post newspaper for 16th of may, 2015

The POST is local and relevant with the highest readership in the Western Suburbs. See www.postnewspapers.com.auEach week 51,990 copies of the POST are distributed, reaching every household and business in the western suburbs.

These suburbs are shown on the map on page 2. Extra copies are delivered to other selected riverside suburbs. Registered by Australia Post publication No. WBF1752.

Hereswherewe go

Phone us on 9383 7777Bexleys Real Estate69 Grantham Street, [email protected] www.bexleys.com.au

Vol 42 No.20 Ph. 9381 3088, 276 Onslow Road, Shenton Park, 6008. www.postnewspapers.com.au May 16, 2015

CambridgeCheck out Check out this weeks this weeks

TimeOutTimeOut See page 63 See page 63

50% 50%

more readers *

in the western suburbs * see page 2

Close shave for loud hairdresserShouting and other noise from

a home hair salon in a quiet Subiaco street has brought a neighbour to tears.

At times I have chosen to remain at work because I found that to be in a more relaxing place than my home, Brooke Milianku, of Raphael Street, told a council meeting this week.

I have often cried on the way

home from work as I usually return to fi nd the business in full operation.

This has resulted in high levels of stress that makes me visibly shake.

Her house has a common wall with that of Nicole Hanrahan, who Ms Milianku said had ad-vertised her salon open until 9pm Monday to Friday, closing earlier on weekends.

The salon was operating with-

out a permit.Ms Milianku told the councils

development services committee the salon had badly disrupted her life for several years.

Due to an adjoining wall, noise generated from this busi-ness can be heard in every room of my house, she said.

This includes water pipes, hair dryers, people entering and exiting while conversation takes place over the top of this loud

working environment.Conversations are shouted

rather than spoken.Some Subiaco councillors at

the meeting agreed, including Leanne Potter, who said she had experienced raised voices in hairdressing salons:

I know I shout, and so does my hairdresser at me, when the dryer is running. How do you have a quiet amenity with people shouting next door?

The salon idea may work with a free-standing home or if it were a quiet beauty therapy clinic where you just massaged faces, but this is where hair dry-ers are going, she said.

Councillors narrowly voted to allow the business to continue for a trial period of 12 months, closing at 7pm during the week and 5pm on Saturdays.

Stewart Newsome and Sandra Saunders are set-ting off on the fi nal leg of a journey they started 25 years ago.

In 1989, as newlyweds in Yorkshire, UK, they decided to travel the world on a motor-

bike but when they arrived in Australia, they could not resist it.

When Sandra known to everyone as Sam got a job with the University of WA, they decided to settle here.

Now they are both retired and their two daughters have grown up, so they have dusted

off the bike to set off again.We are using the same BMW

trail bike, Stewart said.It has been stored in the ga-

rage at their Nedlands home.Stewart has rebuilt the bikes

engine and he and Sam are heading for South America and Alaska.

Please turn to page 76

By LINDA CALLAGHAN

Withers vote under fire

Stewart and Sam back in the saddle

Mayor Simon Withers should have considered abstaining from voting on Cambridge in-fi ll because it would increase the value of his own home, according to legal advice ob-tained by 22 residents.

The advice has also identifi ed an extra 1868 blocks in City Beach and Floreat that would be added to the pool of those eligible for infi ll.

Had Mr Withers abstained from voting to initiate the changes, the advice says, there would not have been a quorum enough voters for the con-troversial infi ll changes to be progressed.

Alternatively, all councillors, including four who abstained, should have been allowed to vote because they had an interest in common with all Cambridge land owners, the advice said.

But Mr Withers has come out swinging, saying that the advice is wrong on several counts.

Its the same NIMBY non-sense that weve already heard from the people they are repre-senting, written on a law fi rms stationery, he said.

The setback changes said to add value to his and other

councillors property were already law, passed in August last year, and were unaffected by Amendment 31, he said.

He said the lawyers had had a bet each way in saying both that he should not have voted and that he and all councillors had an interest in common and all should have voted.

Mr Withers added that the 5% concession cited by the lawyers for calculating the extra 1868 blocks applied only to subdi-visions, while Cambridge only proposed allowing additional use, not subdivision.

The advice says house set-backs are set at 7.5m in City Beach and 9m in Floreat.

This would be changed to 6m in both suburbs, and increase the plot ratio available for Mr Withers block, the advice says.

The shorter distance from the front fence where building is permitted would signifi cantly increase the available plot ratio for Mr Withers property and

Unheard evidence Page 7

Rayney

By BRET CHRISTIAN


By LLOYD GORMAN


On the road again Stewart Newsome and Sam Saunders are using the same bike to fi nish a trip they started 25 years ago. INSET: The couple just before they

left Yorkshire, England. Photo: Billie Fairclough

POST, May 16, 2015

Please send letters to The Editor, 276 Onslow Road, Shenton Park 6008; email to [email protected]; or fax to The Editor at 9388 2258. Full name and address should be given, and thereshould be a daytime phone number for verification. Boring letters, or those longer than 300 words, will be cut. Email letters should carry the writers full residential address. Deadline is noon Wednesday.Letters to the POST Please email letters to [email protected]; or SMS to 0429 558 001; or mail to: The Editor, 276 Onslow Road, Shenton Park 6008. We require every letter intended for publication to include the writers full name and address plus daytime phone number for verication. Boring letters, and those longer than 300 words will be cut. Deadline is noon Wednesday.

More letters pages 12, 14

So much for a quiet life in Mosman Park

Well, well, we had this silly idea, a few years ago, that it would be good to live for a while like the rich and famous in the western suburbs.

So we decided to look for a place in our favourite spot in Mosman Park an amazing view among WAs most expensive streets and properties.

What we have found is that we live in a rolling construction site with double articulated trucks taking in material and taking out demolition rubble and dirt.

We have dust all over the cars, cranes a blot on the landscape one was there for 18 months and was bright yellow and as big as a CBD crane and noise from rock breakers, compactors, trucks, and cranes.

Then on Bay View Terrace and into Owston Street, there are also major constructions with roadblocks and hazards.

One fi nishes and the house next to it starts!Our pool got fi lled with brick dust after a

contractor thought the best way to get rid of it was to use an industrial blower with the wind behind him and blow it towards the neighbours.

As soon as kids are done with schools, we are gone!

Unless we are hit by a major recession, this will just be an ongoing situation.

One of our older kids built in a new develop-ing suburb and has less noise and dust.

So we think we will go back to cheaper and, like before, go for an occasional drive or walk to take in the view especially as we lost our pension this week.

Steve S, Mosman Park (Please dont publish my name and address I fear a

local Anglo-Saxon Jihad may ensue.)

Simple to let residents stay in Subi Any number of simple changes to

the proposed City of Perth bound-ary would still allow UWA and QEII to be part of the City of Perth while allowing the 3000 residents to remain part of the western suburb urban community.

Why include us in the City of Perth?

If Nedlands MP Bill Marmion considers there is such a compelling case for this change, then I chal-lenge him to for once explain the case and put to a vote a simple choice of the Subiaco South ward becoming part of the City of Perth medical precinct or remaining part of the western suburbs, either in Subiaco or transferred to the Nedlands council area.

Doorknock polling by a local member, as cited in the POST (Pressure on to stop Hollywood takeover, May 9), is no substitute for a democratic vote.

If the residents are denied a vote we can only assume who is complicit in turning a prime single residential area into a medical precinct plaything for UWA and QEII.

Some residents accept the need for change and higher-density housing, but most are appalled by ineffi cient land use and planning by both UWA and Subiaco council.

There is an urgent need to engage sensible long-term town planning at a state level and a democratic imperative for local and state governments to take electors along with a well-considered inclusive process, rather than allowing bu-reaucrats to ride roughshod over residents.

I look forward to our local rep-resentatives taking on the initia-tive.

There is no excuse for poor plan-ning and communication followed by an undemocratic process.

Our local representatives are not responsible for this mess, but surely hold keys to a better solution.

Great, inclusive and inspiring new ideas that are well communicated are more likely to win peoples sup-port and, of course, their votes.

Dont take our 3000 votes for granted.

John CloutHardy Road, Nedlands

UWA has seen the lightThe obvious bias in the government proposal to

fund a Bjorn Lomborg-style consensus centre at UWA was precisely why community, academic and student opposition was so strong.

[The university has now shelved plans for the centre because of widespread opposition, though federal Education Minister Christopher Pyne says it will be funded and established at another Australian university.]

How shocking that our federal government tried to infl uence with a $4million carrot setting up a think tank linked to Professor Lomborg.

I am tired of the blatant attempts to suppress credible alternative views to LNP government proposals and deletions.

I agree with George Crisp (Lomborgs is not a dissenting view, Letters, POST, May 9), and bravo Bruce Mackintosh (Government inhibits debate, Letters, same issue) for reminding us of the swift abolition of the independent Climate Commission, almost immediately after the Abbott government gained offi ce in September 2013.

One professor with a record of questionable scientifi c evidence gains federal government ap-proval; half a dozen highly qualifi ed academics, business experts and scientists are deleted.

I am relieved the management at UWA has seen the light.

Carole PetersMurchison Street, Shenton Park

Report, page19

Democracy is engaging with the people, as Canning council is now doing with regard to ward boundaries, councillors and other issues affecting residents.

This is unlike the undemocratic forced amalgamation shambles that was being promoted by the Barnett government, which fi nally

surrendered to common sense after expensive and fi erce opposition by concerned residents.

Thank you to every person in all the councils who attended meet-ings, wrote letters, signed petitions and spoke against undemocratic amalgamations.

