polymorphisms of anti-lipopolysaccharide factors in the swimming crab portunus trituberculatus and...

at SciVerse ScienceDirect

Fish & Shellfish Immunology 34 (2013) 1560e1568

Contents lists available

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate/ fs i

Polymorphisms of anti-lipopolysaccharide factors in the swimming crab Portunustrituberculatus and their association with resistance/susceptibility to Vibrioalginolyticus

Xihong Li a,b, Zhaoxia Cui a,*, Yuan Liu a,b, Chengwen Song a,b, Guohui Shi a,b, Chunlin Wang c

a EMBL, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, ChinabGraduate University of the Chinese Academy of Sciences, Beijing 100039, Chinac School of Marine Science, Ningbo University, Ningbo 315211, China

a r t i c l e i n f o

Article history:Received 7 December 2012Received in revised form1 March 2013Accepted 24 March 2013Available online 6 April 2013

Keywords:Portunus trituberculatusALFPolymorphismVibrio alginolyticusResistance/susceptibility

* Corresponding author. Tel./fax: þ86 532 8289850E-mail address: [email protected] (Z. Cui).

1050-4648/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.fsi.2013.03.373

a b s t r a c t

Anti-lipopolysaccharide factor (ALF) is an important antimicrobial peptide (AMP) that can bind andneutralize major component of Gram-negative bacteria cell wall, lipopolysaccharide (LPS). Seven iso-forms of anti-lipopolysaccharide factors (PtALF1-7) were previously identified from the swimming crabPortunus trituberculatus in our laboratory. Here, polymorphisms of PtALF1-7 were detected and theirassociation with resistance/susceptibility to Vibrio alginolyticus (a main Gram-negative bacteria causinghigh mortality in P. trituberculatus) were investigated. We identified 127, 96, 103, 53 and 158 singlenucleotide polymorphisms (SNPs) in genomic fragments of PtALF1-3, PtALF4, PtALF5, PtALF6 and PtALF7,respectively. Among them, totally sixteen SNPs were significantly associated with resistance/suscepti-bility to V. alginolyticus (P < 0.05). Of these sixteen SNPs, most were located in introns and noncodingexons, while two synonymous SNPs and one nonsynonymous SNP were in coding exons. Additionally,simple sequence repeats (SSRs) were only identified in introns and noncoding exons of PtALF4, PtALF5and PtALF7. Although no significant difference of allele frequencies was found, these SSRs had differentpolymorphic alleles according to the repeat number between susceptible and resistant stocks. Afterfurther confirmation, polymorphisms investigated here might be applied as potential molecular markersfor future selection of resistant strains to diseases caused by Gram-negative bacteria.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

The swimming crab Portunus trituberculatus (Crustacea:Decapoda: Brachyura) (Miers, 1876), is a crucial aquaculture craband widely artificially propagated in China. However, with thedevelopment of intensive culture, serious diseases caused by bac-teria, fungi and viruses frequently occurred and led to great eco-nomic losses [1e3]. Developing new strains of swimming crabwithhigh resistance to pathogen is considered as a main effective so-lution to disease control.

Traditional selective breeding techniques, which estimatebreeding value of individuals on the basis of phenotypes, are alwaystime-consuming, easily influenced by environment and could notfulfill the urgent need for resistant strains [4]. As a result, it is quitenecessary to develop other methods to accelerate selection ofthoroughbred. Marker assisted selection (MAS) is a molecular

9.

All rights reserved.

method that uses DNAmarkers for selection based on genotype andmakes the selection more convenient and cost-effective [5]. Inrecent years, different genes and polymorphisms have been re-ported to have association with pathogen or disease resistance invarious invertebrates and vertebrates, such as Chlamys farreri [6],Argopecten irradians [7], Meretrix meretrix [8], Crassostrea virginica[9], Litopenaeus vannamei [10,11], Penaeus (Fenneropenaeus) chi-nensis [12], grass carp [13,14], sheep [15,16] and human [17e19].Moreover, DNA markers including single nucleotide poly-morphisms (SNPs) and simple sequence repeats (SSRs) have beenreported to be correlated with growth related traits [8,20,21].However, knowledge of gene polymorphism and disease suscepti-bility in P. trituberculatus is still inadequate and scarce. It is essentialto detect molecular markers associated with quantitative traits andto research interaction between genetic polymorphisms and im-munity phenotypes for the improvement of MAS in swimmingcrab.

Genes related to immune responses are thought of optimalcandidates for markers that are associated with resistance topathogen [6]. Previous studies demonstrated that the anti-

Delta:1_given name

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_given name

Delta:1_surname

mailto:[email protected]

www.sciencedirect.com/science/journal/10504648

http://www.elsevier.com/locate/fsi

http://dx.doi.org/10.1016/j.fsi.2013.03.373



X. Li et al. / Fish & Shellfish Immunology 34 (2013) 1560e1568 1561

lipopolysaccharide factor (ALF), a small amphipathic protein whichcan bind and neutralize the main component of Gram-negativebacteria, lipopolysaccharide (LPS) [22,23], is an important type ofantimicrobial peptides (AMPs) and plays a major function in innateimmunity. ALFwas first characterized in the horseshoe crab Limuluspolyphemus [24] and gradually studied in crustaceans [25e30].Seven isoforms of ALF homologs (PtALF1-7) representing by 191ESTs were identified from hemocytes and eyestalk cDNA libraries ofP. trituberculatus [31]. Recombinant PtALFs showed different levelsof in vitro antimicrobial activities against Gram-negative bacteriaand they all displayed clear time-dependent response expressionpattern after challenge with Vibrio alginolyticus, which is themain pathogen that causes high mortality in P. trituberculatus[30,32e34].

