October 2014 1575Biol. Pharm. Bull. 37(10) 1575–1582 (2014)

© 2014 The Pharmaceutical Society of Japan

Regular Article

Polyphenol Extracts from Punica granatum and Terminalia chebula Are Anti-inflammatory and Increase the Survival Rate of Chickens Challenged with Escherichia coliXinlu Zhong,a,# Yaran Shi,a,# Jiajia Chen,a Jianqing Xu,b Lei Wang,a Ross C Beier,c Xiaolin Hou,*,a and Fenghua Liu*,a

a College of Animal Science, Beijing University of Agriculture; Beijing 102206, China: b College of Veterinary Medicine, China Agricultural University; Beijing 100193, China: and c Food and Feed Safety Research Unit, Southern Plains Agricultural Research Center, Agricultural Research Service, United States Department of Agriculture; 2881 R&B Road, College Station, TX 77845, U.S.A.Received February 18, 2014; accepted July 3, 2014

Avian pathogenic Escherichia coli (APEC) causes inflammation in multiple organs of chickens called avian colibacillosis, and results in serious economic loss to the chicken industry. Polyphenolic compounds possess a wide range of physiological activities that may contribute to their beneficial effects against in-flammation-related diseases. In this study, the curative effect and mechanism of action of the polyphenolic extracts from Punica granatum L. and Terminalia chebula RETZ. in chickens challenged with APEC were studied. Specific-pathogen-free white Leghorn chickens (males, 21-d old) were challenged with APEC and then given oral administration of extracts of P. granatum and T. chebula. The extracts decreased the mor-bidity and inflammation induced by APEC. Data from quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay showed that the extracts of P. granatum and T. chebula polyphenols (GCP) reversed the over-expression genes of the Toll-like receptor (TLR) 2, 4, and 5, down-regulated the activation of nuclear factor-kappa B signal transduction pathways, and inhibited the production of pro-inflammatory cytokines. Naturally occurring GCP may be a potential alternative medicine for the prevention or treatment of avian colibacillosis.

Key words polyphenol; Escherichia coli; specific-pathogen-free chick; anti-inflammatory

Avian pathogenic Escherichia coli (APEC)1) are E. coli strains that can cause acute and predominant systemic coli-bacillosis in birds. Avian colibacillosis is a complex syndrome characterized by multiple organ lesions with airsacculitis and associated pericarditis, perihepatitis and with peritonitis being most typical; and the additional diseases, septicaemia, chronic respiratory disease, vitellus infection, salpingitis, peritoni-tis,  chronic  skin  infections,  and  osteomyelitis,2) and swollen head syndrome3) are usually involved. APEC is found in the intestinal microflora of healthy birds and most of  the diseases associated with them result from environmental and host pre-disposing factors. APEC strains cause invasive infection in chickens,  and more  specifically  in  broilers. Diseases  resulting from APEC decrease growth rate, increase mortality and mor-bidity,  and  cause  significant  economic  losses  in  the  poultry industry.2) APEC also can be transmitted to other animals or even humans by certain vectors, and can be a human health risk.3,4)

At present, the approach for the prevention and control of APEC infections include the control of environmental contam-ination and environmental parameters such as humidity and ventilation.  Vaccines  containing  killed  or  attenuated  virulent bacteria protect against infection with the homologous strain, but  are  less  efficient  against  heterologous  strains.  Therefore, vaccination for colibacillosis is not widely practiced due to the large variety of  strains  involved  in field outbreaks.1) Chemical drugs (antibiotics) are widely used, but antimicrobial com-pounds often eradicate intestinal commensal bacteria as well as pathogenic bacteria. The increasing antibiotic resistance

makes  the  use  of  antibiotic  treatments  less  effective.5,6) As a  result,  the  potential  drug  residues  in  livestock  and  poultry caused by the high use of antibiotics threaten the safety of our food supply.4)  Thus,  it  is  highly  desirable  to  find  alternative ways to control APEC.

Pomegranate (Punica granatum L.) and fruit of the Harītakī deciduous tree (Terminalia chebula RETZ.) are used in tradi-tional herbal Chinese medicine, and are used as an intestine astringent to relieve diarrhea and enteritis. P. granatum contains a wide range of phytochemicals which are primar-ily polyphenols.7) Studies have shown that activity of peel extracts of P. granatum is related to the polyphenol content.8) The polyphenols found in P. granatum have been shown to exert  anti-inflammatory,  antioxidant,  and  anticarcinogenic activity,9–11) and promote wound healing.12,13) Extracts of P. granatum  were  effective  at  protecting  human  skin  fibroblast from cell death following UV exposure, which was related to reduced  activation  of  the  pro-inflammatory  transcription  fac-tor nuclear factor-kappa B (NF-κB).14) Extracts of P. granatum were also a potent inhibitor of a number of bacteria, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Yer-sinia enterocolitica, and Salmonella enteritidis,8) and may be used to control various bacteria associated with oral infections in humans.15) The pharmacological effects of pomegranate have been known for a very  long  time and were mentioned  in Greek and Egyptian documents.16,17) Terminalia chebula RETZ. has been used for its healing properties throughout the ages in India  and  South-East  Asia,  and  is  anti-inflammatory,  antioxi-dant, antimicrobial, and has demonstrated wound healing ac-tivity.18) The fruits of T. chebula are rich in tannins, phenolics, and polyphenols, which are related to the antigenotoxic and chemopreventive activities of T. chebula.19,20)

* To whom correspondence should be addressed.  e-mail: hxlsx@163.com;  liufenghua1209@126.com

The authors declare no conflict of interest.# These authors contributed equally to this work.