William BoothQueen Street, Bentley

Lessons in democracy

HHave you tried

our famous

stir-fries?

Delicious New

dishes soonMOSMAN PARK

17 Lochee Street Tel 9384 5697 7am - 8.30pm Mon to Sun

NEDLANDS25A Hampden Road Tel 9386 1661

9am - 3pm Mon to Fri HOT MEALS 9am to 2pm

City Beach

Cottesloe Beach

Matilda Bay

Swan River

Fresh Water

Bay

North Fremantle

Perth CBD

Wembley Downs

Mount Claremont

Wembley

Subiaco

Jolimont Daglish

Floreat

Hackett Estate

HollywooddddCrawley

Shenton Park

Nedlands

Dalkeith

ClaremontCottesloe

FresPeppermint Grove

Mosman Park

Swanbourne

ttt

West Leederville

West Perth

City Beach

Woodlands

Churchlands

www.postnewspapers.com.au

Every household and business in this area has a POST delivered free each week.

Bulk drops are also made to other riverside suburbs. The POST delivers 51,990 newspapers each week.

The POST is read each week by 50% more readers than any other

local publication in the western suburbs.*

News and advertisements are published in all four editions of the POST. Contact us: for news and all advertising enquiries phone 9381 3088, fax 9388 2258.

Classieds: can be faxed, or lodged via our secure website. See the inside back page for details. Email: [email protected]

* Roy Morgan Research September 2014

er 276 Onslow Rd, Shenton Park

Heres where we go

DUNG HOWEED FREE

Sheep Manure80lt bags $11 ea

or 10 for $99Other Manure &

Potting Mixes/Mulch

40lt bags $7.70 eaFREE DELIVERY

Ron0423 590 015 The POST delivers

ACTONREAL ESTATE

WWW.ACTON.COM.AU

ACTON Real Estate is social!

Follow us on Instagram, Twitter and Facebook to see our lighter side.

POST, May 16, 2015 Page 3

Run along for a good timeLake Claremont is the

place for amazing races.Claremont council has or-

ganised a fun run at the lake this Sunday.

O n e o f t h e r u n n e r s , Charlotte Baxter (11), has already won a race there.

My friend Annabelle had her 11th birthday party here, Charlotte said.

As part of the party they had an amazing race.

It started at the cubby house and you were asked

questions: if you got them right you could carry on.

Charlotte and her friend Gigi won the 5km race.

For entrants and spectators at this weekends race there will be organic coffee and foods available, trampolines, and free massages.

Registering for either the 5km walk or run and the 10km run is free and can be done on the day or online.

Kids, dogs and people with prams are welcome.

Each entrantt will receive a

goody bag and prizes on offer include Fitbits and sports vouchers.

Meet at the end of Stirling Road; the running starts at 8am.

The MCs will be former West Coast Eagle Andrew E m b l e y a n d h i s w i f e , Rayne.

Funds from the fun run will support Telethon.

For more information, ring Amy Celisano 9285 4300, [email protected].

Family fun Gracie, left, Sarah, Ben, and Charlotte will be running at Lake Claremont this weekend. Photo: Paul McGovern

Radiowaves kill car, house locks

Rogue radio emissions from a Claremont clinic are locking neighbours out of their homes and cars.

Claremont residents say the interference from Radiowave Therapy Clinic jams their house locks and sometimes means they cant get into or start their cars.

Locals who complained to the POST live in residential Vaucluse Avenue and Langsford Street, be-hind the clinic that faces Stirling Highway.

The council says the clinic de-vices operate on the same radio frequency as car fobs, keyless locks and remote gate openers.

A clinic spokeman said its machinery was safe but did not have any ideas on how to help with the problem.

Its driving me absolutely spare, said one woman, whose home in Vaucluse Avenue is 55m from the clinic.

I have to park out the front of my house as I have been caught too many times, unable to get my car out of the garage and drive-way gates.

A worker at the clinic has even offered me the use of her car to collect my child.

A man in Langsford Street said his car and gate were also affected.

If its turning devices off, is it having some effect on people? he said.

Clinic manager Tim Hall said Radiowave had been operating for 10 years.

Shortly after the facility was fi rst set up, as required, we had an inde-

pendent survey performed by the Australian Communications and Media Authority, Mr Hall said.

[This was] to ensure the clinic operated within the guidelines for maximum level of radiowave emissions as required to maintain public health and safety.

The levels were found to be well within the limits for safe public exposure.

Mr Hall said clinic engineers regularly tested equipment to ensure it complied.

There is also an emission alarm system within the building, which is a third level of precau-tion, he said.

Mr Hall did not respond to a suggestion that residents be notified when his equipment was used.

The Vaucluse Avenue woman said she felt she had got the run-around from Claremont council and the state government.

Claremont approved the clinic 10 years ago.

The council spokeswoman, Liz Ledger, said: We have advised that the radio frequency matters are not something we approve, monitor or control, as this is within the carriage of the various state authorities [Department of Health, Department of Communications].

To assist, we have provided these contact details to the resident.

The Radiation Safety Unit [Health] advised that the actual frequency used at the clinic is very safe for human use [same frequency as the car fobs and garage door openers] which is why there may be interference.

By DAVID COHEN

Subiaco residents appealed to a Sydney developer this week not to allow their 110-year-old heritage homes to crumble while his fi rm builds a 16-sto-rey tower on their doorstep.

Catherine Street resident Ines Janca, representing the 16 owners of the terrace homes

known as Bishops Row near the Subiaco Pavilion market site, spoke for 15 minutes at a closed-door mediation at the State Administrative Tribunal on Wednesday.

She was joined by Peter Farley, who also owns one of the homes that are on Subiaco coun-cil and state heritage lists.

Ms Janca said the residents believed the developer was fi ghting approval conditions that meant his fi rm had to pro-vide dilapidation reports and do repairs when construction-related damage occurred and not at a later date.

The closed mediation

Days challenge kept secret


Radiowaves from this Claremont clinic a ect nearby residents.

WEST to WESTELECTRICAL

EC

110

89WHO WE ARE...rExpert ElectriciansrUp front pricing per jobrAlways on timerFully Insured & licensedrDomestic, Commercial, Industrial

WHAT WE DO...rFull & Part rewiresrOverhead to Underground SupplyrFault finding & repairsrMaintenance & upgradesrLandlord Safety reportsrRCDs & Surge ProtectionrTV, Telephone & Data

OUR SPECIALS...END OF FINANCIAL YEAR

LED LIGHT SPECIALUpgrade your house to led lighting Save $$$ on

your power bill at only $90 plus GST per light (min 4)r '3&&FBSUITUBLFJOTUBMMBUJPOVQHSBEFPS

replacement with every Fuse switch board upgrader $PNQMJNFOUBSZ'SFF3$%UFTUXJUIFWFSZTNPLFBMBSNJOTUBMMBUJPOVQHSBEFemail:[email protected] Ofce 08 9443 8999 for a quote

David Azzopardi 0418 924 950

Looking for a reliable property manager?Let my team show you the

bene ts of 25 years local experience.

10 - 50%

OFF ALL

STOCK

Old Theatre Lane o Bayview Terrace ClaremontTROWBRIDGE

Renovat

ion Sale

50% off

50 fram

ed pictu

res

Dance to great music with great people & burn calories

/zumbaliciousforfitnesscottesloe

Dance Fitness Class

Sara & Yvonne 0411 869 709Tues 7.30pm,Workout Gym 36 Eric Street, Cottesloe

DIVORCE? SEPARATION?If your marriage or de facto relationship is ending, you need to consider how to plan for:

tZPVSDIJMESFOTGVUVSFXJUINJOJNBMEJTSVQUJPOBOEtZPVSmOBODFTJODMVEJOHUIFEJWJTJPOPGQSPQFSUZ

*EFBMMZZPVXJMMFYQFSJFODFBOBNJDBCMFTFQBSBUJPO

)PXFWFSZPVTIPVMECFQSFQBSFEGPSBQFSJPEPGFNPUJPOBMUVSNPJM*UJTXJTFUPLOPXZPVSSJHIUTBOEQMBOFBSMZ

"U%PVHMBT$IFWFSBMMT-BXZFSTXFPGGFStFEVDBUJPOBCPVUUIFMFHBMQSPDFTTtBXFMMQMBOOFETUSBUFHJDBQQSPBDItFNQIBTJTPOSFBDIJOHBOBNJDBCMFSFTPMVUJPOtTLJMMFEOFHPUJBUPSTHJWJOHGPDVTUPBGBJSSFTPMVUJPO

XIJMTUVQIPMEJOHZPVSSJHIUT

'PS B DPOmEFOUJBM EJTDVTTJPO BCPVU ZPVS PQUJPOT BUPVS 4VCJBDP PGmDFT CPPL BO BQQPJOUNFOU POMJOF BUEDMBXZFSTDPNBVPSDBMMWe also specialise in all areas of commercial law, litigation and dispute resolution.

")BZ4USFFU4VCJBDP8"UXEDMBXZFSTDPNBVFPGmDF!EDMBXZFSTDPNBV

Calling all Instagrammers The POST is now on Instagram.

We have been on Twitter and Facebook for a while now, but recently decided it was time to jump on the Instagram bandwagon too.

After all, it is hard to ignore the photo-sharing juggernaut, which has more than 300million users worldwide.

Follow @postnewspa-pers for photos relating to reports you can fi nd in the latest edition of the paper.

These will include every-thing from news and views, to real estate and fashion all from the western sub-urbs, of course.

If you see something newsworthy or amusing

in the western suburbs, take a picture, upload it to Instagram, use the hashtag #postnewspapers, and tag us by writing @postnews-papers in the caption.

