in most of the

developed by Alstom in partnership

with Chalmers University, Sweden,

and Technical University Darmstadt,

Germany, and with financial spon-

sorship from the European Com-

mission Research Fund for Coal and

Steel. Ilmenite is a low-cost, abundant

1311pe_27 27 11/11/13 11:41 AM

www.power-eng.com28

NEXT STEPS AND

PRODUCT VISION

Alstom has developed this transfor-

mative technology from initial paper

studies up to lab-scale prototype where

main technology assumptions have

been verified. Additional planned pro-

totype testing will continue to refine

and improve the process performance

with the goal of achieving an opti-

mized design suitable for a demonstra-

tion plant.

Alstom plans to bring chemical

looping technology to commercial

realization and is working to begin

Pre-FEED and FEED studies aimed at

beginning construction on a large pi-

lot-scale (10- to 50-MWe) demonstra-

tion. Alstom has the product vision of

first commercializing chemical loop-

ing for power generation at industrial

scale (150 MWe) before fully scaling

up to 600 MWe size and ultra-super-

critical conditions.

In parallel, Alstom also is exploring

the syngas and H2 options for the pet-

rochemical and refinery Industry. This

synergistic effort is expected to expe-

dite introduction of the novel, break-

through technology to the market.

CONCLUDING REMARKS

There is no doubt that CLC tech-

nology could be a game changer

for coal power generation. Alstom

has made significant progress in

proving the feasibility of the CLC

concepts at various levels with

much success, the most notable be-

ing the completion of the first-in-

the-world chemical looping com-

bustion unit with self-sustained

operation. Alstom has also verified

the economic benefits of chemical

looping process over other carbon

capture technologies.

material and, because of its density,

can be readily separated from ash by-

products and reutilized. The develop-

ment effort is at the stage of proving

the concept and oxygen carrier at a

1-MWth test facility in Germany.

Limestone-based chemical looping

combustion (LCL-C™) technology is

being developed in Alstom’s labs in

Connecticut with the support from

the U.S. Department of Energy Na-

tional Energy Technology Laborato-

ries (DOE/NETL). Limestone is even

more abundant and low in cost. The

process uses calcium sulfate (CaSO4)

as an oxygen carrier while employing

two “fast” CFB reactors. In this lime-

stone-based process, the LCL-C™ pro-

cess chemistry is very similar to that

in commercial CFB boilers. The solid

oxygen carrier, CaSO4 is produced in

the LCL-C™ system as a result of calci-

nation of limestone, followed by sulfa-

tion when it reacts with the sulfur re-

leased from the fuel. The materials in

the LCL-C™ process (CaO, CaSO4 and

CaCO3) are also commonly present in

CFB boilers. The supply chain network

of the raw material (limestone) and

the byproduct (gypsum) is well devel-

oped throughout the world.

A unique feature of the LCL-C™ sys-

tem is that a near-zero emission power

generation plant can be built around

the concept while continuing to utilize

fossil fuels. In addition to CO2, emis-

sions of other major pollutants such as

Nitrogen Oxide (NOx), Sulfur Oxides

(SOx) and ash are also controlled. Al-

most no thermal NOx is formed result-

ing in significantly low NOx emissions

and SOx emissions. The limestone-sul-

fur reaction step inherently built into

the process, the LCL-C™ process, does

not require a dedicated sulfur emis-

sions control system. Other pollutants

such as mercury, heavy metals, and

VOCs can be easily removed from the

product stream as Alstom’s innovative

Air Quality Control System (AQCS)

concept is incorporated.

Alstom is now conducting a large

pilot test, which has accumulated over

300 hours of operation to date and

sustained auto-thermal operation con-

ditions for more than 50 hours.

This isometric drawing shows a depiction of a 550-MW utility-scale power

plant using the chemical looping process. Photo courtesy of Alstom.

1311pe_28 28 11/11/13 11:41 AM

*Trademark of General Electric Company

Across the board solutions.

GE

Measurement & Control

A NEW MEMBER OF THE EX2100e GENERATOR CONTROL FAMILY

We’ve added to our lineup of EX2100e voltage regulators to provide a better fi t for your

brushless exciter. The new 100 amp class regulator offers all the benefi ts of GE’s latest

EX2100e control platform, scaled to your needs.

Based on GE’s advanced Mark* VIe control technology, the EX2100e is designed for the long

haul. Not only does its improved diagnostic capability help you to better manage and operate

the system, it’s also capable of evolving to meet your changing needs. Modular technology

and streamlined structure makes modernization of your controls more simple and cost

effective than ever before.

With a growing lineup of migration and full system solutions designed for the retrofi t market,

upgrading to the EX2100e from your current system may be easier than you think.

For more information, visit ge-mcs.com/controlsolutions or contact your GE representative.

For info. http://powereng.hotims.com RS#14

1311pe_29 29 11/11/13 11:41 AM

www.power-eng.com30

1A General Schematic of a

Three-Pressure HRSG Design

Deaerator (DA) LP SH SteamIP SH Steam

HP SH SteamIP SH Steam Steam Injection to CT

(if used)

LP Drum IP Drum HP Drum

HP IP

Crossover

Steam Turbine

LP

Reheater CT Exhaust

Condenser

DAPump LP

Blowdown

FWPump

IPBlowdown

HPBlowdown

Attemperatio Water

Steamfrom IP

(if used)

CombustionTurbine

CondensateStorage

MakeupSystem

CondensatePolisher(if used)

Condensate Pump

Superheator Reheat

Legend

Preheater Economizer

HEAT RECOVERY STEAM GENERATORS

from one condenser tube can introduce

enough impurities to cause significant

damage in the evaporator circuits. In the

opinion of many, the CPD sample point

is the most important of any within the

entire water/steam network.

Where the condensate is treated by

a polisher, the effects of a condenser

tube leak are dampened. However, it

is still important that any leak be de-

tected as quickly as possible to prevent

premature exhaustion of the polisher

and subsequent carryover of contami-

nants to the boiler.

Recommended on-line analyses in-

clude:

•  Cation Conductivity (or becoming

popular, degassed cation conductiv-

ity)

•  Sodium

• Dissolved Oxygen

The name for cation conductivity has

undergone an evolution, and research

groups have now begun referring to the

technique as conductivity after cation

exchange (CACE). For this article, we

will continue to use cation conductivity.

The technique has been adopted at most

plants for detecting impurity in-leakage.

If a condenser tube fails or impurities en-

ter from another source (a makeup water

treatment system failure is the next most

likely source), the sodium, calcium, and

magnesium salts in the water are con-

verted to their respective acids, primarily

dilute sulfuric and hydrochloric acids, by

Earlier in this series, I

wrote about modern

techniques to minimize

impurity ingress, scaling,

and corrosion in heat re-

covery steam generators (HRSG). But

without accurate sampling and good

data collection, the conditions within

an HRSG may be or become harmful

without the knowledge of operators or

other technical personnel.

This is another of those cases where

an “ounce of prevention is worth a

pound of cure.” This article outlines

important samples required for suc-

cessful HRSG operation.

MONITORING THE

ENTIRE SYSTEM

Organizations such as the Electric

Power Research Institute (EPRI) have

written entire manuals regarding HRSG

sampling [2], so obviously a complete

overview is not possible in a single tech-

nical article. However, it is possible to

discuss the most important samples and

the benefits derived thereby.

HRSGs come in many different de-

signs, but a common general arrange-

ment is shown in Figure 1. We will use it

for this discussion.

Let’s begin at the condenser and con-

densate pump discharge (CPD), with the

note that many HRSGs are not equipped

with condensate polishers. For units with

water-cooled condensers, the condenser

is the primary source within the system

for impurity ingress. Even a minor leak

Combined-Cycle Water/Steam MonitoringBY BRAD BUECKER, CONTRIBUTING EDITOR

Author

Brad Buecker is a process specialist

with Kiewit Power Engineers in Lenexa,

Kan., and a contributing editor for Power

Engineering.

1311pe_30 30 11/11/13 11:41 AM

®

THE NEW YORK BLOWER FAMILY OF COMPANIES

MAS Air Systems ■ Mechanovent

The last thing your fan application needs

is a loud, unstable blower. At New York

Blower, our pressure blowers feature

all-welded, heavy-gauge steel housings designed specifically to

prevent “flexing” at high pressures. Plus, the unique Aluminum

(Steel optional) Pressure Blower wheel is designed to provide

efficient performance and reduced sound levels.

So you’ll get the stable performance you need,

and none of the pulsation you don’t want

when approaching zero flow.

Get specs for this product and our entire

line at nyb.com or call 800.208.7918.

Less vibration. fan application needs

lower.rr At New YoYY rk

e blowers feature

specifically to

que Aluminum

d to provide

vels.

need,

nt

tire

.

PRESSURE BLOWER

effic

S

ALUMINUM WHEEL

For info. http://powereng.hotims.com RS# 15

1311pe_31 31 11/11/13 11:41 AM

www.power-eng.com32

General Schematic

of cation conductivity

instrumentation

2

CationExchangeColumn

Sample InConductivity

Cell

Sample Out

reheat steam attemperation. Contami-

nated feedwater introduces impurities

directly to the steam.

Recommended on-line analyses in-

clude:

•  pH

• Dissolved Oxygen

•  Specific Conductivity

•  Cation Conductivity

•  Sodium

Suggested grab sample analysis:

•  Ammonia

•  Silica

Ammonia or in some cases an amine

(see final paragraph of this article) is typi-

cally utilized to adjust feedwater pH to

minimize general corrosion. The opti-

mum feedwater pH for systems with all-

ferrous metallurgy is 9.2 to 9.6. Ammo-

nia monitoring via grab sample analyses

can be quite useful, but most common is

to monitor the dosage based on continu-

ous specific conductivity. Cation con-

ductivity and sodium analyses perform

the same function as for the condensate

pump discharge, but also indicate if con-

taminated feedwater is being sent to the

attemperators.

Continuous dissolved oxygen readings

are valuable to confirm that that the de-

aerator is performing properly, but except

in the rare case where copper alloys ex-

ist somewhere in the feedwater network,

in no circumstance should the feedwater

D.O. concentration be zero. As much

research has shown, single-phase flow-

accelerated corrosion (FAC) is generated

by reducing environments where oxygen

has been scavenged by chemicals such as

hydrazine or one of its organic alterna-

tives. [5] In general, single-phase FAC is

most pronounced around 300oF, which

in HRSGs corresponds to the LP econo-

mizer and evaporator.

Some recommendations call for con-

tinuous sodium monitoring of feedwater,

but in this author’s opinion such sam-

pling may be redundant if continuous

monitoring is provided at the condensate

pump discharge or after the condensate

the cation exchange column.

The dilute acids that emerge (HCl and

H2SO

4, primarily) are more conductive

than their respective salts and have an

immediate influence on conductivity,

thus providing a quick indication of up-

sets. The cation column also removes

ammonium ions (NH4

+), which are

formed by conditioning chemicals added

to the feedwater. If ammonium ions are

not removed from the sample, they can

mask impurities. In general, the cation

conductivity of a clean condensate sam-

ple should be less than 0.2 micromhos

(microsiemens) per centimeter (µS). This

limit is mandatory for systems that op-

erate on all-volatile treatment oxidizing

[AVT(O)], which has been developed to

minimize flow-accelerated corrosion in

economizers and evaporator tubes. [3]

So, how does degassed cation conduc-

tivity improve upon the method? Air that

leaks into condensers of course contains

a small percentage of carbon dioxide. At

significant air in-leakage rates, the CO2

that enters can increase the condensate

conductivity and mask other impurity

ingress. Degassed cation conductivity

utilizes either a reboiler or purge vessel

(with nitrogen gas feed) to remove car-

bon dioxide.

Direct sodium monitoring of the

CPD is also very effective for detecting

condenser leaks and other impurity in-

gress. With a tight condenser, sodium

levels in the condensate should be very

low (<3 parts-per-billion [ppb]), and

in many cases less than 1 ppb. On-line

sodium analyses in conjunction with

cation conductivity are very useful. A

combination of the two instruments

provides backup readings in the event

of an instrument malfunction.

Dissolved oxygen (D.O.) analyses

are quite important for monitoring air

in-leakage to the condenser from the

steam-side. Ideally, if the condenser

air removal system is operating at max-

imum efficiency, dissolved oxygen lev-

els should be below 10 ppb. A sudden

increase in dissolved oxygen indicates

a problem below the waterline in the

condenser. Leaks above the waterline,

if severe, may cause significantly de-

creased condenser performance. [4]

DEAERATOR OUTLETThe deaerator (D.A.) in multi-pressure

combined-cycle units may be integral or

separate to the LP drum, but in either

case the D.A. should maintain D.O. con-

centrations below 10 ppb. Deaerator out-

let sampling for dissolved oxygen (grab

sampling is most common) helps the

plant operator or chemist monitor deaer-

ator performance. An increase in D.O.

levels over normal concentrations could

indicate problems with the internal de-

aerator components. Trays may become

misaligned. Or, the deaerator vents may

not be adjusted properly.

FEEDWATER/ ECONOMIZER INLET

This sample is very important, as it is

the last checkpoint before the evaporator

circuits. Feedwater chemistry can have a

significant impact on boiler operation for

several reasons. First, excessive feedwa-

ter contamination will reduce the boiler

cycles of concentration and require in-

creased blowdown. Second, improper

control of feedwater chemistry may cause

corrosion of feedwater piping and heat

exchanger tubes, which will introduce

corrosion products to the boiler. Third,

feedwater is often utilized for main and

1311pe_32 32 11/11/13 11:41 AM

����������������������� ���������������������������������������������������������� �����

���������������������������������� ���� ����!������"���������������������� �����������������

��!������������������� �����"���#���� ����������������"��+��������+$�)������������"��������

���!��"� ����!��������������

%�*�����$��"� � %�+�#���� %��������� %�* ���&�*����

%����&�'���)(���������&�*��� ����� %�����"� %���������

��������������������������������� �!�����"������ �����"�����-�����#�����������$�%�������%&&'��'�-�����������'(�&'�)*)������+����'(�&'�)**

������������������������������������ �,������������������ ���� ���� ������������������������������������ �-������������� ���� ���������������������������

�������� ������������� ��� ��������� ������

��������

���� ������ �����

������ ������������ ��

# � ���������� ����"���

� �������!������ ����

� ������ ������� �� ������

�� ����� ������

����� � � �

��� � � � ��������������

���������� ����������

���������

���������

�������������

#1 Magnetic Level Indicator

#1 Magnetostrictive Level Transmitter

For info. http://powereng.hotims.com RS#16

1311pe_33 33 11/11/13 11:41 AM

www.power-eng.com34

sulfate concentration in the evaporator

circuits. Research has shown that these

contaminants can cause significant cor-

rosion if boiler water chemistry is not

properly maintained.

With regard to silica, carryover is the

primary concern where transfer of silica

from boiler water to steam is primar-

ily by vaporous carryover, not mechani-

cal. The mechanism

is influenced by pres-

sure, where the effect

becomes dramatic as

pressure increases. For

example, in a 900 psi

boiler the recommend-

ed maximum drum

water silica concentra-

tion is 2.8 ppm to keep

silica below 10 ppb in

the steam. In a 2,400

psi boiler the recommended maximum is

0.2 ppm! Again, each boiler will exhibit

individual properties in this regard.

Ammonia sampling is valuable, as at

the low phosphate concentration often

maintained in boiler circuits nowadays,

ammonia can impart a false pH indica-

tion. The operators may think that chem-

istry is adequate to prevent under-deposit

chloride and sulfate corrosion, and its

progeny, hydrogen damage, when in fact

the chemistry is not doing the job. Grab

sample ammonia analyses are typically

recommended, where the analyst can

utilize charts to evaluate the chemistry

effects. Excel programs are also available

that allow these calculations to be made

quickly. [6]

SATURATED STEAM

In the past, main/reheat steam sam-

pling was considered more important

than saturated steam sampling, and in-

deed the importance of main/reheat sam-

pling has not diminished. However, the

recommended maximum concentrations

of sodium, chloride, and silica in steam

have all been reduced to the extremely

low limit of 2 ppb. These impurities are

now known to cause turbine corrosion at

polisher, if one has been installed. Grab

sample analyses for silica (SiO2) indicate

the concentration of this contaminant

that is being transported to the LP drum

and beyond, and the attemperators.

An additional technology, particulate

monitoring, is becoming more popular

for condensate and feedwater chemistry

evaluation, and it can be particularly use-

ful for systems operating with air-cooled

condensers (ACC). An ACC eliminates

the potentially catastrophic impurity in-

gress that can occur from water-cooled

condensers, but ACCs are so very large

that a vast surface area of carbon steel is

exposed to flowing steam and conden-

sate. Typically, the bulk of the corrosion

products that emerge in the condensate/

feedwater consist of iron oxide particles.

Particulate monitoring provides a much

better analysis of carbon steel corrosion

than dissolved iron analysis.

BOILER WATER

Along with condensate pump dis-

charge, the boiler water sample is the

most critical. For drum-type HRSGs

as outlined in this article, the high

temperatures and the concentrating

effect caused by recirculation of the

boiler water require close monitoring.

Furthermore, improperly controlled

concentrations of dissolved solids in

the boiler water can introduce exces-

sive contaminants to the steam, where

they may form deposits and/or corrode

superheater tubes and turbine compo-

nents.

Either the drum blowdown line or

a downcomer should be utilized for

evaporator sampling, although EPRI

recommends the downcomer if the

unit is on oxygenated treatment. [3]

Recommended on-line boiler water

analyses include:

•  pH

•  Specific Conductivity

•  Cation Conductivity

•  Sodium

•  Phosphate (for those units on phos-

phate treatment)

Important grab samples include:

•  Ammonia

•  Silica

Boiler water pH is one of the few sam-

ples where an immediate unit shutdown

is required if the chemistry goes bad.