1576  Vol. 37,  No. 10

APEC invades Birds primarily by damaging the intestine mucosa,  which  induces  regional  inflammation.  Activation of  the  Toll-like  receptor  (TLR)  signaling  pathway  plays  an important role in defense against invading pathogens.21) The TLR pathway strongly potentiates NF-κB activity and induces enhanced levels of the innate immune response.22) However, the over-activation of  the TLR pathway may cause  it  to break out of immune equilibrium and lead to injury of the host. Therefore, the TLR pathway activation must be controlled within a certain range. In the present study, the polyphenols from P. granatum and T. chebula modulation  of  TLR/NF-κB signaling  and  pro-inflammatory  mechanism  was  investigated in  specific-pathogen-free  (SPF)  chickens  following  challenge with APEC.

MATERIALS AND METHODS

The experimental procedures involving animals in this study were approved by the Animal Care Center of the Beijing University of Agriculture, Beijing, China.

Reagents and Materials P. granatum and T. chebula were purchased from the Tongrentang Traditional Chinese Medicine  Shop  (Beijing,  China).  Folin-Ciocalteau  reagent was procured from Sigma Chemical (Beijing, China). Other reagents were all analytical grade and from Beijing Chemical Reagents Co. (Beijing, China)

APEC (serotype O2 : K1) and O2  Serotype  monoclonal-antibody were obtained from the China Institute of Veterinary Drug  Control  (Beijing,  China).  Nutrient  broth,  nutrient  agar, MacConkey  aga,  Eosin  methylene  blue  agar  and  other  bio-chemical test tubes were obtained from the Beijing Aoboxing Bio-tech Co., Ltd. (Beijing, China).Interleukin  (IL)-1β  and  tumor  necrosis  factor  (TNF)-α

enzyme-linked  immunosorbent  assay  (ELISA)  kits  were obtained from Wuhan Cusabio Biotech. Co., Ltd. (Wuhan, China). Primers were synthesized by the Shanghai Shengong Bioengineering Co., Ltd. (Shanghai, China).Twenty  one-day  old  SPF  male  white  Leghorn  chickens 

were obtained from the Beijing Weitong Lihua Experimental Animal  Technology  Co.,  Ltd.  (Beijing,  China).  The  chickens were maintained under clean conditions in wire cages and were given access to water and feed ad libitum. The birds did not  receive  any  vaccination.  The  feed  for  the  chickens  were obtained  from Keaoxieli  Feedstuff  Co.,  Ltd.  (Beijing,  China). Basal  diet  nutrition  was  as  follwoings:  corn  62.05%,  wheat bran  2%,  soybean meal  17.7%,  rapeseed meal  5%,  cottonseed meal 2%, calcium bicarbonate 0.75%,  limestone powder 9.2%, salt  0.3%; metabolic  energy  2561 KJ/kg,  crude  protein  15.7%, calcium  3.49%,  total  phosphorus  0.49%,  lysine  0.691%,  me-thionine 0.256%, methionine+cysteine 0.549%.

Inoculum Preparation A small quantity of the APEC freeze-dried  powder  was  added  in  nutrient  broth,  and  incu-bated at 37°C for 24 h with agitation for recovery. Then the culture was harvested by centrifugation at 5000×g for 10 min and  the  cell  pellets  were  re-suspended  in  phosphate-buffered saline (PBS), pH 7.0. The number of bacteria in these solu-tions  was  determined  by  plate  counting  1 : 10  serial  dilution suspensions on nutrient agar plates. The titer was expressed as cfu/mL.

Preparation of Polyphenol Extract from Punica grana-tum L. and Terminalia chebula RETZ.   Briefly,  extracts  of 

P. granatum and T. chebula polyphenols (GCP, 1 : 1, g/g) were prepared  by  mechanically  grinding  air-dried  plant  material to  a  fine  powder.  The  powder  was  extracted  twice  with  10× volumes  of  ethanol–water  (60 : 40,  v/v)  at  40°C  for  10 h.  The twice extract was centrifuged 2000×g for 10 min, and the supernatant was rotatorily evaporated to near dryness under decreased-pressure  at  40°C  and  freeze-dried.  The  extracted dried material was stored in dark bottle until use.

Polyphenol Assay for the Extract Polyphenol content was determined according to the method of Anesini et al.23) Briefly,  5.0 mL  of  the  sample  extract  dissolved  in  water–methanol  (80 : 20, v/v) was  transferred  in duplicate  to separate tubes containing 1.0 mL of a 20% Folin–Ciocalteu’s reagent in water. Then, 4.0 mL of a sodium carbonate solution (7.5% w/v) was added. The tubes were allowed to stand at room tempera-ture for 60 min. Then the absorbance was measured at 760 nm against water. The total polyphenol content was expressed as gallic acid equivalents in g/g dried material. The concentra-tion of polyphenols in samples was calculated from a standard curve of gallic acid ranging from 10 to 50 µg/mL  (Pearson’s correlation coefficient: r2=0.9998).

Toxicity Effect of the GCP Extract on SPF Chick-ens   Twenty  four  chickens  were  provided water  and  feed  ad libitum.  At  28-d  of  age,  they  were  randomly  divided  into  4 groups.  The  treatment  lasted  for  seven  days  for  each  group: (1)  the  control  (C):  the  birds  were  daily  given  sterile  saline by oral gavage; (2) clinical dose of the GCP extract treatment (1×):  birds  were  received  a  daily  oral  gavage  of  the  GCP extract  dissolved  in  distilled water  at  a  dose  of  0.3 g/kg  body weight (BW); (3) 3 times of clinical dose of the GCP extract treatment (3×): birds were  received a daily oral gavage of  the GCP extract dissolved in distilled water at a dose of 0.9 g/kg BW;  (4)  5  times  of  clinical  dose  of  the GCP  extract  treat-ment (5×): birds were received a daily oral gavage of the GCP extract  dissolved  in  distilled  water  at  a  dose  of  1.5 g/kg  BW. On  the  8th  day,  all  birds  were  sacrificed.  the  GCP  toxicity was assessed by autopsy, histological examination and blood biochemical index.