Although ALF genes from many aquatic animals have beencloned and characterized, little is known about the associationbetween ALF sequence polymorphisms and immunity phenotypes.The objective of this study is to identify polymorphisms of PtALF1-7and investigate possible association of these polymorphisms withresistance/susceptibility to V. alginolyticus.

2. Materials and methods

2.1. Crabs and V. alginolyticus challenge

Two hundred swimming crabs that averaged 10.84 � 0.10 cm inshell length were collected from a commercial farm (Qingdao,China) and acclimatized in aerated seawater at 15 � 1 �C for a weekbefore processing. During whole period of the experiment, crabswere fed with clam meat once daily at night and seawater waschanged every day.

For bacterial challenge experiment, crabs were randomlydivided into five seawater tanks (40 crabs in each group). Crabs inthree tanks that received an injection of 100 mL live V. alginolyticussuspended in 0.1 mol/l PBS (pH 7.0, 5 � 108 cfu mL�1) at thearthrodial membrane of the last walking leg were used as chal-lenged group. Untreated crabs in one tankwere used as blank groupand crabs in another tank that received an injection of 100 mL PBSwere used as control group. All crabs were observed hourly toidentify those that had died until they were sampled at 130 h post-challenge. The first crabs that die in the early time were regardedrelatively susceptible to V. alginolyticus (susceptible stock), and thelast survivors of the bacterial challenge experiment were regardedrelatively resistant to V. alginolyticus (resistant stock). Muscle ofeach crab was removed and kept at �20 �C until genomic DNAwasextracted.

2.2. Sampling and DNA extraction

To detect gene polymorphisms and characterize the poly-morphic loci with resistance to V. alginolyticus, appendages were

Table 1Primers used in the present study.

Gene Primer sequence (50 to 30) Ga

PtALF1-3 F: GCTCAGTATGAGGCTCTG HR: TTCAAGTCTTACGGCTATT

PtALF4 F: GACGCTCTGAAGGACTTTATG JFR: ATAGTATCACATTCACAGTCAGGC

PtALF5 F: ATCAGCAGGTGGGAACTCAA JFR: CTGTCTTTTTGATAACTTCCTCG

PtALF6 F: CGAACAACAGTGCGAGTAAGCT JFR: GTTACAGAATGGTGAGTTTTAC

PtALF7 F: GCATTGAAGACTACGCAACTAAAC JFR: ATCAGCGTTCAATCCATTCCTTCC

collected from susceptible and resistant crabs. Genomic DNA wasisolated from muscle tissue of each crab following a standardphenolechloroform protocol [35].

2.3. Primers, PCR amplification and sequencing

Gene-specific primers were designed basing on the sequences ofseven isoforms of ALFs in P. trituberculatus (PtALF1-3, GenBankaccession no. HM536671; PtALF4, GenBank accession no. JF756054;PtALF5, GenBank accession no. JF756055; PtALF6, GenBank acces-sion no. JF756056; PtALF7, GenBank accession no. JF756057) toamplify genomic DNA fragments (Table 1). Primers without refer-ence in Table 1 were also designed according to our previousstudies.

PCR amplification was performed in a 25 mL reaction volumewhich contained 19.8 mL of sterile distilled H2O, 2.5 mL of 10 � PCRbuffer (TransGen), 0.5 mL of dNTP (10 mM), 0.5 mL forward primer(10 mM), 0.5 mL reverse primer (10 mM), 0.2 mL (1 U) of EasyTaq DNApolymerase (TransGen) and 1 mL of template DNA. The reactionwasdone on TaKaRa PCR Thermal Cycler Dice Model TP600 (Takara BioInc.) with the following conditions: an initial denaturation at 94 �Cfor 3 min, 34 cycles of 94 �C for 30 s, 55 �C for 50 s and 72 �C for2 min, and a final extension of 72 �C for 10 min.

PCR products were detected by electrophoresis on 1% agarosegels and purified by a PCR gel purification kit (Axygen). Objectivefragments were then ligated with pMD19-T simple vector (TaKaRa)and transformed into Trans1-T1 phage resistant chemicallycompetent cell (TransGen). Positive recombinant clones identifiedby screening with M13 forward and reverse primers were thensequenced using an ABI3730 Automated Sequencer (AppliedBiosystem).

2.4. Identification and analysis of SNPs in PtALF genes

Sequences of PtALFs from different crabs were aligned usingClustal X and polymorphisms were identified from these align-ments. SNP genotype of each sample was determined on the basisof sequencing chromatograms.

SNPs with different mutation frequency between resistant andsusceptible stocks were chose to be representative. Data statisticalanalysis of these representative SNPs was characterized with thesoftware SPSS 16.0. Significant analysis of genotype and allele fre-quencies between resistant and susceptible stocks was calculatedby c2 test. Alphawas set at 0.05 for a significant difference and 0.01for an extremely significant difference.