EPRI calls for immediate shutdown if the

pH drops below 8.0 although I am aware

of at least one HRSG

manufacturer that has

set a limit of 7.0. Person-

ally, I feel more comfort-

able with the 8.0 limit,

as if a condenser tube

leak or other serious is-

sue is causing the upset,

time is of the essence in

taking action. From a

treatment standpoint,

many drum units are

operated with EPRI’s phosphate contin-

uum program, in which only tri-sodium

phosphate (Na3PO

4) is utilized for feed

with perhaps a small amount of caustic

(NaOH) at start-up. The free caustic con-

centration should never be higher than 1

ppm to minimize under-deposit caustic

gouging. It must be noted that for HRSGs

as outlined in Figure 1, where the LP

circuit provides feedwater to the IP and

HP circuits, the LP circuit must rely on

the all-volatile feedwater treatment only

with no phosphate addition. Phosphate

can cause difficulties in the IP and HP

economizers that receive feed from the

LP circuit.

Specific conductivity is important for

monitoring total dissolved solids (TDS)

concentration. Excessive solids will me-

chanically carry over to the steam, as

drum steam-separators are never 100

percent efficient. This effect is influenced

by boiler pressure, thus the allowable

dissolved solids concentration decreases

with increasing pressure. Charts are

available to determine TDS limits, but

every steam generator is unique and only

actual operation provides the exact carry-

over data. Cation conductivity provides

a method to evaluate the chloride and

“Boiler water pH is one of the few samples where an immediate unit shutdown is required if the chemistry goes bad.”

1311pe_34 34 11/11/13 11:41 AM

Sending a critical gearbox out for weeks of repair xcan be a prescription for devastating downtime.

Onsite Technical Services from Philadelphia Gear can reduce gear-related downtime from months to days.

When a mission-critical gearbox is out of commission for days, it’s a headache. When days turn to weeks

or months, that headache can become a debilitating spiral of downtime and expense.

Onsite Technical Services (OTSSM

) from Philadelphia Gear, a brand of Timken Gears & Services Inc., was

created to help ensure that doesn’t happen. OTS is a total onsite solution that can reduce gearbox-related

downtime from weeks or months to mere days.

A phone call is all that’s needed to start the process. Our experts are your single point of contact for a

scope of work that can include onsite gearbox removal and re-installation, rebuilding, re-boring, and more.

Our OTS customers benefit from reduced downtime, reduced risk of catastrophic events, and, Philadelphia

Gear’s 120 years of experience and industry-leading warranties.

Finding out if OTS is right for you couldn’t be easier. Just

call 1-800-766-5120 to schedule a free, no-obligation

consultation. It may be the most timely call you ever make.

D O W N T I M E

Fortunately, we make house calls.

For info. http://powereng.hotims.com RS#17

1311pe_35 35 11/11/13 11:41 AM

www.power-eng.com36

chromatography (IC). The equipment is

not inexpensive and it requires a knowl-

edgeable operator, but for anyone who

wishes to closely monitor these harmful

constituents, IC is a good method.

CONCLUSION

Installation of a reliable sampling

system and proper monitoring of the

data requires effort and commitment

on the part of plant management. This

may sometimes be problematic given

the somewhat minimal staffing at com-

bined-cycle plants. However, conscien-

tious monitoring and prompt action

during upset periods can be worth their

weight in gold if they prevent system

corrosion, boiler tube failures and unit

shutdowns. The ultimate price is loss

of life, which has occurred due to flow-

accelerated corrosion tube and piping

failures at a number of utilities during

the last 25 years.

A final note about sampling is that

sample extraction and conditioning are

critical for ensuring accurate analyses. I

will report on these topics in an upcom-

ing issue of Power Engineering.

References

B. Buecker, “Corrosion Control in HRSGs”;

Power Engineering, July 2011.

B. Buecker, “Combined-Cycle Water/Steam:

The Lifeblood of the Plant”; Power Engineering,

June 2012.

Cycle Chemistry Guidelines for Combined

Cycle/Heat Recovery Steam Generators

(HRSGs), EPRI, Palo Alto, CA: 2006, 1010438.

B. Buecker, “The Impact of Condenser Perfor-

mance, Feedwater Heating, and Steam Reheat

on Steam Generator Efficiency”; presentation at

the 25th Annual Electric Utility Chemistry Work-

shop, May 10-12, 2005, Champaign, IL.

Guidelines for Controlling Flow-Accelerated

Corrosion in Fossil and Combined Cycle Plants,

EPRI, Palo Alto, CA: 2005, 1008082.

Buecker B. and S. Shulder, “The Basics

of Power Plant Cycle Chemistry”; Pre-Con-

ference Seminar of the 27th Annual Elec-

tric Utility Chemistry Workshop, May 15-17,

2007, Champaign, IL.

the limit of 10 ppb is being maintained

in the steam.

MAKEUP WATER

TREATMENT

Space limitations prevent much ad-

ditional discussion of sampling issues,

but briefly, makeup water treatment

system sampling is also important. An

increasingly common makeup water

treatment scenario is micro- or ultrafil-

tration, followed by reverse osmosis, in

turn followed by portable ion exchange

or continuous deionization (CEDI) for

polishing. A properly designed and

operated system should produce water

with a specific conductivity less than

0.1 µS, silica less than 10 ppb, and so-

dium, chloride, and sulfate less than 3

ppb. Research has also shown that a

good makeup system should limit total

organic carbon (TOC) in the effluent to

less than 300 ppb. Organic carbon that

enters the condensate system will break

down at the high temperatures in the

boiler to generate small-chain organic

acids that potentially may influence

turbine corrosion. This issue is still

being researched intensively, but is

the primary reason why organizations

such as EPRI do not recommend the

feed of organic pH control chemicals,

or, if necessary, organic metal passiv-

ator/oxygen scavengers, to condensate

and feedwater.

AN ADDITIONAL

MONITORING TOOL

In my previous articles and in other

literature cited in this article and else-

where, the severe corrosion that even

minor amounts of chlorides and sulfates,

particularly chlorides, can cause in steam

generators, especially if they concentrate

under deposits. Chloride and sulfate

monitoring is more difficult than other

parameters, and these constituents are

often not monitored at all. However,

a technique that can be utilized to de-

tect even part-per-billion (ppb) concen-

trations of chloride and sulfate is ion

very low levels. This issue has increased

the importance of periodic saturated

steam sampling for mechanical carry-

over, as that is the primary mechanism

for Na, Cl, and SO4 to enter the steam.

Main and Reheat Steam

These samples are quite critical, as they

provide a direct indication of steam im-

purities generated by drum carryover or

by feedwater attemperation. Some sub-

stances such as silica exhibit decreasing

solubility with decreasing steam pressure,

and will precipitate on turbine blades

as pressure lowers upon steam passage

through the turbine. Other contami-

nants, including sodium, chloride, and

sulfate will come out of steam in the early

condensate that begins to form in the LP

turbine. These salts can initiate stress cor-

rosion cracking and corrosion fatigue of

blades and rotors.

Recommended continuous analyses

include:

•  Cation Conductivity

•  Sodium

An important grab sample analysis is,

•  Silica

The primary measurement is cation

conductivity, and it is typically used as

the criteria for performance evaluation

and warranty requirement by turbine

manufacturers. The common upper

limit is 0.2 µS. As in the earlier discus-

sion, degassed cation conductivity is an

alternative to eliminate the influence of

CO2 upon the readings. In fact, in some

cases degassed cation conductivity may

be particularly useful if amines are used

for pH control in the feedwater. The high-

temperatures in superheaters and reheat-

ers induce decomposition of organic

compounds to small-chain organic acids

and CO2. The compounds naturally will

influence conductivity.

Sodium is another good tool for moni-

toring steam chemistry, as these instru-

ments are reliable and provide quick

results. Sodium readings above 2 ppb

suggest impurity leakage into the steam.

Grab sample silica analyses ensure that

1311pe_36 36 11/11/13 11:41 AM

To find your nearest representative,

visit cleaverbrooks.com or call 800.250.5883.

When you need BIG POWER,total integration generates bigger and better results.No matter the business — refi nery, utility, manufacturing or petrochemical — if you are in an industry that

demands big power, you’ll want to check out the complete range of boiler systems from Cleaver-Brooks.

For more than 80 years, we have set the industry standard in the design and production of boiler systems

that continually maximize effi ciency and deliver uncompromising reliability and the lowest possible emissions.

Our total integration is that every component — from gas inlet to stack outlet — is designed, engineered and

manufactured by just one company.

©2013 Cleaver-Brooks, Inc.

For info. http://powereng.hotims.com RS#18

1311pe_37 37 11/11/13 11:41 AM

www.power-eng.com38

Pictured is an airlock on a

scrubber discharge material

handling system. Photo courtesy

of Allen-Sherman-Hoff

presence of additives used to clean

the flue gas. For example, the prob-

lems associated with moisture become

more complex with the addition of

dry scrubber byproducts. Dry scrub-

bers are commonly used in the power

industry for removing SO2

from flue

gases produced by power boilers burn-

ing low sulfur fuel. These scrubber by-

products can add many dimensions to

the moisture issue, including cementa-

tion and caking. Furthermore, the re-

cent Mercury and Air Toxic Standards

(MATS) mandated by the EPA have ad-

vanced the use of dry sorbent reagents

for removal of Hg, HCL, and other

toxins. These substances have not only

changed the physical properties of the

fly ash but also promoted chemical re-

actions that can have negative effects

on ash handling. This article will dis-

cuss the practical effects of dry scrub-

ber byproducts and other dry sorbents

on ash handling, especially in the pres-

ence of moisture.

Prior to scrubbing, fly ash consisted

predominantly of silica and alumina

glassy material.

Hot furnace temperatures melted

the quartz and alumina, which re-so-

lidified as amorphous glassy spheres.

Subbituminous coal fly ash usually

Moisture can present

significant chal-

lenges in the opera-

tion of fly ash han-

dling systems, even

at low (1 to 2 percent) levels. In tradi-

tional fly ash materials, moisture is the

“glue” that holds ash particles together

via capillary forces thereby enhancing

the cohesive bonds between particles.

This causes the ash to bridge and rat-

hole and become difficult to discharge

from bins, hoppers and vessels.

Over the past two decades, many

coal fly ash material characteristics

have significantly changed due to the

Effects of Coal-Fired Boiler Flue Gas Conditioning on Fly Ash Conveying and Storage SystemsBY TYLER LITTLE, TONY HABIB, LOU ZOTTI AND ROBERT G. WALSH, ALLEN-SHERMAN-HOFF CO.

Authors

Tyler Little, P.E., Research Engineer; Tony

Habib, Manager of R&D; Lou Zotti, Pro-

posal Manager; and Robert G. Walsh,

P.E., Manager of Market Development.

Allen-Sherman-Hoff Co. is a division of

Diamond Power International.

1311pe_38 38 11/11/13 11:41 AM

TM

OWNED &

PRODUCED BY: PRESENTED BY:

TMTM

A U G U S T 2 0 – 2 2 , 2 0 1 4 | N A S H V I L L E , T E N N E S S E E

M U S I C C I T Y C E N T E R , H A L L B

W W W . C O A L - G E N . C O M

For info. http://powereng.hotims.com RS#19

1311pe_39 39 11/11/13 11:41 AM

For info. http://powereng.hotims.com RS#20

Cohesive strength vs. numberof temperature cycles (Specht, 2006)

1

45

40

35

30

25

20

15

10

5

0

Yiel

d St

reng

th (

kPa)

0 1 2 3 4 5

Number of temperature cycles

2% Decahydrate

4% Decahydrate

contains a relatively small amount of

lime in addition to the silica, alumi-

nan and other minerals. The calcium

compounds more readily crystallize

which present as surface irregularities

on the glassy spheres.

When designing ash handling equip-

ment for non-scrubbed fly ash applica-

tions, considerations were given to the

physical properties of the ash, such as

cohesive strength, permeability and

density. These properties played a ma-

jor role in the conveying, storage and

discharge of the fly ash material. For

example, bituminous ash had relative-

ly low cohesive strength and high per-

meability since it was made predomi-

nantly of glass spheres with minimal

contact among particles (see photo on

pg. 41). On the other hand, subbitumi-

nous coal fly ash had a relatively higher

cohesive strength due to the presence

1311pe_40 40 11/11/13 11:41 AM

www.power-eng.comFor info. http://powereng.hotims.com RS#21

of other constituents with smaller

and odd-shaped particles (CaO and

CaSO4) that tended to increase contact

points between particles. However,

despite their differences, bituminous

and subbituminous coal fly ashes had

physical properties that were relatively

independent of time. For this reason,

these materials could be stored in

hoppers for hours without significant

changes in cohesive strength.

With the addition of dry scrubber or

dry sorbent injection (DSI) systems,

special considerations need to be giv-

en because the material has changed

chemically. These

systems introduce

new compounds,

both reacted and

non-reacted, which

are prone to cemen-

tation and caking.

According to Dr. Kerry Johanson of

Material Flow Solutions, the cohesive

strength of fly ash with soluble addi-

tives can increase by an order of mag-

nitude due to solid bridging, a mois-

ture dependent process where material

is dissolved at the particle surface and

then dried leaving behind a crystal

bond between particles. This process

is often cyclical due to temperature

swings which cause condensation and

drying on the surface of the particles.

For example, Figure 1 illustrates that

sodium carbonate (a common unreact-

ed sorbent) with 4 percent crystalline

water doubles its cohesive strength

over three temperature cycles.

The strength of the crystal bond is

affected by the local moisture content,

temperature and drying time. This

phenomenon is often the cause of cak-

ing along the walls of silos due to day/

night temperature cycles.

Cementation is another mecha-

nism by which calcium-based mate-

rials become more cohesive, and is

driven primarily by chemical makeup,

moisture and time.

Figure 2 illustrates

the change in mate-

rial strength of dry-

scrubbed fly ash

during a three hour

period in the pres-

ence of moisture. The red curve rep-

resents the material strength while

the temperature was held constant for

three hours. The blue curve shows the

material strength while the tempera-

ture was cycled (high and low) to pro-

mote caking. This particular material

was obviously sensitive to time, tem-

perature and moisture, but not to tem-

perature cycling which is indicative of

cementation.

Dry scrubbers use hydrated lime,

Fly Ash Morphology. Photo courtesy of Allen-Sherman-Hoff

Moisture is the ‘glue’ that holds ash particles together via capillary forces.

1311pe_41 41 11/11/13 11:41 AM

www.power-eng.com42

For info. http://powereng.hotims.com RS#22

2Strength as a Function of Storage Time

Unc

onfr

med

Yie

ld S

tren

gth

(psf

)

Major Principle Stress (psf)

0 200 400 600 800 1000 1200 1400

Storage Time = cycled 3 (hr)

Storage Time = 3 (hr)

Storage Time = 0 (hr)

1,000

800

600

400

200

0

lime is utilized during the scrubbing

process. Some fly ash material makes

it to the collection hopper with unre-

acted hydrated lime which, with time,

tends to carbonate and form calcium

carbonate or limestone, which is a ce-

menting process {Ca(OH)2 + CO2 ->

CaCO3 + H

2O}. X-ray diffraction has

detected the presence of CaCO3 in

hardened deposits in transport lines.

In DSI systems, sodium bicarbonate

or trona is often used as a scrubbing

agent. The unreacted compounds for

these sorbents are highly soluble and

are therefore also susceptible to re-

crystallization and caking in transport

pipe and storage media.

Whether calcium or sodium based

sorbents are used for scrubbing, the re-

agents and reacted products are sensi-

tive to moisture and can cause buildup

in the hoppers and silos, especially

with time and temperature cycling

(night and day swings). According to

Damon Woodson of Southern Co., si-

los in the southern states become more

difficult to unload after a rainy day, es-

pecially in the winter. Moisture intro-

duced into the silo during the day can

condense at night when temperatures

are cooler. The combination of mois-

ture, time and temperature provide

an ideal environment for cementation

and caking.

Ca(OH)2, as an agent for sulfur remov-

al. The reacted agents are typically cal-

cium sulfate or calcium sulfite, which

are sensitive to moisture and time. Cal-

cium sulfate can turn into plaster with

the right amount of moisture and time.

The absorber exit temperature is usu-

ally kept around 40°F above the dew

point (40°F approach temperature).

The fly ash/byproduct mixture typical-

ly has a moisture content of 1 to 2 per-

cent. The industry attempts to improve

scrubbing efficiency to reduce lime us-

age by lowering the approach tempera-

ture. This often comes at the expense

of higher moisture content. Research

has demonstrated that an increase in

moisture content from 1 percent to 2

percent with 24 hour storage increases

the cohesive strength of calcium sul-

fate material by approximately three

times (Shulze, 2008). It is important to

remember, however, that the moisture

can be concentrated in the cooler parts

of storage vessels where the local mois-

ture can be as high as 10 percent for

bulk moisture levels of 1 to 2 percent.

In practice, not all of the hydrated

1311pe_42 42 11/11/13 11:42 AM

For info. http://powereng.hotims.com RS#23

1311pe_43 43 11/11/13 11:42 AM

www.power-eng.com44

subzero temperatures, or relative-

ly long transport piping. For DSI

systems with trona, heated air is

not recommended.

•  Fly ash with dry scrubber material

has good air retention,

which permits the use

of lower transport ve-

locities compared to

non-scrubbed ash.

Storage Silos

•  Flat-bottom silo aer-

ation coverage should

be at least 20 percent

of the total cross-sectional area to

ensure even distribution. Dry air

is recommended.

• While silo insulation is preferred,

it is usually not practical and is

costly.

•  Silo aeration blower pressure

should be sized to overcome the

full design volume (head) of ash

acting on the air slides.

•  The silo aeration blower pressure

should be checked on a regular

basis to confirm that the air slides

have not been compromised.

Blowing pressure trending down-

ward with time at a given silo level

is indicative of poor air distribu-

tion and channeling, which can

lead to material consolidation and

erratic discharge.

•  Ash conditioning should be done in

a pin-paddle combination pugmill

(see photo on this page). Pins pro-

vide the dwell time to wet the ma-

terial while the paddle provides the

force to push the material through.

Lining the mixer, pins and paddles

with a “non-stick” surface helps to

prevent material buildup and pro-

tects the carbon steel base material

from corrosion and erosion. The

mixer should be washed thorough-

ly at least once a day.

Moisture will continue to be present

in every fly ash handling application.

Understanding not only the physical

properties of the material but also the

chemical properties of the fly ash can

help in designing a system with less

cementing and caking problems. This

understanding will lead to a more reli-

able fly ash conveying system.