Effects of the GCP Extract on Survival Rate of Chick-ens Challenged with APEC   At  28-d  of  age,  the  150  chick-ens  were  randomly  divided  into  five  groups  according  to treatment;  all  groups  received  treatment  for  7 d  at  8:00  pm by  controlled  oral  intake  using  syringe  delivery  of  saline  or the  GCP  extract.  During  the  experimental  period,  the  birds were provided water and feed ad libitum.  The  chickens  were divided  into  the  following  groups.  (1) Negative  control  (NC): the birds received standard water and feed ration, and were daily given sterile saline by oral gavage during the course of the  experiment.  (2)  Positive  control  (PC):  birds were  injected in the abdomen with 200 µL of an aqueous APEC solution at a concentration of 2×109 colony forming unit (cfu)/mL at the beginning of the experiment. 12 h after challenge, and each following day the birds received an oral gavage of sterile sa-line at a dose of 0.3 mL/kg BW for seven consecutive day; (3) PC plus a low dosage of the GCP extract treatment (PC+LT): birds were administered APEC as was the PC, and 12 h after challenge the birds received a daily oral gavage of the GCP extract  dissolved  in  distilled  water  at  a  dose  of  0.15 g/kg  for seven consecutive day; (4) PC plus a medium dosage of the GCP extract treatment (PC+MT):  birds  were  administered APEC as was the PC, and 12 h after challenge the birds re-

October 2014 1577

ceived a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.3 g/kg BW for seven consecutive day; (5) PC plus a high dosage of the GCP extract treatment (PC+HT): birds were administered APEC as  the PC, and 12 h after challenge the birds received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.6 g/kg BW for seven consecutive day. The mortality  rate  for each group was carried out at day 8.

The Anti-inflammatory Effect of APEC Infected Chick-ens Treated with GCP   Fifty-four  chickens  at  28 d  of  age were divided equally into three groups and provided water and feed ad libitum.  (1)  Negative  control  (NC),  the  birds  re-ceived daily oral gavage of sterile saline at a dose of 0.3 mL/kg  BW.  (2)  Positive  control  (P),  animals  were  injected  in  the abdomen with 200 µL of an aqueous solution of APEC at a concentration of 8×108 cfu/mL at the beginning of the experi-ment. Twelve hours after challenge, the birds received a daily oral  gavage  of  sterile  saline  at  a  dose  of  0.3 mL/kg  BW.  (3) Positive control plus treatment (P+T): birds were administered APEC as was the P, and beginning 12 h after challenge, the birds received a daily oral gavage of the GCP extract dis-solved in distilled water at dose of 0.3 g/kg BW.At  24,  72,  and  120 h  post-challenge,  six  birds  were  ran-

domly chosen from each group. The birds were anesthetized and sacrificed by  jugular exsanguination. Approximately 2 cm of ileum intestinal sections were collected under sterile condi-tions. Samples were stored at –80°C until analyzed by poly-merase chain reaction (PCR) and ELISA.

Total RNA Extraction, Reverse-Transcription and Quan-titative Real-Time PCR The ileum intestinal tissue was homogenized,  and  the  total  RNA was  isolated  from  each  ho-mogenized tissue sample using the TRIzol extraction method as described by the manufacturer (Invitrogen, Beijing, China). The total RNA was quantitated using an ND-1000 spectropho-tometer by determining the 260 nm/280 nm absorbance ratio (NanoDrop Technologies, Wilmington, DE, U.S.A.).cDNA  used  for  quantitative  real-time  PCR  (QRT-PCR)  as-

says was synthesized from 2 µg  of  purified  RNA  by  using 50 ng  of  random  hexamers  and  the  SuperScript  II  first-strand 

cDNA  synthesis  kit  according  to  the  instructions  of  the manufacturer  (Invitrogen,  Beijing,  China).  Briefly,  A  20 µL reaction mixture contained 2 µg of  total RNA,  0.5 µg of oligo dT  primer  (16–18  mer),  40 U  of  RNasin,  1000 µM of deoxy-ribonucleotide triphosphate mix, 10 mM of dithiothreitol, and 5 U  of  Moloney  murine  leukemia  virus  (M-MLV)  reverse transcriptase (Promega Biotech Co., Ltd., Beijing, China) in 1× reverse transcriptase buffer. The reaction mixture was in-cubated at 37°C for 1 h.All  primers  for  genes  encoding  for  TLR4,  NF-κB1(p50),

IL-1β,  IL-8,  TNF-α, intercellular adhesion molecule 1 (ICAM1)  and  vascular  cell  adhesion  molecule  1  (VCAM-1) were  designed  using  Primer  premier  5.0  and  the  DNAMAN software  program  using  sequences  acquired  from  GenBank. The specificity of the designed primers was initially examined by  comparison  of  the  primers  with  sequences  in  the  NCBI database  (http://blast.ncbi.nlm.nih.gov/Blast.cgi)  through BLAST  analysis,  and  then  experimentally  verified  through PCR assays. The PCR conditions for each target gene were optimized, and the optimal conditions are listed in Table 1.QRT-PCR  assays  were  performed  on  an  Applied  Biosys-

tems  ABI  7500  Real-Time  PCR  System  (Thermo  Fisher  Sci-entific, Waltham, MA, U.S.A.) with  Brilliant  II  SYBR Green QPCR  Master  Mix  (Stratage,  Beijing,  China).  cDNA  was diluted  10-fold,  and  1 µL  of  each  diluted  cDNA  sample  was added to a 25 µL reaction mixture containing 12.5 µL of Bril-liant  SYBR Green QPCR master Mix,  150 nM (each) primers, and 0.375 µL ROX reference dye. Cycling parameters were as follows:  an  initial  denaturation  at  95°C  for  10 min;  40  cycles of 30 s at 94°C, 1 min at the annealing temperature of 58°C, and extension for 0.5 min at 72°C. The conditions used for the dissociation  curves were  as  follows:  95°C  for  1 min,  55°C  for 30 s, and 95°C for 30 s.

