Available online at www.sciencedirect.com

ScienceDirect

Journal of Nutritional Biochemistry 25 (2014) 1108–1116

RESEARCH ARTICLES

Postnatal overfeeding promotes early onset and exaggeration of high-fat diet-inducednonalcoholic fatty liver disease through disordered hepatic lipid

metabolism in rats☆,☆☆

Chenlin Jia, Yanyan Daia, Weiwei Jiangb, Juan Liua, Miao Houa, Junle Wangc, Jonas Buréne, Xiaonan Lia,d,⁎

aDepartment of Children Health Care, Nanjing Children’s Hospital, Nanjing Medical University, Nanjing, ChinabDepartment of Neonatal Surgery, Nanjing Children’s Hospital, Nanjing Medical University, Nanjing, ChinacDepartment of Clinical Laboratory, Nanjing Children’s Hospital, Nanjing Medical University, Nanjing, China

dInstitute of Pediatric Research, Nanjing Medical University, Nanjing, ChinaeDepartment of Public Health and Clinical Medicine, Umeå University, Umeå, Sweden

Received 29 September 2013; received in revised form 1 April 2014; accepted 13 June 2014

Abstract

Exposure to overnutrition in critical or sensitive developmental periods may increase the risk of developing obesity and metabolic syndrome in adults.Nonalcoholic fatty liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome, but the relationship among postnatal nutrition, lipidmetabolism, and NAFLD progression during development remains poorly understood. Here we investigated in a rat model whether postnatal overfeedingincreases susceptibility to NAFLD in response to a high-fat diet. Litters from Sprague-Dawley dams were culled to three (small litters) or ten (normal litters) pupsand then weaned onto a standard or high-fat diet at postnatal day 21 to generate normal-litter, small-litter, normal-litter/high-fat, and small-litter/high-fatgroups. At age 16 weeks, the small-litter and both high-fat groups showed obesity, dyslipidemia, and insulin resistance. Hepatic disorders appeared earlier in thesmall-litter/high-fat rats with greater liver mass gain and higher hepatic triglycerides and steatosis score versus normal-litter/high-fat rats. Hepatic acetyl-CoAcarboxylase activity and mRNA expression were increased in small-litter rats and aggravated in small-litter/high-fat rats but not in normal-litter/high-fat rats.The high expression in small-litter/high-fat rats coincided with high sterol regulatory element-binding protein-1c mRNA and protein expression. However,mRNA expression of enzymes involved in hepatic fatty acid oxidation (carnitine palmitoyltransferase 1) and output (microsomal triglyceride transfer protein)was decreased under a high-fat diet regardless of litter size. In conclusion, overfeeding related to small-litter rearing during lactation contributes to the NAFLDphenotype when combined with a high-fat diet, possibly through up-regulated hepatic lipogenesis.© 2014 Elsevier Inc. All rights reserved.

Keywords: Early overfeeding; Liver; High-fat diet; Lipid metabolism; Nonalcoholic fatty liver disease; Rat

1. Introduction

Nonalcoholic fatty liver disease (NAFLD) is characterized byexcessive triglyceride (TG) accumulation in the absence of “signifi-cant” alcohol consumption [1] and is closely associatedwithmetabolicdysregulation such as obesity, diabetes, hyperlipidemia, and cardio-vascular disease. NAFLD is considered the hepatic manifestation ofmetabolic syndrome [2]. The prevalence ofNAFLD ranges from20–30%

☆ Funding: This work was supported by the National Basic ResearchProgram of China (973 Program) (2013CB530604) and the National NaturalScience Foundation of China (81273064).

☆☆ Declaration of interest: The authors declare that there is no conflict ofinterest that could be perceived as prejudicing the impartiality of theresearch reported.

⁎ Corresponding author at: Nanjing Children's Hospital, Nanjing MedicalUniversity, 72 Guangzhou Road, Nanjing, 210008, P. R. China. Tel.: +86 2586862996; fax: +86 25 86862997.

E-mail address: xnli@njmu.edu.cn (X. Li).

http://dx.doi.org/10.1016/j.jnutbio.2014.06.0100955-2863/© 2014 Elsevier Inc. All rights reserved.

in the general population and 75–100% in obese adults [3,4], as well ashaving a range of 10–50% of obese children [5]. Although NAFLD is a“benign” condition, it may progress to nonalcoholic steatohepatitis(NASH), fibrosis, cirrhosis, and hepatocellular carcinoma and isassociated with a significantly shorter survival [6]. Therefore,understanding themechanisms underlying an increased susceptibilityto NAFLD from obesity is crucial to developing strategies to preventmetabolic syndrome and NAFLD, especially in childhood.

Obesity is influenced by the interaction of genes, nutrition, andlifestyle. Additionally, increasing evidence from clinical and animalexperimental studies shows that the way an individual grows anddevelopment early in life directly affects features of the metabolicsyndrome in later life [5,7]. In particular, weight gain in the first yearsof life is important in programming body mass index in young adults[8], and the nutritional environment is another important factor.Maternal [9–11] and postnatal infant overfeeding [12,13] couldincrease the risk of obesity and associated metabolic disturbanceand NAFLD in adulthood. In animal research, rats are ordinarily rearedin litters of 8-12 pups (normal litter). Quantitative changes in the food

Table 1Purified diet formula and composition [weight (%)].

Standard diet (%) High fat diet (%)

Casein 18.92 18.92L-Cystine 0.28 0.28Maltodextrin 3.32 3.32Corn starch 48.34 39.34Sucrose 13.00 13.00Cellulose 4.74 4.74Soybean oil 6.00 6.00Lard - 9.00Mineral mix 4.26 4.26Vitamin mix 1.14 1.14Total 100.00 100.00Energy (kcal/100 g) 392.60 438.24

1109C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

supply of neonatal rats can be produced by altering litter size at birth,so that large and small litters are obtained [14]. It is usually expectedthat more milk would be available to the individual pups when littersize is decreased below that normally delivered, mainly by a high-TGmaternal milk [15,16], thereby imposing a state of persistentpostnatal overfeeding upon the suckling animals. Clearly, postnataloverfeeding using small litter (SL) rearing (3 pups) and a post-weaning high-fat (HF) diet in rats induces early onset and/or morepronounced obesity, insulin resistance, and lipid disorders at puberty[17]. However, the biochemical and molecular mechanisms underly-ing this increased susceptibility to metabolic disorders from postnataloverfeeding is unknown.