There are ways to mitigate the im-

pact of moisture-related issues when

designing or operating an ash han-

dling system with conditioning ad-

ditives. Material storage time should

be minimized, sources of moisture

should be eliminated, and tempera-

ture cycling should be avoided where

possible. The following are practices

adopted by Allen-Sherman-Hoff for

mitigating moisture related problems

and improving material handling sys-

tem performance:

Fabric Filter Hoppers

•  Fabric filter or precipitator hop-

pers should be pulled continuous-

ly regardless of load to avoid con-

solidation, caking and cementing.

•  Hopper heaters should be used

but the temperature should be

kept at around 30°F above the

flue gas dew point.

Higher heater tem-

peratures can drive

off crystalline wa-

ter leaving solid

bridges.

•  Hopper walls

should be insulat-

ed to keep material

warm and prevent

condensation.

•  Dry air should be used to aerate

the hopper. This should reduce

ratholing tendency and improve

material discharge.

Transport Systems

•  Transport lines should be insu-

lated.

•  Transport inlet air heating is pre-

ferred for materials consisting of

calcium compounds in instances

of extreme weather conditions,

such as a humid environment or

The combination

of moisture, time

and temperature

provide an ideal

environment for

cementation and

caking.

Conditioner with Pins and Paddles. Photo courtesy of Allen-Sherman-Hoff

1311pe_44 44 11/11/13 11:42 AM

For info. http://powereng.hotims.com RS#24

1311pe_45 45 11/11/13 11:42 AM

www.power-eng.com46

1a 1b

pulverized coal boiler with low NOx

burners (LNBs), OFA and electrostatic

precipitator (ESP) particulate control.

Unit 1 burns a blend of 90 percent Pow-

der River Basin (PRB) and 10 percent lo-

cal Missouri coal.

Modifications to reduce emissions are

under way on both units. Unit 1 is in-

stalling a fabric filter, new WFGD system,

new induced draft (ID) fans and new dis-

tributed control system (DCS). Unit 2 is

retiring the ESP and installing a fabric fil-

ter, WFGD system, new ID fans and SCR

system.

The Unit 1 SCR was installed in 2007

with a 3 + 1 catalyst layer configuration,

which consists of three initial layers of

catalyst with one spare layer for future

use. In the fall of 2012, La Cygne vacu-

umed 2.9 million pounds of fly ash from

the Unit 1 SCR after a 17-month operating

cycle. This was twice the typical amount

of fly ash removed in previous outages

because the unit had operated for an

extended time with a low demand load

factor. However, the catalyst pluggage of

approximately 50 percent was typical of

previous operating cycles. The Unit 1 SCR

consists of two reactor casings separated

by a common division wall. Flue gas en-

ters the SCR North Side B and South Side

A of the SCR hood to flow down through

these separated casings (refer to the flow

model arrangement shown on Figure 2).

Fly ash would accumulate five to six feet

deep near the SCR north to south reactor

casing division wall. The fly ash accu-

mulation caused high ash removal costs,

catalyst replacement costs, high cata-

lyst pressure drop and fan power costs,

and high ammonia slip and ammonia

reagent costs. In addition, cleaning the

catalyst became a critical path activity

during outages. The fly ash accumulation

also caused unit capacity de-rates in com-

bination with other draft losses. Excess

The Kansas City Power &

Light (KCP&L) La Cygne

Generating Station pro-

vides 1,532 MW of peak

power to customers from

its site south of Kansas City. La Cygne

Unit 1 is an 815 MW Babcock & Wilcox

(B&W) cyclone boiler with overfire air

(OFA) and selective catalytic reduction

(SCR) nitrogen oxide (NOx) controls.

It is the second-oldest B&W wet flue

gas desulfurization (WFGD) installation

in the country. Unit 2 is a 717 MW B&W

Airflow Problems Lead to Fly Ash Accumulation

BY SCOTT HIEDEMAN, KCP&L, REID THOMAS AND DALE PFAFF, FUEL TECH, INC., AND DIANE FISCHER, BLACK & VEATCH

Computer modeling and modifications to the SCR hood solve this costly problem for Kansas City Power & Light’s La Cygne Generating Station

Poor air flow led to fly ash accumulation in the SCR of La Cygne Unit 1. In fall 2012, 2.9 million pounds of fly ash had to be removed after 17 months.

A Costly Problem

1311pe_46 46 11/11/13 11:42 AM

www.power-eng.com

ìPROBLEM SOLVEDîISNíT JUST OUR TAGLINE,

ITíS WHO WE ARE.

Spillage, airborne dust and carryback

problems arenít simply annoyances.

They put productivity, employee

safety and your organization at risk.

Here at Martin, we focus on

completely understanding and

assessing your problems up front

to deliver comprehensive solutions

that work; on time and on budget,

ensuring your bulk material

handling problems stay solved.

With Martin, consider it done.

call 1 800 544 2947 | visit martin-eng.com

email info@martin-eng.com

Æ Registered trademark of Martin Engineering Company in the US and other select locations.

© 2013 Martin Engineering Company. Additional information can be obtained at www.martin-eng.com/trademarks.

For info. http://powereng.hotims.com RS#25

flow to the upper four SCR hood

turning vanes.

•  The turning vanes and perforated

plate on top of the original egg crate

flow straightening grid created flow

recirculation zones that caused fly

ash dropout. The turning vanes also

collected ash on horizontal surfaces

because of low flow, and these ash

piles sloughed off during forced

draft (FD) fan startups.

•  The egg crate structural support steel

created flow disturbance that could

not be corrected in the short dis-

tance to the first catalyst layer.

The flue gas recirculated behind the

SCR hood turning vanes, but the fly ash

did not follow this twisting route and

fly ash accumulations are shown on Fig-

ures 1a and 1b.

Many minor changes were attempted

through the five years of Unit 1 SCR op-

eration prior to fall 2012. These changes

included the following:

•  The original flow modeling was re-

viewed, and missing flow control

baffles were installed.

•  The sonic horn’s air supply dryer

drain solenoid was corrected to

drain off excess condensation.

•  The sonic horns were heat traced and

insulated.

•  The fly ash was vacuumed from the

catalyst. Horizontal vane and beam

surfaces were covered or removed in

some areas to “pilot” corrective ac-

tions to prevent ash pile accumula-

tions.

•  The original catalyst was 7.1 millime-

ter (mm) pitch honeycomb ceramic

catalyst. Catalyst layer replacements

were made with larger 8.2 mm pitch

honeycomb catalyst, and 9.2 mm

pitch catalyst was installed near the

SCR reactor casing division wall.

These minor repairs were not success-

ful, because they were not addressing the

root cause of poor flow distribution.

CAUSES OF PLUGGAGE

To keep PRB fly ash moving through

the catalyst, flue gas flow to the catalyst

must be of uniform velocity, vertical and

without recirculation. In 2010, KCP&L La

Cygne initiated Computational Fluid Dy-

namics (CFD) flow modeling with Fuel

Tech, Inc. (FTEK) to determine the cause

of fly ash accumulation and design po-

tential devices to correct flow variances

to the catalyst. The CFD analysis shown

on Figures 3 and 4 indicated problem

areas in SCR design flow, including the

following:

•  SCR inlet duct north-south contrac-

tion pushed flow to the lower four

SCR hood turning vanes.

•  Trusses and large gusset plates in

SCR inlet duct and hood restricted

1311pe_47 47 11/11/13 11:42 AM

www.power-eng.com48

CFD Analysis

Source: Fuel Tech

3

This CFD analysis shows problem areas in the airfow in the SCR of La Cygne Unit 1.Velocity: Magnitude (ft/s)

10.000 60.00050.00040.000

Velocity: Magnitude (ft/s)

30.00020.000

Flow Model

2

The La Cygne Unit 1 SCR consists of two reactor casings separated by a common division wall. Flue gas entersthe SCR North Side B and South Side A of the SCR hood to fow down through these separated casings.

Straightening Gridand Perf Plate

Catalyst

Catalyst Supports

LPA Screen

Symmetry Plane

Turning Vanes

Trusses

Mixer

AIG

Dampers

SOLUTION

IMPLEMENTATION

Modification to the Unit 1 SCR hood

was originally planned for the fall of

2013, when a longer duration outage was

scheduled. However, low demand load

factors on KCP&L and Westar systems in

2012, and the high price of continuing

catalyst ash pluggage led to the decision

for a 2012 installation. A short boiler in-

spection outage was extended to a 44-day

outage to accommodate the work. Design

of the new flow distribution devices for

the Unit 1 SCR hood was initiated in July

2012, with the outage scheduled for Oct.

1, 2012. With the short time frame for

design and fabrication, the contracted

services were secured for flow modeling,

structural engineering, fabrication, and

construction installation.

Black & Veatch was contracted to pro-

vide design drawings and specifications,

review the flow modeling and proposed

flow distribution devices, and evaluate

constructability. The entire team partici-

pated in preliminary flow model result

review meetings to provide immediate

input to flow modeling and direction

to engineering. Conceptual SCR hood

structural truss supports were developed

prior to flow modeling. Probable flow

distribution devices were detailed by

engineering to obtain construction in-

stallation bids. Catalyst installation was

instead fell out on the catalyst layers. Be-

cause of these issues, KCP&L decided that

the existing flow straightening devices

needed to be removed and replaced with

a new design that addressed the findings

of the flow model.

1311pe_48 48 11/11/13 11:42 AM

www.power-eng.com 49For info. http://powereng.hotims.com RS#26

Advanced

CORMETECH

Technology

STM

olutions

�����������ACTiveTM

catalyst

�������������������� ���������

���������� ���TM

catalyst

����������� ���������������

������������TM

catalyst

������������������������ ��

removal and low NH3 Slip

������������ �������TM

pressure drop solution

CORMETECH, Inc.��������������� ��

�����������������������������

������������

www.cormetech.com sales@cormetech.com

CORMETECH offers a full

range of products and services

to maximize the life and effectiveness

of your SCR System

CLEANER AIR

��������������

planned for Layers 2-3-4 to allow Layer 1 to be a work

platform for the SCR hood modifications. Flow device

fabrication was performed off-site at fabrication shops to

speed production. Fabrication was scheduled to continue

through the start of the Oct.1 outage because demolition

would occur before new materials would be needed.

The CFD modeling study analyzed the removal of the

SCR hood turning vanes, and replacement with the GSG.

Previous CFD modeling had shown heavy flow recircula-

tion behind the SCR hood turning vanes. The GSG device

consists of parallel plates installed in the SCR hood on the

diagonal, to turn the flue gas and fly ash vertically into the

first catalyst layer.

The GSG technology is a significant step forward

in SCR process design. Until recently, improving the

velocity distribution and flow direction into the face

of the first catalyst layer was accomplished by the tra-

ditional solution of many large turning vanes along

with a straightening grid placed immediately above

the catalyst. The turning vanes were tuned to achieve

an even velocity distribution while the straightening

grid below straightened the flow direction.

The turning vane system requires exact spacing and an-

gling of turning vanes during SCR construction to ensure

required flow distributions are met. This traditional solu-

tion is also extremely sensitive to changes to the upstream

flow distribution and any changes to the system require

remodeling and retuning of the vanes to maintain the re-

quired distributions. After years of research and develop-

ment using scale and computational modeling, the GSG

has been thoroughly tested and successfully installed on

a number of units.

The GSG combines the turning vanes and straightening

grid into a single sloped grid. The GSG has been shown to

be an extremely robust flow corrective solution. It is much

less sensitive to upstream flow distributions compared

to traditional solutions. This means that the catalyst and

catalyst performance are protected even when the unit

is not running at optimum design conditions, including

economizer bypass operation. In addition, the GSG can

accommodate future boiler or ductwork changes.

The CFD model results indicated the GSG corrected the

large flow recirculation zones and flow was vertical out of

the GSG. However, the flow statistics were not within the

project team’s target of +/-15 percent of arithmetic mean

velocity. The SCR hood truss/gussets and egg crate struc-

tural steel were creating large flow velocity variances be-

fore the first catalyst layer.

The CFD model was analyzed with removal of the two

trusses, removal of the egg crate support steel and re-

moval of both truss and egg crate. Removal of all internal

1311pe_49 49 11/11/13 11:42 AM

www.power-eng.com50

Baseline Velocity Vectors

Source: Fuel Tech

4

23.00018.40013.8009.20004.60000.00000

The fow direction vectors show the fow recirculation zones behind the SCR hood turning vanes.

Velocity Magnitude (ft/s)

Z

Y

X

steel not only supported the old flow

straightener weight but also restrained

the pressure forces on this elevation. A

buckstay arrangement was developed to

resist these forces.

The selected arrangement was instal-

lation of the GSG device with perforated

plate at the turning vane location. The

GSG replaces the turning vane and egg

crate functions by turning the flow 90 de-

grees and aligning the flow vertically to

pass through the catalyst layers. A perfo-

rated plate was needed on the GSG blades’

leading edge to overcome the low flow at

the SCR A and B division wall. The flow

statistics did not quite reach the desired

project goal of 100 percent of all flow ve-

locities within +/-15 percent of arithme-

tic mean. The final model showed flow

distribution statistics with 91 percent of

all analyzed flow velocities within +/-

15 percent, which is equal to 9.5 percent

root mean squared (rms). This was a sig-

nificant improvement compared to the

into the front of the reactors and pushed

more flow past the truss/gusset system to

the back half of the reactors. The lower

percentage open area at the back wall

was needed to reduce flow being turned

down to the catalyst by the back wall.

The final modification arrangement

included demolition of the turning vanes

in the hood of the SCR reactors and de-

molition of the original egg crate flow

straightener, perforated plate, and its sup-

port steel.

The conceptual design developed by

FTEK in the flow model was then devel-

oped in to detailed design drawings for

fabrication and installation. The GSG

blade detail drawing was completed in

advance, based on FTEK’s standard de-

sign. Engineering added the final per-

forated plate details and turned these

drawings over for fabrication. Engineer-

ing also began redesign of the support for

the SCR pressure load where the egg crate

support steel was removed. The egg crate

structure obviously had the best result;

however, removal of egg crate steel had

a nearly identical result without the ex-

pense of replacing the SCR hood truss

system. The egg crate steel was too close

to the first layer of catalyst for the flow

distribution to recover, but the flow sta-

tistics were still not close enough to the

recommended +/-15 percent of mean.

The SCR inlet flue contraction and

truss/gussets were both working to push

flow to the SCR inlet corner and away

from the back half of the SCR reactor cas-

ings at the division wall. The next CFD

model run added a perforated plate to

the leading edge of the GSG blades. This

showed improvement in the flow statis-

tics. One more CFD model run was per-

formed to tune a variable perforated plate

across the leading edge of the GSG blades.

The final perforated plate open area was

varied 42-50-63-50  percent open. This

variable perforated plate prevented ex-

cess flue gas from making the quick turn

1311pe_50 50 11/11/13 11:42 AM

www.power-eng.com 51

Your trusted partner for bolted joints

The Nord-Lock Group is a world leader in bolt securing systems. We offer a unique combination of bolting expertise and a wide product range, including wedge-locking solutions and Superbolt tensioners.

Discover safe and easy bolting for your critical applications today!

www.nord-lock.com

SAFETY AND

QUALITY ARE KEY

IN THE NUCLEAR

INDUSTRY

A MAGAZINE ABOUT OPTIMISING BOLT SECURING WWW.BOLTED.COM # 2 2013

WHY YOU DON’T WANT

TO COMPROMISE

BOLT SECURITY

MININGHOLDING TOGETHER

THE WORLD’S

LARGEST CRANE

BIG LIFT

HOW TO DEAL WITH

GALLING, SEIZING

AND SLACKENING

EXPERT ADVICE

O

INCREASE YOUR

BOLTING KNOWLEDGE:

www.bolted.com/subscribe

Bolting tips & case studies from

the bolting experts.

For info. http://powereng.hotims.com RS#27

The egg crate steel above the Layer 1

catalyst that was removed had provided

the catalyst removal cart wheel tracks. As

a result, an alternate catalyst installation

method needed to be developed. A grat-

ing floor was installed in catalyst Layer 1.

Future Layer 1 catalyst installation will

be by pallet carts. Catalyst was installed

in Layers 2-3-4 during the 2012 outage to

aid GSG construction sequence. Catalyst

support beam teepee ash guards were

installed on the grating floor to prevent

PRB fly ash stalagmites from growing up

from the beams.

Additional PRB fly ash accumula-

tion prevention measures were taken by

installing ash guards on all horizontal

surfaces inside the SCR. The 2011 EPRI

Report, “Operation and Maintenance

Guidelines for Selective Catalytic Reduc-

tion Systems” discusses several zones

where fly ash can accumulate. Zones 2,

4, and 5 showed fly ash accumulation

on horizontal surfaces, where unstable

fly ash piles can fall off onto the catalyst.

Flow recirculation Zones 1, 3, or 5, rep-

resenting areas under turning vanes or

structure at La Cygne, can cause fly ash

to drop out of the flue gas flow eddies.

La Cygne catalyst seals were sloped

similar to the beam guards to prevent sta-

lagmite growth. Catalyst support beam

and loading monorail beam pockets were

covered to prevent ash buildup and ash

sloughs. SCR hood truss beam pockets

were covered, beam tops were sloped to

eliminate ash buildup, and beam bot-

toms were fabricated into air foils to avoid

recirculation zones.

PRB coal ash collects inside the SCR

catalyst structural beam pockets.  The ash

in the deep beam pockets can slough off

in large sections to cause bigger piles on

the catalyst.  Beam ash guards were in-

stalled to prevent ash accumulation.

RESULTS

An SCR internal inspection after 4

original, traditional turning vane design

where 58 percent of flow velocities were

within +/-15 percent (17.5 percent rms).

The flue gas flow direction, shown with

velocity vectors, result was excellent. The

flow recirculation was nearly eliminated,

except at the two truss systems, and the

flow direction was vertical going into the

catalyst.

GSG with perforated plate installation

and egg crate support removal produces

vertical, non-recirculating, uniform ve-

locity to the catalyst.