Validation of the Expression for IL-1β and TNF-α Using ELISA Analysis To further validate the PCR data, an ELISA method was used to determine IL-1β and TNF-α.

Statistical Analysis The results are presented as the mean with the standard error (S.E.). The data were analyzed using GraphPad  Prism  5  software  to  determine  the  significant  dif-

Table 1. PCR Primers

Gene Accession number Primer sequence 5′→3′ Product length (bp)

β-Actin NM_205518 F: ACGTCTCACTGGATTTCGAGCAGG 298R: TGCATCCTGTCAGCAATGCCAG

NF-κB1 NM_205134 131 F: GAAGGAATCGTACCGGGAACA 131R: CTCAGAGGGCCTTGTGACAGTAA

TLR2 XM_003641159.1 F: CATTCACCATGAGGCAGGGATAG 157R: GGTGCAGATCAAGGACACTAGGA

TLR4 NM_001030693 F: TGCACAGGACAGAACATCTCTGGA 347R: AGCTCCTGCAGGGTATTCAAGTGT

TLR5 NM_001024586.1 F: TCCATCCTGGAGGAGCGTTA 260R: GGGCATTTGGCCCAGATCAT

IL-1β NM_204524.1 F: TGGGCATCAAGGGCTACAAG 267R: TGTAGGTGGCGATGTTGACC

TNF-α NM_204267.1 F: TGTGTATGTGCAGCAACCCGTAGT 229R: GGCATTGCAATTTGGACAGAAGT

ICAM-1 M_003642866.2 F: CCATACACATTGCGCTGCTC 170R: TCTACCACATCCTCCCCTGG

VCAM-1 M_004936551.1 F: CTGACTCGGGGCAGTACATC 228R: GGGTTGTGACCACATCACCT

1578  Vol. 37,  No. 10

ference. The t-test  values  of  less  than  0.05  were  considered statistically significant.

RESULTS

APEC infections were validated based on the clinical mani-festation of signs, pathologic examination, and isolation of E. coli. All E. coli strains were isolated from the liver surface of debilitated or dead chickens. The colony characteristics of  the isolated  strains were observed on MacConkey agar and Eosin methylene blue agar plates, and biochemical tests and serotype confirmed that these were confirmed to be APEC strains.

Extract Yield and Polyphenols Content Previous study showed that Punica granatum L. and Terminalia chebula RETZ contained relative higher polyphenolic substance.8,19,24) In this work, we extracted  the polyphenols using water–ethanol solu-tion,  and  obtained  a  33%  yield  of  extracted  dried  material. The  total  phenolic  content was  determined  at  28%  calculated as gallic acid equivalents in dried extract material.

The GCP Extract Showed No Toxicity on SPF Chickens To assess the toxicity, the mental status, food intake and other behavior  for  the  chickens  from  four  groups were  investigated in the whole experiment. The GCP toxicity was further diag-nosed at the 8th day by the means of autopsy, pathological ex-

amination, and biochemical test. After hematoxylin and eosin (HE)  staining,  the  liver,  kidney,  lung  histopathology  were investigated under light microscopy. The results indicated that all the groups were normal; the representative histopathology of  liver,  kidney,  and  lung  from  the  control  and  the  highest dosage group (5×) was shown in Fig. 1. The blood chemistry indexes  were  shown  in  Table  2,  which  were  no  significant difference between the control group and the three GCP treat-ment groups. The present results indicate that GCP, under the dosage,  was  non-toxicity  under  the  described  experimental conditions.

The GCP Extract Increased the Survival Rate of Chick-ens Challenged with APEC Strains In this study, the GCP extract  curative  effect  on  APEC  signs  in  SPF  chickens  was initiated  using  an  APEC  challenge  dose  equivalent  to  a  40% SPF  chicken  survival  rate.  The  study  demonstrated  that  the GCP extract alleviated the state of illness and prevented the mortality  of  chickens  challenged  with  APEC.  APEC  caused acute  systemic  infection  and  inflammation.  Chickens  in  each group began to die about 24 h after challenge, but the mortal-ity of the APEC positive control group was higher than the other GCP extract treated groups. The spiritual status and ill signs  showed  a  significant  improvement  in  a  dose-dependent relationship. The bird survival rates in the GCP treated

Fig.  1.  The Presentative Histopathology of the Control and the Highest Dose Group (5×) (HE, 200×)The above was the control, and the bottom was the highest dose group. From left to right, the tissues were liver, kidney, and lung, respectively.