2.5. Identification and analysis of SSRs in PtALF genes

Each individual SSR allele (or haplotype) was identified and therepeat number of each unit was counted using the software

enBankccession no.

Amplificationlength

Reference

M536671 981 bp Liu et al. (2011)

756054 932 bp Liu et al. (2012)

756055 1743 bp Liu et al. (2012)

756056 821 bp

756057 1481 bp

Fig. 1. SNPs and deduced amino acids of PtALF1-3 in P. trituberculatus. (A) SNPs of PtALF1-3. Nucleotides are numbered on the left. Sequences of exons are shown in capital lettersand sequences of introns are shown in small letters. Start and stop codons are boxed. SNP sites are underlined and the mutations are described below. (B) Deduced amino acids ofPtALF1-3. Non-synonymous mutations are underlined and the variations are described below. Synonymous mutations are marked with arrowheads. Early termination mutation isshadowed and marked with asterisk.

X. Li et al. / Fish & Shellfish Immunology 34 (2013) 1560e15681562

SSRHunter. c2 test was used to analyze the difference of repeatnumber frequencies between resistant and susceptible stocks.

3. Results

3.1. Identification of susceptible and resistant crabs

Among 120 challenged individuals, the first dead crabwas foundat 7 h after infection with V. alginolyticus. Thirty crabs that died inthe first 100 h were regarded as susceptible stock, whereas thirty-two that survived after challenge for 130 h were regarded asresistant stock. No dead crabs were observed in blank and controlgroups.

Table 2Distribution of PtALF1-3 SNPs in susceptible and resistant stocks.

Serial No. Position Genotype Genotype No. (%) c2

Susceptible Resistant

1 I2-32 T/T 15(55.6) 23(74.2) 2.219�/� 12(44.4) 8(25.8)

2 I2-34 T/T 25(92.6) 24(77.4) 2.534A/A 2(7.4) 7(22.6)

3 E3-169 A/A 15(55.6) 9(29.0) 5.249A/G 0(0.0) 2(6.5) 3.194G/G 12(44.4) 20(64.5)

4 E3–200 T/T 15(55.6) 10(32.3)C/C 12(44.4) 21(67.7)

5 E3-514 T/T 15(55.6) 9(29.0) 4.185�/� 12(44.4) 22(71.0)

E indicates exon, I indicates intron and the number in position indicates number of base* Indicates significant difference and ** indicates extremely significant difference betwe

3.2. Analysis of SNPs in PtALF genes

3.2.1. SNPs of PtALF1-3 gene and association with V. alginolyticus-resistance

Previous study had showed that PtALF1, 2 and 3 were encodedby the same genomic locus and obtained by different pre-mRNAsplicing [32], so genomic sequences of PtALF1-3 were character-ized together here. By sequencing from 27 susceptible specimensand 31 resistant specimens of P. trituberculatus, 127 SNPs including107 transitions, 15 transversions and 5 indels were detected inPtALF1-3 gene (Fig. 1A). Of these, 30 SNPs were found in introns, 33were in coding exons and 64 were in noncoding exons. 24 codingSNPs were non-synonymous mutations and 8 were synonymous

P Base type Allele No. (%) c2 P


0.136 T-Ins 30(55.6) 46(74.2) 4.438 0.035*T-Del 24(44.4) 16(25.8)

0.111 T 50(92.6) 48(77.4) 5.069 0.024*A 4(7.4) 14(22.6)

0.072 A 30(55.6) 20(32.3) 6.388 0.011*0.074 G 24(44.4) 42(67.7) 6.388 0.011*

T 30(55.6) 20(32.3)C 24(44.4) 42(67.7)

0.041* T-Ins 30(55.6) 18(29.0) 8.370 0.004**T-Del 24(44.4) 44(71.0)

pairs. P values less than 0.05 were shown in bold.en resistant and susceptible stocks.

Fig. 2. SNPs (A) and deduced amino acids (B) of PtALF4 in P. trituberculatus.


mutations (Fig. 1B). Transition of G179 to A led to early terminationof open reading frame (ORF) (Fig. 1B).

Genotype and allele frequencies of SNPs in PtALF1-3 wereanalyzed between susceptible and resistant stocks (Table 2). OneSNP (E3-514 T-ins/del) was significantly different in both genotypeand allele frequencies between the two stocks (P < 0.05), of whichT-del allele was more prevalent in resistant crabs (71.0%) than insusceptible crabs (44.4%). In addition, c2 test also revealed anotherfour SNPs (I2-32 T-ins/del, I2-34 T-A, E3-169 A-G and E3-200 T-C)that had significant difference in genotype frequencies betweensusceptible and resistant stocks (P < 0.05).

3.2.2. SNPs of PtALF4 gene and association with V. alginolyticus-resistance

A 932 bp fragment of PtALF4 in exon3 was amplified from 28susceptible specimens and 25 resistant specimens. By sequencing

Table 3Distribution of PtALF4 SNPs in susceptible and resistant stocks.