The fabrication of the GSG modules

was straightforward. These modules were

completed and shipped to the site prior

to the installation crew needs during the

October 1 outage. The late addition of the

variable perforated plate added a compli-

cation to the fabrication schedule. Fab-

rication time at six different shops was

secured to laser or plasma cut all the per-

forated plate parts. The final GSG device

with perforated plate was installed.

1311pe_51 51 11/11/13 11:42 AM

For info. http://powereng.hotims.com RS#28

NO DPF. FEWER PARTS. LESS MAINTENANCE.

SMART. PROVEN. POWER.Volvo Penta meets Tier 4 fi nal requirements without the need for a

DPF or DOC. Learn more at volvopenta.com/industrial.

The GSG and perforated plate modifi-

cations resulted in more than $5,000,000

in capital cost savings compared to other

options including truss removal and

changing the original inlet flue gas distri-

bution design.

SUMMARY AND

RECOMMENDATIONS

The following lessons learned are

provided as a recommendation to utili-

ties facing similar challenges with SCR

pluggage:

•  Select an experienced flow modeler

with PRB coal fly ash modeling ex-

perience.

•  Perform complementary design

activities of CFD and physical

modeling.

•  Require a flow model resolution

in the SCR hood of 5,000,000 to

10,000,000 analyzed cells.

• Model SCR hood equipment 6 inch

or larger in the physical model and

any flow disturbance in the CFD

model.

•  Require flow to the catalyst to be

uniform, vertical, and without re-

circulation.

•  Require that the design criteria for the

flue gas flow distribution be within

+/-15  percent of arithmetic mean

velocity, and not rms or coefficient

of variation (Cv).

•  Require that no flow recirculation

be allowed in the SCR hood.

• Minimize the structure in the SCR

and gas flues in accordance with the

EPRI SCR guidelines.

• Minimize horizontal surfaces in-

side the SCR.

•  Install ash guards with 60 degree

slope on any remaining horizontal

surface or catalyst seal.

•  Install catalyst with a minimum

pitch of 8.2 mm for honeycomb

or 5.7 mm plate when firing PRB

coals.

months of operation showed excellent re-

sults at the SCR division wall, which was

a trouble spot originally.  The plant staff

noted the significant decrease in fly ash

accumulation on the first catalyst layer.

These improvements are the results of

the GSG technology providing improved

flow (uniform, vertical, and non-recircu-

lating flow) in the SCR hood.

Reduced fly ash accumulation in La

Cygne Unit 1 SCR will reduce catalyst

replacement costs, reduce fly ash vacuum

removal costs, reduce catalyst pressure

drop and fan power costs, reduce ammo-

nia slip and ammonia costs, and reduce

complexity of outages. The next catalyst

layer replacement is not budgeted until

after 2019. This would result in one layer

being replaced after seven years of opera-

tion, compared to previous replacement

of eight layers in five years. Flow mod-

eling for root cause correction of fly ash

pluggage and GSG technology has led to

this SCR performance turnaround.

1311pe_52 52 11/11/13 11:42 AM

Æ

DECEMBER 9–11, 2014 // ORLANDO, FLOLORIDA / ORANGE COUNTY CONVENTION CENTER

W W W . P O W E R - G E N . C O M

OWNED & PRODUCED BY: PRESENTED BY: SUPPORTED BY:

FOREVER ADVANCING

www.powergenerationweek.com

For info. http://powereng.hotims.com RS#29

1311pe_53 53 11/11/13 11:42 AM

www.power-eng.com54

NUCLEAR SAFETY

Energy Institute (NEI) then prepared re-

port NEI-12-02 to provide guidance to

businesses in complying with the order,

and the NRC issued interim staff guid-

ance for public comment on the rule. The

rule came about when

reports surfaced that

workers at the Fuku-

shima plant were not

aware of pool levels

or temperatures at the

plant after the March

11 earthquake and

tsunami rendered all

electrical equipment

useless. It is a problem that workers at

Tokyo Electric Power Co. (TEPCO) are

still facing. More incidents of radioactive

water spills caused by workers not having

instrumentation that alerts them to how

much water is in the storage containers

have been reported.

Conversely, if spent fuel pool levels

boil down too low, then the risk of fires

and radioactive steam increases.

The U.S. has taken lessons learned

from Japan and started implementing

them across the fleet. Plant operators are

retrofitting their spent fuel pools with

newer monitoring equipment that uses

guided wave radar (GWR) sensors, and

other countries are installing equipment

into their new builds.

Westinghouse offers a spent fuel pool

instrumentation system (SFPIS) that uses

permanently installed primary and back-

up GWR sensors that meet those require-

ments. The system meets both NRC and

NEI requirements and is able to monitor

spent fuel pool water levels even under

harsh weather conditions. Many of the

nuclear power plants in the U.S. are us-

ing GWR sensors,a proven technology

that has been used across the industry for

years.

While the U.S. nuclear fleet mostly

uses GWR, China is using a spent fuel

pool monitoring system from Fluid Com-

ponents International in their CPR1000

reactors called the CL86 Plus. The CL86

Plus is essentially three systems in one,

said Kenneth Christian, Nuclear Product

Manager with Fluid Components Inter-

national. It is an extension of FCI’s CL86.

The CL86 Plus combines the three critical

measurements of con-

tinuous level, point

level and temperature

into a single inte-

grated multi-variable

solution designed spe-

cifically for spent fuel

pool monitoring. The

CL86 Plus also has

VeriCal, which pro-

vides an in-situ calibration verification of

the instrument. This complies with the

requirement to test the instrument prior

to a refueling outage and is achieved by

lowering and raising the water level with-

in the instrument’s stilling well without

having to remove the instrument from

the water or change the pool level.

Nuclear safety envelops

many aspects within

the nuclear power

industry, from cy-

bersecurity to worker

safety to monitoring equipment. Compa-

nies must adhere to stringent federal and

state safety regulations, including new

rules spawned from the Fukushima Dai-

ichi nuclear power plant accident in 2011.

With more problems arising recently

from the Fukushima plant and the grow-

ing risk of cyber attacks, companies are

looking for ways to keep workers, power

plants and the public safe from another

disaster.

The U.S. Nuclear Regulatory Com-

mission issued Order EA-12-051 on

March 12, 2012, more than a year after

the Fukushima accident. The measure

requires all U.S. nuclear power plants

to install water level instrumentation in

each spent fuel pool on site. The Nuclear

How to Keep Nuclear Plants Safe? Let Me Count the WaysBY SHARRYN DOTSON, ASSOCIATE EDITOR

Fluid Components International combines three

critical measurements into one product. Courtesy:

Fluid Components International

“The U.S. Nuclear Regulatory Commission issued Order EA-12-051 on March 12, 2012, more than a year after Fukushima.”

1311pe_54 54 11/11/13 11:42 AM

The Westinghouse Advanced Logic System® (ALS) platform

is the fi rst fi eld-programmable gate array-based safety

system instrumentation and control solution to be licensed

by the U.S. Nuclear Regulatory Commission.

Our ALS solution is a logic-based platform that doesn’t use

a microprocessor or software for operation, but instead

relies on simple hardware architecture. Not only is the

ALS system maintainable for the long term, but it is also

scalable and can provide single-system replacements or

full safety instrumentation and control replacement.

To learn more, visit us at www.westinghousenuclear.com

THE NEXT GENERATION OF

SAFETY SYSTEMS SOLUTIONS

THE ADVANCED

LOGIC SYSTEM®

PLATFORM

For info. http://powereng.hotims.com RS#30

1311pe_55 55 11/11/13 11:42 AM

www.power-eng.com56

ALS technology differs in that it doesn’t

use software or a microprocessor. Instead,

it is a logic-based technology that helps to

maintain the integrity of the system.

“Instead of having software driving

this, it’s a card that has a logic diagram

burned into the chip,” Howell said.

“Once it is burned in, it can’t be altered

without taking it out and putting in a new

chip. From a safety perspective, it main-

tains the integrity of the program.”

The NRC approval was just for the

backbone, Howell said.Adding it to other

safety applications would require addi-

tional approvals.

“It is licensed for backup diesels and

any other safety-related activity,” he said.

“There are various applications in a safety

system.”

Howell also said Westinghouse is

working to scale it up so it can be applied

to the overall safety system. The compa-

ny is also working to implement it in the

1,100 MW AP1000 nuclear reactor tech-

nology and has plans to install it in its

small modular reactors currently under

development.

The ALS system is also a good tool for

cybersecurity at nuclear power plants, but

it isn’t the only product available to pro-

tect plant systems and networks. Several

U.S. nuclear power plants are using uni-

directional security gateways to protect

plant systems from cyber attacks, such as

Christian said China has ordered

33 CL86 Plus units for their CPR1000

plants, including ten units delivered

with six units already being installed.

The company is working to deliver the

product for use with AREVA Inc. in their

power plants in Europe. The instruments

use FCI’s thermal dispersion technology.

“Essentially, you have a heated RTD

and an unheated RTD contained in min-

eral insulated rods, and both are continu-

ous over the entire active length of the

CL86 Plus,” Christian said. “When the

water level rises, the temperature differ-

ential, or delta T, in-

crementally decreases

until it is smallest in

a fully submerge, or

wet, condition. The

differential is detected

as a variable resistance

between the heated

and unheated RTDs

and is electronically

converted into a linearized output signal

directly proportional to the medial level.”

The mineral insulated cable are sup-

ported internally on a spine, which is

then centered with spacers in a stainless

steel stilling well assembly for protection,

Christian said. There are no moving parts

and nothing that can foul or clog. These

are robust, Class 1E instruments that

have been supplied to the commercial

nuclear industry continuously for over 35

years.

While the CL86 Plus and Westing-

house’s SFPIS are just some of the many

products that help keep an eye on spent

fuel pool levels, other systems at a nucle-

ar power plant concentrate on making

sure the entire plant is operating safely

and as designed.

Nuclear power plants use both safety

and non-safety systems. The non-safety

systems cover normal plant operations

like the control system, pumps and mo-

tors. The safety system kicks in when the

regular system stops

working, such as the

backup diesel gen-

erators. Safety systems

also have much higher

requirements from the

NRC and the Insti-

tute of Electrical and

Electronics Engineers

(IEEE).

Post-Fukushima requirements con-

tinue to drive a lot of utilities and com-

panies to look for ways to boost their

plant’s safety measures. The NRC recently

approved Westinghouse’s Advanced

Logic System (ALS) Platform, which is

the backbone of the safety system at a

nuclear power plant, said David Howell,

senior vice president of Automation and

Field Services with Westinghouse. The

Westinghouse’s ALS program

uses a card with the logic

diagram burned into it

instead of software. Courtesy:

Westinghouse

“Their attention to detail is stunning. There’s no such thing as being perfectly safe.” - Andrew Ginter, Waterfall

Security Solutions

1311pe_56 56 11/11/13 11:42 AM

wwwww.w.popowewergrgenenfifinanancnciaialflfororumum.c.comom

DECEMBER 10-11, 2014

Orange County Convention Center » Orlando, Florida

LeadingThThe e POPOWEWER-R-GEGEN N InInteternrnatatioionanal l FiFinanancnciaial l FoForurum m isis d desesigignened d toto

prprovovidide e cocorprpororatate-e-lelevevel l prprojojecect t dedevevelolopepersrs a andnd f f n nanancicierers s anan e excxclulusisiveve

vevenunue e toto l leaearnrn, , nenetwtworork k anand d dodo b bususininesess.s. W Wee arare coco-locatateded w witithh

POPOWEWER-R-GEGEN N InInteternrnatatioionanal,l, t thehe l larargegestst c cononfefererencnce e anand d exe hihibibititionon

fofor r ththe e popowewer r gegeneneraratitionon i indndusustrtry..

ThThe e FiFinanancnciaial l FoForurum m cocombmbinineses t thehe l leaearnrnining g anand d nenetwwororkik ngng

exexpeperirienenceces s ofof a an n ininduduststryry-l-leaeadidingng c cononfefererencnce e wiwithth t thehe o opppporortutuninityty

toto d do o bubusisinenessss o onene o on n onone e wiwithth t thehe w wororldld’s’s t topop e engnginineeeeriringng,,

prprococururememenent t anand d coconsnstrtrucuctitionon f f r rmsms a as wewellll a as s huhundndreredsds oof f origiginnal

eqequiuipmpmenent t mamanunufafactctururererss anand d susupppplilierers.s.

Supported By:

Owned & Produced By: Presented By:

DECEMBER 7-11, 2014www.powergenerationweek.com

For info. http://powereng.hotims.com RS#31

1311pe_57 57 11/11/13 11:42 AM

www.power-eng.com58

For info. http://powereng.hotims.com RS#32

PROVIDING VALUABLE PARTNERSHIP AND

INNOVATIVE PRODUCTS

Led by a team of elite and dedicated sales engineers, we don’t

just sell cables, we help provide added partnerships that can

directly impact the success of your installation. Southwire’s

Industrial Power Cable division has grown to be one of North

America’s top suppliers of industrial wire and cable for a broad

range of product applications. Southwire’s North American

distribution network get’s your cable to you when and where you

need it. To learn more, visit www.southwire.com or

call 866-777-5775.

© 2013 Southwire Company. All Rights Reserved

Southwire Mobile Apps: www.southwire.com/apps

Scan code to

download apps.

sites glued shut their USB ports,” Ginter

said. “The problem is that Stuxnet also

blew through plant firewalls like they

weren’t there. To make glue in USB ports

effective, you’d have to glue shut every

port on every computer in the compa-

ny, not just the

plant comput-

ers.

“With a uni-

directional gate-

way protecting

your plant net-

works, though,

gluing shut the

USB ports on

the plant networks

alone becomes an effective tactic,” Gint-

er said.

Marvin Fertel, president and CEO of

NEI, said that the nuclear industry is

keeping a constant eye on the issue.

“The bad guys keep thinking of new

things they can do, and I think the good

guys are thinking about that, too,” Fer-

tel said. “Everybody’s doing what they

need to.”

Waterfall Securities Solutions offers a

unidirectional system that is currently

installed in U.S. nuclear power plants.

Canada uses two kinds of networks:

air-gapped, which does not have a con-

nection to an outside network, and ana-

log, so their systems cannot be hacked,

Ginter said.

The unidirectional systems are typi-

cally installed to protect the safety sys-

tems, or to protect plant networks from

corporate networks, Ginter said. Each

Waterfall Security transmitter or receiv-

er box uses 8 watts of power, so when

the system is added to a plant they have

to check the power load first.

“When they look at deploying our

stuff, they have to make sure those ad-

ditional watts don’t exceed power sup-

ply limits or air conditioning limits and

impair critical control systems,” Ginter

said. “Their attention to detail is stun-

ning. There’s no such thing as being per-

fectly safe.”

viruses and malware.

Unidirectional gateways work like this:

A firewall is a box with software inside,

while a gateway is hardware, namely two

boxes – the transmitter box and the re-

ceiver box – with a short fiber optic laser

in between. You

can send from

the transmitter

to the receiver,

but there is no

hardware that

can send any sig-

nal back.

“The NRC

5-71 standard

and the NEI 08-

09 guidelines both say that nuclear pow-

er plants can use firewalls or unidirec-

tional communications to protect their

critical networks,” said Andrew Ginter,

Vice President of Industrial Security with

Waterfall Security Solutions. “However,

if plant operators use firewalls, they have

to set up a lot of additional security mea-

sures around the firewalls.”

Plants using unidirectional communi-

cations need far fewer additional security

measures because the hardware-enforced

unidirectional communications protect

plant networks so thoroughly.

“Hackers continue to get smarter

and their tools get more powerful,”

Ginter said.

“For example,

‘advanced per-

sistent threats’

have proven that

they can punch

through fire-

walls essentially

at will. It some-

times takes them

a little time to

figure it out, but

they do it.”

Ginter uses

the example

of the Stuxnet

computer worm,

which was dis-

covered in 2010

and infected

uranium enrich-

ment plants in

Iran. “The Stux-

net worm moved

between sites on

USB sticks, so

when word of the

worm got out, a

lot of industrial

This diagram shows how unidirectional gateway networks work to keep

networks safe from cyber attacks. Courtesy: Waterfall Security Solutions

1311pe_58 58 11/11/13 11:42 AM

Save the Date!December 9–11, 2014

Orange County Convention Center // Orlando, Flwww.renewableenergyworld-events.com

Owned &Produced by Presented by Supported by Media Sponsor

For info. http://powereng.hotims.com RS#33

1311pe_59 59 11/11/13 11:42 AM

www.power-gen.com | www.power-eng.com

Owned & Produced by Presented by Supported by Co-located with

Nominated by their peers and selected via online voting by Power Engineering subscribers, POWER-GEN International recognized the following power industry professionals at the 2013 event for their

signif cant impact or contribution to the advancement of the generation industry. As part of POWER-GEN International’s 25th anniversary celebration, these 25 individuals were

acknowledged for their accomplishments over the last 25 years that have helped to shape our industry.

POWER-GEN International Congratulates the Industry’s Top 25 Most Influential Power Professionals

Power Engineering and POWER-GEN International congratulate the following industry leaders:

Jack Welch, former CEO, GE

Bill Lee, former CEO, Duke Energy

Thomas Fanning, CEO, Southern Company

Michael Suess, CEO, Siemens Energy

Randy Zwirn, President and CEO, Siemens

David M. Ratcliffe, Chairman,President and CEO, Southern Company Energy

David Crane, President and CEO, NRG Energy

Jim Adam, former Chairman and CEO, Black & Veatch

Jim Dehlsen, Founder/CEO, Clipper Wind Turbines

Tom Cameron, Senior Vice President, Engineering and Project Management, Summit Energy

Ernie Moniz, Secretary, U.S. Department of Energy

John Brown, former CEO, BP

Herb Kohler, Owner/Founder, Kohler

Bob McFetridge, Westinghouse Electric Corp.

Larry Monroe, Senior Research Consultant, Southern Company

Carl Bauer, former Director, U.S. Department of Energy’s National Energy Technology Laboratory

Nancy Floyd, Founder and Managing Director, Nth Power

Kurt Yeager, former President and CEO, EPRI

Peter Cartwright, former CEO, Calpine

Richard Kelly, former CEO, Xcel Energy

Lewis Hay III, Executive Chairman, NextEra Energy Inc.