The best pictures will feature on our Instagram page and could also make it into the newspaper.

Page 4 POST, May 16, 2015

Page 4

Digging up recruitsThe Army Reserve is

now recruiting in WAs biggest cemetery.

Thats what a POSTie thought when she saw this mobile ad in West Perth on Wednesday.

Now recruiting in Karrakatta, the poster

says, with a photo of three burly (and living) blokes in khaki under their civ-vies.

Another POSTie with a military mind pointed out Karrakatta also had barracks.

But there are far more people across the tracks, in the necropolis.

Underground operation? Our Army Reserve wants people from Karrakatta.

Give in to it!

Real estate agents, police offi cers, hairdressers: lots of people celebrated Star Wars Day last Monday.

Star Wars Day is May the Fourth a play on the im-mortal phrase, May the force be with you and its celebrated worldwide.

In Melbourne, two fans used 250,000 Lego bricks to build a 5m-wide Millennium Falcon.

Another Melburnian is walking 12,000km around Australia dressed as a Stormtrooper to raise money for charity.

In the western sub-urbs, Kym Cohen wore a Darth Vader T-shirt to her appointment with Nedlands hairdresser Carl Freedman.

But if Monday was May the Fourth, why wasnt Tuesday the Revenge of the Fifth?

Manly Ladies College?A Methodist Ladies College mother fell out of her

chair this week when she saw a report about the Sydney MLC.

Broken Hills daily paper, The Barrier Daily Truth, reported on the girls being on exchange.

Below a picture of four police (one bearded), it said the Sydney girls were preparing Johnny cakes.

Hair-raising We love caption conundrums.

More the farce bewitch you

Eagle-eyed Wembley resident Cyril Urlings spotted a mistake in the POST.

A photograph used with a report on planned road-works in Harborne and Grantham streets showed the wrong junction.

Cyril, who said he had lived in the area for 50 years, recognised it im-mediately and recruited another resident to back him up.

The picture showed Grantham and Selby streets.

The federal government is putting up about $700,000 from blackspot funding to alter traffi c lights at the junction of Grantham and Harborne streets.

It said 13 people had been hurt there in right-turn crashes.

Cyril said the money would be better spent at another nearby junction.

Crossed lines on road junction

Scott breezes inScott Fleay has joined the

hole-in-one club.The Peppermint Grove

councillor told colleagues on Tuesday evening he had achieved the feat on the sixth hole at Royal Perth Golf Club.

There was a howling breeze, Mr Fleay said.

Bending the ElbaA POST reporter was asked

to show his ID at a Cottesloe bar on Tuesday night.Jacob Nazroo and David Cohen went to Elba on Napoleon S tree t w h i l e P e p p e r m i n t Grove councillors con-ducted secret business. But before Jacob (21) could take a sip of the house red, an Elba employee swooped. It happens all the time, our fresh-faced reporter said. David said it seemed like 117 years since he had been asked to prove he was over 18.

Youre spoilt for choice when it comes to big events over the next few weeks.

On May 28, Premier Colin Barnett will help celebrate 70 Years of the Liberal Party at North Cottesloe surf club. Tickets are $75.

The night be fore , J o o n d a l u p M P J a n Norberger is hosting a Mad Max move night at Grand Cinemas Joondalup.

Tickets are $25 a $30 Chinese dinner is op-tional.

It unfortunately clashes with another chance to meet Mr Barnett, at the Stirling Adriatic Centre ($20 party members, $50 others).

A $100 cocktail party with federal MP Ken Wyatt is on in Applecross next Saturday.

And theres a $150 din-ner with Mr Barnett and former South Perth MP Bill Grayden at the Pagoda in Como on June 11.

Political fare on menu

2.5kW TCLSplit SystemIncluding GST*

3.5kW TCLSplit SystemIncluding GST*

5kW TCLSplit SystemIncluding GST*

7kW TCLSplit SystemIncluding GST*

2.5kW SamsungSplit InverterIncluding GST*

3.5kW SamsungSplit InverterIncluding GST*

5kW SamsungSplit InverterIncluding GST*



2.5kW PanasonicSplit InverterIncluding GST*

3.5kW PanasonicSplit InverterIncluding GST*

5kW PanasonicSplit InverterIncluding GST*

0433 019 676

Free Delivery25 Year Warranty on panels5 Year Warranty on inverter -oponal prae to year warranty>iense to Desin an /nstallCommercial systems availableperience installersYality assreFinance available

We make your Solar Choice easy!Free On Site Quotes

*

2Split Includ

$1,185*

*Split Includ

Includ

3.5kWSplit $1,285*

*Split Includ

* Includ

5kW Split $1,585*

*Split Includ

* Includ

7kW Split$2,085*



2.5kW FujitsuSplit InverterIncluding GST*


8kWSplitInclud

$1,298*

SplitInclud

ng

Includ

2.5kWSplit$1,498*

SplitInclud

g

Includ

3.5kWSplit$1,898*

SplitInclud

g

Includ

5kWSplit$2,398*

7kW PSplit IInclud

$2,898*

Split IInclud

ic

Includ

8kW PSplit I$1,377*

Split IInclud

ic

Includ

2.5kWSplit I$1,577*

Split IInclud

Includ

3.5kWSplit I$1,977*

c

$2,477*

c

$2,977*

$1,390*

$1,590*

or visit us at: www.htcontractors.com.au

$8,700*Outlets8 from

10.0kW Inverterreverse cycle

SAMSUNG

3.0kw SystemIncluding GST*

Fr255

pwwii

Fr

em $4,499*


eT

55 opwwww>i>i

emT* $4,499

eemTT $6,199*

Tier 1 Opal 250W panelsSMA Inverter


cccooooYYYYY

inin

iiooooYYYYYYFiFiFF

>i>iiCoCoCoCoCCoCo

emT* $6,199

emT* $6,899*

call us,

5kW FujitsuSplit InverterIncluding GST*




$2,090*

u

$2,490*

u

$3,090*

u

$3,590*



SAMSUNG

$10,700*Outlets12


SAMSUNG

Ducted Split Systems!5 Year Warranty on parts & labour



PANASONIC

callll us,

$9,990*Outlets10

12.5kW Inverter

PANASONIC

$10,990*Outlets12


from

PANASONIC

reverse cycle

from from

rterGST*

$3,5

700*OutlettsSAAAMMMMMMSMSMSMSUNUNUNUNNGGGG

from

Fully Installed

inc GST inc GST inc GST

inc GST inc GST inc GST

Heath Tournier Contractors*Free Delivery - supplied & installed. Standard Back To Back with the outdoor unit mountedon a concrete or paved surface (single storey, brick & weatherboard homes), pipe work includes 2 metres of pipe & one pipe cover of 2 metres, electrical includes 15 metres of electrical supplycable. If there are any extras required over and above this *we will quote for FREE*

W SamsunInverter

.5kWplit

ng

$1 298*

Fully Installed

One Stop Tradesman Shop!

Split Systems

Tournier FoundationBuilding futures for our homeless youth thePPaayy leesss, PPaayy ccaasshh!!Pay less, Pay cash!

A percentage of our profits go towardssupporting The Tournier Foundation

EC 008512 PL 8903 GF 015914 AU 31311 A 5903985

Our Services:ElectricalSolar PowerPlmbin 'asir-Conionin


Taking push out of chairsSalvaged bicycles from

verge collections and the skills of Mosman Park Mens Shed members have produced affordable attachments to motorise wheelchairs.

After six months develop-ment, shed members fi nished their latest prototype this week and are awaiting approval that it meets Australian safety standards.

The powered attachment can be easily clipped on to any size wheelchair, even while some-one is sitting in it.

This is the third prototype, shed member Vic Power said.

The shed members and I are absolutely chuffed with this.

It plugs into a wall socket and takes fi ve to six hours to charge and has a range of up to 30km on one battery.

Two batteries give 60km.Shed members used a design

by paraplegic Robert Wynn to build their version, which has up to six hours running time.

Mr Power said he had been inspired to design something after a friend had broken his

back in an industrial accident two years ago.

He said motorised wheel-chairs cost between $5000 and $15,000, but the version tested at the shed this week used a motor and batteries that cost

about $1300 plus another $40 worth of stainless-steel com-ponents.

Mr Power believes that cost can be reduced signifi cantly by using motors he has sourced in China.

Once we get it going, we can probably knock these up in under three hours, he said.

We will have these compo-nents on the shelf and can put a basket over the front wheel to carry things.

Vic Power test drives the powered wheelchair. INSET: How the powered frame clips on to the wheelchair. Photos: Billie Fairclough


By DAVID HUDLESTONIf the Wearne Hostel site

were sold, the proceeds would go to the state government, not the four councils named on the title, Mosman Park councillors have been told.

At Tuesday nights corporate and technical services commit-tee meeting, South ward coun-cillor Jenna Ledgerwood was clarifying the councils position over Curtin Cares request for a 99-year lease or ownership of the $30million site for a nomi-nal fee.

Curtin Care is seeking security of tenure so it can borrow to build a new centre costing up to $100million.

At the beginning of the com-mittee meeting, Stone Street resident Roz MacNish said the four councils had been entrusted with the land on behalf of their ratepayers

To give the property to a single private interest, no mat-ter how noble, is a betrayal of that trust it is immoral and it is unethical, she said.

Its not fair on the ratepayers and its not fair on other busi-nesses of a similar nature.

She said Curtin Cares request

Wearnequestions

Developer queries Rokeby marketsThe developer behind the

proposed redevelopment of the Station Street Markets says there are serious ques-tion marks over new weekend markets on Rokeby Road.