Serial No. Position Genotype Genotype No. (%) c2


1 1504 G/G 17(60.7) 10(40.0) 3.075G/A 2(7.1) 1(4.0)A/A 9(32.1) 14(56.0)

2 1692 T/T 16(57.1) 6(24.0) 5.975C/C 12(42.9) 19(76.0)

3 1713 T/T 21(75.0) 13(52.0) 3.038C/C 7(25.0) 12(48.0)

4 1719 G/G 16(57.1) 6(24.0) 5.975A/A 12(42.9) 19(76.0)

5 1753 G/G 16(57.1) 6(24.0) 5.975T/T 12(42.9) 19(76.0)

6 1829 T/T 10(35.7) 4(16.0) 2.641�/� 18(64.3) 21(84.0)

* Indicates significant difference and ** indicates extremely significant difference betwee

and alignment, 96 SNPs including 77 transitions, 16 transversionsand 3 indels were found in the investigated region (Fig. 2A). Onlyfour SNPs were detected in coding exons, of which two (1517 T-Cand 1526 C-T) were non-synonymousmutations that changedW121to R and H124 to Y by transitions of T1517 to C and C1526 to T, and theother two (1504 G-A and 1509 G-T) were synonymous mutationsthat encoded E116 and A118, respectively (Fig. 2B).

Genotype and allele frequencies of SNPs in PtALF4 wereanalyzed between susceptible and resistant stocks (Table 3). Ac-cording to the results of c2 test, three SNPs (1692 T-C, 1719 G-A and1753 G-T) exhibited significant (P < 0.05) difference in genotypefrequencies and extremely significant (P < 0.01) difference in allelefrequencies between susceptible and resistant crabs. Results alsorevealed another three SNPs (1504 G-A, 1713 T-C and 1829 T-ins/del) that had significant difference (P < 0.05) only in allelefrequencies.

P Base type Allele no. (%) c2 P


0.215 G 36(64.3) 21(42.0) 5.278 0.022*A 20(35.7) 29(58.0)

0.015* T 32(57.1) 12(24.0) 11.951 0.001**C 24(42.9) 38(76.0)

0.081 T 42(75.0) 26(52.0) 6.0776 0.014*C 14(25.0) 24(48.0)

0.015* G 32(57.1) 12(24.0) 11.951 0.001**A 24(42.9) 38(76.0)

0.015* G 32(57.1) 12(24.0) 11.951 0.001**T 24(42.9) 38(76.0)

0.104 T-Ins 20(35.7) 8(16.0) 5.282 0.022*T-Del 36(64.3) 42(84.0)

n resistant and susceptible stocks. P values less than 0.05 were shown in bold.



By sequencing from 18 susceptible samples and 17 resistantsamples, 103 SNPs including 78 transitions, 19 transversions and 6indels were identified in genomic sequence of PtALF5 gene(Fig. 3A). Of these, 62 SNPs were found in introns, 9 were in codingexons and 32 were in noncoding exons (Fig. 3A). Four coding SNPswere synonymous mutations and five were non-synonymous mu-tations (Fig. 3B). Early termination of ORF occurred for the transi-tion of C25 to T.

Genotype and allele frequencies of SNPs in PtALF5 were char-acterized between susceptible and resistant crabs (Table 4). Only

Fig. 3. SNPs (A) and deduced amino acid

one SNP located in noncoding exon (E2-727 T-A) was indicated tobe significantly different between susceptible and resistant crabs,of which T/T genotype frequency was significantly higher in resis-tant stock than in susceptible stock (P< 0.05) and Tallele frequencywas also extremely significantly higher in resistant stock than insusceptible stock (P < 0.01).


Genomic sequence of PtALF6 was amplified from 25 susceptiblesamples and 24 resistant samples. 53 SNPs including 31 transitions,16 transversions and 5 indels were detected (Fig. 4A). Of these, 13

s (B) of PtALF5 in P. trituberculatus.


Serial No. Position Genotype Genotype No. (%) c2 P Base type Allele No. (%) c2 P

Susceptible Resistant Susceptible Resistant

1 E2-727 A/A 17(94.4) 11(64.7) 4.833 0.028* A 34(94.4) 22(64.7) 9.665 0.002**T/T 1(5.6) 6(35.3) T 2(5.6) 12(35.3)

** Indicates extremely significant difference between resistant and susceptible stocks.E indicates exon and the number in position indicates number of base pairs. P values less than 0.05 were shown in bold.


SNPs were found in introns, 18 were in coding exons and 21 were innoncoding exons (Fig. 4A). Six synonymous mutations and twelvenon-synonymous mutations were found in coding region (Fig. 4B).

Genotype and allele frequencies of SNPs in PtALF6 were char-acterized between susceptible and resistant stocks (Table 5). For thenon-synonymous SNP of E3-45 G/T changing D94 to Y, no T allelewas found in susceptible stock, while T allele frequency in resistantstock was 12.5%, with a significant difference (P < 0.05) betweenthem. This was the only likely SNP locus in PtALF6 that wascorrelated with V. alginolyticus-resistance/susceptibility trait.


By sequencing from 23 susceptible individuals and 28 resistantindividuals of P. trituberculatus, we found 158 SNPs including 114transitions, 37 transversions and 7 indels in genomic sequence ofPtALF7 (Fig. 5A). Of these SNPs, 46 were located in introns, 33 werein coding exons and 64 were in noncoding exons. 30 coding SNPswere non-synonymous mutations and 7 were synonymous muta-tions (Fig. 5B). Transition of G455 to A changed the codon encodingTrp to termination codon, causing early stop of ORF (Fig. 5B). Indelof G841 led to a frame-shift mutation in exon3.