Table  2.  Blood Biochemical Index of the GCP Extract on SPF Chickens

Groups ALT (U/L) AST (U/L) BUN (mmol/L) UA (umol/L)

C 4.00±2.10 225.0±42.05 0.43±0.10 188.17±12.371× 3.67±1.03 235.0±18.25 0.40±0.09 192.83±45.523× 3.33±1.03 265.0±43.51 0.32±0.04 197.83±63.395× 4.67±1.86 262.5±33.39 0.37±0.08 170.83±25.54

Table  3.  Survival Rate of Infected Chickens in Different Groups (n=30)

NC PC PC+LT PC+MT PC+HT

Daily weight gain (g) 14.49±2.05a 7.00±3.26c 12.68±2.29ab 11.57±2.26b 11.62±2.26b

Feed conversion 2.13±0.13c 3.02±0.48a 2.63±0.36b 2.24±0.27c 2.07±0.20c

Survival rate (%) 100 36.67 43.33 53.33 60.00

The difference was significant among different alphabets (p>0.05).

October 2014 1579

groups were shown in Table 3. When the GCP extract dosage increased  from 0.15 g/kg  to  0.6 g/kg BW,  the  survival  rate  in-creased  from 43.3%  to 60%. This  effect was  attributed  to  the GCP extract used to treat the chickens.

The GCP Extract Inhibited TLR2, 4, and 5 Expres-sion and the Activation of NF-κB in Chickens Challenged with APEC The TLR family is a highly conserved group of proteins that participate in pathogen recognition and in the initiation and regulation of the innate and adaptive immune responses. In this study, as shown in Fig. 2, the control group intestinal tissue expressed a baseline response for TLR2, 4,  and  5,  and  NF-κB; whereas, the APEC challenge stimu-lated  the  expression of  the TLRs and  the  activation of NF-κB (p<0.05).  The  GCP  extract  inhibited  the  over-expression  of the TLRs and activation of NF-κB to APEC (p<0.05).

GCP Extracts Decreased the Inflammatory Cytokine Concentration in Chicken Intestinal Tissue Following APEC Challenge   The mRNA expression of genes encoding for  the  cytokines,  TNF-α,  IL-1β,  IL-8,  ICAM1,  and  VCAM1 in  intestinal  tissues  were  measured  by  QRT-PCR.  The  cyto-kines  were  expressed  in  the  intestinal  tissue  of  the  negative chicken group, and were significantly enhanced in response to APEC challenge (p<0.05). The expression levels of the cyto-kines  decreased  at  all  three  time  points  after  receiving  GCP treatment (Fig. 3).The  gene  expression  end-products,  IL-1β  and TNF-α, were

further validated using an ELISA, the two different types of  data  were  relatively  consistent.  As  shown  in  Fig.  4,  IL-1β and TNF-α  in  the  positive  control  group  both  increased  post-challenge, while treatment with GCP extracts inhibited the over-expression of the pro-inflammatory cytokines.

DISCUSSION

The extractable chemical constituents of Punica grana-tum L. and Terminalia chebula RETZ. belong mainly to the polyphenols.  The  polyphenol  content  is  25–30%  in P. grana-tum,  and  23–37%  in  T. chebula RETZ.24) Their extracts have shown multiple pharmacological activities, such as antimi-crobial,8,15,25) cardiac action, antioxidant,11,26) antitumor,10,27,28) antiviral,29) and the promotion of wound healing.12,13)

The intestinal tract contains the largest reservoir of bacteria and  endotoxins  in  an  animal’s  body.  The  intestinal  tissue  is the first  line of defense against  invading microbial pathogens. Intestinal bacterial infection can lead to lower growth rate, disease  and  even  death.  APEC  strains  are  the  first  pathogens associated with digestive tract diseases in poultry production. The infected tissues respond to APEC infection by producing pro-inflammatory  cytokines  to  combat  the  invading  APEC strains.

In this research, intraperitoneal injection of APEC was used,30) following a high challenge dose of APEC (2×109), the occurrence  of  death  in  infected  chickens  decreased  following treatment by the GCP extract in a dose-dependent manner. For studying the pharmacological action mechanism of the GCP extract, the APEC challenge dose used was 8×108. This dos-age  caused  chickens  100%  morbidity  without  mortality.  The advantage of this dosage ensured a good consistency between samples. The GCP toxicity of 1, 3, 5 times of clinical dose and consecutive  administration  of  drug  for  21 d  on  SPF  chicken was previously tested, and the results showed that GCP had no affect on survival rate, blood biochemistry, histopathology. So we did not set the GCP control group in the study.

TLRs play an important role in the intestinal innate im-mune system initially in helping the intestinal tract recognize

Fig.  2.  The Relative Expression Levels of the Genes Coding for TLR2, 4, and 5, and NF-κBDifferent letters, a and b, indicate differences between groups at p<0.05.

1580  Vol. 37,  No. 10

bacteria. TLR2, 4, and 5 participate in the innate immune response to APEC and the development of enteritis.21,31) TLRs not only are immune recognition receptors on the cell surface, but also are transmembrane signal transduction molecules. TLR  stimulation  by  pathogen-associated  molecular  patterns (PAMPs) with  subsequent  changes  in  the  cytokine  profile  are major components of innate immunity,32) which are major in-teractions  involved  in  the  innate  resistance  to  Gram-negative 

bacteria,  but  also  in  the pathogenesis  of  septic  shock. TLR 2, 4, and 5 recognize APEC strains,33,34) TLR 2, 4, 5, respective-ly identify bacterial teichoic acid, LPS and flagellin. But inac-tive Escherichia coli induce TLR 2 and 4.35) In the process of Escherichia coli pathogen, LPS and other ingredients together help initiate the pro-inflammatory cytokines.21,36)

TLRs initiate a series of signal transduction intermediators and activate NF-κB to induce the production of pro-inflamma-

Fig.  3.  The Relative mRNA Expression Levels of the Cytokine GenesDifferent letters, a and b, indicate differences between groups at p<0.05.