Speaking at an Australia Property Institute event focus-ing on Subiaco, Greg Pearce, from Windsor Knight, was asked

about the markets by a Rokeby Road trader.

The Rokeby market develop-ers, from the Venn Property Group (VPG), were also at the event.

The guys behind it are in the room, Mr Pearce said. I dont want to upset another developer we work together but I have serious reservations about that concept.

He said that as a market opera-

tor he thought closing Rokeby Road to traffic on Saturday and Sunday was a huge logistic challenge.

Despite having hundreds of square metres of cold rooms at Station Street, stallholders started fi lling up the markets on Tuesday to open for Friday, Saturday and Sunday.

He said comparisons between markets in Rokeby Road and other well-established inter-

national markets were not like-for-like.

We all compare with the Paris markets, but the Paris markets and other markets are all on bits of land that are not roads, that are not vital communication and transport links, he said.

I think someone really needs to think about the impact of clos-ing Rokeby Road, getting rid of that parking, getting rid of those transport links. I have a serious

reservation about it.Mr Pearce suggested that the

council-owned Forrest Street carpark between Denis and Rowland streets would be a better location.

He warned that closing park-ing spaces in Rokeby Road was a risk because people wanted to be able to park outside shops.

He said the Station Street Markets, which brought in about

By LLOYD GORMAN


Missing woman foundA 62-year-old Nedlands woman missing for 24

hours this week has been found at a hotel.The woman caused concern for friends and

family when she hadnt been seen since 3pm on Tuesday.

But on Wednesday she was found.

Level 3, 79 Stirling Street, Perth, Western Australia.www.clairskeeley.com.au

P. (08) 9228 0811 F. (08) 9228 0899E. [email protected]

Committed to better solutions.

Need a better way to resolve family issues ?

Divorce or separation is a difcult time.

We have experienced solicitors to assist you to achieve a settlement that best meets the specic need of you and your children.

FREE LECTURES - ALL WELCOME

SPIRITUAL POISE HAS POWERSaturday, 23 May at 2.30pm

Spiritual Poise transforming your life.Explore how inner calm or poise can be

experienced reliably, ifits based on divine Spirit, God

THE SCOPE AND DEPTH OF THOUGHTSunday, 24 May at 2.30pm

Thought impacts experience.Explore how prayer makes a difference

State Library Theatre25 Francis St Northbridge

National Speaker, Mary Beattie, is a practitioner of Christian Science healing and a member of the Christian Science Board of Lectureship.

For more info: www.csperth.org.au or phone 9322 8188

IRON EAGLE WA

Shenton Park

Canterbury F

Subiaco Canterbury B

Phone 041 219 8306 For price and displaywww.ironeaglewa.com.au

STAINLESS STEELDETENTION SCREENDOORS & WINDOWSSecurity without

spoiling your view

Steel Security Doors withStainless Steel Mesh

Canterbury D Canterbury H

41A Kirwan Street, Floreat 08 9284 1188www.aurumplanning.com.au

Keyperson Insurance (Illness, Accident, Life)

Portfolio Advice and Management

Your local advisers:Brendan Downes, Simon Phillips

PERSONAL INSURANCE BROKERS

Independent Financial Advice

drserene.com

AS SEEN ON TODAY TONIGHT

Claremont Medical Centre92855100

Natural Face Rejuvenation

Let me decipher your MTHFR genes to keep you

healthy and beautiful

POST, May 16, 2015

Client tested Barrys civic resolveWhen Barry Crommelin

was Peppermint Grove shire president, his patience was tested.

Barry, who founded a chemi-cal fi rm, was approached by his major business customer who sought an exemption from a

council by-law.Barry refused, and suffered

in consequence the very churlish loss of a signifi cant amount of business but he did not blink, Barrys lifelong friend Richard Clark said in his eulogy.

This was one of many exam-ples of Barrys approach to life and ethics.

Barry was a Grove councillor from 1979 and fi nished as shire president from 1997 to 1999.

He died last month, aged 82, at his Irvine Street home sur-rounded by his family after a four-year battle against mantle cell lymphoma.

Hundreds gathered at Royal Freshwater Bay Yacht Club to celebrate his life after some of his ashes were scattered in the bay.

Barrys widow, Carole, said Barry had gone to Christ Church Grammar School from kindergarten and fi nished as head boy.

A centrepiece of the celebra-tion was a swimming cup fi lled with yellow chrysanthemums on a blue cloth.

Barry was so proud of the cup, which had his and his son Peters name on it, Carole said.

She said they were the only father and son whose names were on the cup.

Barry was a state hockey play-er and swimmer and coached hockey for many years at the Claremont school.

His son, Tim, said Barrys determination was seen in his training.

He was not satisfi ed with his running, so he would run around Christ Churchs oval in his cadet-issue army boots to strengthen his legs, Tim said.

Richard said Barry tried a year of medical school, a stint at a chemical fi rm, and stockbrok-

ing before he tarted his own business, Crommelin Chemicals, in 1958.

He started with virtually no capital but real courage, a willing back, and the enthu-siasm of a salesman selling the Sydney Harbour Bridge, Richard said.

B a r r y w o u l d s p e n d hours at night in the grimly spooky Cordons Iceworks in Claremont.

The place had no lights, and had holes in the concrete fl oor fi lled with putrid water.

In the hope they never chose to visit, Barry would describe it to his customers as his fac-tory.

Richard said he had helped Barry use a broken oar to stir

chemicals in an old underground petrol tank, heated from under-neath by eight kerosene blow lamps.

Today, Crommelin is a leading supplier of waterproofi ng and sealing products for building industries in Australia and Asia.

Richard said after Barry met Carole, Miss Australia in 1965, he had a rudder for life.

Peter said Barry had always has and entrepreneurial spirit he had sold frangipanis from the family tree to a fl orist and rabbit skins from his grandfa-thers Pingelly farm.

Tim said Barry was a voracious reader, a passionate historian, and had a love affair with the English language.

By DAVID COHEN

All aboard Barry Crommelin o Rottnest Island circa 1968.

On holiday Barry Crommelin in San Francisco about 15 years ago.

An early-morning swim-mer at a Claremont pool was resuscitated after having a heart attack last Thursday morning.

The man was at a Kirby Swim class in Christ Church Grammar Schools pool when he became ill.

He was dragged out and a de-fi brillator was used to stabilise him until he was taken to Sir Charles Gairdner Hospital.

A Kirby worker said: There was an incident, but comment would have to come from the school.

A CCGS spokeswoman did not provide further details.

2/16 Battalion marks 75 years

Veterans and their families from a battalion of soldiers that fi rst marched out exactly 75 years ago are commemorating the event with the help of the WA Governor.

This Saturday, May 16, Governor Kerry Sanderson will lead the service at the Flame of Remembrance, at the Kings Park War Memorial.

Veterans, their families and supporters are welcome to at-tend.

On May 16, 75 years ago, sol-diers of the 2/16th Battalion marched out of Northam Army Camp through the streets of Northam.

In the next fi ve years of fi erce fi ghting in World War II, they continued tradition of the fi rst 16th battalion that had landed at Gallipoli on the fi rst Anzac Day and went on to fi ght in France with horrifi c loses.

The 2/16th was part of an inva-sion of Syria and Lebanon and fought with distinction at Kokoda, other bloody battlefi elds of Papua New Guinea, then Borneo.

Some of the Kokoda veterans will attend.

Guests are asked to be seated by 10.45am for the 10.55 cer-emony, which is expected to last about 40 minutes.

Swimmer revived

POST

PEOPLE


Ocean views from parts of the heritage-listed Cottesloe Civic Centre will be affected if a new block of units gets fi nal approval.

Cottesloe council is set to challenge the approval for the towns fi rst multimillion-dollar development assessment panel application.

A state government-appointed DAP gave the green light to 12 apartments in Overton Gardens, in front of the Cottesloe Civic Centres back lawn.

Council staff recommended the project be refused, because it would be higher than 7m, af-fect views, and be too bulky.

But the DAP approved it, and deleted or modified several conditions.

D A P m e m b e r L u i g i DAlessandro sought to remove a condition restricting the height to 7m after Roberts Day planner

Deon White said the primary height would be allowable.

Thats my understanding, Mr DAlessandro said.

But council planning manager Andrew Jackson said: That could probably be contested at law, in my opinion.

DAP presiding member Clayton Higham voted for the re-moval, despite having doubts.

Its probably in breach of the [town planning] scheme, Mr Higham said before the vote.

The council and developers

cannot agree if pergolas, eaves, and walls on top of the develop-ment are part of the building.

Councillor and DAP member Jack Walsh had concerns about views from the civic centres back lawn being affected.

This building will be the length of the block, Mr Walsh said.

The state government rec-ognised these views in our new town planning scheme.

This is going to double the amount of view thats blocked out.

Peppermint Grove resident Jane Whiddons Overton Gardens Pty Ltd paid $7.5mil-lion for three 1950s apartment blocks, at numbers 15, 17, and 19 on Overton Gardens north side (Cottesloe faces fi rst DAP, POST, May 2).

The three lots cover 1677sq.m. Construction of the 12 apart-ments is scheduled to start in the fi nal quarter of the year.

Cold case reopens unheard evidenceThe cold case re-investiga-

tion announced this week into the murder of Corryn Rayney is expected to lift the lid on weeks of evidence that was never heard at her husbands murder trial in 2012.

It was suggested at the trial that the police had other prime candidates for the murder right on the doorstep.

Mrs Rayneys body was found buried in Kings Park in August 2007 and her car was found abandoned nearby in Kershaw Street, Subiaco.

Lloyd Rayney was charged with the murder and he successfully fought the charge in court.