Genotype and allele frequencies of SNPs in PtALF7 were char-acterized between susceptible and resistant stocks (Table 6). Onenoncoding SNP (I1-30 T-C) was found to have extremely significant


difference (P < 0.01) in allele frequencies between the two stocks,of which C allele frequency was 14.3% in resistant individuals,whereas no C allele in susceptible individuals. Furthermore, onesynonymous SNP (E3-23 G-A) encoding G93 was detected to besignificantly different (P < 0.05) in allele frequencies between thetwo stocks, while another noncoding SNP (E3-656 T-A) wassignificantly different (P < 0.05) in genotype frequencies. Two ge-notypes of T/T and T/A were characterized at E3-656 and T/A ge-notype frequency was significantly lower in susceptible stock thanin resistant stock (P < 0.05).

3.3. Analysis of SSRs in PtALF genes

Besides SNPmarkers, microsatellite DNAmarkers (or SSRs) werealso found only in PtALF4, PtALF5 and PtALF7. Alleles (or haplo-types) of these SSRs are described as follow.

3.3.1. SSRs in PtALF4 geneOnemicrosatellite with a trinucleotide repeat unit of (TAC)nwas

detected in noncoding exon of PtALF4 (Supplementary 1). Among11 alleles of this unit according to the repeat number of this unit,(TAC)14 demonstrated highest frequency (46.4% in susceptible stockand 32.0% in resistant stock, respectively), followed by (TAC)8(21.4% and 16%, respectively). Although c2 test revealed no signif-icant difference, alleles with the repeat number of 3, 7, 10, 11 and 18



Serial No. Position Genotype Genotype No. (%) c2 P Base type Allele No. (%) c2 P


1 E3-45 G/G 25(1.0) 21(87.5) 3.329 0.068 G 50(1.0) 42(87.5) 6.658 0.012*T/T 0(0.0) 3(12.5) T 0(0.0) 6(12.5)

* Indicates extremely significant difference between resistant and susceptible stocks.E indicates exon and the number in position indicates number of base pairs. P values less than 0.05 were shown in bold.


were not found in susceptible stock, while only allele with therepeat number of 13 was not found in resistant stock.

3.3.2. SSRs in PtALF5 geneIn PtALF5, three dinucleotide repeats, (TG)n, (GT)n and (CT)n,

were identified in introns, while one pentanucleotide repeat,(ACCAC)n, and one octanucleotide repeat, (CACAACAC)n, weredetected in noncoding exons (Supplementary 2). For the poly-morphism of (CT)n, of which amplification length ranged from24 bp to 84 bp, no short alleles with the repeat number to be less


than 25were found in resistant stock, while no long alleles with therepeat number to be more than 35 were in susceptible stock.Additionally, two SSRs, (ACCAC)n and (CACAACAC)n, identified innoncoding exons were less diverse than those in introns. For thepolymorphism of (ACCAC)n, only two crabs were detected with therepeat number to be four and the others were all found with therepeat number to be three. Similarly, for the polymorphism of(CACAACAC)n, allele with the repeat number to be three had ahigher proportion than alleles with the repeat number to be twoand four.



Serial No. Position Genotype Genotype No. (%) c2 P Allele Allele No. (%) c2 P


1 I1-30 T/T 23(1.0) 24(85.7) 3.565 0.059 T 46(1.0) 48(85.7) 7.131 0.008**C/C 0(0.0) 4(14.3) C 0(0.0) 8(14.3)

2 E3-23 G/G 21(91.3) 20(71.4) 3.165 0.075 G 42(91.3) 40(71.4) 6.329 0.012*A/A 2(8.7) 8(28.6) A 4(8.7) 16(28.6)

3 E3-656 T/T 19(82.6) 15(53.6) 4.791 0.029* T 42(91.3) 43(76.8) 3.833 0.050T/A 4(17.4) 13(46.4) A 4(8.7) 13(23.2)

* Indicates significant difference and ** indicates extremely significant difference between resistant and susceptible stocks.E indicates exon, I indicates intron and the number in position indicates number of base pairs. P values less than 0.05 were shown in bold.


3.3.3. SSRs in PtALF7 geneWe identified two dinucleotide repeats with their respective

length ranging from 24 bp to 66 bp and from 10 bp to 24 bp in in-trons of PtALF7 (Supplementary 3). For the polymorphism of (AC)n,no statistically significant difference was found between resistantand susceptible stocks. However, there were no alleles with therepeat number to be 15 and 29 in susceptible crabs, while no alleleswith the repeat number to be 17, 22 and 33 in resistant crabs.

4. Discussion

In the present study, PtALFs, the antimicrobial peptide genespreviously found in our lab, are selected to be candidate genes forpolymorphisms identification and totally sixteen SNPs are investi-gated to be correlated with resistance to V. alginolyticus inP. trituberculatus. According to the number of SNPs identified inPtALF1-7, PtALF7 may be most diverse and PtALF6 may be mostconserved. To our knowledge, this is the first study to comparediversity among different isoforms of ALFs and identify an associ-ation between nucleotide polymorphisms of ALF genes and bacte-rial resistance in economic crustaceans. We have analyzed tissuedistribution of PtALFs and temporal expression change of themafter V. alginolyticus challenge [31e34]. Combining these studieswith SNPs in this context, results reveal PtALF1-7 to be up-regulated after V. alginolyticus challenge and support informationfor polymorphisms identified here as causative mutations affectingV. alginolyticus-resistance in P. trituberculatus. This is also confirmedin human and oysters that genetic polymorphisms affecting geneexpression play significant role in susceptibility and resistance todiseases [36,37].