NAFLD is primarily a result of inappropriate fat storage; anymechanism leading to “ectopic” fat accumulation must involvepersistent alterations in lipid metabolism [11]. Hepatic lipid metab-olism includes circulating lipid uptake, de novo lipogenesis, fatty acidoxidation, and TG-rich lipoprotein secretion. Hepatic steatosis occurswhen there is an imbalance in which lipid availability (uptake andsynthesis) exceeds lipid disposal (oxidation and export) [18].Enzymes regulating lipid metabolism are key in these processes.Hepatic lipoprotein lipase (LPL) and liver-type fatty acid-bindingprotein (L-FABP) are considered to play a central role in hepatic lipiduptake [18–20]. Acetyl-CoA carboxylase (ACC) is the rate-limitingenzyme involved in de novo lipogenesis [21], and carnitine palmi-toyltransferase-1 (CPT1) and microsomal TG transfer protein (MTP)are the rate-limiting enzymes involved in fatty acid oxidation andexport, respectively [22,23]. During energy overconsumption, LPL,L-FABP, and ACC mRNA expression in liver increase [24,25], but CPT1and MTP decrease [26]. These alterations contribute to a hepatic lipidinput (ACC, L-FABP, and LPL) that exceeds its output (CPT1 and MTP),favoring the occurrence of NAFLD [27–29]. Moreover, the activities ofthese enzyme systems are regulated by transcriptional factors, such assterol regulatory element binding protein-1c (SREBP-1c) and perox-isome proliferator-activated receptor α (PPARα) [30,31]. In NAFLD,hepatic SREBP-1c and ACC mRNA expression is increased [24,32]whereas PPARα and CPT1 expression is decreased [33].

In addition, accumulating evidence indicates that exposure tomalnutrition in the critical or sensitive periods of development may“program” the long-term or life-time structure or function of theorganism [34]. Maternal protein restriction in pregnant rats reduceshepatocyte numbers [35], hepatic lipogenesis [10], and PPARα DNAmethylation in the offspring [36]. A maternal HF diet up-regulateshepatic lipid intake (LPL) [37] and lipogenesis (ACC) [11], decreasesβ-oxidation (CPT1), and impairs hepatic mitochondrial metabolism inadult offspring [38]. Taken together, these observations stronglysuggest that early malnutrition is linked to a derangement in liverdevelopment and function. In a previous study, SL rearing inducedincreased 11β-hydroxysteroid dehydrogenase type 1 activity andthus enhanced glucocorticoid action in peripheral tissue duringpuberty [17], which contributed to obesity and insulin resistance inadults. However, the effects of SL rearing on the lipid metabolicpathway in liver and possible association with NAFLD developmenthave not been determined.

Our aim was to study the influence of neonatal overfeedinginduced by SL rearing and a post-suckling HF diet on key enzymes andtranscriptional factors involved in hepatic liver lipid metabolism. Wealso examined whether postnatal overfeeding increases susceptibilityto NAFLD in response to a HF diet.

2. Methods and materials

2.1. Animals

All studies were approved by the University Committee on Use and Care of Animalsand overseen by the Unit for Laboratory Animal Medicine at Nanjing MedicalUniversity (ID: 2008031801). Sprague–Dawley rats (Nanjing, Jiangsu, China) were

maintained under controlled light (0600–1800 h) and temperature (22±2°C)conditions with free access to tap water.

2.2. Experimental design

The experimental setup was similar to that described in Boullu-Ciocca et al. [39].Briefly, female rats were time-mated, and at postnatal day 3 (P3), male pups wereredistributed to litter sizes of three (small litters, SL) or ten (normal litters, NL) toinduce early postnatal overfeeding or normal feeding respectively [40,41]. At P21, ratswere weaned to be fed either a standard laboratory diet or HF diet (Slac, Shanghai,China, Table 1) until postnatal week 16 (W16). Four groups were analyzed, namely NL,SL, NL-HF, and SL-HF. There were 24-36 rats in each group and 120 rats in the totalexperiment. All animals were housed three per cage, and body weight and food intakeswere monitored throughout life. The animals were killed at W3, W6, W10, and W16between 0830 and 1000 h after fasting overnight (12 h). Rats were anesthetized withchloral hydrate (300 mg/kg body weight, i.p.), and blood samples were obtained fromthe right ventricle. The blood was centrifuged (2000×g, 4°C, 15 min) and the separatedserum stored at−70°C for subsequent determination of biochemical parameters. Liver,epididymal, and retroperitoneal fat pads were dissected out and weighed. All tissueswere snap-frozen in liquid nitrogen and kept at −70°C until gene expression analysis.

2.3. Serum biochemistry

Total TG, total cholesterol (TC), alanine aminotransferase (ALT), and aspartic acidtransaminase (AST) in the serum were measured using an Olympus AU400 analyzerwith enzymatic reagents (Olympus America, New York, NY, USA).

2.4. Intraperitoneal glucose tolerance test

The intraperitoneal glucose tolerance test (IPGTT) was performed as describedpreviously [42]. Briefly, at W3, W6, W10, and W16, rats were fasted overnight. A bloodsample was then taken from a tail vein and the rats injected i.p. with 2.0 g D-glucose(50% stock solution in saline)/kg body weight. Blood samples were drawn at 30-, 60-,and 120-min intervals after the glucose injection, and glucose levels were measured bya glucose meter (Accu-Chek; Roche).

2.5. Hepatic lipid assays

Concentrations of TG in the liver were determined using tissue TG assay kits(Applygen, Beijing, China). Hepatic TG concentration was expressed relative to 1 g ofliver protein. Hepatic protein concentrations were determined using a Pierce BCAprotein assay kit with bovine serum albumin as the standard (Thermo Fisher Scientific,Rockford, IL, USA).

2.6. Hepatosomatic index

The hepatosomatic index was determined according to Wotton et al. [43] andcalculated as follows: hepatosomatic index=(liver weight/body weight) * 100%.

2.7. Liver histological analyses

Portions of the left and right lobeswere either flash frozen in isopentane (Oil RedO)or fixed in buffered formalin [hematoxylin and eosin (H&E)] for histological analyses.

2.8. NAFLD Activity Score (NAS)

The NAS is used to assess the severity of NAFLD, according to Kleiner et al. [44]. Anactivity score was generated by adding the individual scores for the following features:steatosis (b5%=0; 5–33%=1; 33–66%=2; N66%=3); lobular inflammation (none=0;b2 foci=1; 2–4 foci=2; N4 foci=3); and ballooning (none=0; few=1; prominent=2).A score of less than 3 correlates with mild nonalcoholic fatty liver, a score of 3–4

Table 2Primer sequences used for mRNA quantification by real-time PCR.