The judge who acquitted Mr Rayney, Brian Martin QC, said in his fi nding that Mrs Rayney had most likely been the victim of a random sex attack.

At the trial, while cross-examining police, Mr Rayneys lawyer began exploring facts about a man whose DNA had been found on a cigarette butt that forensic offi cers picked up outside the Rayney family home in Como.

A man with the same name, who was well known to police, had been stopped by a patrol car in Bentley for a random breath test which proved negative minutes away from where Mrs Rayney was last seen alive after leaving a boot-scooting class.

A notebook of another offi cer produced in court had this mans name and the words sex as-sault Kings Park written on the same page.

The man shared a house in Como with a friend extremely well known to police for sexual offending, a detective told the court.

A call made on the night of the murder from a phone box in Mrs Rayneys street was traced by police to the mans sister, the murder trial was told.

The judge and others high-lighted many pieces of evidence that indicated the possible involvement of individuals not connected to Mr Rayney.

When Mrs Rayneys body was found, her belt had been unbuckled and jeans zipper ripped, her handbag had been upended on the rear fl oor of her car and the contents scattered, and her watch and passport were missing.

The trial judge said that the two men had been put forward by Mr Rayneys lawyer, David Edwardson QC, as realistic alternative candidates.

He said Mr Edwardson was suggesting that not only had the investigation inappropriately focused on Mr Rayney to the exclusion of others, but in fact the police had some prime candidates right there on the doorstep.

But the prosecution inter-vened, saying that exploring this line would delay the three-month trial by some weeks while new statements police obtained

from witnesses.Justice Martin then adjourned

the court overnight.The next morning, Mr

Edwardson told the court that Mr Rayney did not have to prove anything.

It was the state that had set itself the task of proving the case against Mr Rayney.

Mr Edwardson then said he would not be suggesting that the two alternative men were guilty of the crime, but he was putting forward facts to demon-strate the intensity of the focus on Mr Rayney by the major crime squad in comparison to others.

The judge said in his fi nding that the state had not only failed to prove its scenario against Mr Rayney, but it had also failed to disprove an alternative scenario that was not consistent with Mr Rayneys innocence.

By BRET CHRISTIAN

Corryn Rayney

Today The view from Cottesloes Civic Centre this week.

The future? How the view might change if 12 units are built.

A developers impression of the project.

By DAVID COHEN

Threat to Civic Centre view

A man has been fi ned $200 after pleading guilty in the Perth Magistrates Court to six charges of stealing in Daglish and Jolimont.

Wembley offi cers caught David Press (44) after a Richardson Avenue, Daglish, resident

reported seeing him take a bicycle from her ve-randah. Mr Press stole bank cards, a backpack, a bag of glasses a resident was going to donate to charity, two sets of keys, a camera, a mobile phone, and a GPS from cars in Troy, Richardson, and Robinson terraces last month.

Bike theft leads to stolen stash

Maintenance Specialist Roof Work Hot & Cold Water Services

Bathroom Renovations Licensed Gas Fitter Sewer Blockages & Drainage Works

GOREY Plumbing Services

0407 381 727 Subiaco, Claremont, Nedlands, Peppermint Grove, Dalkeith,

City Beach + all areas in Western SuburbsPLMWA Lic No. 615 Gas Lic No. 6654 more than just handymen

Congratulations to the following students, who are recipients of our 2016 Scholarships.

IONAPRESENTATION COLLEGE

www.iona.wa.edu.au

Sr Alocoque Gittins Academic Scholarship Year 7 Amelia Edwards Iona Presentation Primary SchoolBridget Garbellini Our Lady Of Good Counsel SchoolYasmin Henderson-Kelly Australian International School, MalaysiaLillia Kono Cottesloe Primary SchoolAngelina Lyus Coogee Primary School

Sr Joan Evans General Excellence Scholarship Year 7Vivienne Le Tessier Iona Presentation Primary School

Iona Past Pupils Association Academic Scholarship Year 7 Abby Maslen Cottesloe Primary School

Sr John Jones Academic Scholarship Year 10Madeleine Broad Iona Presentation CollegeRachel Dollar Iona Presentation CollegeSaskia McDonald Iona Presentation College

343 Railway RoadSHENTON PARK

*Optional with any wash. Please mention ad

Scott Banister-Jones 0438 933 634

[email protected] www.scottbj.com.au

Your townhouse or house Broadway or Hampden Rd

precinct $650,000-$1,400,000

4 Actual buyers(note these are actual people

not made up to get your listing)Your Property SOLD

CLAREMONT Bay View Terrace Ph: 9385 1220

THINK TOYS THINK TOYWORLD

Your Local Toy Specialists

BEANIE BOOS JURASSIC WORLD

BARBIE LEGO

SUBIACOHay Street Ph: 9388 1575

MAY RELEASES IN STORE NOW

POST, May 16, 2015

241 Rokeby Road, Subiaco WA 6008 | T (08) 9237 9222 | E [email protected] | W www.subiaco.wa.gov.au | F www.facebook.com/cityofsubiaco

Subiaco scene

Community notices

Upskill practical budgeting workshop for young peopleHave you recently moved out of home or are thinking about moving out? This workshop is for you!

Moving out is a big change and your newly found freedom can come with lots of additional costs. This free workshop, facilitated by Homelove and a certied accountant, will help you navigate this new world of rent and bills. You will learn some practical budget measures that will not only stretch your accounts but also your creativity.

As part of the citys Upskill skills development program, this workshop is open to all young people aged sixteen to twenty-ve, and is particularly suited to those saving for a goal such as a car or holiday.

When: Monday 25 May, from 5pm to 7pmWhen: Profectus, St Catherines College, 2 Park Road, Crawley

Places are limited. Please RSVP on 9237 9216 or [email protected]

Food Allergy Week 2015Did you know that up to two per cent of Australians are affected by food allergies, including one in ten babies?

Some food allergies cause potentially life-threatening reactions known as anaphylaxis. There is currently no cure for food allergy and total avoidance of the food is the only way to prevent a reaction.

Sunday 17 to Saturday 23 May is Food Allergy Week. If you have a family member, friend or work colleague that is affected, take the time to educate yourself on this important issue so you can understand and support people living with food allergies.

For more information, please visit www.foodallergyaware.com.au

Cyber-safety awareness programThinkUKnow is a cyber-safety awareness program for children, young people, teachers and parents. Children and young people aged seven to seventeen years, parents, teachers and other interested adults are invited to attend two simultaneous discussions (one for children and young people with Constable Care, and one for adults with ThinkUKnow) about staying safe online.

The evening will start with facilitated discussions in pairs or small groups and conclude with a combined group conversation led by ThinkUKnow.

When: Monday 18 May, from 6pm to 8pm When: Subiaco Library, 237 Rokeby Road, Subiaco

Places are limited. Please RSVP on 9237 9300 or [email protected]

Applications for Subi Kids Crew now openSubi Kids Crew (SKC) aims to give children a voice by providing the opportunity to participate in community initiatives, events and consultation.

SKC is for children aged between seven and eleven years, who live or go to school in the City of Subiaco, and would like to learn about and contribute to their local community.

Through the program, the city also aims to identify and develop future leaders. The four main areas of the program are skill development, advisory, ambassadorial and interpersonal development.

Applications are open now until 5pm on Monday 8 June. For more information, contact 9237 9317 or visit www.subiaco.wa.gov.au to download an application.

Seniors Social Day ClubThe citys Seniors Social Day Club is a fun and friendly club, with a positive and inclusive atmosphere. The club hosts a range of activities, including arts and crafts projects, pottery, cooking, interactive quizzes, games, exercise programs, community lunches, day trips and much more. A three course lunch is provided, as well as morning and afternoon tea.

The city offers a transport service to and from the day club, allowing participants to get picked up right outside their front door. The Seniors Social Day Club operates from the Tom Dadour Community Centre, 363 Bagot Road, Subiaco.

For more information, including participation fees, please contact the city on 9237 9336.

Q Corporate, Community and Technical Services Committee meeting Tuesday 19 May

Agenda items

Lords Operational Performance ReportDisability Access and Inclusion Committee membership

Rosalie Sporting Association Rosalie Park Pavilion (East) Lease agreement

Application for loan fundingFinancial statements March 2015Financial statements April 2015

Elected Members Motion Median strip Rokeby RoadElected Members Motion Convex mirrors Hart Lane

Q Draft Community Facilities Concept Plan and draft Rosalie Park Master Plan

The City of Subiaco, in partnership with CommPlan Alliance, has developed the draft Community Facilities Plan and the draft Rosalie Park Master Plan. The city would like to receive feedback from the community on the recommendations.

The draft documents plan for the future development and operation of the citys community facilities and Rosalie Park over the next twenty years. They include an analysis of the citys current and expected requirements as well as input from experts, stakeholders and the community.

Please go to www.subiaco.wa.gov.au/haveyoursay where you can view the draft plans and complete the surveys. Hard copy surveys and plans are also available at the citys Administration Centre, 241 Rokeby Road, Subiaco and Subiaco Library, 237 Rokeby Road, Subiaco.

Please submit your feedback by 5pm on Monday 15 June.

Q Rescission of planning policies

The City of Subiaco is inviting public comment on the rescission of Planning Policy 2.8 Aged or dependent persons dwellings.

The city is also inviting public comment on the rescission of Planning Policy 2.10 Amusement Centres.

Comments are to be received by 5pm on Friday 22 May.