Michael G. Morris, former CEO, American Electric Power

John Rowe, former CEO, Exelon

Charlie Gay, President, Applied Solar

James A Rogers, former CEO and current Chairman of Duke EnergySelected Most Inf uential Person in Power Generation

For info. http://powereng.hotims.com RS#34

1311pe_60 60 11/11/13 11:42 AM

SU

PPLIE

R’S

SH

OW

CA

SE

| S

ho

wc

aS

e ad

vertiS

ing c

on

tac

t Jen

na h

all: 9

18

-83

2-9

24

9, J

en

na

h@p

en

nw

ell.c

om

www.power-eng.com 61

SU

PPLIE

R’S

SH

OW

CA

SE

| S

ho

wc

aS

e ad

vertiS

ing c

on

tac

t Jen

na h

all: 9

18

-83

2-9

24

9, J

en

na

h@p

en

nw

ell.c

om

www.power-eng.com 61

SOLVAir trona effectively cleans flue gas by reacting with acid gases, such as SO

2, SO

3, Hg and HCl. This applica-

tion guide shows how to calculate the quantities of trona needed to achieve desired results when used in DSI systems.

www.solvair.us

Contact: Rosemary Dunnardunadv@gmail.com

713.521.7450

Air Pollution Control

Why Should You

Filter Your Water?

$%&$'�'��'�������'���'� �'�������'��'�����'���

�����'$$%����$''�����'����$�$�'''���'�����'����%�&�

����������� !''''��" #������� !

The Best Engineered Water Filteration Solution Always Costs Less

���� � ���� �� �������� ���� ����

�������� ���� ��� ��������� ���� �����

��������� �� �� ��� ���� ���� ����

����������������������������� ���� �

������� � � ����������� ����� � ��� � ��

����������� ���������������������

����� ����� �������� ������ ���������

�������� � ����� �������� ���� ����

������� ������ ��� � �� ���� ��� � ������

� ��� ��

Automatic Filters

����������� ����������������������

������������ ���������������������������� ���������� � ������� ��� ���������� ����������� ������� ����� ������ �� ������������ ���������� � ������������ ��������� �����

�����������������������

� �������������������������

������������������� ���������������������������� ���������������������������������� �������� �� ��� ����� ������� ���� ������������������������������ �������������������������������������� ��� ����������

PE113

Concrete Buildings

in E

xis

ting a

nd E

volv

ing E

nerg

y N

eeds

��

��

��

��

��

��

��

����

�

�!�

����

��!

��

��

���

��

���

��

��

���

���

�

����

��

����

�

��

��

���

��

����

���

���

���

���

��

���

�

�

��

��

� �

���

��

���

���

��

����

�

ww

w.m

pshq.c

om

Gas Turbine

Viega ProPress® is a better way to join copper

tubing and stainless steel pipe. Viega ProPress is

faster, flameless and more consistent when

compared to traditional pipe joining methods.

Fittings are available in sizes 1/2” to 4” in copper

or 304 and 316 stainless steel.

www.ViegaProPress.us

Flameless Pipe Joining

FLUOR, WE ARE

PROBLEM SOLVERS

With worldwide energy consumption

expected to double to an estimated 2.55

million megawatts by 2030, Fluor’s experts

are committed to providing industry-leading

solutions, innovation and technologies

that bring strategic value to our clients’

capital projects. With more than 20 years

of experience building gas-fred power

plants, Fluor recently completed Dominion’s

590-megawatt combined cycle project, the

Bear Garden Generating Station.

www.fuor.com

© 2

01

3 F

luo

r C

orp

ora

tio

n. A

ll R

igh

ts R

ese

rve

d. A

DG

V0

89

41

3

EPC Firm

http://powereng.hotims.com/RS#300

http://powereng.hotims.com/RS#304http://powereng.hotims.com/RS#303

http://powereng.hotims.com/RS#302http://powereng.hotims.com/RS#301

http://powereng.hotims.com/RS#306

1311pe_61 61 11/11/13 11:42 AM

www.power-eng.com62

Sh

ow

ca

Se a

dv

erti

Sin

g c

on

tac

t J

en

na h

all

: 91

8-8

32

-92

49

, Jen

na

h@

pen

nw

ell

.co

m |

SU

PPLI

ER

’S S

HO

WC

ASE

Increase Steam Boiler Efficiency:

Brochure HRS 1188 describes three differ-ent types of continuous boiler blowdown heat recovery systems manufactured by Penn Separator Corp. All systems recover up to 90% of the BTU’s normally lost to drain. Visit our website www.pennseparator.com for a sales representative nearest you.

Heat Recovery Systems

High Temperature

Industrial Solutions When you need high temperature

thermal performance or personnel and

fire protection, ROXUL® has you covered

with a wide range of Pipe, Board, Blanket

and Wrap products to meet

your industrial insulation

requirements.

indust

equirem

with a wide

and Wr

yourr in

req

Visit www.roxul.com

or call 800.265.6878

High Temperature Insulation

Call or Email for a quick quoteand fast track delivery ofHigh Voltage Equipment24/7/365

Phone—660.596.7727Email—hvsales@energy-parts.comwww.energy-parts.com/power-eng

High Voltage Equipment

Crown Electric

Iso Phase Bus

FabricationInstallation

Upgrades & UpratesGSU Change Outs

175 Edison Dr.

Middletown, OH 45044

www.crown-electric.com

sales@crown-electric.com

ext.

201513 539-7394

Iso Phase Bus

ISS utilizes a Portable Coordinate

Measurement Machine (PCMM), laser

metrology, to quickly, safely and effectively

provide inspection of Heat Recovery

Steam Generator (HRSG) Elliptical

man-ways. Flatness is measured and any

necessary field machining can be done by

ISS utilizing portable, elliptical/orbital lathes.

FEATURES:

&'()������()����(����)�����������(��) )��()�

surface flatness

&��(�)����( ��� �(�� ����������)�� ������ �

&'()���( �� ����(����)�)�� ������(�����

flatness issues

&�����()����)���)���� �����

&�������� � )������ ()�������������(����)��)��(��

and heat treating if required

BENEFITS:

&����(� )��)���

& )�)( �������)������(�(�������(�)������)�

&��������� ()���)�� ���)��� ��(�!"!!�����!"!!#�

&�����(�(�����)�����(�$)����������)���(�

����%��� )��������

&'()���( �� ����(����)��� �(��)���(��)� ��(��(��

complete the repair

���� ���()��������)�����(�� �( ��(���

at 1-855-RING-ISS.

HRSG Elliptical Machining

http://powereng.hotims.com/RS#307 http://powereng.hotims.com/RS#309http://powereng.hotims.com/RS#308

http://powereng.hotims.com/RS#310 http://powereng.hotims.com/RS#311

Phone: (610) 544-7200

E-mail: Buster@PennCrusher.com

Eliminate fugitive dust to improve plant safety with

Posimetric® FeedersDust-free processing of coal, limestone,

biomass, crushed stone, sand, wood chips and more.

The Leader in Uptime Since 1905

a brand of TerraSource Global

www.TerraSource.com

Posimetric® is a licensed trademark of GE Energy (USA) LLC. TerraSource Global is a wholly-owned subsidiary of Hillenbrand, Inc.

Handling a World of Materials

Material Crushers

http://powereng.hotims.com/RS#312

1311pe_62 62 11/11/13 11:42 AM

SU

PPLIE

R’S

SH

OW

CA

SE

| S

ho

wc

aS

e ad

vertiS

ing c

on

tac

t Jen

na h

all: 9

18

-83

2-9

24

9, J

en

na

h@p

en

nw

ell.c

om

www.power-eng.com 63

SU

PPLIE

R’S

SH

OW

CA

SE

| S

ho

wc

aS

e ad

vertiS

ing c

on

tac

t Jen

na h

all: 9

18

-83

2-9

24

9, J

en

na

h@p

en

nw

ell.c

om

www.power-eng.com 63

PW Power Systems continues to bring you advances

in products and capabilities for the energy and

power markets . Now an MHI group company,

PWPS, with over 50 years of experience, is driven

to provide the high-quality products and support you’ve

always depended on. It’s the same trusted technology

you know, always moving forward. Visit www.pwps.com

or call 1.866.PowerALL (1.866.769.3725) to learn more.

Same power.

Same products.

New owner.

MobilePac

JEA Northside Generating Station in Jacksonville, FL, installed 6,000 feet of Viega ProPress 316 stainless steel pipe and over 500 fittings. “The system is easy to work with because of the consistency of the connections,” said Ron Beverly, CFB Operations Specialist.

For more information: www.ViegaProPress.us

Pipe Joining

���������������������� �������

����������������������

��� ���������������

������������

Polymer Mortar Pipe

����������� �����

������������������

����������������������������������

www.bete.com

BETEís new

HydroPulse Nozzle

DRIP FREE

Provides a controlled intermittent liquid

spray using only liquid pressure as the force for

atomization in addition to a

performance

Spray Nozzles, Absorber

Silo and Bin

Cleaning Services and Equipment

Call 800-322-6653

or visit

www.molemaster.com

Silo and Bin Cleaning SevicesProtective Coatings Association

http://powereng.hotims.com/RS#313

http://powereng.hotims.com/RS#317http://powereng.hotims.com/RS#316

http://powereng.hotims.com/RS#315http://powereng.hotims.com/RS#314

http://powereng.hotims.com/RS#318

1311pe_63 63 11/11/13 11:42 AM

Sh

ow

ca

Se a

dv

erti

Sin

g c

on

tac

t J

en

na h

all

: 91

8-8

32

-92

49

, Jen

na

h@

pen

nw

ell

.co

m |

SU

PPLI

ER

’S S

HO

WC

ASE

www.power-eng.com6464

Sh

ow

ca

Se a

dv

erti

Sin

g c

on

tac

t J

en

na h

all

: 91

8-8

32

-92

49

, Jen

na

h@

pen

nw

ell

.co

m |

SU

PPLI

ER

’S S

HO

WC

ASE

������������

TO THE RESCUE

Michigan Seamless Tube, LLC800.521.8416 | www.mstube.com

Tube & Pipe, Seamless Turbine Services Valves

http://powereng.hotims.com/RS#319 http://powereng.hotims.com/RS#321http://powereng.hotims.com/RS#320

REMARKABLYSIMPLE

� TIER 4 FINAL READY

� PROVEN SCR TECHNOLOGY

� NO DPF REQUIRED

� NO DOC REQUIRED

� NO REGENERATION NECESSARY

� DE-TIER CAPABILITY

WWW.VOLVOPENTA.COM

1.757.436.2800

Volvo Engines

http://powereng.hotims.com/RS#322

FOREVER ADVANCING

WWW.POWER-GEN.COM

DECEMBER 9–11, 2014 / ORLANDO, FLORIDA / ORANGE COUNTY CONVENTION CENTER

OWNED & PRODUCED BY: PRESENTED BY: SUPPORTED BY:

1311pe_64 64 11/11/13 11:43 AM

CLA

SSIF

IED

S |

Cla

ss

ifie

d ad

vertis

ing C

on

taC

t Jen

na H

all: 9

18

-83

2-9

24

9, J

en

na

H@p

en

nw

ell.C

om

For info. http://powereng.hotims.com RS# 453

�����������������������������������������

������ � ��������������� ����������������

For info. http://powereng.hotims.com RS# 456

For info. http://powereng.hotims.com RS# 454

For sale or rent

The world’s verybest portable end

prep tools and abrasive saws

800-343-6926www.escotool.com

Light up your

ad with a little

COLOR!Call Jenna Hall

at 918-832-9249

WE ARE BUYING!!!

ARE YOU SELLING?

VALVES

INSTRUMENTATION

ELECTRICAL CONTROLS

PROCESS EQUIPMENT

PROCESS CONTROLS

PLANT MACHINERY

PSA SNUBBERS, ETC.

VISITwww.FerncroftManagement.com

email:vavlebuyer@ferncroftmanagement.com

T. 978-815.6185 Fax. 603-814.1031

FerncroftManagement,LLC

LIMITORQUE OPERATORS WANTEDNOISE?����������� ��������������������

������������������������������

�������������� ������� ��������

�������������������������������

�������������������������������

Houston: 713-789-9400

Calgary: 403-259-6600

www.HFPacoustical.com

info@HFPacoustical.com

For info. http://powereng.hotims.com RS# 455

For info. http://powereng.hotims.com RS# 451

For info. http://powereng.hotims.com RS# 450

rental

equipment

the steam & power special forces®

1-800-990-0374

www.rentalboilers.com

Rental Boilers • Deaerator Systems •

Economizers • Water Softener Systems •

24-Hour Emergency Service

Tur bine ControlsWoodward, GE, MHC

Parts and ServiceObsolete Parts Inventory

Control System, ModernizationTraining, Troubleshooting

(610) 631-3480www.turbogen.netinfo@turbogen.net

TurboGen Consultants, Inc.

For info. http://powereng.hotims.com RS# 452

1311pe_65 65 11/11/13 11:43 AM

Cla

ss

ifie

d a

dv

erti

sin

g C

on

taC

t J

en

na H

all

: 91

8-8

32

-92

49

, Jen

na

H@

pen

nw

ell

.Co

m | C

LASSIF

IED

S

For info. http://powereng.hotims.com RS# 459

1319 Macklind Ave., St. Louis, MO 63110 Ph: (314) 781-6100 / Fax: (314) 781-9209

www.ampulverizer.com / E-Mail: sales@ampulverizer.com

Quality and Service Since 1908

Ring Granulators, Reversible Hammermills,

Double Roll Crushers, Frozen Coal Crackers

for crushing coal, limstone and slag.

GEORGE H. BODMAN, INC.Chemical cleaning advisory services for

boilers and balance of plant systems

George H. BodmanPres / Technical Advisor

P.O. Box 5758 Office (281) 359-4006Kingwood, TX 77325-5758 1-800-286-6069email: blrclgdr@aol.com Fax (281) 359-4225

For info. http://powereng.hotims.com RS# 460

For info. http://powereng.hotims.com RS# 458

For info. http://powereng.hotims.com RS# 461 For info. http://powereng.hotims.com RS# 463

��������������������������������� ����� �������������

���������� ���������� �� ������������� ����

���� !� ��!�� ����!!!!

�!�� ��� ! ��!��!�!��������

�!� !��� ���� �!!!����� �!!!!!!!!!!!�!� ���� !����� !��!�!!!���� �� �!!!�!��!��� !� !!!!!!!!!!!!!!! ���� ! ����!!!!�� ������!!�!����!� ������� �!!!!!!!!!!!!!!!!!!!!������!����� �!!����!����!�!�����!!!�������!� ����!!!�������!!!

���������� ������ ��������

������ ������ ���������������������������������������������������������������

������������������� ��� �� �� �����������������������

usa.siemens.com/searchjobs

DonÇt follow the leader.

Join their team. If youíre in sales and want to work for a leading supplier of control and electrical solutions, contact Siemens today!

Siemens is a leading supplier of control and electrical solutions to the power industry. We are currently looking for outside sales professionals with the drive and talent to apply their skills in positioning a broad line of high-quality products and services.

We offer a totally integrated, complete solutions portfolio that will meet your customersí business drivers. And we offer a competitive compensation and benefits package that will meet your needs. Join the Siemens team. Weíre making a difference through empowered people.

Light up your ad with a l i t t le

COLOR!Call Jenna Hall at 918-832-9249

For info. http://powereng.hotims.com RS# 457 For info. http://powereng.hotims.com RS# 462

1311pe_66 66 11/11/13 11:43 AM

24 / 7 EMERGENCY SERVICE

BOILERS20,000 - 400,000 #/Hr.

DIESEL & TURBINE GENERATORS50 - 25,000 KW

GEARS & TURBINES25 - 4000 HP

LARGEST INVENTORIES OF:

Air Pre-Heaters • Economizers • DeaeratorsPumps • Motors • Fuel Oil Heating & Pump Sets

Valves • Tubes • Controls • CompressorsPulverizers • Rental Boilers & Generators

847-541-5600 FAX: 847-541-1279 visit www.wabashpower.com

FOR SALE/RENT

POWER

EQUIPMENT CO.

444 Carpenter Avenue, Wheeling, IL 60090

wabash

For info. http://powereng.hotims.com RS# 466

Get a thorough mix with:

Pugmill Systems, Inc.P.O. Box 60

Columbia, TN 38402 USA

Ph: 931-388-0626 Fax: 931-380-0319

www.pugmillsystems.com

For info. http://powereng.hotims.com RS# 464

1. Publication title: Power Engineering 2. Publication

number: 440-980. Filing date: October 1, 2013. 4. Issue

frequency: Monthly. 5. Number of issues published annu-

ally: 12. 6. Annual subscription price: $95.00. 7. Complete

mailing address of known office of publication: PennWell

Corporation 1421 So. Sheridan Road, Tulsa, OK 74112, Tulsa

County. 7a. Contact person: Traci Huntsman. 7b. Telephone:

918-831-9435. 8. Complete mailing address of headquar-

ters or general business office of publisher: PennWell

Corporation 1421 So. Sheridan Road, Tulsa, OK 74112, Tulsa

County. 9. Full names and complete mailing addresses of

Publisher, Editor and Managing Editor: Publisher: Richard

Baker, 1421 So. Sheridan Road, Tulsa, OK 74112, Tulsa

County. Editor: Russell Ray, 1421 So. Sheridan Road, Tulsa,

OK 74112, Tulsa County. Managing Editor: Russell Ray, 1421

So. Sheridan Road, Tulsa, OK 74112, Tulsa County. 10. Own-

er: Penn Well Corporation, 1421 So. Sheridan Rd, Tulsa, OK

74112; Successors to the Estate of Helen B. Lauinger, 1421

So. Sheridan Rd, Tulsa, OK 74112. 11. Known Bondholders,

Mortgages, and Other Security Holders Owning or Holding

1 Percent or More of Total Amount of Bonds, Mortgages, or

Other Securities: None. 12. N/A. 13. Publication Title: Power

Engineering. 14. Issue Date for Circulation Data Below:

September 2013.