Forward primer 5′–3′ Reverse primer 5′–3′

LPL GCTTCCCCTTACTGGTTCC AACTGGCAGGCAATGAGACTL-FABP GCCTAATCATTCATAGCTTCCCTA TACCAACTGAGCTACATTCTCAGCACC TGAAGGGCTACCTCTAATG TCACAACCCAAGAACCACCPT1 CAGCTGGGCCTAACTTTGAG CCTCTCTGCAATCACACGAAMTP AGCAACATGCCTACTTCTTACAC TCACGGGTTCACTTTCACTGSREBP-1c CGCTACCGTTCCTCTATCA CTCCTCCACTGCCACAAGPPARα AGCCATTCTGCGACATCA CGTCTGACTCGGTCTTCTTGGAPDH CCTTCCGTGTTCCTACCC CCTGCTTCACCACCTTCTT

GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

1110 C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

correlates with moderate nonalcoholic fatty liver, and a score of 5 or more correlateswith NASH. The average score for each histological characteristic in each group (n=6)was used. At least 3 slices per liver tissue sample, and 10 fields of vision each slice wereaccomplished to determine the NAS.

2.9. RNA extraction and real-time PCR

Total RNA was isolated from the liver using TRIzol (Invitrogen) according to themanufacturer’s instructions and quantified spectrophotometrically at OD 260. Theintegrity of total RNA was assessed using agarose gel electrophoresis, and cDNA wassynthesized usingM-MLV reverse transcriptase (Promega)with 1.0 μg of the RNA sampleas recommended by the manufacturer. Genes of interest were analyzed by real-time PCRusing the SYBR GREEN ABI Prism 7500 sequence detector for the target genes ACC, LPL,L-FABP, CPT1, MTP, SREBP-1c, and PPARα (Table 2). Expression of target genes wasnormalized to glyceraldehyde-3-phosphate dehydrogenase expression.

2.10. Western blot analysis

Rat liver tissues were homogenized in ice-cold radio immunoprecipitation assaybuffer to make whole cell lysates. Protein concentrations were determined using aPierce BCA protein assay kit with bovine serum albumin as the standard (ThermoFisher Scientific, Rockford, IL, USA). A total of 40 mg of protein was loaded in each wellof 10% SDS-PAGE, separated, and transferred onto nitrocellulose filter membranes(0.45 mm;Millipore, Billerica, USA) at 4°C. The membranes were blocked in 5% non-fatmilk for 1.5 h at room temperature and then blotted with a primary antibody to SREBP-1c (Abcam, Cambridge, MA, USA), PPARα (Abcam, Cambridge, MA, USA), or β-actin(Santa Cruz, California, USA) at 1:1000 dilution overnight at 4°C. After being washedfour times (10 min/wash) in PBST buffer at room temperature, the membrane wasincubated with the second antibody for 1 h and immunoreactive bands visualizedusing chemiluminescence. The intensity of target proteins (SREBP-1c and PPARα) andreference proteins (β-actin) was quantified using a Gel-Pro analyzer 4.0 software, andthe relative blackness of target proteins over reference protein was used to estimatethe expression of SREBP-1c and PPARα.

2.11. ACC activity assay

The assay for ACC activity in the liver is based on the acetyl-CoA–dependentformation of acid-stable radioactivity derived from H14CO3

−[45]. Rat livers werewashed, minced with scissors, and homogenized in potassium chloride solution(11.5 g/L, KCl) on ice. The homogenates were diluted 1 in 4 with KCl and transferredinto sterile centrifuge tubes and centrifuged at 9000×g at 4°C for 20 min. The resultingsupernatant was prepared as enzymes for the ACC assay directly following the methodof Craig et al. [46]. Activity was expressed in mU/mg of protein where the proteincontent was determined by the Lowry procedure [47].

2.12. Statistical analysis

The data were normally distributed and expressed as mean±S.E.M. Significantdifferences among groups of rats were analyzed using one-way analysis of variance(ANOVA). Serum glucose during IPGTT was analyzed by one-way ANOVA withrepeated measures. To determine the independent effects of postnatal overfeeding andpost-weaning diets on each parameter, the data were analyzed using a two-wayanalysis of variance. Statistical significance was accepted when Pb.05.

3. Results

3.1. Body weight gain, food intake, energy intake, adipose tissue weight,and serum lipids

As early as W3, SL rats displayed greater body weight, food andenergy intake, and fat pad (retroperitoneal and epididymal) weightcompared with NL rats, which persisted until adulthood (Fig. 1A–E).

The food and energy intake, body and fat pad weight in SL-HF ratswere persistently higher than in all other groups, and NL-HF ratsbegan to have greater food intake and body and fat pad weight thanNL rats at W9 but less than SL-HF rats during the experimental period(Fig. 1A–E). Serum TG was increased in SL rats at W3 (Fig. 1F). After3 weeks on a HF diet, serum TG in SL-HF rats was higher than in allother groups, and these effects persisted until W16. By contrast,NL-HF rats began to have greater TG levels than NL rats at W16 only.SL rearing showed significant interactions with the HF diet withregard to serum TG at W6 (F=14.56, Pb.01), W10 (F=4.49, Pb.05),and W16 (F=5.15, Pb.05). Both SL-HF and NL-HF rats exhibitedhigher TC levels compared with their counterparts from W6 to W16(Fig. 1G). Serum ALT and AST levels remained unchanged in all groupsduring the study period (data not shown).

3.2. Glucose homeostasis

IPGTT (Fig. 2), which is a proxy measure of insulin sensitivity,showed that SL-HF rats had the greatest area under the curve (AUC)for plasma glucose already at W6 (Fig. 2B), which persisted untiladulthood, whereas the AUC was increased in SL and NL-HF ratscomparedwith NL rats atW10 andW16 (Fig. 2C, D). SL rearing and HFdiet induced glucose intolerance with a pronounced interaction atW6(F=5.365, Pb.05), W10 (F=4.861, Pb.05), andW16 (F=4.457, Pb.05).