QCelebrate Library and Information Week

Garry Dunne, Director of City Services at the City of Perth, will help us celebrate Library and Information Week with a free presentation on the new City of Perth Lending Library. Monday 25 May, 6pm Subiaco Library, 237 Rokeby Road, SubiacoPlease RSVP on 9237 9300 or [email protected]

QNational Simultaneous Storytime

Join children across Australia for the annual National Simultaneous Storytime. Special guest storyteller Mayor Heather Henderson will be reading this years story The Brothers Quibble by Aaron Blabey.Wednesday 27 May, 10.45amSubiaco Library, 237 Rokeby Road, Subiaco Please RSVP on 9237 9300 or [email protected]

QQFilm Club Maos Last Dancer

Maos Last Dancer tells the true story of a small boys extraordinary journey from poverty to international stardom. Thursday 28 May, 11.45amSubiaco Community Centre, 203 Bagot Road, SubiacoCost: $13Please RSVP by Thursday 21 May on 9237 9320 or [email protected]

QLibrary and Information Week talk Library online services

Find out about downloading free books online and how to use the librarys e-resources at a free lunchtime talk. Friday 29 May, 12.15pmSubiaco Library, 237 Rokeby Road, SubiacoPlease RSVP on 9237 9300 or [email protected]

Q Development applications for comment

The city is inviting public comment on the proposed demolition of the existing dwelling and the construction of a three storey building comprising ve multiple dwellings, at 368 Barker Road, Subiaco.

The city is also inviting public comment on the proposed demolition of the existing dwelling and construction of four, three storey grouped dwellings at 43 Troy Terrace, Daglish.

Comments are to be received by 5pm on Friday 5 June.

For more information on the above, visit www.subiaco.wa.gov.au/formalsubmissions or view hard copies at the citys Administration Centre, 241 Rokeby Road, Subiaco or Subiaco Library, 237 Rokeby Road, Subiaco during normal operating hours.

Comments should be submitted in writing through the online submission form at www.subiaco.wa.gov.au/formalsubmissions, via email to [email protected] or addressed to the Chief Executive Ofcer, City of Subiaco, PO Box 270, Subiaco WA 6904. Comments should clearly indicate the name and address of the person making the submission and the proposal or application to which the submission relates.

Q Development applications received

Property Proposal

23 Hopetoun Terrace, Daglish

Alterations and additions to existing dwelling including rear single storey extension with attic

226 Nicholson Road, Subiaco

Alterations and additions to existing dwelling and construction of a pergola

Public submissions in respect to these proposals are not being requested at this time. Formal consultation, where required, will be undertaken in accordance with the citys policy on planning public consultation. To view the policy, visit www.subiaco.wa.gov.au

QCHILDREN QALL AGESQADULTSQSENIORS QYOUTH

Whats happening in Subi


Prudent pruning call for MosmanMosman Park councillor

Brett Pollock wants common sense to prevail as the council develops a policy to create safe and enjoyable walking areas through its riverside and ocean-front parks.

People like to walk along here and see the river and ocean, they dont want to see bushes, he said during a walk through Minim Cove bush.

Its all about a balance.At last months council meet-

ing, Mr Pollock successfully proposed a review of council-directed bushcare programs run by volunteers.

He said that a gazebo in Vlamingh Parklands had an open ambience where people could enjoy the river views, but a similar one at Milo Beach was completely enclosed by overgrown bush.

Mr Pollock said he didnt fa-vour removing all the vegetation but thinning out the under-storey or planting trees and shrubs whose height suited the area.

Pointing to what he called a woody weed, he said if it was allowed to grow uncontrolled

it would be solid scrub.He said he was concerned that

thick vegetation was creating an unsafe environment for people, especially women, using the walkways.

If these woody weeds are left to keep going, it will be solid scrub people could hide in, he said.

Mr Pollock is well known for the conservation and revegeta-tion of Wooleen Station in the North-West, which he bought in 1989.

I have spent a lot of time preserving natural bushland. I understand it all, I know what it is all about and I am all for it, he said.

But it gets to a stage where

a bit of common sense and a council policy is required.

I am not against bush care, I am not against protecting rare fl ora and fauna I just want some common sense.

We need open space for kids and dogs to exercise as well as bush.

I am all for preventing ero-sion on the riverbank, which is part of what all this vegetation is for.

My idea is to get growth under control and maintain it.

He said he didnt want it clear-felled to make way for river views.

The woody weeds need to be

undercut, so walkers can see through, but still have the den-sity for bird life.

I just want a responsible policy document created to pro-tect the core value of Mosman Park bush and ratepayers.

We have just got to make sure we have the right balance for all the interest groups in Mosman Park.

Tuesday nights corporate and technical services committee passed a recommendation to ask CEO Kevin Poynton to develop a draft policy for management of the councils bush areas to be put out for public comment.

The full council will vote on it on May 26.

By DAVID HUDLESTON

Somewhere behind this track down to Milo Beach is the Swan River.

Grove queries Cott rangersPeppermint Grove council-

lors have repeated last years concerns about the value of using Cottesloe rangers.

At a meeting on Tuesday, councillor Greg Peters criticised flurries of ranger activity followed by relapses after no parking tickets had been issued in Peppermint Grove over the previous two weeks.

Last year, the council request-ed an accounting from Cottesloe, which showed 89 parking tickets were issued in Peppermint Grove over the following six weeks.

Mr Peters suggested GPS de-vices be put into rangers cars to monitor activity, but Grove CEO John Merrick said: We get what we pay for.

For the hours contracted for ranger services from Cottesloe, we receive excellent value, and rang-ers attend at extremely short notice to our requests at all time.

Acting Cottesloe CEO Mat Humfrey said rangers tasks in Peppermint Grove were very similar to what they would be expected to do in Cottesloe.

Mr Humfrey said rangers did eight hours of Grove patrols each week down from 18 hours in February last year.

But shire president Rachel Thomas said regular updates and increased accountability might be required.

Brett Pollock shows the open view of the river available at the gazebo on the Vlamingh Parklands, left, while a similar gazebo at Milo Beach is completely enclosed by plants.

SurrogacyONE FREE SEMINAR

Leading USA medical fertility expert Dr Michael Feinman in Perth on

Monday 18th of May 2015

Surrogacy, egg donation, implantation failure, pre-implantation genetic diagnosis (PGD) DO NOT MISS OUT!

NEDLANDS YACHT CLUB 6.30pm - 8.30pm RSVP fertilityoptionsseminar.com

or phone 0488 910 018

170 Stirling Highway Nedlands. 9386 6730 www.webberfurniture.com.au

wEBBERS

Now in Store.

Container of Teak Display Cabinets

Zermatt modular. Avaiable any size.Armadillo & Co Sierra weave wool rug.

c c c c c c c c c c c c c c c c

c c Yes I will be attending, please reserve me tickets. I am unable to attend, pleaseaccept my donation.

NAME:Payment Methods (please circle): CHEQUE / CREDIT CARD Amount ($):

Type of Credit Card (please tick): Visa Mastercard EXPIRY DATE: /

NAME ON CARD:

CARD NUMBER:

Please Post my Receipt & Tickets to:

c c

The President, Mr Dan Smetana together with the Executive Committee of the Cottesloe Branch, Liberal Party of Australia

(WA) Inc., has much pleasure inviting you to:

Cottesloe Celebrates70 years of

The Liberal PartyThis is your personal invitation to celebrate 70 years of

the Liberal Party in Western Australia together with:Guest of Honour

The Hon. Colin Barnett MLAMember for Cottesloe,

The Premier of Western Australia,Minister for State Development & Science

And Other Special GuestsWhen: Thursday, 28 May 2015Where: North Cottesloe Surf Life Saving Club

151 Marine Pde, CottesloeTickets: $75 eachTime: 6PM - 8PMDress: Business, ElegantTickets: Smita from PRDnationwideTel: 9383 2066Email: [email protected]: PO Box 726, Claremont, WA 6010

Proudly brought to you by The Cottesloe Branch Authorised by Ben Morton, 640 Murray St, West Perth, 6005This is an input taxed event - no GST payable or claimable

Celebrating 70 years of achievementin Western Australia

The Marian Centre in Wembley will run a group CBT program for insomnia. The course provides accurate information about insomnia and sleep, and practical techniques for improving sleep through targeting unhelpful cycles of thinking and behaviour which might contribute to poor sleep.Details below:r/FYUHSPVQDPNNFODJOHUI.BZUPUI+VOFr4VCTFRVFOUQSPHSBNCFHJOTUIFUI+VMZUP UI"VHVTUr4BUVSEBZNPSOJOHTBNUPQNGPVSXFFLTr'BDJMJUBUFECZ$MJOJDBM3FHJTUFSFE1TZDIPMPHJTUTr(1SFGFSSBMSFRVJSFEBOE1SJWBUFIFBMUIGVOE

rebates may apply.r4VJUBCMFGPSBHFTmZFBSTr/PUF1FPQMFPVUTJEFUIJTBHFSBOHFNBZCFEFFNFE TVJUBCMFVQPOGVSUIFSEJTDVTTJPOBTTFTTNFOU

For further information please contact The Marian Centre on (08) 9380 4999 Ext: 1126 and ask for Andrea Herwig.

Want To Sleep Better Without Medication?

POST, May 16, 2015

COMMUNITY Planting DayInterested community members are invited to join local volunteer group, Friends of Roscommon Reserve, plant local native seedlings at the reserve.

This rewarding activity is vital in helping to improve the condition of this important local bushland.

When: Saturday, 6 June 2015

Time: 9am - 11am

Where: Corner of Roscommon Road and Glengariff Drive, Floreat

Register: www.cambridge.wa.gov.au/CommunityPlanting

For more information about the planting day please contact a member of the Towns sustainability team on 9347 6000 or via email at [email protected]

WHATS on in TOWN ...