15. Extent and Nature of Circulation:

Average # of No. copies of copies each single issue issue during published preceding nearest to 12 months: filing date:

a. Total # of copies 46546 42006

b. Legitimate paid and/or requested distribution

1. Outside county paid/requested 41427 40248

mail subscriptions stated

on PS form 3541

2. In-county paid/requested mail 0 0

subscriptions stated on PS form 3541

3. Sales through dealers and 952 557 carriers, street vendors, counter

sales, and other paid or requested

distribution outside USPS®

4. Requested copies distributed 0 0

by other mail classes

through the USPS

c. Total paid and/or 42379 40805

requested circulation

d. Nonrequested copies distribution

1. Outside county nonrequested 1548 388

copies stated on PS form 3541

2. In-county nonrequested copies 0 0

stated on PS form 3541

3. Nonrequested copies distributed 0 0

through the USPS by other

classes of mail

4. Nonrequested copies distributed 1934 320

outside the mail

e. Total nonrequested distribution 3482 708

f. Total Distribution 45861 41513

g. Copies not Distributed 685 493

h. Total 46546 42006

i. Percent Paid/Requested Circulation 92.41% 98.29%

16. Total circulation includes electronic copies - N/A

17. Publication of Statement of Ownership: Will be printed

in the November 2013 issue of this publication. 18. Sig-

nature and title of Editor, Publisher, Business Manager,

or Owner: Traci Huntsman, Manager Corporate Assets and

Postal Compliance. Date: 10-01-13.

I certify that all information furnished on this form is true

and complete. I understand that anyone who furnishes false

or misleading information on this form or who omits mate-

rial or information requested on the form may be subject

to criminal sanctions (including fines and imprisonment)

and/or civil sanctions (including civil penalties).

STATEMENT OF OWNERSHIP, MANAGEMENT,

AND CIRCULATION

CONDENSER & HEAT EXCHANGER TOOLS

CLEANERS, PLUGS, BRUSHES

John R Robinson Inc

PH # 800-726-1026

e-mail: jrrinc@earthlink.net

www.johnrrobinsoninc.com

For info. http://powereng.hotims.com RS# 467For info. http://powereng.hotims.com RS# 465

CONDENSER OR GENERATOR AIR COOLER TUBE PLUGS

THE CONKLIN SHERMAN COMPANY, INC.

Easy to install, saves time and money.ADJUSTABLE PLUGS - all rubber with brass insert.

Expand it, install it, reverse action for tight fit.

PUSH PULL PLUGS - are all rubber, simply push it in.

Sizes 0.530 O.D. to 2.035 O.D.

Tel: (203) 881-0190 Fax: (203) 881-0178

E-mail: Conklin59@aol.com www.conklin-sherman.com

Just Plugging Along

We’ve got people.

The PennEnergy JOBS process puts your

recruitment message in front of the industry’s

best talent whether it’s online, in print, or at an

event. This approach offers you the f exibility

to create custom recruitment advertising

campaigns best suited to meet your budget

and objectives.

| Learn More |

Visit: www.PennEnergyJOBS.com

Call: 1-800-738-0134

Got jobs?

1311pe_67 67 11/11/13 11:43 AM

www.power-eng.com68

INDEX

RS# COMPANY PG# SALES OFFICERS# COMPANY PG#

1421 S. Sheridan Rd., Tulsa, OK 74112 Phone: 918-835-3161, Fax: 918-831-9834 e-mail: pe@pennwell.com

Sr. Vice President North American Power Group Richard Baker

Reprints Foster Printing Servive 4295 Ohio Street Michigan City, IN 46360 Phone: 866-879-9144 e-mail: pennwellreprint@fosterprinting.com

National Brand Manager Rick Huntzicker Palladian Professional Park 3225 Shallowford Rd., Suite 800 Marietta, GA 30062 Phone: 770-578-2688, Fax: 770-578-2690 e-mail: rickh@pennwell.com AL, AR, DC, FL, GA, KS, KY, LA, MD, MO, MS, NC, SC, TN, TX, VA, WV

Brand Sales Manager Dan Idoine 806 Park Village Drive Louisville, OH 44641 Phone: 330-875-6581, Fax: 330-875-4462 e-mail: dani@pennwell.com CT, DE, IL, IN, MA, ME, MI, NH, NJ, NY, OH, PA, RI, VT, Quebec, New Brunswick, Nova Scotia, Newfoundland, Ontario

Brand Sales Manager Tina Shibley 1421 S. Sheridan Road Tulsa, OK 74112 Phone: 918-831-9552; Fax: 918-831-9834 e-mail: tinas@pennwell.com AK, AZ, CA, CO, HI, IA, ID, MN, MT, ND, NE, NM, NV, OK, OR, SD UT, WA, WI, WY, Alberta, British Columbia, Saskatchewan, Northwest Territory, Yukon Territory, Manitoba

International Sales Mgr Anthony Orfeo The Water Tower Gunpowder Mills Powdermill Lane Waltham Abbey, Essex EN9 1BN United Kingdom Phone: +44 1992 656 609, Fax: +44 1992 656 700 e-mail: anthonyo@pennwell.com Africa, Asia, Central America, Europe, Middle East, South America

European Sales Asif Yusuf The Water Tower Gunpowder Mills Powdermill Lane Waltham Abbey, Essex EN9 1BN United Kingdom Phone: +44 1992 656 631, Fax: +44 1992 656 700 e-mail: asify@pennwell.com Europe and Middle East

Classifieds/Literature Showcase Account Executive Jenna Hall 1421 S. Sheridan Rd. Tulsa, OK 74112 Phone: 918-832-9249, Fax: 918-831-9834 email: jennah@pennwell.com

16 Orion Instruments 33 www.orioninstruments.com

34 PGI 2013 TOP 25 60 www.power-gen.com

31 PGI FINANCIAL FORUM 57 www.powergenfinancialforum.com

17 Philadelphia 35 Gear Corporation

29 POWER-GEN 53 International 2014

www.power-gen.com

36 ProEnergy Services LLC C4 www.proenergyservices.com

13 Railserve, Inc. 27 www.railserveleaf.biz

33 REWNA 2014 59 www.renewableenergyworld-events.com

11 SANTEE COOPER 25 www.santeecooper.com/wpsale

7 Siemens Ag 15 www.siemens.com/energy

2 Siemens Industry 5 usa.siemens.com/ruggedcom

32 SOUTHWIRE COMPANY 58 www.southwire.com

15 The New York 31 Blower Company

www.nyb.com

28 VOLVO PENTA 52 OF THE AMERICAS

www.volvopenta.com/industrial

9 WEG ELECTRIC MOTORS 19 www.weg.net/us

30 Westinghouse Electric Co 55 www.westinghousenuclear.com

Advertisers and advertising agencies assume liability for all contents (includ-ing text representation and illustrations) of advertisements printed, and also as-sume responsibility for any claims arising therefrom made against the publisher. It is the advertiser’s or agency’s responsi-bility to obtain appropriate releases on any items or individuals pictured in the advertisement.

10 Allen-Sherman-Hoff 21 www.a-s-h.com

8 Areva 17 www.us.areva.com

12 Babcock Power Inc. 26 www.babcockpower.com

20 Belt Tech Industrial 40 www.belttech1.com

35 Bete Fog Nozzle Inc C3 www.bete.com

Brandenburg Industrial C2 Service Company

www.brandenburg.com

18 Cleaver Brooks 37 Inc/Nebraska Boiler

www.cleaverbrooks.com

19 COALGEN 2014 39 www.coal-gen.com

26 Cormetech Inc 49 www.cormetech.com

21 Fibrwrap 41 www.fibrwrap.com

4 Fluke Corporation 9 www.fluke.com/lasersharp

1 Fluke Corporation 3 www.fluke.com/energysavings

14 GE 29 www.ge-mcs.com

5 GE 11 www.ge-flexibility.com

23 GE 43 www.ClearCurrentPRO.com

6 INTEGRATED 13 POWER SERVICES

www.ips.us/rewind-technologies

24 Kiewit Power Inc 45 www.kiewit.com/power

3 Larsen& Toubro Limited 7 www.lntvalves.com

25 Martin Engineering 47 www.martin-eng.com

22 Nexus Engineering 42 www.nexus-tech.com

27 Nord-Lock\Superbolt 51 www.nord-lock.com

1311pe_68 68 11/11/13 11:43 AM

BETE. Your strategic partner for engineered spraying solutions.

Meeting the demands for cleaner, more efficient operations

For over 50 years, BETE has been recognized as the leader in spray nozzle design and innovation for the power industry. BETE’s technological advancements have revolutionized nozzles used for atomizing, evaporation, cooling, misting, and fogging. Achieve higher spray nozzle efficiency and reliability using BETE nozzles.

Performance Through Engineering

BETE’s Application Engineers are known for their ability to find creative solutions to difficult spraying challenges. As specialists in fluid flow, BETE’s engineers design everything from individual spray nozzles to lance assemblies that can be integrated into existing processes. From engineering concept to delivery, we are dedicated to producing the highest quality nozzles.

BETE... highly efficient

and reliable nozzles

for all your power generation

challenges.

TFXP Nozzles

for fire protection and evaporative cooling with the largest free passage which are full cone and are clog resistant

MaxiPass™ Nozzles

provide maximum free passage to deliver atomized slurry into the absorber tower with a finely atomizing full cone spray

TH Nozzles

patented geometry designed to give the most uniform liquid distributionaround the periphery of the spray

Made in the USA

BETE Fog Nozzle, Inc.

T(413)772-0846

F(413)772-6729

www.bete.com

TH Nozzles

Large free passage with the most uniform liquid distribution

SpiralAir Nozzlesare finely

atomized full cone sprays

available in a range of spray

angles

TF Nozzlesprovide an exceptional

clog-resistant spray for cooling gases

For info. http://powereng.hotims.com RS#35

1311pe_C3 3 11/11/13 11:43 AM

ENERGIZEYO U R P O W E R P L A N T

US Corporate Ofce | 660.829.5100 | proenergyservices.com

Download the freeLayar app and watchthis ad come to life

Boost your plant’s efciency, improve lifecycle costs, decrease plant downtime, and maximize your power assets.

Contact ProEnergy today and learn how we’re energizing the power industry.

Introducing ProEnergy’s Integrated Power Solutions

Fast Track Power

Solutions

Energy Parts

Solutions

Energy

Services

For info. http://powereng.hotims.com RS# 36

1311pe_C4 4 11/11/13 11:43 AM

Fo r t he i ndu s t r y ’ s c a r e e r - m ind e d p r o f e s s i ona l s WINTER 2013

A sup p l emen t t o P ennWe l l pub l i c a t i on s | w w w. P ennEne r g yJ O B S . c om

Key Considerations for U.S. Energy Policy

Reexamining U.S. Energy Policy Through Alternative Fuels

TRAINING INSIGHTS

Millennials Take On Our Increasingly Complex World

REGIONAL INSIGHTS

Electricity Diversity Takes Shape in the Middle East

New Policies Develop Asia-Pacifc Energy Future

1311PEJEW_C1 1 11/6/13 1:08 PM

1311PEJEW_C2 2 11/6/13 1:08 PM

2 EDITOR’S LETTER

The Policy Issue

Dorothy Davis Ballard, PennWell

3 Key Considerations for U.S. Energy Policy

Charles Dewhurst, BDO USA, LLP

5 Reexamining Outdated U.S. Energy

Policy Through Alternative Fuels

Robert Johnsen, Primus Green Energy

7 TRAINING INSIGHTS

Millennials Take On Our Increasingly Complex World

Dr. Scott M. Shemwell, Knowledge Ops

10 ORGANIZATIONAL INSIGHTS

Integrated Management Systems meet

policy and regulation demands

Brad Kamp, Interliance Consulting, Inc.

12 REGIONAL INSIGHTS

MIDDLE EAST

Electricity Diversity Takes Shape in the Middle East

PennEnergy.com

15 ASIA–PACIFIC

New Policies Develop Asia-Pacifc Energy Future

PennEnergy.com

w w w . P e n n E n e r g y J O B S . c o m

WINTER 2013

A PENNWELL PUBL ICAT ION

Stacey Schmidt, Publisher

staceys@pennwell.com

Dorothy Davis Ballard, Content Director

dorothyd@pennwell.com

Hilton Price, Editor

hiltonp@pennwell.com

Cindy Chamberlin, Art Director

cindyc@pennwell.com

Daniel Greene, Production Manager

danielg@Pennwell.com

Tommie Grigg,

Audience Development Manager

tommieg@pennwell.com

PennWell Corporation

1421 South Sheridan Road

Tulsa, Oklahoma 74112

918 835 3161

PennWell.com

Recruitment Advertising Sales:

Courtney Noonkester

Sales Manager

918 831 9558

courtneyn@pennwell.com

Ad ve r t i s e r s ’

I ndex Chevron �������������������������������������������������������������������������������������������������������������� C2

PennEnergy Recruting Now ���������������������������������������������������������������������������������� 4

PennEnergy ���������������������������������������������������������������������������������������������������������� 6

PennEnergy Jobs �������������������������������������������������������������������������������������������������� 8

MAPSearch��������������������������������������������������������������������������������������������������������� 14

PennEnergy Research Services �������������������������������������������������������������������������� C3

Aramco Services Co� ������������������������������������������������������������������������������������������ C4

1311PEJEW_1 1 11/6/13 1:10 PM

2 Winter 2013 | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | EnergyWorkforce

Ed i to r ’ s

Le t t e r

IN researching and gathering together resources for the last issue of 2013, there

emerged a theme we had not originally considered – policy. While examining

industry milestones and their infuence on the energy workforce, what continued to

stand out are the existing and evolving policies behind these developments.

We open the fnal issue of 2013 with two timely examinations of U.S. energy policy

from industry leaders at BDO and Primus Green Energy. Our frst editorial feature

presents key considerations for the U.S. on page 3, highlighting the need for a cohesive

national energy policy in ensuring continued progress.

Explored next are the outdated U.S. energy policies as they apply to alternative fuel

resources on page 5. At the center of this editorial is an examination of the current

Renewable Fuel Standard and the limitations it imposes on the energy industry through

its outmoded structure.

PennEnergy then offers

international insights on the

infuence of policy in an

examination of emerging

energy diversity in the

Middle East on page 12 and

developments in the Asia-

Pacifc region on page 15.

Our winter edition is

rounded out by a look at the

policies that shape the business of energy through its workforce. Learn the challenges

and advantages for emerging Millennials in the industry on page 7 as they navigate a

corporate culture still working to catch up with more stringent modern policies.

Finally, we are offered a look at how integrated management systems can help meet

the demands of policy and regulation on page 10. Find out how companies are using

IMS to stay compliant and save money.

What we have put together for this issue offers a lot of insight, but in truth, just

brushes the surface. Our goal is to encourage new dialogue on the impact of policy on

the energy industry. We want to hear more from you. Who else could paint the most

honest picture of what the evolving shifts in global policy have meant and may mean

for us going forward?

So be certain to join the conversation at PennEnergy.com and connect with us on

Google +, LinkedIn, Facebook, and Twitter. You will also fnd us at POWER-GEN

International November 12-14 at the Orange County Convention Center in Orlando, FL.

Carpe diem!

—Dorothy Davis Ballard

The Policy Issue

“Our goal is to encourage new

dialogue on the impact of policy

for the energy industry.”

1311PEJEW_2 2 11/6/13 1:10 PM

Cover STORY

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 3

Key Considerations for U.S. Energy PolicyBy Charles Dewhurst, leader of the Natural

Resources practice at BDO USA, LLP

IN March 2012, when President

Obama addressed Prince George’s

Community College in Maryland, he

stated that the United States “need[s] an

energy strategy for the future – an all-

of-the-above strategy for the 21st century

that develops every source of Ameri-

can-made energy.” Later, in June 2013,

Obama delivered a speech on climate

change at Georgetown University, ap-

plauding the United States’ progress in

the clean energy sector and its strides to-

ward energy independence. Since 2012,

the U.S. energy industry has certainly

made much progress toward boosting

its production and exportation of energy

resources, but regulatory and political

uncertainties persist and could threaten

future growth. Developing a compre-

hensive and cohesive national energy

policy now will help us capitalize on

the momentum of the U.S. energy sec-

tor and ensure its future growth. This

policy should be forward-looking, aim-

ing to secure U.S. energy resources and

capabilities for years to come.

While renewable energy often seems

to be at odds with more traditional sources

like oil and gas, this dynamic is counter-

productive. The United States requires

regulations and policies that allow these

energy sources to complement, rather

than contradict, each other. There are

benefts and drawbacks to every form of

energy, yet each has an important role to

play in the United States’ energy industry

and economy overall. Between now and

2040, the Energy Information Adminis-

tration (EIA) predicts that 31 percent of

new U.S. electricity-generating capac-

ity will come from renewables, while

natural gas will account for 63 percent.

While renewable energy may be more

environmentally friendly, its infrastruc-

ture can be relatively costly to build and

operate, and is usually located in geo-

graphically remote areas that cannot ser-

vice large, urban areas easily. Moreover,

many forms of alternative energy are, by

their very nature, intermittent and sub-

ject to occasional interruptions. At the

same time, traditional sources like oil

and gas are much less expensive to pro-

duce and excellent at providing a con-

sistent supply of energy, but also have

a greater environmental impact. U.S.

energy policy should refect the need for

a variety of energy sources to operate and

fourish concurrently in order to support

the country’s overall needs.

Coal also has a role to play in bolster-

ing the United States’ energy economy.

While the coal industry has been criti-

cized for its greenhouse gas emissions, it

is still a dominant player in the energy

sector. According to the EIA, U.S. esti-

mated recoverable coal reserves are the

largest in the world, and our exports are

rising as other countries, such as China,

struggle to meet their growing energy

needs. The EIA reports that from 2000-

2010, an average of fve percent of U.S.-

produced coal was exported each year. In

2011, that number doubled to 10 percent,

and it has been growing since. The EIA

notes that, despite coal serving as the

largest source of power generation for the

United States for more than six decades,

1311PEJEW_3 3 11/6/13 1:10 PM

FREE • CONFIDENTIAL • ALL JOB TYPES & EXPERIENCE LEVELS

Top Oil & Gas Industry Employers are

RECRUITING NOW!