3.3. Liver mass and hepatic TG content

From W3 to W16, liver mass and hepatosomatic index wereincreased significantly in SL rats compared with NL rats (Fig. 3A andB) and accompanied by greater hepatic TG content (Fig. 3C). SL-HFrats showed the highest liver weight, hepatosomatic index, andhepatic TG content compared with all other groups from W6 to W16while NL-HF rats had greater liver mass, hepatosomatic index, andhepatic TG content than NL rats at W16 only (Fig. 3A–C). The SL withHF diet group showed significant interaction effects in liver mass(W6: F=4.56, Pb.05; F=4.79, Pb.05;W16: F=5.08, Pb.05) and hepaticTG content (W6: F=11.49, Pb.01; W16: F=5.29, Pb.05).

3.4. Histological examination

Hepatic histological damage is shown in Fig. 4A. At W10, SL-HFrats exhibited hepatic steatosis (H&E) that was confirmed by Oil RedO staining while NL-HF livers showed normal morphology. At W16,SL-HF livers were filled with large droplets, with evidence of bothmicro- and macrovascular steatosis, and were accompanied withballooning and spots of necrosis in hepatocytes that had progressedfrom the 10-week point. By contrast, in NL-HF rats, small lipiddroplets were observed at W16 only. Liver histology was normal inboth NL and SL rats during the experimental period. The severity ofthe NAFLD in the rat livers at W16 was assessed using the NAS(Fig. 4B), which allows scoring of individual features, includingsteatosis, ballooning, and lobular inflammation. Both NL and SL ratsreceived no scores, and NL-HF rats achieved a score of 2.1, indicatingmild NAFLD. SL-HF livers generated a total NAS score of 3.5, includingsteatosis, ballooning, and inflammation, which was higher than in allother groups and indicated a moderate NAFLD.

3.5. mRNA expression of rate-limiting enzymes in lipid metabolism

Hepatic ACCmRNA expression in SL rats was higher than NL rats atW3 and persisted until W16 (Fig. 5A). ACCmRNA expression in SL-HFrats was highest among all groups from W10 to W16 whereas ACCmRNA expression in NL-HF rats was similar to NL at W16. Moreover,the pattern of ACC gene mRNA expression was in conformity withenzyme activity in all groups (Fig. 5B). Hepatic LPL and L-FABP mRNA

Fig. 1. Phenotypic characterization in rats from W3 to W16. (A) Body weight. (B) Food intake. (C) Energy intake. (D) Retroperitoneal adipose tissue (RAT) weight. (E) Epididymaladipose tissue (EAT) weight. (F) Total plasma triglycerides (TG) levels. (G) Total plasma cholesterol (TC) levels. Data are expressed as mean±S.E.M., n=6–9 in each group. *Pb.05,**Pb.01 vs. NL. $Pb.05 vs. SL. #Pb.05, ##Pb.01 vs. all other groups.

1111C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

expressionwere increased in SL rats atW3 only (Fig. 5C and D). NL-HFrats had transiently increased hepatic L-FABP and CPT1 mRNAexpression at W10 (Fig. 5D and E). NL-HF and SL-HF rats haddecreased LPL, CPT1, and MTP mRNA expression at W16 whereas SLrats only had decreased LPL and MTP expression at W16 compared toNL rats (Fig. 5C–F).

3.6. Hepatic SREBP-1c and PPARα mRNA and protein expression

The pattern of SREBP-1c mRNA expression in liver was similar tothat for ACCmRNA expression, i.e., increased in SL rats comparedwithNL rats at W3 and more aggravated in SL-HF rats from W10 to W16.There was no difference in SREBP-1c mRNA expression betweenNL-HF rats and NL rats (Fig. 6A). The mRNA expression of PPARαwasdecreased in SL-HF rats at W10 and W16 (Fig. 6B). Moreover, mRNAexpression of SREBP-1c and PPARα was consistent with proteinexpression patterns in all groups (Fig. 6C).

4. Discussion

Manipulation of rat litter rearing to induce neonatal overfeedinghas beenwidely used to study the short- and long-term consequencesof childhood obesity [41,48]. Consistent with these reports, weconfirmed that SL rearing in rats can induce insulin resistance,obesity, and other metabolic disorders (e.g., elevated plasma glucoseand TG) in adults. Our most important finding in this study was thatSL rearing followed by a post-weaning HF diet promoted early onsetand exaggeration of NAFLD compared to HF diet exposure alone in thepost-weaning period. Specifically, this study provides the firstevidence that postnatal feeding induced by SL rearing leads to thedevelopmental programming of ACC gene expression and enzyme

activity, an up-regulated hepatic de novo lipogenesis, and anexacerbated effect of the HF diet later in life, which contributed tothe development of NAFLD and metabolic alterations.

It is widely accepted that exposure to overnutrition in critical orsensitive developmental periods may increase the risk of developingmetabolic disorders in adults [49–52]. The critical periods includeearly fetal life, infancy, and even adolescence [53]. Liver is consideredto be the most vulnerable organ following nutritional programmingduring the perinatal period [54,55]. The HF diet is central to the onsetof NAFLD [56], and when it is preceded by maternal HF feedingcoinciding with early organogenesis of the fetal liver, greater NAFLD[38] and even NASH [11] are induced in adulthood. In the presentstudy, we observed the dynamic changes in rat liver during thepostnatal period ((from prepuberty (W3 to W6), via puberty (W6 toW10), to adulthood (W16)) and confirmed that neonatal overfeedinginduced by SL rearing induced greater liver mass and hepatic TGaccumulation in adults. Moreover, small litters and a post-weaning HFdiet in combination exhibited a pronounced interaction with thegreatest rate of liver mass gain and dyslipidemia as well as anincreased hepatic TG content, and an established hepatic steatosisearlier at the end of adolescence (W10). With the progression ofsteatosis, SL-HF rats exhibited serious steatosis accompanied byhepatocyte ballooning and point necrosis in adults. By contrast, NLrats were resistant post-weaning to HF-induced injury until W16,which is similar to a previous report in mice [11]. It is striking thatdivergent nutritional exposure during early life can reprogram theresponse to a particular nutritional environment, as reportedpreviously in rat offspring exposed to gestation stress [57] andmaternal malnutrition [58]. These observations suggest that thepostnatal period, particularly the suckling period, represents a criticaltime frame during which metabolic regulatory set points may be

Fig. 2. IPGTT and area under the curve (AUC) in rats at W3 (A), W6 (B), W10 (C), andW16 (D). Data are expressed asmean±S.E.M., n=6–9 in each group. *Pb.05, **Pb.01 vs. NL. #Pb.05,##Pb.01 vs. all other groups.