Fig.  4.  IL-1β and TNF-α Levels of Intestine TissueDifferent letters, a and b, indicate differences between groups at p<0.05.

October 2014 1581

tory  cytokines.  NF-κB activation is essential for the expres-sion of a variety of cytokines.22) In the study, Escherichia coli induced expression of TLR 2, 4, 5 in various degrees. TLR4 was firstly  induced,  and  reached peak  at  the  third  day,  recov-ered close to normal at the fifth day. TLR2, TLR5 expressions were  later  induced,  and  kept  higher  at  the  fifth  day.  NF-κB1 (p50) was jointly induced by TLR2, 4, and 5, and partly re-covered at  the fifth day.  It  indicated TLRs-NF-κB pro-inflam-mation pathway was activated in the course of the disease. The GCP  treatment  significantly  reversed  the  over-expression of TLR2, 4, 5, and NF-κB1 (p50).Although TLR-mediated signaling is paramount in eradicat-

ing microbial infections and promoting tissue repair, the regu-lation must be  tight. TLRs-NF-κB signal pathway induces the transcription  and  translation  of  pro-inflammatory  cytokines, which  leads  to  the massive  release of  inflammatory cytokines and  adhesion molecules,  including  TNF-α,  IL-1β,  IL-6,  IL-8. ICAM1, VCAM1, and promote the proliferation of epithelial cells and inhibit intestinal bacterial translocation.37)

However,  over-production  of  cytokines  can  cause  impair-ment to the host. Macrophages and monocytes secreted pro-inflammatory  cytokines  like  TNF-α,  IL-1β,  and  IL-8  fol-lowing  the  bacteria  infectious  stimulation.  These  cytokines activated  inflammatory  cells  like  neutrophils,  macrophages, and monocytes released large amounts of the toxic oxidizing radicals, the result caused organ injury via the peroxidation of membrane lipids and the oxidative damage of proteins and DNA,  further  led  to  augment  of  local  tissue  injury.38)  TNF-α and  IL-1β  are  thought  to be  relative pro-cytokines can  trigger the  inflammatory  cascade  and  induce  other  cells  to  produce other  cellular  factors.  Blocking  the  production  of  these  cyto-kines  by  receptor  antagonists  inhibits  the  previous mentioned diseases. In local regions, these molecules lead to apoptosis of intestinal mucosal epithelial cells and damage organs and tis-sues  of  the  intestinal  tract.  Cytokines  can  also  act  on  distant organs  and  amplify  systemic  inflammatory  reactions.31) Com-pared  to  wild-type  mice,  intestinal  epithelial  damage  caused by  colitis was milder  in  TLR4-deficient mice.39,40) Expression of  NF-κB might contribute to the ureter damage observed in obstructive  uropathy,  and  inhibition  of  NF-κB could attenu-ate the tissue damage of obstructed ureters.41)  VCAM-1  and ICAM-1  participate  in  firm  adhesion  of  leukocytes  to  endo-thelial cells, which are secreted by endothelial cells activated by  proinflammatory  factors  and  are  thought  to  play  a  central role  in  the  development  of  tissue  inflammation.  Inflammation can induce VCAM-1 and ICAM-1, cause local thrombosis, and thrombosis can amplify inflammation.42)

In  the  study,  TNF-α,  IL-1β,  IL-8,  VCAM-1,  and  ICAM-1 were all induced by Escherichia coli  challenge,  The  over-expressioned cytokines  indicated  that  the chickens were  in an inflammatory  reaction  status,  while  the  down-regulation  of these inflammatory by administration of the GCP extract may partly explain  the beneficial anti-inflammatory and antithrom-botic effects, which exhibited protection of intestinal tissue in APEC infected chickens.

In summary, APEC infection elevated levels of TLR2, 4, and 5, induced the activation of NF-κB and enhanced the pro-duction of TNF-α, IL-1β, and other cytokines in chickens. The GCP  extract  treatment  inhibited  the  TLRs/NF-κB signaling pathway, and down-regulated  the production of TNF-α,  IL-1β, IL-8,  ICAM1,  and  VCAM1.  The  treatment  exerted  an  anti-

inflammatory  action,  and  resulted  in  the  decreased  mortality rate after challenge with APEC strains.

Acknowledgments This  work  was  supported  by  Grants from  the  National  Natural  Science  Foundation  of  China (31272478,  31372485),  the  National  Twelve-Five  Techno-logical  Supported  Plan  of  China  (2011BAD34B01),  and the Public Service Sectors Agriculture Research Projects (201003060–9/10).

REFERENCES

  1)  Dho-Moulin M, Fairbrother  JM. Avian pathogenic Escherichia coli (APEC). Vet. Res., 30, 299–316 (1999).

2) Barnes HJ, Gross WB. Colibacillosis. Diseases of poultry. 10th ed.  (Barnes HJ, Beard CW, Calnek BW eds.)  Iowa State University Press, Ames, pp. 131–141 (1997).

  3)  White DG, Wilson RA, Gabriel AS, Saco M, Whittam TS. Genetic relationships among strains of avian Escherichia coli associated with swollen-head syndrome. Infect. Immun., 58, 3613–3620 (1990).

  4)  Doyle MP, Erickson MC. Reducing the carriage of foodborne patho-gens in livestock and poultry. Poult. Sci., 85, 960–973 (2006).

  5)  Angst  DC,  Hall  AR.  The  cost  of  antibiotic  resistance  depends on evolutionary history in Escherichia coli. BMC Evol. Biol., 13, 163–170 (2013).

6) Witte W. Antibiotic resistance. Int. J. Med. Microbiol., 303, 285–286 (2013).