Interested community membbeeeeeeerssssrsss a re i innvvvvvvvvnvitititititiittteeeeddeee to join localvolunteer group, Friends of RoooooooRoscsccs omomommmmomommmmommmmmmmommmomon n nnnnnnnnnn ReReRRRRR serve, plant local native seedlings aatt ththe e reseervrvvvvvvvve.e.

This rewarding activvitity y isisissisis v v vvvvvvvititiitititalal i inn hheehh lplpiniinngg g gg tootoo iimmmpmpmpmmpmppppprororororororovvvevevv thehe condition of this important local busushlhlananannnnannannddd.ddd.dd

When: Saturday, 6 6 JuuJunnenneneneneneee 22 0101111011115555 555555

Time: 9aam - 1111aaamammammaama

Where: CoCornrnnneeeeerereer o of ff RoRoRoscsccsscs omoomommmmomomomomomm n nnnnnn RoRooR adadadananannandddd d GlGlllenneneengagagaagaagg riririrrriiffffffffffff D DDririrr veveeve, ,, FlFllF ororroooo eaeaattt

RReRegigigigig stsstststeerer: wwwwwwww.w.w ccccccaacc mmbmbmmbmbm riidgddgdgge.e wawawawa.gggggovovovovv.aa.a.auu/u/u/u////CoCCoCoCooooCommmmmmmmmmmmmmmmuununnunuuu iitittttitityPyPyPPPyPPPPllaalalannttntnntttiininnnnninngg

FoForr momorere iinfnfoormationonn abobobooboooutututuuuuuu t tttttthhehehehe ppppplaaallalantntntnnntnn iiniinininnggggggg gg dadaddayyy yy plpllp eaeaeaeaeaaeaasesseeseess cccccoononnoo tattaatatattataaataactctctcttttctctc a a aaaaaa mmemember oof tthehe Towns susussustststaaiainanaananabbibbililililitytytytyyty tt teeeaeeaeam m onn 9999 9343344433 7 7777 6060600000000000000000000000 oorr vivivivvviaaa aa eeemmeeeee aaiiaaaaiaiiiia lll lll aatatsustaiaainananaabbibibillilililittytyty@@c@@c@@c@c@c@c@c@cammmammamaaammama bbbbbbrbbrb ididiidgeeeeegee wwww.wwwaaaa.aa gogogogogooooovv.vv.vv.auauauuaau

Read and Relax @ the libraryIndulge your love of reading at our new Read and Relax sessions starting at Cambridge Library this May.

If you enjoy listening to interesting stories and poems delivered in a friendly and relaxed setting then join us on Monday, 18 May from 1.30pm in the library reading room.

You are welcome to just listen, or if you prefer take a turn at reading to the group.

This is a free session and all are welcome!

For more information contact Cambridge Library on 9383 8999 or email [email protected].

Bin Tagging Success!The recent trial bin tagging program involving 2000 properties across the Town has been hailed a success with an 8% increase in perfect recycling bins and a massive 29.3% drop in recyclables being placed in waste bins.

Over eight weeks waste officers inspected bins to determine if residents were putting the right materials in the right bins. During the trial the biggest issue identified was recyclables being tied up in plastic bags, resulting in them being treated as landfill. Empty plastic bags belong in the recycling bin but all recyclables must go in the bin loose. Over the program the number of recyclables in plastic bags dropped from 23.2% to 14.1%, a very pleasing result!

At the close of the trial all perfect recyclers went into a draw with 30 Recycling Champions to shortly receive a $50 gift voucher for their efforts!Waste Minimisation Officer Jackie Dickson

checks on recycling

A $1000 towards a school sustainability project was the well-deserved reward for Floreat Park Primary School, winners of the inaugural Waste Warriors Clean Up Cambridge Competition.Sponsored by the town, the competition was open to all local schools and recognised outstanding contribution in helping keep our town clean and beautiful.

Winning school Floreat Primary introduced a range of Waste Warrior initiatives during the challenge, some of which required year groups to create their own programs - the Year 6 group took responsibility for recording energy from the schools solar panels, the Year 5s had the task of monitoring the worm farm, the Year 4s monitored the schools frog friendly habitat and the Year 3 class became environmental officers.

The leadership group for the challenge was the Year 6 class who led regular clean-ups and Waste Warrior activities. For their efforts the group was presented with individual eco-prizes.

A gift voucher for Environment House was also awarded to a family from the school, the Spiro family, who as part of the competition pledged to be sustainable and reduce waste.

Floreat Primary has some excellent on-going waste reduction and sustainability programs:

Waste free lunch events

Recycled sculptures

Worm farms fed from organic scraps collected at lunch and snack time

Composting

Promotion of reusable containers and bags

A veggie garden with produce used in lunches

Book recycling; and

Walk to school days

The school continues to encourage their community to make positive changes to themselves and the environment with their latest project, a Screen Free Contest, which challenged students, parents and teachers to turn off all electronic devices for three days!

Well done to Floreat Park Primary School for being very worthy Waste Warriors and your ongoing commitment to keeping Cambridge clean!

CAMBRIDGE NEWS

Subscribe to receive the Cambridge News via email at www.cambridge.wa.gov.au/subscribe 1 Bold Park Drive Floreat | 08 9347 6000 | [email protected] | www.cambridge.wa.gov.au

May 2015

Floreat are WASTE WARRIORS!

HOME ECO AUDITS for Cambridge ResidentsBook a free Home Eco Audit and find out how to save money on your electricity, gas and water bills, while taking responsibility for your impact on the environment.

Expert auditors will show you how to be more energy and water efficient, saving our precious resources and your money.

Each household that registers for an audit will receive up to $50 worth of energy and water saving hardware to install in their home.

Bookings are essential as places are limited to the first 50 households.

Register for an Home Eco Audit at www.cambridge.wa.gov.au/EcoAudit or call 9347 6000

The winning Year 6 group with teacher Amanda Gibbon and mayor Simon Withers


Scouts join forces with mens shedsScouts and mens sheds are

getting together to share facili-ties and activities.

The agreement, due to be an-nounced at the Mosman Park shed on Saturday, will be the fi rst of its kind in Australia.

Scouts WA CEO Sherry Donaldson said the relation-ship would be great for scouts who could learn new skills from shed members for the WA Scouts

Award Scheme.She said scout halls that were

used on evenings and at week-ends would be available during the day for shed activities.

We are talking to mens sheds about sharing our facilities and joining us in some of our activities, such as Campwest and Cubilee, she said.

WA Mens Shed Association chairman Mike Wiggin said the connection would give mens sheds a way to reach out to young

people as well as take part in community development.

He said mens health and wellbeing were key areas for mens sheds.

Getting involved in the com-munity helps men to break down isolation and establish social networks, he said.

The agreement formalises joint activities that have al-ready started between the two organisations.

Many mens shed members are

retired tradesmen who share their skills.

Some mens sheds have dif-fi culty fi nding homes and some are operating in very small facilities and cant expand, he said.

In some locations, the scout hall is on a large enough block of land to accommodate a new mens shed that shares kitchens and toilets.

He said the sheds could run activities like art, photography

and IT training workshops in scout halls on weekdays, provided they did not involve machinery.

Scouts WA has 114 scout groups and there are more than 12,000 members in 165 mens sheds, including those planning sheds.

The mens sheds make up WAs biggest mens community organisation with more members than Lions, Rotary, Apex and Freemasons combined.

By DAVID HUDLESTON

Mosman Park backs cub kitchenScouts had a win when the chair

of Mosman Park corporate and technical services meeting used his casting vote.

It meant the committee passed a recommendation to give a new cub group $3000 to renovate the kitchen in their rundown hall.

The cubs are meeting in Alf Adams Pavilion until the old scout hall on the corner of Wellington and Solomon streets is renovated.

The cubs applied to the councils Community Chest for a $3000 grant to install the kitchen.

Mosman Park Mens Shed has signed on to help with the $112,500 renovation to fi x the hall, a 25-year eyesore, while the Friends of Mosman Park Bushland have agreed to help the cubs build a carbon-neutral, waterwise garden and

landscape the block.A report to the committee said the

renovated hall would then be a central location for community use after Scouts WA had paid for most of the structural, roof and electrical repairs.

It said the selection committee thought the project was well planned, much needed by the Mosman Park community, and refl ected great out-comes for a relatively small fi nancial contribution.

The committee did not support the Beehive Montessori Schools ap-plication for $3000 towards a $7600 aquaponics project.

The school hopes Year 7 and 9 stu-dents will create the system and look after it, with the rest of the school participating in sustainability and science lessons.

In its submission, the school said showcasing the project in newslet-ters, open days, and local community events, and by promoting its partner-ship with Western Earth Carers and the School Animal Ethics Committee, would encourage others to embrace sustainability and add to the towns reputation as a supporter of the en-vironment.

While the selection committee felt the project was well planned and of signifi cant value to the local school community, it was not community-driven.

It suggested promoting the project on the councils newsletter and Facebook page.

The recommendations will be con-sidered at the full council meeting on May 27.

The Mosman Park Mens Shed has volunteered to refurbish the old scout hall on the corner of Wellington and Solomon streets, which has been an

eyesore for 25 years.

Virtual mergerfor Grove, Cott

Peppermint Grove and Cottesloe councils and maybe Claremont are having an IT merger.

Grove workers hope the move will give their staff more time and offer more convenience for Cottesloe residents.

Grove corporate service manager Paul Rawlings reported to councillors on Tuesday that the shires fi nancial and electronic systems would move to Cottesloes server from early next fi nancial year.

Lots of Cottesloe residents use the library and the [Cottesloe Central] shops, Mr Rawlings said later.