Fig. 3. Liver weight, hepatosomatic index, and hepatic TG content in rats fromW3 toW16. (A) Liver weight. (B) Hepatosomatic index. (C) Hepatic TG content. Hepatosomatic index=(liver weight/body weight) * 100%. Data are expressed as mean±S.E.M., n=6–9 in each group. *Pb.05, **Pb.01 vs. NL. $Pb.05 vs. SL. #Pb.05, ##Pb.01 vs. all other groups.

1112 C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

Fig. 4. Histological analysis and NAFLD activity score in rats from W6 to W16. (A) Representative H&E and Oil Red O stains of livers in rats at W6, W10, and W16. W6, all groupsremained normal; W10, SL-HF offspring exhibit mild steatosis (small arrow); W16, NL-HF offspring exhibit mild steatosis (small arrow), and SL-HF offspring exhibit moderatesteatosis (large arrow), hepatocyte ballooning (arrowhead), and point necrosis (H&E) with a greater degree of steatosis (Oil Red O); ×200 for light microscopy. (B) NAFLD ActivityScore (NAS) atW16. The total NAS score was generated by adding the individual scores for the following features: steatosis, lobular inflammation, and ballooning. A score b3 correlateswith mild nonalcoholic fatty liver, a score of 3 to 4 correlates with moderate nonalcoholic fatty liver, and a score N5 correlates with NASH. Data are expressed as mean±S.E.M., n=6 ineach group. *Pb.05, **Pb.01 vs. NL. $Pb.05 vs. SL. #Pb.05, ##Pb.01 vs. all other groups.

1113C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

programmed, and that overfeeding in early life may predispose anorganism to an early onset and aggravation of NAFLD with exposureto a HF diet later in life.

The roles of lipid metabolic enzymes involved in hepatic fatty acidintake (LPL, L-FABP), synthesis (ACC), oxidation (CPT1), and output(MTP) and their importance in NAFLD development are welldocumented [18]. A major question at issue in the present studywas to ascertain whether exposure to overfeeding in early life wouldcompromise the liver’s metabolic capacity to deal with high levels ofdietary fat ingested later in life, resulting in increasing hepatic lipidderangement and progression to a NAFLD-like phenotype. Asexpected, we found that SL rats had increased mRNA expressionand enzyme activity of hepatic ACC, which persisted into earlyadulthood. ACC gene expression and activity are markedly induced byhigh fat/carbohydrate feeding in animals and result in increasedadiposity and hepatic TG content [21,59]. A high-TG maternal milk ofdams whose litters were reduced during lactation was reported inprevious study [15]. So in our study, SL rearing may underlieincreased hepatic fatty acid synthesis capacity at weaning and makeSL rats more prone to liver lipogenesis and TG accumulation followinga post-weaning HF diet. Moreover, we reported that SL-HF rats show

signs of NAFLD at the end of adolescence. Conversely, NL rearing wasresistant to HF diet–induced ACC expression, similar to the reportedresistance to the HF diet in the female progeny of obese mice fed acontrol diet during the periconceptual, gestation, and lactationperiods [60].

In the present study, MTP and CPT1 gene expression wereunchanged in SL rats during lactation, which implies that the rate-limiting enzymes involved in fatty acid oxidation and export areunresponsive to SL rearing. The transient elevation (at W10) ofL-FABP and CPT-1 mRNA expression in NL-HF rats might consequent-ly maintain lipid homeostasis by increasing lipid oxidation (CPT1) tocompensate for the excessive intake of lipid (L-FABP) in the HF diet.However, CPT1 and MTP mRNA expression was decreased inadulthood (W16), which corresponded to NAFLD development inNL-HF rats, and more serious NAFLD in SL-HF rats, consistent with aprevious study in which the development of fatty liver induced byorotic acid was caused mainly by inhibition of CPT1 and MTP [28].

Long-term HF feeding often impairs the insulin sensitivity ofperipheral tissues and affects insulin’s actions on lipid metabolism inmany respects [61]. CPT1 and MTP are negatively regulated by insulin[62], which is thought to explain the inhibition of lipid oxidation and

Fig. 5. Hepatic gene expression of rate-limiting enzymes in lipid metabolism in rats from W3 to W16. (A) Acetyl-CoA carboxylase (ACC) mRNA expression. (B) ACC enzyme activity.(C) Lipoprotein lipase (LPL) mRNA expression. (D) Liver-type fatty acid-binding protein (L-FABP) mRNA expression. (E) Carnitine palmitoyltransferase1 (CPT1) mRNA expression.(F) Microsomal triglyceride transfer protein (MTP)mRNA expression. Data are expressed asmean±S.E.M., n=6–9 in each group. *Pb.05, **Pb.01 vs. NL. $Pb.05 vs. SL. #Pb.05, ##Pb.01 vs.all other groups. Note: At W3 rats have not yet been assigned to any diet.

1114 C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

export in insulin resistance [63,64]. In the present study, inhibition ofCPT1 expression occurred also in SL rats along with progressinginsulin resistance. Similarly, LPLmRNA expression in SL rats increasedduring lactation but decreased at the end of the experimental period,indicating that regulation of LPL might be affected by many factors,such as dietary intake and insulin levels [65].

Fig. 6. Hepatic mRNA and protein expression of transcriptional factors regulating lipid metabolimRNA expression. (B) Peroxisome proliferator activated receptor α (PPARα) mRNA expression#Pb.05, ##Pb.01 vs. all other groups. (C) Representative western blots of SREBP-1c, PPARα, an

Taken together, the developmental ontogeny of enzymes in lipidmetabolismof the liver could reflect the pathological process ofmetabolicdisease in SL rats. The neonatal overfeeding and post-weaning HF dietcould developmentally and biochemically “prime” hepatic lipid synthesispathways associatedwith the onset of NAFLD. Impaired hepatic fatty acidoxidation and export subsequently results in severe steatosis.

sm in rats fromW3 toW16. (A) Sterol response element binding protein-1c (SREBP-1c). Data are expressed as mean±S.E.M., n=6–9 in each group. *Pb.05 vs. NL. $Pb.05 vs. SL.d β-actin.