  7)  Galego  LR,  Jockusch  S,  Da  Silva  JP.  Polyphenol  and  volatile profiles  of  pomegranate  (Punica granatum L.) fruit extracts and liquors. Int. J. Food Sci. Technol., 48, 693–700 (2013).

  8)  Al-Zoreky NS. Antimicrobial  activity of pomegranate  (Punica gra-natum L.) fruit peels. Int. J. Food Microbiol., 134, 244–248 (2009).

  9)  Kawaii  S,  Lansky  EP.  Differentiation-promoting  activity  of  pome-granate (Punica granatum)  fruit  extracts  in  HL-60  human  promy-elocytic leukemia cells. J. Med. Food, 7, 13–18 (2004).

10)  Afaq  F,  Saleem  M,  Krueger  CG,  Reed  JD,  Mukhtar  H.  Anthocy-anin- and hydrolyzable tannin-rich pomegranate fruit extract modu-lates MAPK and NF-kappaB pathways and inhibits skin tumorigen-esis in CD-1 mice. Int. J. Cancer, 113, 423–433 (2005).

11)  Seeram  NP,  Adams  LS,  Henning  SM,  Niu  Y,  Zhang  Y,  Nair MG, Heber D.  In vitro antiproliferative, apoptotic and antioxidant activi-ties of punicalagin, ellagic acid and a total pomegranate tannin ex-tract are enhanced in combination with other polyphenols as found in pomegranate juice. J. Nutr. Biochem., 16, 360–367 (2005).

12)  Murthy KNC, Reddy VK, Veigas JM, Murthy UD. Study on wound healing activity of Punica granatum peel. J. Med. Food, 7, 256–259 (2004).

13)  Hayouni  EA,  Miled  K,  Boubaker  S,  Bellasfar  Z,  Abedrabba  M, Iwaski  H,  Oku  H,  Matsui  T,  Limam  F,  Hamdi  M.  Hydroalcoholic extract  based-ointment  from  Punica granatum L. peels with en-hanced in vivo healing potential on dermal wounds. Phytomedicine, 18, 976–984 (2011).

14)  Pacheco-Palencia LA, Noratto G, Hingorani L, Talcott ST, Mertens-Talcott SU. Protective effects of standardized pomegranate (Punica granatum  L.)  polyphenolic  extract  in  ultraviolet-irradiated  human skin fibroblasts. J. Agric. Food Chem., 56, 8434–8441 (2008).

15) Abdollahzadeh Sh, Mashouf R, Mortazavi H, Moghaddam M, Roozbahani  N,  Vahedi  M.  Antibacterial  and  antifungal  activities of Punica granatum peel extracts against oral pathogens. J. Dent. (Tehran), 8, 1–6 (2011).

16)  Braga LC,  Shupp  JW, Cummings C,  Jett M,  Takahashi  JA, Carmo LS,  Chartone-Souza  E,  Nascimento  AM.  Pomegranate  extract  in-hibits Staphylococcus aureus growth and subsequent enterotoxin production. J. Ethnopharmacol., 96, 335–339 (2005).

17)  Reddy  MK,  Gupta  SK,  Jacob  MR,  Khan  SI,  Ferreira  D.  Antioxi-

1582  Vol. 37,  No. 10

dant,  antimalarial  and  antimicrobial  activities  of  tannin-rich  frac-tions, ellagitannins and phenolic acids from Punica granatum L. Planta Med., 73, 461–467 (2007).

18)  Bag  A,  Bhattacharyya  SK,  Chattopadhyay  RR.  The  development of Terminalia chebula RETZ.  (Combretaceae):  in  clinical  research. Asian Pac. J. Trop. Biomed., 3, 244–252 (2013).

19)  Pfundstein  B,  El  Desouky  SK,  Hull  WE,  Haubner  R,  Erben  G, Owen RW. Polyphenolic compounds in the fruits of Egyptian me-dicinal plants (Terminalia bellerica, Terminalia chebula and Termi-nalia horrida):  characterization,  quantitation  and  determination  of antioxidant capacities. Phytochemistry, 71, 1132–1148 (2010).

20)  Pellati F, Bruni R, Righi D, Grandini A, Tognolini M, Pio Prencipe F, Poli F, Benvenuti S, Del Rio D, Rossi D. Metabolite  profiling of polyphenols in a Terminalia chebula RETZIUS ayurvedic decoction and evaluation of its chemopreventive activity. J. Ethnopharmacol., 147, 277–285 (2013).

21)  Munyaka  PM,  Tactacan  G,  Jing  M,  O  K,  House  JD,  St.  Paul  M, Sharif  S,  Rodriguez-Lecompte  JC.  Response  of  older  laying  hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid. Poult. Sci., 92, 105–113 (2013).

22)  Luo  H,  Guo  P,  Zhou  Q.  Role  of  TLR4/NF-kappaB  in  damage  to intestinal mucosa barrier function and bacterial translocation in rats exposed to hypoxia. PLoS ONE, 7, e46291 (2012).

23) Anesini C, Ferraro GE, Filip R. Total polyphenol content and anti-oxidant capacity of commercially available tea (Camellia sinensis) in Argentina. J. Agric. Food Chem., 56, 9225–9229 (2008).

24)  Reddy  BM,  Rao  NK,  Ramesh  M,  Rao  AVN,  Lin  LJ,  Lin  LZ, Cordell GA. Chemical investigation of the fruits of Terminalia che-bula. Pharm Biol., 32, 352–356 (1994).

25)  Choi JG, Kang OH, Lee YS, Chae HS, Oh YC, Brice OO, Kim MS, Sohn DH, Kim HS, Park H, Shin DW, Rho  JR, Kwon DY.  In vitro and in vivo antibacterial activity of Punica granatum peel ethanol extract against Salmonella. Evid. Based Complement. Alternat. Med., 2011, 690518 (2011).