Among all SNPs identified in PtALF1-7, we find 97 coding SNPsthat cause change of nonconserved amino acids. This also occurs inALFSp of Scylla paramamosain and ALFPm3 of Penaeus monodon[38,39]. However, another four coding SNPs lead to either earlytermination of ORF or frame shift mutation in the present study,which causes change of conserved cysteine residues. The sameresult is observed by Liu et al. in PtesALF1-3 of P. trituberculatus[32]. These results together indicate that ALFs have multiple vari-ations and not all variations are active.

Most SNPs correlated with V. alginolyticus-resistance wereidentified in introns and noncoding exons. Mutations in the non-coding region do not directly participate in the process of trans-lation, but theymay lead to different regulations ormodifications ofgene expression and protein processing [40,41]. For example, anoncoding mutation in Twirler Mice disrupts regulation of Zeb1Tw

expression and causes developmental malformations and obesity[42]. Further research on these noncoding SNPs may be helpful tofind effective markers to assist selective resistant disease forP. trituberculatus.

Among SNPs related to V. alginolyticus-resistance in codingexons, we find two synonymous SNPs, 1504 G-A in PtALF4 and E3-23 G-A in PtALF7. Similarly, a number of synonymous SNPs are

observed in human DRD2 gene and they have potentiallyimportant pathophysiological and pharmacogenetic effects [43].Although synonymous mutations do not impact biological traitsdirectly, they are not neutral mutations and are indispensable fortheir important role. For example, a minor number of changesfrom preferred to unpreferred codon can cause different results inphenotype and may be applied in selection [44]. A synonymousSNP in cvSI-1 gene is associated with Perkinsus marinus resistancein C. virginica and its linkage to mutation in promoter can explainthe resistance [9,37]. In addition, only one nonsynonymous SNP(E3-45 G-T in PtALF6) in coding region with resistance toV. alginolyticus was identified. The same result occurs in the SODfamily of A. irradians [7]. Such nonsynonymous variation withenhanced resistance may cause great difference on compositionand structure of protein, changing biological traits quickly, andplay crucial role in selective breeding.

Interestingly, we find several SSRs only in PtALF4, PtALF5 andPtALF7. Consistent with the report that SSRs form a large fraction ofnoncoding DNA, but are relatively rare in coding region [45], theseidentified SSRs are all in introns and noncoding exons. They mayplay important functional roles in chromatin organization, regula-tion of DNA metabolic processes, modification of gene expressionand genetic disorders [46]. Studies demonstrate that microsatelliteDNA markers have correlation with disease resistance or growthrelated traits in Fenneropenaeus chinensis [12], merino sheep [16],Patinopecten yessoensis [20] and P. trituberculatus [21]. Although nostatistically significant association between SSRs and resistance/susceptibility to V. alginolyticus is found in the present study, wecan find some differences when comparing the repeat number ofthese SSRs between susceptible and resistant stocks. Hence, it isstill unknown whether the identified SSRs in P. trituberculatus canbe regarded as potential V. alginolyticus-resistance markers or not.

In conclusion, the present study suggests that totallysixteen SNPs in PtALF1-7 have association with resistance/sus-ceptibility to. Polymorphisms identified here can be considered asV. alginolyticus-resistance candidate markers in P. trituberculatusand further studies to better validate this association will also beperformed. Potentially, these polymorphisms may be applied infuture molecular selection of resistant crabs and controlling dis-eases caused by Gram-negative bacteria.

Acknowledgments

This research was supported by National Natural ScienceFoundation of China (31101924), Chinese National ‘863’ Project (No.2012AA10A409) and Zhejiang Major Special Program of Breeding(2012C12907-3) to Dr. Zhaoxia Cui.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.fsi.2013.03.373.




References

[1] Wang G, Jin S, Chen Y, Li Z. Study on pathogens and pathogenesis of emul-sification disease of Portunus trituberculatus. Advances in Marine Science2006;24:526e31.

[2] Liu Q, Wang X, Dai F, Liu P, Li J. Preliminary study on Vibrio alginolyticusdisease in Portunus trituberculatus. Shandong Fisheries 2007;24:1e4.

[3] Wan X, Shen H, Wang L, Cheng Y. Isolation and characterization of Vibriometschnikovii causing infection in farmed Portunus trituberculatus in China.Aquaculture International 2011;19:351e9.

[4] Collard BCY, Jahufer MZZ, Brouwer JB, Pang ECK. An introduction to markers,quantitative trait loci (QTL) mapping and marker-assisted selection for cropimprovement: the basic concepts. Euphytica 2005;142:169e96.

[5] Dekkers JCM, Hospital F. The use of molecular genetics in the improvement ofagricultural populations. Nature Review Genetics 2002;3:22e32.

[6] Li L, Zhao J, Wang L, Qiu L, Zhang H, Dong C, et al. The polymorphism oflysozyme gene in Zhikong scallop (Chlamys farreri) and its association withsusceptibility/resistance to Listonella anguillarum. Fish & Shellfish Immu-nology 2009;27:136e42.