1115C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

Lipogenesis is regulated by transcription factors, particularlySREBP-1c. A high expression of SREBP-1c increases the hepaticexpression of all lipogenic enzymes [66], and mice overexpressingSREBP-1c develop insulin resistance, diabetes, and fatty liver [67]. Inthe present study, SREBP-1c mRNA and protein expression increasedin conjunction with ACC in SL and SL-HF rats, suggesting that theprocess of hepatic lipogenesis might be regulated by SREBP-1c.Previous reports have confirmed that CPT1, MTP, and L-FABP areregulated by PPARα [30,31,68]. Mice with a defect in PPARα (PPARα(−/−)) have decreased fatty acid oxidation and an aggravatedsteatosis [69], and PPARα may regulate mitochondrial biogenesis viaperoxisome proliferator-activated receptor-γ, coactivator-1α [70]. Inour study, PPARα mRNA expression was decreased in conjunctionwith CPT1 and MTP in SL-HF rats but not in NL-HF rats, suggestingthat the downregulation of PPARα could explain the decrease inhepatic fatty acid oxidation. In addition to PPARα, other factors suchas adenine mononucleotide protein kinase [71,72] or insulin levels[65]may be involved in activation of pathways resulting in hepaticsteatosis in rat.

Worth noting is that exposure to SL rearing alone induced increasedACC and decreased CPT1 mRNA expression, but without hepaticsteatosis at the end of the experiment (W16). The lack of a NAFLDphenotype in these rats is likely the result of a short observation period.Inmice, Bruce et al. observed that offspring of dams fed the HF diet andthat in turn were fed a control diet after weaning developed NAFLD byage 30 weeks but not by age 15 weeks [11].

In conclusion, neonatal overfeeding induced by SL rearingincreased vulnerability to the HF diet from post-suckling to adulthoodin rats and promoted early onset and exaggeration of HF diet–inducedNAFLD. The persistent increase in hepatic ACC activation induced by SLrearing might be an important mechanism in the development andprogression of NAFLD, possibly regulated by SREBP-1c. Further studiesfor additional insight into the molecular pathways leading to NAFLDarewarranted. Finally, the results of this study emphasize that healthyeating habits should be encouraged, especially early in childhood.

Acknowledgments

This work was supported by the National Basic Research Programof China (973 Program) (2013CB530604) and the National NaturalScience Foundation of China (81273064). We thank Jianping Wang(Department of Clinical Laboratories, the Second Affiliated Hospital ofNanjing Medical University) and Yifan Li (Isotope Research Center,Nanjing Medical University) for technical assistance.

References

[1] Clark JM, Brancati FL, Diehl AM. The prevalence and etiology of elevatedaminotransferase levels in the United States. Am J Gastroenterol 2003;98:960–7.

[2] Angulo P. Obesity and nonalcoholic fatty liver disease. Nutr Rev 2007;65:S57–63.[3] Sheth SG, Gordon FD, Chopra S. Nonalcoholic steatohepatitis. Ann Intern Med

1997;126:137–45.[4] Ludwig J, Viggiano TR, McGill DB, Oh BJ. Nonalcoholic steatohepatitis: Mayo Clinic

experiences with a hitherto unnamed disease. Mayo Clin Proc 1980;55:434–8.[5] Symonds ME, Sebert SP, Hyatt MA, Budge H. Nutritional programming of the

metabolic syndrome. Nat Rev Endocrinol 2009;5:604–10.[6] Feldstein AE, Charatcharoenwitthaya P, Treeprasertsuk S, Benson JT, Enders FB,

Angulo P. The natural history of non-alcoholic fatty liver disease in children: afollow-up study for up to 20 years. Gut 2009;58:1538–44.

[7] Ong KK, Loos RJ. Rapid infancy weight gain and subsequent obesity: systematicreviews and hopeful suggestions. Acta Paediatr 2006;95:904–8.

[8] Rolland-Cachera MF, Deheeger M, Maillot M, Bellisle F. Early adiposity rebound:causes and consequences for obesity in children and adults. Int J Obes (Lond)2006;30(Suppl. 4):S11–7.

[9] Zhang J, Wang C, Terroni PL, Cagampang FR, Hanson M, Byrne CD. High-unsaturated-fat, high-protein, and low-carbohydrate diet during pregnancy andlactation modulates hepatic lipid metabolism in female adult offspring. Am JPhysiol Regul Integr Comp Physiol 2005;288:R112–8.

[10] Erhuma A, Salter AM, Sculley DV, Langley-Evans SC, Bennett AJ. Prenatal exposureto a low-protein diet programs disordered regulation of lipid metabolism in theaging rat. Am J Physiol Endocrinol Metab 2007;292:E1702–14.

[11] Bruce KD, Cagampang FR, Argenton M, Zhang J, Ethirajan PL, Burdge GC, et al.Maternal high-fat feeding primes steatohepatitis in adult mice offspring,involving mitochondrial dysfunction and altered lipogenesis gene expression.Hepatology 2009;50:1796–808.

[12] Koletzko B, Brands B, Demmelmair H. The Early Nutrition Programming Project(EARNEST): 5 y of successful multidisciplinary collaborative research. Am J ClinNutr 2011;94:1749S–53S.

[13] Sayer AA, Syddall HE, Dennison EM, Gilbody HJ, Duggleby SL, Cooper C, et al. Birthweight, weight at 1 y of age, and body composition in older men: findings fromthe Hertfordshire Cohort Study. Am J Clin Nutr 2004;80:199–203.

[14] Kostolansky IT, Angel JF. Effects of litter size and diet composition on thedevelopment of some lipogenic enzymes in the liver and brown adipose tissue ofthe rat. J Nutr 1989;119:1709–15.

[15] Cunha AC, Pereira RO, Pereira MJ, Soares VM, Martins MR, Teixeira MT, et al. Long-term effects of overfeeding during lactation on insulin secretion–the role of GLUT-2.J Nutr Biochem 2009;20:435–42.

[16] Moreira AS, Teixeira TM, Da SOF, Pereira RO, de Oliveira SG, Garcia DSE, et al. Leftventricular hypertrophy induced by overnutrition early in life. Nutr MetabCardiovasc Dis 2009;19:805–10.

[17] Hou M, Ji C, Wang J, Liu Y, Sun B, Guo M, et al. The effects of dietary fatty acidcomposition in the post-sucking period on metabolic alterations in adulthood:can omega3 polyunsaturated fatty acids prevent adverse programming outcomes?J Endocrinol 2012;215:119–27.

[18] Musso G, Gambino R, Cassader M. Recent insights into hepatic lipid metabolism innon-alcoholic fatty liver disease (NAFLD). Prog Lipid Res 2009;48:1–26.