26)  Kaur  G,  Jabbar  Z,  Athar  M,  Alam  MS.  Punica granatum (pome-granate)  flower  extract  possesses  potent  antioxidant  activity  and abrogates  Fe-NTA  induced  hepatotoxicity  in  mice.  Food Chem. Toxicol., 44, 984–993 (2006).

27) Lin CC, Hsu YF, Lin TC. Effects of punicalagin and punicalin on carrageenan-induced  inflammation  in  rats.  Am. J. Chin. Med., 27, 371–376 (1999).

28)  Sineh  Sepehr K,  Baradaran  B, Mazandarani M, Khori  V,  Shahneh FZ. Studies on the cytotoxic activities of Punica granatum L. var. spinosa (apple punice) extract on prostate cell line by induction of apoptosis. ISRN Pharmaceutics, 2012, 547942 (2012).

29) Biasi F, Astegiano M, Maina M, Leonarduzzi G, Poli G. Polyphenol supplementation as a complementary medicinal approach to treat-ing  inflammatory bowel disease. Curr. Med. Chem., 18, 4851–4865 (2011).

30)  Li J, Li D. Study on the broilers model infected with E. coli. and its pathological indexes. China Poultry, 28, 12–15 (2006).

31)  Fukata  M,  Michelsen  KS,  Eri  R,  Thomas  LS,  Hu  B,  Lukasek  K, 

Nast  CC,  Lechago  J,  Xu  R,  Naiki  Y,  Soliman A,  Arditi M,  Abreu MT.  Toll-like  receptor-4  is  required  for  intestinal  response  to  epi-thelial injury and limiting bacterial translocation in a murine model of acute colitis. Am. J. Physiol. Gastrointest. Liver Physiol., 288, G1055–G1065 (2005).

32) Manicassamy S, Pulendran B. Modulation of adaptive immunity with Toll-like receptors. Semin. Immunol., 21, 185–193 (2009).

33)  Bambou  JC,  Giraud A, Menard  S,  Begue  B,  Rakotobe  S,  Heyman M, Taddei F, Cerf-Bensussan N, Gaboriau-Routhiau V.  In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epi-thelial cells by a commensal Escherichia coli strain. J. Biol. Chem., 279, 42984–42992 (2004).

34)  Gilbert FB, Cunha P, Jensen K, Glass EJ, Foucras G, Robert-Granie C,  Rupp  R,  Rainard  P.  Differential  response  of  bovine  mammary epithelial cells to Staphylococcus aureus or Escherichia coli ago-nists of the innate immune system. Vet. Res., 44, 40 (2013).

35)  Yang W, Zerbe H, Petzl W, Brunner RM, Gunther J, Draing C, von Aulock  S,  Schuberth  HJ,  Seyfert  HM.  Bovine  TLR2  and  TLR4 properly transduce signals from Staphylococcus aureus and E. coli, but S. aureus  fails  to  both  activate  NF-kappaB  in  mammary epithelial  cells  and  to  quickly  induce  TNFalpha  and  interleukin-8 (CXCL8) expression in the udder. Mol. Immunol., 45, 1385–1397 (2008).

36)  Kogut  MH,  He  H,  Kaiser  P.  Lipopolysaccharide  binding  protein/CD14/ TLR4-dependent  recognition of Salmonella LPS induces the functional  activation  of  chicken  heterophils  and  up-regulation  of pro-inflammatory cytokine and chemokine gene expression in these cells. Anim. Biotechnol., 16, 165–181 (2005).

37)  Wullaert  A.  Role  of  NF-kappaB  activation  in  intestinal  immune homeostasis. Int. J. Med. Microbiol., 300, 49–56 (2010).

38) Feihl F, Waeber B, Liaudet L. Is nitric oxide overproduction the target  of  choice  for  the  management  of  septic  shock?  Pharmacol. Ther., 91, 179–213 (2001).

39)  Heimesaat  MM,  Fischer  A,  Siegmund  B,  Kupz  A,  Niebergall J,  Fuchs  D,  Jahn  HK,  Freudenberg  M,  Loddenkemper  C,  Batra A, Lehr HA, Liesenfeld O, Blaut M, Gobel UB, Schumann RR, Bereswill  S.  Shift  towards  pro-inflammatory  intestinal  bacteria  ag-gravates acute murine colitis via  Toll-like  receptors  2  and  4. PLoS ONE, 2, e662 (2007).

40)  Ohkawara  T,  Takeda  H,  Nishihira  J,  Miyashita  K,  Nihiwaki  M, Ishiguro Y, Takeda K, Akira S,  Iwanaga T, Sugiyama T, Asaka M. Macrophage migration inhibitory factor contributes to the develop-ment  of  acute  dextran  sulphate  sodium-induced  colitis  in  Toll-like receptor  4  knockout  mice.  Clin. Exp. Immunol., 141, 412–421 (2005).

41)  Chuang  YH,  Chuang WL,  Huang  SP,  Liu  CK,  Huang  CH.  Inhibi-tion  of  nuclear  factor-kappa  B  (NF-κB) activation attenuates ure-teric damage in obstructive uropathy. Pharmacol. Res., 60, 347–357 (2009).

42)  Ryu  M,  Kim  EH,  Chun  M,  Kang  S,  Shim  B,  Yu  YB,  Jeong  G, Lee JS. Astragali Radix  elicits  anti-inflammation  via activation of MKP-1, concomitant with attenuation of p38 and Erk. J. Ethnophar-macol., 115, 184–193 (2008).