[7] Bao Y, Li L, Zhang G. Polymorphism of the superoxide dismutase gene familyin the bay scallop (Argopecten irradians) and its association with resistance/susceptibility to Vibrio anguillarum. Developmental and Comparative Immu-nology 2010;34:553e61.

[8] Yue X, Wang H, Huang X, Wang C, Chai X, Wang C, et al. Single nucleotidepolymorphisms in i-type lysozyme gene and their correlation with vibrio-resistance and growth of clam Meretrix meretrix based on the selected resis-tance stocks. Fish & Shellfish Immunology 2012;33:559e68.

[9] Yu H, He Y, Wang X, Zhang Q, Bao Z, Guo X. Polymorphism in a serine proteaseinhibitor gene and its association with disease resistance in the eastern oyster(Crassostrea virginica Gmelin). Fish & Shellfish Immunology 2011;30:757e62.

[10] Liu C, Wang X, Xiang J, Li F. EST-derived SNP discovery and selective pressureanalysis in Pacific white shrimp (Litopenaeus vannamei). Chinese Journal ofOceanology and Limnology 2012;30:713e23.

[11] Zeng D, Chen X, Li Y, Peng M, Ma N, Jiang W, et al. Analysis of Hsp70 inLitopenaeus vannamei and detection of SNPs. Journal of Crustacean Biology2008;28:727e30.

[12] Dong S, Kong J, Meng X, Zhang Q, Zhang T, Wang R. Microsatellite DNAmarkers associated with resistance to WSSV in Penaeus (Fenneropenaeus)chinensis. Aquaculture 2008;282:138e41.

[13] Wang L, Su J, Yang C, Wan Q, Peng L. Genomic organization, promoteractivity of grass carp MDA5 and the association of its polymorphisms withsusceptibility/resistance to grass carp reovirus. Molecular Immunology2012;50:236e43.

[14] Su J, Heng J, Huang T, Peng L, Yang C, Li Q. Identification, mRNA expressionand genomic structure of TLR22 and its association with GCRV susceptibility/resistance in grass carp (Ctenopharyngodon idella). Developmental andComparative Immunology 2012;36:450e62.

[15] Larruskain A, Minguijon E, Arostegui I, Moreno B, Juste RA, Jugo BM. Micro-satellites in immune-relevant regions and their associations with Maedi-Visnaand ovine pulmonary adenocarcinoma viral diseases. Veterinary Immunologyand Immunopathology 2012;145:438e46.

[16] Dukkipati VS, Blair HT, Garrick DJ, Lopez-Villalobos N, Whittington RJ,Reddacliff LA, et al. Association of microsatellite polymorphisms with immuneresponses to a killed Mycobacterium avium subsp. paratuberculosis vaccine inMerino sheep. New Zealand Veterinary Journal 2010;58:237e45.

[17] Song F, Li X, Zhang M, Yao P, Yang N, Sun X, et al. Association between hemeoxygenase-1 gene promoter polymorphisms and type 2 diabetes in a Chinesepopulation. American Journal of Epidemiology 2009;170:747e56.

[18] Ruan L, Zhao W, Wei Y, Huang C, Lin F, Shen Y. Heme oxygenase-1 genepromoter polymorphism and susceptibility to acute cerebral infarction.Journal of Apoplexy and Nervous Diseases 2008;125:644e7.

[19] Matokanovic M, Rumora L, Popovic-Grle S, Cepelak I, Culic O, Barisic K. As-sociation of hsp70-2 (þ1267A/G), hsp70-hom (þ2437T/C), HMOX-1 (numberof GT repeats) and TNF-alpha (þ489G/A) polymorphisms with COPD inCroatian population. Clinical Biochemistry 2012;45:770e4.

[20] Man Z, Meng C, Nanjing Z. Genetic structure of Japanese scallop population(Patinopecten yessoensis) and correlation of microsatellite DNA markers withgrowth traits. Chinese Agricultural Science Bulletin 2012;28:125e30.

[21] Liu L, Li J, Liu P, Zhao F, Gao B, Du Y, et al. Correlation analysis of microsatelliteDNA markers with growth related traits of swimming crab (Portunus tritu-berculatus). Journal of Fisheries of China 2012;36:1034e41.

[22] Morita T, Ohtsubo S, Nakamura T, Tanaka S, Iwanaga S, Ohashi K, et al.Isolation and biological activities of Limulus anticoagulant (anti-LPS factor)which interacts with lipopolysaccharide (LPS). Journal of Biochemistry1985;97:1611e20.

[23] Warren HS, Glennon ML, Wainwright N, Amato SF, Black KM, Kirsch SJ, et al.Binding and neutralization of endotoxin by Limulus antilipopolysaccharidefactor. Infection and Immunity 1992;60:2506e13.

[24] Tanaka S, Nakamura T, Morita T, Iwanaga S. Limulus anti-LPS factor: ananticoagulant which inhibits the endotoxin mediated activation of Limuluscoagulation system. Biochemical and Biophysical Research Communications1982;105:717e23.

[25] Liu F, Liu Y, Li F, Dong B, Xiang J. Molecular cloning and expression profile ofputative antilipopolysaccharide factor in Chinese shrimp (Fenneropenaeuschinensis). Marine Biotechnology 2005;7:600e8.