Don’t miss another

CAREER OPPORTUNITY

Visit PennEnergyJobs.com to UPLOAD YOUR RESUME to the database today.

with PennEnergy Jobs

its annual share of total net generation for

the country was only 37 percent last year,

down 26 percent since 2007. This decline

is partially due to some power producers

now favoring less expensive, more envi-

ronmentally friendly natural gas. Yet as

long as coal remains plentiful, exportable

and relatively inexpensive to produce, its

future should be considered in any com-

prehensive energy policy.

Our energy policy must also grap-

ple with ensuring that the United States

has the right infrastructure to deliver its

energy products to market. The approval

of the Keystone XL pipeline would be

a step toward alleviating a shortage in

infrastructure capacity that limits the

industry’s ability to take full advantage of

the U.S. oil and natural gas renaissance.

While the United States and Canada

wait for Obama to sign off on the cross-

border segment of the massive project,

both have begun tentatively outlining

and planning the logistics for the domes-

tic portions of the pipeline. The energy

industry continues to move projects for-

ward, but uncertainty remains around

whether policy decisions will ultimately

permit these projects to come online.

As the industry waits for further clarity

on energy policy at the national level, it

continues to keep an eye on state-level reg-

ulatory changes. These do not supplant the

need for a national policy regime; however,

this decentralized regulation allows states

to individually determine how to most

effectively and effciently exploit their own

resources. Each state faces unique oppor-

tunities, as well as unique policy pressures

from its residents, suggesting that in some

cases, policy is best determined on a local,

specifc basis.

Overall, a comprehensive national

energy policy is essential to positioning

the United States as a leader in the global

energy market. As the international energy

landscape continues to evolve, the United

States is poised to become a net energy

exporter and to fulfll burgeoning global

demand. However, in order to take advan-

tage of this opportunity, the United States

requires a policy with a clear-eyed vision of

what the energy industry needs now, and

what it will need in the future. ⊗

1311PEJEW_4 4 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 5

Reexamining Outdated U.S. Energy Policy Through Alternative FuelsBy Robert Johnsen, CEO, Primus Green Energy

THE abundance of natural gas

brought about by new drilling

techniques has led to a profound

shift in the North American energy mix,

enabling a new era of energy indepen-

dence by reducing reliance on petro-

leum and coal.

The natural gas boom has been em-

braced by the governments of both the

United States and Canada, with the

United States in particular positioning

natural gas as the centerpiece of an “all

of the above” energy strategy that pro-

motes a balanced mix of energy sources.

While this strategy has been welcomed

by the oil and gas industry, it has led to

some unease in the renewable energy

sector, which fears that support for nat-

ural gas could stunt the administration’s

focus on the adoption of clean energy

technologies.

In reality, however, the administration

has continued to support both tradition-

al and renewable energies, believing that

natural gas can serve as a “bridge” to

renewable energy that enables a reduc-

tion in carbon emissions while buying

time for the renewable energy sector

to improve economics and effciencies.

This all-of-the-above strategy is personi-

fed by Energy Secretary Ernest Moniz,

a staunch believer in renewable energy

who has also promoted the use of natu-

ral gas to curb carbon emissions.

Unfortunately, however, some ar-

eas of U.S. energy policy are lagging

behind this all-of-the-above strategy.

One sector in which this phenomenon

is very apparent is alternative fuels.

Alternative fuel technologies pro-

duce fuels from any non-petroleum

source, such as biomass, natural gas,

municipal solid waste, coal or other

carbon-based feedstocks. The main

policy related to alternative fuels is the

Renewable Fuel Standard (RFS), a pol-

icy dating back to 2005 that mandates

minimum requirements for how much

alternative fuel must be blended into

commercial transportation fuels. The

amount of alternative fuel to be blended

increases each year, with an end goal of

36 billion gallons by 2022.

In its frst few years, the RFS success-

fully encouraged the development of al-

ternative fuel technologies, leading to a

cleaner transportation fuel mix. For ex-

ample, ethanol comprises 10 percent

of most fuels sold in gas stations today.

But, the RFS was created in the context

of the alternative fuel technologies that

were available in the mid- to late-2000s,

which were primarily frst-generation bio-

fuels that used corn as the feedstock and

produced ethanol as the end product.

In recent years, advanced alternative

fuel technologies have been introduced

that open up new feedstock and end prod-

uct opportunities, but the RFS has not

been modifed since 2007 to accommo-

date them. An example is Primus Green

Energy’s STG+ technology, which can

convert a variety of feedstocks, includ-

ing biomass and natural gas, into drop-

in transportation fuels that can be used

directly in vehicle engines without the

“blend wall” that is required for the use of

frst-generation biofuels such as ethanol.

The limitations of the current RFS

are apparent in the biofuel industry’s fail-

ure to meet minimum mandates. The in-

dustry’s continued inability to produce

1311PEJEW_5 5 11/6/13 1:10 PM

PennEnergy.com was created by PennWell, a leader in the coverage of the global petroleum and power industries since 1910, to serve as the broadest and most complete source of energy-related news, research, and insight.

Including content from all PennWell award-winning energy-related brands, PennEnergy.com delivers original news, fi nancial market data, in-depth research materials, books, equipment, and service information all in one easy-to-navigate website.

Your Source for Energy News, Research, and Insight.

Make PennEnergy a part of your day and know what is happening in the world of energy.

We’re In Great Company…

PennEnergy.comP E

A FEW OF OUR PENNWELL FRIENDS:

UTIL ITYPRODUCTSconference & exposition

®

6 Winter 2013 | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | EnergyWorkforce

enough biofuel to meet federal mandates

has prompted the American Petroleum

Institute (API) to fle a lawsuit against the

U.S. Environmental Protection Agency

arguing that the RFS is an unrealistic

mandate that unfairly penalizes oil and

gas companies for failing to incorporate

the mandated amount of biofuels into

their transportation fuels.

There is a way, however, to bring RFS

policy into line with the government’s all-

of-the-above stance on the energy mix –

and that is to include fuels produced from

natural gas in the RFS standard.

One of the most recent developments

in advanced alternative fuel technology is

the ability to use natural gas as a feedstock

to produce transportation fuels. There are

several companies, including Primus, Cel-

anese and Coskata, who originally set out

to commercialize biomass-based alterna-

tive fuel technologies, but who recognized

that using natural gas as a feedstock repre-

sented a rare opportunity to bring these

advanced technologies to market more

quickly while simultaneously moving clos-

er toward energy independence.

Despite the fact that natural gas is

cleaner burning than petroleum, the

RFS does not currently include fuels

derived from natural gas, meaning that

the cleaner-burning fuels being produced

by Primus and other companies cannot

be used to fulfll the optimistic alterna-

tive fuel mandates that are not current-

ly being met. Although there have been

attempts in Congress to expand the RFS

to include natural gas-derived fuels —

most recently by U.S. Rep. Pete Olsen

(R-Texas) — so far, this legislation has

come to naught.

If the administration is truly commit-

ted to an all-of-the-above energy policy,

and if it truly does see natural gas as a

bridge, it should revise its fagship ener-

gy policies to refect the latest develop-

ments in the alternative energy sector.

The goal of such policies should be to

support technologies that hold the great-

est potential to make the administration’s

energy strategy a reality, rather than those

whose limitations have been highlighted

by their failure to produce enough fuel to

satisfy federal mandates. ⊗

1311PEJEW_6 6 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 7

Millennials Take On Our Increasingly Complex WorldBy Dr. Scott M. Shemwell, CEO of Knowledge Ops

ON January 1st at 0348 hours a

young engineer employed by

a service company is trying

to address a problem she has encoun-

tered with a compressor on a drilling

rig in the deepwater Gulf of Mexico.

She graduated from college three years

ago and went to work for a large energy

services company. However, several

months ago she changed jobs and is

now on her frst offshore hitch as team

leader with her new company, a similar

size global energy services company.

She is a competent engineer but is

uncertain what the company policy

is regarding a piece of rotating equip-

ment that while seemingly malfunction-

ing does not appear to jeopardize safe-

ty, the environment or production at the

present time. But she worries that the sit-

uation could get worse.

A quick call to the “graveyard” shift

at the company onshore Operations

Center is not reassuring. Staffed by

those who are too junior to be on vaca-

tion during the holiday season, the en-

gineer she talked with had only been

with company three years and actually

had less feld experience than she did.

His supervisor was not encouraging ei-

ther. Should he call and wake experts

at this early hour?

Adding to the problem, the com-

pressor’s data plate was mostly unread-

able. And of course, a famous Texas blue

northern was blowing through. High

winds, rain and cold temperatures fur-

ther impaired proper equipment identi-

fcation, much less working conditions.

Both the feld engineer and the oper-

ations engineer are aware that their com-

pany signed a Bridging Document with

their customer as part of the new Safety

and Environmental Management Sys-

tem (SEMS) regulatory requirements

and both had attended the appropriate

training for this project. Both are knowl-

edgeable that the Stop Work Authority

(SWA) gives them the right and even

the obligation to dramatically intervene

with operations if they feel it necessary.

As a new mom, the feld engineer

is concerned that she might develop a

reputation in the company as “fakey”

if her next decision turned out to be

a mistake. The engineer at the opera-

tions center was receiving real time data

feeds from the rotating equipment but

he could not “feel” the vibrations as the

on-site individual could and the equip-

ment was still within tolerances.

Horns of a Dilemma

The engineers in our story are compe-

tent, qualifed individuals doing a great

job. Early in their careers, they are the

vanguard of feld operations. Millennials

by label, they are technologically savvy

and among the best and the brightest

in their felds.

Things never go “bump in the night”

TRAINING Insights

1311PEJEW_7 7 11/6/13 1:10 PM

We’ve got people.

PennEnergy JOBS is the key to attracting the

energy industry professionals you need to hire to

meet your business goals. Our process puts your

recruitment message in front of the industry’s best

talent whether it’s online, in print, or at an event.

This approach offers you the f exibility to create

custom recruitment advertising campaigns best

suited to meet your budget and objectives.

| Learn More |

Visit: www.PennEnergyJOBS.com

Call: 1-800-738-0134

Got jobs?

1311PEJEW_8 8 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 9

during daylight hours in perfect weath-

er, hence the colloquial term. Moreover,

the personal stress of a new mother con-

cerned about her reputation and oppor-

tunities for promotion resulting from just

another day at the “offce” should not be

underestimated by those desk bound or

later and more secure in their careers.

The real world of feld operations can

be very unforgiving even when the results

turn out OK. All of the individuals in our

story have signifcant “skin in this game.”

It is fne to “empower” people in the

team building sessions. It is an entirely dif-

ferent story in the middle of the preverbal

stormy night when one’s career and reputa-

tion are on the line. Field personnel must

believe they company will stand behind

their decisions, right or maybe less so.

Enablement

These best and brightest can only be as

good as their supporting infrastructure.

These individuals not only face engineer-

ing issues, any actions they take must be

in accordance with company policy, the

Bridging Document and various regu-

latory compliance requirements as well.

This is a lot to put on the plate of an en-

gineering team.

However, since their childhood these

individuals have been online. Our feld

engineer mother looks in on her infant

son at day care from her smart phone from

a hundred miles offshore. The operations

center engineer routinely Skype’s with his

girlfriend, a physician, who is in east Afri-

ca serving with Doctors Without Borders.

These individuals are at the top of

their technological game. However, they

lack the feld engineering experience of

their more seasoned colleagues. This rep-

resents a demographic challenge for orga-

nizations in the middle of the Big Crew

Change. How do these young people

come up to speed—quickly?

Organizations not only depend on the

individuals depicted in our story for their

bottom line, shareholder value is at risk if

they cannot prevent the next major me-

ga-disaster. And what if they can prevent

a minor incident?

Loss time, loss production, loss any-

thing has economic consequences. Most

organizations run on margins that are

thinner than they would like. Oil com-

panies are included in this group. More

importantly, energy service provider

margins can be even lower. This busi-

ness model pushes our engineers to low-

er costs, reduce downtime and in some

cases push the envelope.

Millennial Transformation

Out engineers appear to have the deck

stacked against them. Normal Accident

Theory (NAT) with its roots in the Three

Mile Island nuclear power plant incident

suggests that tightly coupled technologies

with invariant sequences and limited slack

such as deepwater drilling operations will

have accidents in the normal course of

events. In other words there is a certain

inevitability of a major incident on their

watch. Maybe not during this rotation but

a certain possibility during their careers.

However, these Millennials have a safe-

ty arsenal their parents did not—a new

business model that capitalizes on their

technology prowess. The emerging feld

of High Reliability Theory (HRT) “empha-

sizes are a strategic prioritization of safety,

careful attention to design and procedures,

a limited degree of trial-and-error learning,

redundancy, decentralized decision-mak-

ing, continuous training often through

simulation, and strong cultures that cre-

ate a broad vigilance for and responsiveness

to potential accidents.”

Arm feld engineers and graveyard op-

erations watch colleagues with HRT driv-

en policy and associated tools and then

get out of their way. A strategic or system-

ic safety model with a holistic perspective

of the life cycle the process coupled with

truly empowered key personnel trained

with the latest learning tools in a strong

Culture of Safety offer a new perspective

for a new workforce.

Aircraft pilots routinely retain and up-

grade their skills in sophisticated fight

simulators. “What If” scenarios, where-

by the team can learn by trial and error

environment where the worst result is a

computer animated “do-over.” Other in-

dustry sectors train using this well docu-

mented successful approach.

In a true Culture of Safety a mom

would not worry about her job or career

if she erred on the side of safe operations.

She would not be labeled nor would her

co-worker in the Operations Center hesi-

tate to wake up the experts New Year’s Eve.

Finally, if the maintenance history

and all updated equipment manuals were

available on a Smart Tablet with training

videos and animation support, trepida-

tion by those new to the company/pro-

cess would lessen. Organizational poli-

cy, its Operations Management System

and bridging documentation built into

the workfow will enable better decision

making in the High Reliability Organi-

zation of the near future.

A decade ago the digital oilfeld was

labeled the Digital Oilfeld of the Future.

Integrated Operations is a common mod-

el today.

The Millennial’s World-of-the-

Future will mirror the concepts of an

HRO. Will she be working for you or

your competitor? ⊗

1311PEJEW_9 9 11/6/13 1:10 PM

10 Winter 2013 | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | EnergyWorkforce

Integrated Management Systems meet policy and regulation demandsBy Brad Kamph, President, Interliance Consulting, Inc.

ECONOMICS, technology, and gov-

ernment policy are transforming

the energy feld and challenging

the business-as-usual approach to com-

pany governance. The rise of “can’t

fail” functions—safety, environmental

management, regulatory compliance,

system integrity, and others—are now

forcing pipeline, gas, and power utility

companies to consistently deliver high-

level performance in all aspects of their

operations.

The stakes are high, and the um-

pires—energy regulators, legislators,

watchdog groups, and the general pub-

lic—are watching. The umpires are

looking for guidelines that show a com-

pany runs its everyday operations with

the best interests of employees, the pub-

lic and the environment in mind.

It’s a must-win match.

How are companies playing to win?

Companies can efficiently comply

with policies and regulations through

implementing an integrated manage-

ment system (IMS)—a method for as-

suring that everyone works together in

the most effective manner possible. An

IMS is accomplished by re-engineering

business functions and processes so ev-

ery employee—from CEO to feld tech-

nician—understands and executes the

company plan.

The bottom line: Companies using

an IMS can more easily adhere to regu-

lations, perform well in audits and save

money by implementing operational

effciencies.

A beginning with the end in mind

Implementing an IMS begins with the

evaluation of a single area or an entire

company. Either way, the frst assess-

ment is of the current management sys-

tem’s effectiveness.

Starting at the highest level of the

company, a well-designed management

system incorporates the priorities and

objectives of the organization into ev-

eryday activities in a manner that is log-

ical, measurable, and self-reinforcing.

Authority is aligned with responsibility,

so each employee knows what to do and

has the tools to do it. Targets are estab-

lished that are tied to measurable out-

comes. An objective process is put in

place to determine progress and identi-

fy gaps. There is also a built-in mecha-

nism to correct problems and improve

performance over time.

Interliance client Wild Well Control,

the world’s No. 1 oil and gas well emer-

gency response company, implement-

ed a safety management system that

lowered its underwriting costs and re-

duced its equipment and personnel loss-

es to zero. Casey Davis, Wild Well Con-

trol’s vice president of Health, Safety and

Environment, says, “It’s very unusual to

have a safety management system that

is compliant to multiple regulatory re-

gimes and is also an effective manage-

ment tool. That’s how thorough our

management system is. We save over $2

million per year in underwriting costs

and operating expenses.”

A results-oriented management system

Along with energy-sector companies,

Interliance has also helped utility com-

panies to create an IMS. One in particu-

lar also included implementing custom-

ized training and knowledge transfer.

With 17,000 employees, First-

Energy is one of the nation’s largest

ORGANIZATIONAL Insights

1311PEJEW_10 10 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 11

investor-owned electric systems, serving

six million people with 23,000 megawatts

of capacity and managing distribution

lines spanning 194,000 miles.

When FirstEnergy realized that 90

percent of its senior workforce was going

to retire within fve to seven years—and

that it took that long to train new employ-

ees, they faced the potentially devastating

results of a retirement exodus of this size.

Brian Wilkins, a long-time staff member

at First Energy, was tasked with capturing

workforce knowledge and transferring it

to new employees. He turned to Interli-

ance for help.

First, he developed, with several

professors at local universities, a fully-

accredited, two-year college program to

train future employees in critical skill

sets. Then, FirstEnergy worked with In-

terliance to reduce on-the-job training

from a two- to three-year process down

to just 18 months.

Other aspects of the management sys-

tem included compliance and internal

and external audits, which were required

every six months. Another element was

linking on-the-job-training to perfor-

mance reviews and pay. The compli-

ance of the people executing the on-the-

job-training and management system was

tied to their performance review, which

was tied to their pay.

The management system helped save

the company about $5 million annually,

says Wilkins.

Improvements that pay for themselves

To put it simply, when it comes to com-

pany management, everything is con-

nected. For example, problem solving

can involve multiple departments across

a company and have a high potential for

conficting interests. How do you man-

age this process, effectively handle tough

decisions and mitigate business risk? By

creating a system that defnes a compa-

ny’s core functions and processes, shows

how they overlap and interact with each

other, integrates all inputs, and is easily

used throughout the entire organization.