[19] Feng AJ, Chen DF. The expression and the significance of L-FABP and FATP4 in thedevelopment of nonalcoholic fatty liver disease in rats. Zhonghua Gan Zang BingZa Zhi 2005;13:776–9.

[20] Pardina E, Baena-Fustegueras JA, Llamas R, Catalan R, Galard R, Lecube A, et al.Lipoprotein lipase expression in livers of morbidly obese patients could beresponsible for liver steatosis. Obes Surg 2009;19:608–16.

[21] Kim KH. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu RevNutr 1997;17:77–99.

[22] Ginsberg HN, Zhang YL, Hernandez-Ono A. Regulation of plasma triglycerides ininsulin resistance and diabetes. Arch Med Res 2005;36:232–40.

[23] Eaton S. Control ofmitochondrial beta-oxidation flux. Prog Lipid Res 2002;41:197–239.[24] KohjimaM, Enjoji M, Higuchi N, KatoM, Kotoh K, Yoshimoto T, et al. Re-evaluation

of fatty acid metabolism-related gene expression in nonalcoholic fatty liverdisease. Int J Mol Med 2007;20:351–8.

[25] Yang ZH, Miyahara H, Takeo J, Katayama M. Diet high in fat and sucrose inducesrapid onset of obesity-related metabolic syndrome partly through rapid responseof genes involved in lipogenesis, insulin signalling and inflammation in mice.Diabetol Metab Syndr 2012;4:32.

[26] Koteish A, Diehl AM. Animal models of steatosis. Semin Liver Dis 2001;21:89–104.[27] den Boer M, Voshol PJ, Kuipers F, Havekes LM, Romijn JA. Hepatic steatosis: a

mediator of the metabolic syndrome. Lessons from animal models. ArteriosclerThromb Vasc Biol 2004;24:644–9.

[28] Wang YM, Hu XQ, Xue Y, Li ZJ, Yanagita T, Xue CH. Study on possible mechanism oforotic acid-induced fatty liver in rats. Nutrition 2011;27:571–5.

[29] Zhu L, Baker SS, Liu W, Tao MH, Patel R, Nowak NJ, et al. Lipid in the livers ofadolescents with nonalcoholic steatohepatitis: combined effects of pathways onsteatosis. Metabolism 2011;60:1001–11.

[30] Andrews DB, Schwimmer JB, Lavine JE. Fast break on the fat brake: mechanism ofperoxisome proliferator-activated receptor-delta regulation of lipid accumulationin hepatocytes. Hepatology 2008;48:355–7.

[31] Spann NJ, Kang S, Li AC, Chen AZ, Newberry EP, Davidson NO, et al. Coordinatetranscriptional repression of liver fatty acid-binding protein and microsomaltriglyceride transfer protein blocks hepatic very low density lipoprotein secretionwithout hepatosteatosis. J Biol Chem 2006;281:33066–77.

[32] Kohjima M, Higuchi N, Kato M, Kotoh K, Yoshimoto T, Fujino T, et al. SREBP-1c,regulated by the insulin and AMPK signaling pathways, plays a role innonalcoholic fatty liver disease. Int J Mol Med 2008;21:507–11.

[33] Svegliati-Baroni G, Candelaresi C, Saccomanno S, Ferretti G, Bachetti T, MarzioniM, et al. Amodel of insulin resistance and nonalcoholic steatohepatitis in rats: roleof peroxisome proliferator-activated receptor-alpha and n-3 polyunsaturatedfatty acid treatment on liver injury. Am J Pathol 2006;169:846–60.

[34] Lucas A. Programming by early nutrition: an experimental approach. J Nutr 1998;128:401S–6S.

[35] Souza-Mello V, Mandarim-de-Lacerda CA, Aguila MB. Hepatic structural alterationin adult programmed offspring (severematernal protein restriction) is aggravatedby post-weaning high-fat diet. Br J Nutr 2007;98:1159–69.

[36] Lillycrop KA, Phillips ES, Jackson AA, Hanson MA, Burdge GC. Dietary proteinrestriction of pregnant rats induces and folic acid supplementation preventsepigenetic modification of hepatic gene expression in the offspring. J Nutr 2005;135:1382–6.

[37] Mazzucco MB, Higa R, Capobianco E, Kurtz M, Jawerbaum A, White V. Saturatedfat-rich diet increases fetal lipids and modulates LPL and leptin receptorexpression in rat placentas. J Endocrinol 2013;217:303–15.

[38] Bayol SA, Simbi BH, Fowkes RC, Stickland NC. A maternal “junk food” diet inpregnancy and lactation promotes nonalcoholic Fatty liver disease in rat offspring.Endocrinology 2010;151:1451–61.

1116 C. Ji et al. / Journal of Nutritional Biochemistry 25 (2014) 1108–1116

[39] Boullu-Ciocca S, Achard V, Tassistro V, Dutour A, Grino M. Postnatal programmingof glucocorticoid metabolism in rats modulates high-fat diet-induced regulationof visceral adipose tissue glucocorticoid exposure and sensitivity and adiponectinand proinflammatory adipokines gene expression in adulthood. Diabetes 2008;57:669–77.

[40] Velkoska E, Cole TJ, Dean RG, Burrell LM, Morris MJ. Early undernutrition leads tolong-lasting reductions in body weight and adiposity whereas increased intakeincreases cardiac fibrosis in male rats. J Nutr 2008;138:1622–7.

[41] Rodrigues AL, de Moura EG, Passos MC, Dutra SC, Lisboa PC. Postnatal earlyovernutrition changes the leptin signalling pathway in the hypothalamic-pituitary-thyroid axis of young and adult rats. J Physiol 2009;587:2647–61.

[42] Chen H, Simar D, Lambert K, Mercier J, Morris MJ. Maternal and postnatalovernutrition differentially impact appetite regulators and fuel metabolism.Endocrinology 2008;149:5348–56.

[43] Wootton RJ, Evans GW, Mills L. Annual cycle in female 3-spined sticklebacks(Gasterosteus aculeatus L.) from an upland and lowland population. J Fish Biol1978;12:331–43.

[44] Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, et al.Design and validation of a histological scoring system for nonalcoholic fatty liverdisease. Hepatology 2005;41:1313–21.

[45] Alberts AW, Vagelos PR. Acetyl CoA carboxylase. I. Requirement for two proteinfractions. Proc Natl Acad Sci U S A 1968;59:561–8.