[26] Somboonwiwat K, Marcos M, Tassanakajon A, Klinbunga S, Aumelas A,Romestand B, et al. Recombinant expression and anti-microbial activity ofanti-lipopolysaccharide factor (ALF) from the black tiger shrimp Penaeusmonodon. Developmental and Comparative Immunology 2005;29:841e51.

[27] de la Vega E, O’Leary NA, Shockey JE, Robalino J, Payne C, Browdy CL, et al.Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broadspectrum antimicrobial peptide essential for shrimp immunity against bac-terial and fungal infection. Molecular Immunology 2008;45:1916e25.

[28] Li C, Zhao J, Song L, Mu C, Zhang H, Gai Y, et al. Molecular cloning, genomicorganization and functional analysis of an anti-lipopolysaccharide factor fromChinese mitten crab Eriocheir sinensis. Developmental and ComparativeImmunology 2008;32:784e94.

[29] Yedery RD, Reddy KV. Identification, cloning, characterization and recom-binant expression of an anti-lipopolysaccharide factor from the hemocytesof Indian mud crab, Scylla serrata. Fish & Shellfish Immunology 2009;27:275e84.

[30] Yue F, Pan L, Miao J, Zhang L, Li J. Molecular cloning, characterization andmRNA expression of two antibacterial peptides: crustin and anti-lipopolysaccharide factor in swimming crab Portunus trituberculatus.Comparative Biochemistry and Physiology Part B, Biochemistry & MolecularBiology 2010;156:77e85.

[31] Liu Y, Cui Z, Song C, Wang S, Li Q. Multiple isoforms of immune-related genesfrom hemocytes and eyestalk cDNA libraries of swimming crab Portunus tri-tuberculatus. Fish & Shellfish Immunology 2011;31:29e42.

[32] Liu Y, Cui Z, Luan W, Song C, Nie Q, Wang S, et al. Three isoforms of anti-lipopolysaccharide factor identified from eyestalk cDNA library of swim-ming crab Portunus trituberculatus. Fish & Shellfish Immunology 2011;30:583e91.

[33] Liu Y, Cui Z, Li X, Song C, Li Q, Wang S. A new anti-lipopolysaccharide factorisoform (PtALF4) from the swimming crab Portunus trituberculatus exhibitedstructural and functional diversity of ALFs. Fish & Shellfish Immunology2012;32:724e31.

[34] Liu Y, Cui Z, Li X, Song C, Li Q, Wang S. Molecular cloning, expression patternand antimicrobial activity of a new isoform of anti-lipopolysaccharide factorfrom the swimming crab Portunus trituberculatus. Fish & Shellfish Immu-nology 2012;33:85e91.

[35] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. New York:Cold Spring Harbor Laboratory Press; 2001.

[36] Theuns J, Brouwers N, Engelborghs S, Sleegers K, Bogaerts V, Corsmit E, et al.Promoter mutations that increase amyloid precursor-protein expression areassociated with Alzheimer disease. American Journal of Human Genetics2006;78:936e46.

[37] He Y, Yu H, Bao Z, Zhang Q, Guo X. Mutation in promoter region of a serineprotease inhibitor confers Perkinsus marinus resistance in the eastern oyster(Crassostrea virginica). Fish & Shellfish Immunology 2012;33:411e7.

[38] Imjongjirak C, Amparyup P, Tassanakajon A, Sittipraneed S. Anti-lipopolysaccharide factor (ALF) of mud crab Scylla paramamosain: molecularcloning, genomic organization and the antimicrobial activity of its syntheticLPS binding domain. Molecular Immunology 2007;44:3195e203.

[39] Somboonwiwat K, Supungul P, Rimphanitchayakit V, Aoki T, Hirono I,Tassanakajon A. Differentially expressed genes in hemocytes of Vibrio harveyi-challenged shrimp Penaeus monodon. Journal of Biochemistry and MolecularBiology 2006;39:26e36.

[40] Nott A. A quantitative analysis of intron effects on mammalian gene expres-sion. RNA 2003;9:607e17.

[41] Hu J, Nakanishi M, Qi Y. Regulation of noncoding region for expression ofSendai virus hemagglutinin-eneuraminidase (HN) gene. Science China LifeSciences 1999;42:362e9.

[42] Kurima K, Hertzano R, Gavrilova O, Monahan K, Shpargel KB, Nadaraja G, et al.A noncoding point mutation of Zeb1 causes multiple developmental malfor-mations and obesity in Twirler mice. PLoS Genetics 2011;7:e1002307.

[43] Duan J. Synonymous mutations in the human dopamine receptor D2 (DRD2)affect mRNA stability and synthesis of the receptor. Human Molecular Ge-netics 2003;12:205e16.

[44] Hershberg R, Petrov DA. Selection on codon bias. Annual Review of Genetics2008;42:287e99.

[45] Hancock JM. The contribution of slippage-like processes to genome evolution.Journal of Molecular Evolution 1995;41:1038e47.

[46] Youchun L. Microsatellites: genesis, genomic distribution, function andevolutionary dynamics. Journal of Sichuan Agricultural University 2001;19:303e16.

polymorphisms of anti-lipopolysaccharide factors in the swimming crab portunus trituberculatus and...

Documents