Companies using integrated manage-

ment systems experience fewer failures,

respond more effectively to challeng-

es, and deliver consistently better safety

and compliance performance over time.

These systems become a great solution to

regulatory worries, reduce operating risk

and improve profts, creating the perfect

outcome: better safety and compliance

improvements that pay for themselves. ⊗

Interliance Consulting, Inc., is a world leader in architecture and implementation of integrated management systems for “can’t fail” business functions such as Health, Safety and Environment, Emergency and Crisis Response, Regulatory Compliance, and Risk Management. For further information, contact Brad Kamph. Interliance Consulting, Inc. 200 E. Sandpointe Ave., Suite 510 Santa Ana, CA 92707 Phone: 855.540.8889 Web site: www.interliance.com Email: info@interliance.com

1311PEJEW_11 11 11/6/13 1:10 PM

12 Winter 2013 | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | EnergyWorkforce

Electricity Diversity Takes Shape in the Middle EastBy PennEnergy.com

IN the last year, a number of coun-

tries in the Middle East have revised

their energy policies to diversify

their electricity generation and increase

the use of cleaner, renewable power.

Though the Middle East is home to

some of the largest oil and natural gas

producers on the planet, countries

within the region are investing more

money in solar, geothermal and other

renewable sources and encouraging en-

ergy effcient projects.

Saudi Arabia aims to expand

renewable energy market

In July, Saudi Arabia invested $109 bil-

lion in renewable energy development.

The investment will help the country

reach its goal of generating a third of its

energy from solar, wind and other re-

newable sources of power, Arab News

reported earlier this year.

Also in July, the King Abdullah City

for Atomic and Renewable Energy (KA-

CARE) released details of its new Na-

tional Energy Plan, which details just

how much renewable energy it aims to

generate. According to the plan, Sau-

di Arabia will add 41 gigawatts of solar

power, 1 GW of geothermal and 9 GW

of wind power. The country also plans

to add 18 GW of nuclear power and 3

GW of waste-to -energy, according to the

Arab News.

In December 2012, Saudi Arabia

announced its first large-scale solar

project would be complete by the end

of the year. The installation produces

100 megawatts at full capacity - enough

to power 20,000 homes. The project will

also help Saudi Arabia meet its goal of

having renewable energy account for 7

percent of its total power supply by 2020.

“We truly believe solar will be a ma-

jor contributor to meeting our own re-

quirements,” said Sultan Ahmed Al-Ja-

ber, the UAE’s special envoy for Energy

and Climate Change, the Saudi Gazette

reported. “We are not like many oth-

er countries today that have a desper-

ate need for complementary sources of

power. We are looking at it from a stra-

tegic point of view ... we want to become

a technology player, rather than an en-

ergy player.”

UAE energy diversifcation

The United Arab Emirates has also

made major investments in energy gen-

eration in the past year. In July, Ministry

of Energy Suhail Al Mazrouie said the

country would invest $25 billion over

the next fve years to explore new natu-

ral gas felds and increase its gas output,

the Arabian Gazette reported.

Months later, in October, UAE gov-

ernment officials made another an-

nouncement regarding energy policy.

UAE’s Undersecretary of Energy Dr.

Matar Al Niyadi said the country would

be diversifying its energy mix, with new

energy policy focusing on “diversifca-

tion, conservation and effciency” as

well as securing an energy supply and

managing talent in the industry, the

Khaleej Times reported.

“Diversifying our energy mix is the

frst pillar of our energy policy,” Al Niya-

di said. “To meet immediate demands,

we are using more natural gas to gener-

ate electricity, because of its clean and

effcient burning properties.”

The country was the frst in the Mid-

dle East to establish renewable energy

targets, Al Niyadi said. In March, the

country approved the largest concen-

trated solar power plant in the world,

the Shams 1 project. This, along with

other projects, will help UAE reach its

goal of generating 2.5 gigawatts of new

renewable energy capacity by 2030, the

Khaleej Times reported.

Niyada also spoke of other UAE proj-

ects in the pipeline that will help the

country meet its energy diversifcation

policy, including energy effciency and

conservation efforts.

“In the UAE, we have the region’s

frst mandatory green building codes,

REGIONAL Insights

1311PEJEW_12 12 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 13

leading to cuts in energy and

water consumption by more

than 33 percent in new build-

ings,” Niyada said in October.

Kuwait sets renewable

energy goals

Earlier this year, Kuwait revised

its renewable energy policy, in-

creasing the amount of energy

it hopes to generate from solar

and other alternative sources.

The country previously aimed

to generate 10 percent of its en-

ergy from renewable sources by

2020. In May of this year, the country

pushed that target up, saying it now will

aim to generate 15 percent of its energy

from renewable sources by 2030.

Kuwait, which has one of the highest

energy consumption rates per capita in

the world, hopes to decrease its depen-

dence on oil for power, Gulf Business re-

ported. In four years, the country believes

it can cut oil consumption signifcantly

in just four years, using just 20 percent of

its oil production capacity.

Kuwait already has a major renewable

energy project in the works - a 280 mega-

watt solar thermal power plant in Kuwait.

The plant, located in Al-Abdaliya, will be

Kuwait’s frst solar facility. It is also the

frst project in which a private company

has been involved with a government en-

ergy development strategy, Clean Tech-

nica reported.

MoU established between

Cyprus, Greece and Israel

In early September, the three nations

signed a memorandum of understand-

ing which covers cooperation between

the countries regarding energy and water

resources, New Europe reported.

“The MoU is a framework through

which it will determine the number of

activities that the countries have agreed

to jointly pursue such as [energy securi-

ty and supply], environmental issues and

a number of other issues which are com-

mon for the three,” said Cypriot Energy

Minister George Lakkotrypis.

Lakkotrypis expressed interest in Cy-

prus, Greece and Israel being connect-

ed through an underwater electric cable,

linking electric grids and making it pos-

sible to supply other nations with power,

New Europe reported.

Greek Energy Minister Yannis Mani-

atis also said the MoU and future ener-

gy projects developed through the agree-

ment will help stabilize energy supplies

in the three countries and beyond.

“[T]he electric conduit can easily be-

come a cable which will supply and ex-

port electricity to the European energy

market, and provide us with energy se-

curity,” said Israel’s Energy Minister Sil-

van Shalom.

The MoU also states that the three na-

tions will jointly work to protect the nat-

ural gas felds in the Mediterranean Sea.

Pakistan’s move to renewable,

geothermal energy

Pakistan, like other countries in the

Middle East, has made commitments to

transition to using more renewable en-

ergy. Chairman of the Energy Founda-

tion Pakistan Javed Ahmad announced

in late September it would aim to gen-

erate thousands of megawatts of elec-

tricity from geothermal energy projects

and other renewable sources, Pakistan

Today reported. Ahmad said renewable

energy was sustainable, could be gen-

erated at low costs and would reduce

the country’s dependence on import-

ed fuel.

Pakistan imports about one-third of its

energy requirements, costing the coun-

try $15 billion during the fscal year end-

ing June 2013, The Diplomat reported. In

2012, oil and gas accounted for 65 per-

cent of Pakistan’s energy mix. Energy

demand in the country is only expected

to increase, growing to around 40,000

MW by 2020. Yet, the government aims

to meet its energy shortfalls by increas-

ing its investments in renewable energy

projects.

Ahmad said he would work to attract

investment in 10,000 MW of geothermal

power projects and start producing elec-

tricity at lower prices within just three

years, the source said.

Existing geothermal power plants in

Pakistan have proven successful, Ahmad

said, according to the Associated Press of

Pakistan. The move to more clean, re-

newable sources would also reduce the

country’s air pollution created from its

coal-fred power plants, he added. Ex-

panding geothermal and renewable ener-

gy in the country would also trigger eco-

nomic growth, Ahmad said. ⊗

“…we want to become a technology player, rather

than an energy player.” —Sultan Ahmed Al-Jaber

1311PEJEW_13 13 11/6/13 1:10 PM

ALWAYS COMPREHENSIVE

Comprehensive coverage of trans-

mission, gathering, and distribution

pipelines for petroleum and natural

gas and all associated facilities.

ALWAYS CURRENT

Regular updates keep you informed

of the latest pipeline developments.

ALWAYS COMPLETE

The MAPSearch Research staff’s

unyielding attention to detail along

with long-standing relationships

within the energy industry enable us

to provide the most complete and

accurate information available.

ALWAYS SUPPORTABLE

MAPSearch provides up-to-date

maintenance and support.

MAPSearch provides you with the latest maps and data related

to pipeline systems in the U.S., Canada, Mexico and offshore Gulf

of Mexico. We bring you hard-to-fi nd information collected from

pipeline operators, government, and regulatory agencies on more

than 1,000,000 miles of pipeline, over 33,000 facilities and 4,500

interconnects — offshore and on.

Our pipeline-related products bring you

• A choice of formats — printed map products or digital data in

GIS format

• In-depth information — including commodity transported,

pipeline diameter, owner/operator, direction of fl ow, facility/

pipeline interconnections and more

• Complete coverage — Crude Oil, LPG/NGL, Natural Gas,

Petrochemicals, Refi ned Products, Specialty Gases and 30

types of facilities

• Semi-Annual updates sent to GIS clients

Get the Job Done with MAPSearch®

For more information on PennWell’s

MAPSearch North American Pipeline offering:

Call 800.823.6277 | Email sales@mapsearch.com | Visit www.MAPSearch.com

GIS Data f o r the Ene rgy Indus t r y

Offshore and Onshore Pipeline Systems and Facilities

1311PEJEW_14 14 11/6/13 1:10 PM

EnergyWorkforce | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | Winter 2013 15

New Policies Develop Asia-Pacific Energy FutureBy PennEnergy.com

THE Asia-Pacifc region has had a

number of new energy policies

enacted in the last year - from

new solar feed-in tariff rates to interna-

tional agreements on fossil fuel devel-

opment. The new policies have impact-

ed numerous forms of energy genera-

tion, including renewable sources and

natural gas.

China solar tax rebates aim to curb

declining profts of industry

A number of Asian countries are encour-

aging renewable energy development as

a way to reduce pollution levels. Chi-

na, a major supplier of solar panels, is

offering tax rebates to solar pan-

el and solar product manufactur-

ers. The goal of the rebates is to

help the sector that has taken a

hit in recent years among weak de-

mand and to cut pollution levels,

the BBC reported.

Manufacturers will be grant-

ed a 50 percent value-added tax

rebate from Oct. 1, 2013 to Dec.

2015. The Ministry of Finance

announced the new tax re-

bate policy Sept. 29, Bloom-

berg reported. The announce-

ment sparked interest in the

country’s solar sector almost immedi-

ately, according to the source. Shares

for LDK Solar Co. and Suntech Pow-

er Holdings Co., two Chinese solar

manufacturers, rose to their high-

est level in two months following the

tax rebate plan announcement. LDK

gained 30 percent, for example.

The tax rebate plan may have also

improved the future outlook of Chi-

na’s solar industry. In late Septem-

ber, analysts said they expected so-

lar installations in China to increase

as much as 15 gigawatts in 2014 - up

from about 7 GW this year, Bloom-

berg reported.

The government also enacted a new

policy in late August. The National De-

velopment and Reform Commission

said Aug. 30 it would offer a $0.07 per

kilowatt-hour subsidy to solar power sta-

tions in the country, according to the

Want China Times.

China LNG expansion project to

meet rising energy demand

Along with solar and other renewable

energy development, China also com-

mitted to increasing its use of natural

gas. The government-owned National

Offshore Oil Corp said in September

it plans to add fve liquefed natural gas

receiving terminals by 2015 and double

its capacity to as much as 40 million

tonnes per year, reuters reported. The

project means China will be able to sig-

nifcant boost the amount of LNG it im-

ports to meet strong energy demands in

the country.

The move will also help China in-

crease its use of natural gas

to 8 percent of its energy mix

by 2015. Natural gas currently

accounts for 5 percent of Chi-

na’s energy use. More natural

gas also means China can cut

air emissions from coal and

reduce oil imports, Reuters

reported.

The U.S. Energy Informa-

tion Administration expects

Chinese LNG demand will

increase 5 percent annually

through 2035. The increase of

LNG in the Asian country is

expected to have global implications.

“China is already infuencing the

underlying mid-term LNG market and

will likely continue to,” said Stephen

REGIONAL Insights

1311PEJEW_15 15 11/6/13 1:10 PM

16 Winter 2013 | FOR JOB OPPORTUNITIES, VISIT www.PennEnergyJOBS.com | EnergyWorkforce

Cornish, Geneva-based director of glob-

al gas and LNG at Koch Supply & Trad-

ing, a subsidiary of Kansas-based indus-

trial company Koch Industries, Risk.net

reported

Thailand also looks to expand LNG market

Thailand, too, will be expanding its

LNG imports to meet increasing ener-

gy demands and to avoid power outages

in the country. PTT LNG, a subsidiary

of the state-owned oil and gas company

PTT, said it will double capacity at its 5

million megatons per year LNG import

terminal, Platts reported.

The expansion, being referred to as

Phase II, includes building a new jet-

ty, storage tanks and new processing

and regasifcation facilities at the import

terminal.

“The government has a clear poli-

cy to ensure stable supply of natural gas

for industry, especially for power genera-

tion and this includes going ahead with

Phase II on schedule,” an offcial with

PTT LNG said in June.

The project is expected to be complete

by late 2016, with new capacity being op-

erational in the frst three months of 2017,

Platts reported.

The project announcement comes af-

ter PTT came close to experiencing pow-

er outages due to a lack of energy sup-

plies. In March, PTT said it would need

to double LNG imports in April to avert

power outages. The state-owned com-

pany imported two LNG shipments of

70,000 tonnes each that month - about

70,000 more than it normally receives,

Bangkok Post reported.

Japan’s feed in tariff regime boosts

renewable energy investments

Japan began offering feed-in tariffs in

July 2012 through its Act on Purchase

of Renewable Energy Sourced Electric-

ity by Electric Utilities to encourage in-

vestments in renewable energy sources,

including wind and solar power. The act

requires utilities operating in the coun-

try to purchase renewable energy for pric-

es and durations set by the Minister of

Economy, Trade and Industry (METI).

The new policy was expected to spur de-

velopment in renewable energy in Japan.

It worked. In 2012 alone, the tariffs

boosted investment in renewable energy

by 75 percent, resulting in $16.3 billion

spent on solar, wind and other clean en-

ergy developments in Japan, a report on

the tariff system by DLA Piper said.

The government revised this tariff

scheme this year at the end of March,

and the new surcharge rates took effect in

April of this year. The 2013 revised feed-

in tariff rate by METI remain among the

“most generous” rates in the world, the

report said.

In February, Hitachi, a Japanese en-

gineering and electronics company, an-

nounced it would invest about $10.5

million in a 8-megawatt solar plant sched-

uled to be complete by the end of the

year. Months later, in May, Goldman

Sachs announced plans to invest approx-

imately $487 million in renewable en-

ergy projects in Japan over the next fve

years. Goldman Sachs formed the Japan

Renewable Energy Company to develop

a range of clean energy projects as well.

In September, The Japan News report-

ed, the feed-in tariff system has drawn a

number of solar power companies to in-

vest in new projects. For instance, Hok-

kaido Electric plans to build a battery

system for solar generation at a substa-

tion in Abira. Advanced projects like this

will allow utilities to buy 10 percent more

electricity from renewable projects, the

METI believes.

In the second quarter of 2013, Ja-

pan added 1.7 gigawatts of solar capaci-

ty, mainly through commercial installa-

tions. Much of this new renewable power

generation is thanks to the country’s feed-

in tariff scheme, Clean Technica recent-

ly reported.

Vietnam strikes deal with

US over nuclear power

Vietnam, which is home to the second-

largest market for nuclear power in East

Asia, struck a deal with the United States

over its nuclear power program. Under

the agreement, the U.S. will sell nucle-

ar fuel and technology to Vietnam. In

exchange, Vietnam is prohibited from

enriching or reprocessing plutonium or

uranium during nuclear energy develop-

ment, Bloomberg reported. The agree-

ment is aimed at curbing the creation of

nuclear weapons.

The agreement helps both nations.

“It will open up opportunities for Viet-

nam to have the best and most modern

technology,” Tran Chi Thanh, Hanoi-

based head of the Vietnam Atomic En-

ergy Institute, said by phone today. “One

key issues is that we must train personnel.

The agreement will hopefully give us op-

portunities to do so.”

U.S. Secretary of State John Kerry

said the deal will open numerous oppor-

tunities for businesses in the U.S. and

Vietnam.

“Our companies can now compete,”

he said, according to Bloomberg.

Vietnam has 13 nuclear power stations

in the planning phase. If built, these proj-

ects would add 16,000 MW of new pow-

er over the next 20 years, Bloomberg

reported. ⊗

1311PEJEW_16 16 11/6/13 1:10 PM

Actionable data for the Power industry:

Make your next step your BEST step.

Power Generation

Renewable Energy

Transmission & Distribution

Smart Grid

...and much more

www.PennEnergyResearch.com

DIRECTORIES SURVEYS FORECASTS INDUSTRY ANALYSISSTATISTICAL TABLES CUSTOM RESEARCH

1311PEJEW_C3 3 11/6/13 1:08 PM

5:25PMPIONEERING UNCHARTED

TERRITORY BENEATH THE WAVES

9:25AMPIONEERING ADVANCES IN RENEWABLE

SOURCES TO SHAPE THE FUTURE OF ENERGY

Join the worldís leading energy company with a career in Power Systems at

Saudi Aramco. Take the opportunity to explore alternative energy sources

����������������������������������������� ����������������������

consulting expertise to develop new generation improvements to optimize

plant performance. Collaborate with other specialists in renewable sources

to evaluate breakthrough energy technologies. Experience truly rewarding

��������������������������������������������������������������������

a chance to explore the wealth of activities in Saudi Arabia. Saudi Aramco

provides a work-life balance and a chance to do it all.

Visit us at the Power-Gen International Conference, November 12-14,

in the Career Fair, Booth #5386.

DREAM BIG at www.Aramco.Jobs/PowerGen

POWER SYSTEMS PROFESSIONALS

1311PEJEW_C4 4 11/6/13 1:08 PM