[46] Inoue H, Lowenstein JM. Acetyl coenzyme A carboxylase from rat liver. EC 6.4.1.2acetyl-CoA: carbon dioxide ligase (ADP). Methods Enzymol 1975;35:3–11.

[47] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Proteinmeasurement with the Folinphenol reagent. J Biol Chem 1951;193:265–75.

[48] Boullu-Ciocca S, Dutour A, Guillaume V, Achard V, Oliver C, Grino M. Postnataldiet-induced obesity in rats upregulates systemic and adipose tissue glucocorti-coid metabolism during development and in adulthood: its relationship with themetabolic syndrome. Diabetes 2005;54:197–203.

[49] Samuelsson AM, Matthews PA, Argenton M, Christie MR, McConnell JM, JansenEH, et al. Diet-induced obesity in female mice leads to offspring hyperphagia,adiposity, hypertension, and insulin resistance: a novel murine model ofdevelopmental programming. Hypertension 2008;51:383–92.

[50] Jones HN, Woollett LA, Barbour N, Prasad PD, Powell TL, Jansson T. High-fat dietbefore and during pregnancy causes marked up-regulation of placental nutrienttransport and fetal overgrowth in C57/BL6 mice. Faseb J 2009;23:271–8.

[51] Yajnik CS, Deshmukh US. Maternal nutrition, intrauterine programming andconsequential risks in the offspring. Rev Endocr Metab Disord 2008;9:203–11.

[52] Elahi MM, Cagampang FR, Mukhtar D, Anthony FW, Ohri SK, Hanson MA. Long-term maternal high-fat feeding from weaning through pregnancy and lactationpredisposes offspring to hypertension, raised plasma lipids and fatty liver in mice.Br J Nutr 2009;102:514–9.

[53] Symposium on the childhood environment and adult disease. Ciba Foundation,London, 15-17 May 1990, 156. , Ciba Found Symp; 1991. p. 1–243.

[54] Desai M, Crowther NJ, Lucas A, Hales CN. Organ-selective growth in the offspringof protein-restricted mothers. Br J Nutr 1996;76:591–603.

[55] Desai M, Gayle D, Babu J, Ross MG. Permanent reduction in heart and kidney organgrowth in offspring of undernourished rat dams. Am J Obstet Gynecol 2005;193:1224–32.

[56] Morgan K, Uyuni A, Nandgiri G, Mao L, Castaneda L, Kathirvel E, et al. Alteredexpression of transcription factors and genes regulating lipogenesis in liver and

adipose tissue of mice with high fat diet-induced obesity and nonalcoholic fattyliver disease. Eur J Gastroenterol Hepatol 2008;20:843–54.

[57] Tamashiro KL, Moran TH. Perinatal environment and its influences on metabolicprogramming of offspring. Physiol Behav 2010;100:560–6.

[58] Minana-Solis MC, Escobar C. Increased susceptibility to metabolic alterationsin young adult females exposed to early malnutrition. Int J Biol Sci 2007;3:12–9.

[59] Ryu MH, Cha YS. The effects of a high-fat or high-sucrose diet on serum lipidprofiles, hepatic acyl-CoA synthetase, carnitine palmitoyltransferase-I, and theacetyl-CoA carboxylase mRNA levels in rats. J Biochem Mol Biol 2003;36:312–8.

[60] Gallou-Kabani C, Vige A, Gross MS, Boileau C, Rabes JP, Fruchart-Najib J, et al.Resistance to high-fat diet in the female progeny of obese mice fed a control dietduring the periconceptual, gestation, and lactation periods. Am J PhysiolEndocrinol Metab 2007;292:E1095–100.

[61] Buettner R, Scholmerich J, Bollheimer LC. High-fat diets: modeling the metabolicdisorders of human obesity in rodents. Obesity (Silver Spring) 2007;15:798–808.

[62] Hagan DL, Kienzle B, Jamil H, Hariharan N. Transcriptional regulation of humanand hamster microsomal triglyceride transfer protein genes. Cell type-specificexpression and response to metabolic regulators. J Biol Chem 1994;269:28737–44.

[63] Adeli K, Taghibiglou C, Van Iderstine SC, Lewis GF. Mechanisms of hepatic verylow-density lipoprotein overproduction in insulin resistance. Trends CardiovascMed 2001;11:170–6.

[64] Qiu W, Taghibiglou C, Avramoglu RK, Van Iderstine SC, Naples M, Ashrafpour H,et al. Oleate-mediated stimulation of microsomal triglyceride transfer protein(MTP) gene promoter: implications for hepatic MTP overexpression in insulinresistance. Biochemistry-Us 2005;44:3041–9.

[65] Choi SH, Ginsberg HN. Increased very low density lipoprotein (VLDL) secretion,hepatic steatosis, and insulin resistance. Trends Endocrinol Metab 2011;22:353–63.

[66] Ahmed MH, Byrne CD. Modulation of sterol regulatory element binding proteins(SREBPs) as potential treatments for non-alcoholic fatty liver disease (NAFLD).Drug Discov Today 2007;12:740–7.

[67] Shimomura I, Hammer RE, Richardson JA, Ikemoto S, Bashmakov Y, Goldstein JL,et al. Insulin resistance and diabetes mellitus in transgenic mice expressingnuclear SREBP-1c in adipose tissue: model for congenital generalized lipodystro-phy. Genes Dev 1998;12:3182–94.

[68] Furuhashi M, Hotamisligil GS. Fatty acid-binding proteins: role in metabolicdiseases and potential as drug targets. Nat Rev Drug Discov 2008;7:489–503.

[69] Hashimoto T, Cook WS, Qi C, Yeldandi AV, Reddy JK, Rao MS. Defect inperoxisome proliferator-activated receptor alpha-inducible fatty acid oxidationdetermines the severity of hepatic steatosis in response to fasting. J Biol Chem2000;275:28918–28.

[70] Wang S, Kamat A, Pergola P, Swamy A, Tio F, Cusi K. Metabolic factors in thedevelopment of hepatic steatosis and altered mitochondrial gene expression invivo. Metabolism 2011;60:1090–9.

[71] Hardie DG. The AMP-activated protein kinase pathway–new players upstreamand downstream. J Cell Sci 2004;117:5479–87.

[72] Ix JH, Sharma K. Mechanisms linking obesity, chronic kidney disease, and fattyliver disease: the roles of fetuin-A, adiponectin, and AMPK. J Am Soc Nephrol2010;21:406–12.