It means they would be able to pay their Please turn to page 76

t4QPUMJHIUTt$IBOEFMJFSTt-BNQTBOE#BTFTt1FOEBOUTt8BMM-JHIUTt-PX7PMUBHF3FDFTTFE-JHIUTt(BSEFOT0VUEPPS-JHIUJOHt'MPPS4UBOETt(MPCFT.PSF

4UJSMJOH)XZ$MBSFNPOUt1IPOFtXXXMJHIUJOHBMFTDPNBVWJFXPVSPOMJOFTIPXSPPN

Once a Year Sale

MANY BASES AND SHADES AT HALF PRICE

25% OFF ALL LEADLIGHT PENDANTS AND LAMPS

"MM4UPDLEJTDPVOUFETPNFNPSFUIBO

Marie du Puy t +61 8 9322 4755 | m 0414 204 110

This luxury 2 bed apartment stands out from all the REST!The European stylish kitchen is the central focus of the living/dining room for entertainment with an extended 18m2 balcony with views of Wellington Square. A quiet tranquil tree scape location. ONE OF A KIND!

FOR SALE 14/178 Bennett Street, East PerthABSOLUTE WINNER! from $649,000

Home open Sat 12noon to 12.45pm FIRST TIME OFFERED!

On Christmas Eve last year, I parked in the Wilson carpark at the Ear Science Institute in Salvado Road, Subiaco.

My six-month-old daughter had had cochlear implant sur-gery earlier that month but there was a problem with the battery and they werent working.

Though it was Christmas Eve, I managed to get an appointment that afternoon and was advised it would take half an hour.

To be safe, I paid for one hours parking, but our appoint-ment started late and took longer than half an hour.

When we got back to the car we were 10 minutes late and had been issued a parking fi ne.

Given the circumstances, I asked Wilson Parking to review the fi ne, which they did and rejected.

I also asked why Wilson wouldnt have a parking system where you paid after being parked at a medical establish-ment.

I havent received a re-sponse.

What disappoints me most is that I have requested that a sen-ior offi cer from Wilson Parking

call and discuss my concerns, but this has not occurred.

How sad that a major corpora-tion like Wilson Parking doesnt have the strength of character to listen to a legitimate com-plaint.

I will unhappily pay the fi ne, but am disappointed that Wilson seems more concerned with generating revenue through fi nes than providing an effective parking service to its clients, in my opinion.

I will never park in a Wilson carpark again.

Ian LoganathanGsell Street, Wanguri

Northern Territory

The POST contacted Wilson Parking and a spokesperson said Mr Loganathans fine would be cancelled and the national man-ager of parking enforcement services would speak to him about it. Editor

Keep cyclistsoff footpaths

My wife and I are appalled at the recent government proposal to allow bicycle riders of any age to ride on footpaths, which has the potential to remove the only place of relative safety for walkers of all ages.

We are both over 80 and every day walk in the Hollywood ward, which is hazardous enough because the pavements are poorly maintained by Nedlands council.

Though these pavements are used by cycling students at local schools, we all get on well and acknowledge each other without diffi culty.

Hampden Road, Nedlands, and the area around the hospitals are a different matter, with the footpaths regularly used by cycle-riding students and staff, giving a fair indication of the problem and what we may suffer if the proposal proceeds.

Along Aberdare Road, Shenton Park, there is a perfectly good marked cycleway, yet cyclists continue to ride on the path.

This also occurs in other areas, which is ridiculous.

We can therefore only hope that the government reconsid-ers and retains the existing regulations.

John and Deirdre DuncanKingston Street, Nedlands

Page 12 POST, May 16, 2015


More letters page 14

Spend on students, not slogansAdding to its recent farcical

announcement of a Consensus Centre is the proliferation of signs around the University of WA proclaiming such pearls of wisdom as: Sometimes having a goal is more important that having a map.

Not only can the university not spell, but the cost of these signs has also deprived at least

two post-graduate students of scholarships and sustenance for this year.

Possibly many more student scholarships are affected by this ridiculous advertising campaign.

I feel the university is turning itself into a laughing stock.

Name and address withheld by request

A reader sent in this photo of an inspirational slogan on a slab outside UWAs business school.

Dog walkers should leash their snack-inclined pooches, says Swanbourne reader Bob Trotter, who sent in this photo of a turtle hatchling he saw this week on the bike path at Lake Claremont. He said it was about the size of a

50-cent piece.

Parking woes outside hearing institute

Democracyneeds debate

I must add a small voice to the chorus deploring UWAs decision to axe the Consensus Centre.

The decision refl ects badly on our state.

Democracy demands the full and frank expression of opinions

Opinions are best tested by debate and a university ought to provide a forum for public debate.

On the other hand, totalitar-ian organisations, especially if backed by religious or quasi-religious dogma, are the greatest opponents of free speech.

Ivor SurveyorLentara Crescent, City Beach

MAJOR PUBLIC AUCTION SUNDAY

24TH MAY AT 2PMViewing From 12 Noon

Prior To Auction

DONNELLY AUCTIONS with 40 years experience in antiques and collectables including Persian rugs are selling by public auction a collection of over 150 hand-woven rugs and carpets to cover debts owed to financial institutions by a major importer. We have agreed to sell the collection mostly unreserved and have not accepted any price guides from the vendor or bank.Payment methods: Cash, cheques (with ID), major credit cards.Delivery can be arranged. Buyers Premium 16.5% applies. (GST inclusive).MANY FINE SILK AND SILK INLAY PIECESALL PIECES GUARANTEED AUTHENTIC AND SOLD WITH CERTIFICATIONCollection offer is excellent and includes genuine hand-woven rugs and carpets.Sizes range from scatter room sized carpets, tribal, village and city rugs including fine large silk TABRIZ, CHOBI, Silk Inlay Indian JAIPUR, Superfine Persian QUM,SHIRAZ, BALUCHI, BAHKTIARI, TORKOMAN, KASHAN, BOKHARA, SARUQ and many more.AUCTIONEERS NOTE: This is a genuine mostly unreserved sale! This auction affords our clients the opportunity to purchase a magnificent hand-woven rug for a fraction of its retail or even sale price. If you have been considering enhancing your home or office with a fine quality hand-woven rug then this is an opportunity not to be missed.We will sell all items to the highest bidder, do not miss this one!

For more information please call Mat Donnelly 0408 881 722www.donellyauctions.com.au *COMPLIMENTARY CATALOGUES*

328 WALCOTT ST, MT LAWLEYMOSTLY UNRESERVED GENUINE CLEARANCE OF HAND-WOVEN

RUGS AND CARPETS FROM PERSIA

ALLITEMS

MUST BESOLD!

ng

de

OVEN


:H1RZPDNHSHUWKVILQHVWDXWKHQWLFELOWRQJ

EHHIELOWRQJBiltong is a South African word for air-dried meat. We take perfect cuts from the silverside or topside of the hindquarter, seasoned with a combination of spices and cured in our unique drying facility.

Choose from the luxurious taste of Ningaloo Wagyu biltong or the slightly dryer taste of premium WA beef biltong. Both lovingly prepared on site using the finest WA beef, together with our unique blend of herbs and spices.

JOIN US THIS WEEKEND TO SAMPLE THIS UNIQUE PRODUCT

POST, May 16, 2015


I regularly walk and cycle on the busy dual-use paths along the beautiful coast be-tween North Fremantle and Swanbourne.

What is not beautiful but, in my opinion, very dangerous is the poor condition of the path between Mosman Park beach and Cottesloe.

Not only are the paths far too narrow in places, making pass-ing diffi cult, but many popular areas are also cracked, uneven, worn, covered in sand or vegeta-tion, with faded markings that make it dangerous and confus-ing for all users.

These paths need urgent uni-versal upgrading to allow safe, healthy and enjoyable use by walkers, joggers, cyclists, people with prams and mobility aids, dogs and so on.

People of all ages and abilities need to feel safe when visiting the area, not have to constantly negotiate their way.

North Fremantle has made some substantial upgrades to its coastal paths and I believe Cottesloe and Mosman Park councils can do the same if not better for the community.

Erica SalihPalmerston Street, Mosman Park

Coastal paths need improving

Reader Erica Salih says sections of the dual-use path along the beach between Cottesloe and Mosman Park are unsafe and need fi xing.

Suburbs must be preserved

This is an exerpt from the pub-lication, From Limestone and Sandhills The Development of Floreat and City Beach, by Ian Pleydell, published 2003: The master plan for the Garden Suburbs of City Beach and Floreat date back to 1925.

They are both examples of town planning principles based on the ideals of the Garden City movement, a movement that greatly infl uenced city, town and suburban planners before and after World War I in many western countries.

It was certainly a power-ful force acting on the Perth City Council at the time with Town Clerk W.E Bold being the movements most prominent [supporter].

The author goes on to say: What we can ask, though, is for the heritage of the two suburbs not to be forgotten, and where practicable and equitable, protected.

It should be clearly evident to everyone what the motivating forces were in the development of the suburbs, and why things are as they are. That is, their cultural heritage must be pre-served in some way.

It is essential to promote the garden city concept in a conservational sense whenever possible, even if in respect for those like W.E. Bold who had the vision, or at least a vision, for the future people of Perth.

Lets hope Planning Minister John Day respects the vision of men like W.E Bold and those responsible for putting the Endowment Lands Act, 1920, in place.

Tony GoodlichTilton Terrace, City Beach

Marmion must get off the fenceWe are so lucky to have

the POST to keep residents informed of issues like the impending fate of Hollywood under the City of Perth Act.

Like many resi

post newspaper for 16th of may, 2015

Documents