Phylogenetic relationship andorganization of organisms within berry-

bacterial consortia

Jarrod Jude ScottMicrobial Diversity Course

2007

Summary

The goal of this project was to determine the organismal composition andspatial organization of bacteria within pink and purple berries fromSippewissett salt marsh in Cape Cod, MA. Using phylogenetic and CARD-FISH analysis our results indicate that there is no observable differencebetween these two types of berries. Further, we found the majority of clonesobtained from library construction fall within three broad groups ofeubacteria; α-proteobacteria, γ- proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group (CFB). Using CARD-FISH we were alsoable to show that different groups within the berry matrix exhibitednoticeable spatial arrangement.

Methods and Results

Sample Collection:

Samples were collected at two times during the summer of 2007. Samples usedin clone library construction were collected from Sippewissett salt mash on 17July. Samples used in fish analysis were collected on 10 July from the samelocation.

Clone library construction:

A. DNA extraction

DNA from stored (-20°C) samples was extracted using an UltraClean soil DNAkit (MO BIO #12800-50). Protocol was followedexactly except for the time of beadbeating. Wedecided to test the efficacy of different beadbeatingtimes on extracted DNA quality. For each of thepink and purple samples, samples werehomogenized for 30s, 60s and 120s. Based on theresults of gel electrophoresis and NanoDropSpectrophotometer quantification, the 30streatment was chosen for further analysis (seetable 1 and figure 1).

B. PCR analysis

PCR was performed using the general eubacterialprimers 8F/1492R and general archaeal primers4F/1392R with the following reaction conditions:initial denaturation of 95°C for 5:00, then 29 cyclesof 95°C for 0:30, 46°C for 0:30, 72°C for 1:30, anda final extension of 72°C for 5:00. Lanes A = 1:1 DNA template; B = 1:10; C =negative control, D = positive control; E = poison control (Note that at the timethere was no positive control for the archaeal primer sets). Amplification of theeubacterial primers was successful for both dilutions used. The archaeal primershowever failed to produce strong product (a faint band can be seen in pink laneA)(figure 2). Based on the initial gel a temperature gradient PCR was run on the30s and 120s samples using general archaeal primers 4F/1392R and 21F/958R.The same conditions were used as above except the annealing temperature waschanged to a gradient from 46°C to 62°C. 21F/958R failed to amplify at anytemperature but 4F/1392R produced product at all temperatures tested (figure 3).

Figure 1: Gel of extracted DNAon both pink and purplesamples using different bead-beating times.

T a b l e1: Spectrophotometerresults of three different bead-beating treatments on each typeof berry.

Figure 3: Temperature gradient PCR of the generalarchaeal primers 21F/958R & 4F/1392R.

C. Clone library construction

Based on the abovementioned results clone libraries were constructed using8F/1492R and 4F/1392R on both pink and purple berries using the TOPO TA

quantity(ng/µL)

260/280 260/230

pink-30s 12.7 1.27 1.21pink-60s 11.6 1.44 0.81pink-120s 8.8 1.47 1.16purple-30s 13.2 1.38 0.90purple-60s 10.7 1.27 0.50purple-120s 9.8 1.49 1.13

Figure 2: Initial PCR of 30sextraction using 8F/1492 and4F/1392R.

cloning kit. The suggested protocol was followed exactly. Positive clones weresequenced and aligned in the ARB software package.

The 4F/1392R clone libraries yielded no archaeal sequences but rather amplifiedseveral different species of eukaryotes. At this point it was decided to abandonattempts at identifying archaeal species from the berries. The results fromeubacterial clone libraries are shown below in figures 4-6. The clone librariesindicate that the berries contain representatives from the gamma II subdivision ofproteobacteria (figure 4), delta-proteobacteria (figure 5), and the Cytophaga-Flavobacterium-Bacteroides group (CFB) (figure 6). Black boxes within each treerepresent clades containing very similar clones. The numbers in parenthesesindicate the number of clones in each group. The data did not indicate that thepink and purple berries are comprised of different communities.Figure 4: Maximum parsimony tree showing the phylogenetic relationshipof clones that fell into the gamma II subdivision of proteobacteria.

Figure 5: Tree showing clones from the delta subdivision of proteobacteria.Almost all clones fell within two distinct clades.

Figure 6: MP tree of the clones that were in the CFB group of bacteria. Themajority of clones were within one of three clades identified by solid blackboxes.

FISH analysis

A. Berry Fixation and cutting

Sample berries were fixed in 1% by volume formaldehyde solution in 1XPBS.Berries were then washed 3X in 1XPBS. Samples were put into 1mL of OCT(Optical Cutting Solution, Tissue-Tek, Sakura), and stored at 4°C until cutting.Sections were obtained by first freezing the OCT embedded berries at -20°C for~4hrs. Thin (~10µm) sections were cut using a cryotome.

In order to process the cut samples slides were prepped by dipping into asolution of 0.1% gelatin and 0.01% Cr(III)KSO4 solution and allowing them to dry.For each probe listed below (table 2) we used two ~10µm cross-sectionsattached to an individual slide. Therefore a total of 20 cross-sections on 10 slideswere processed through the FISH protocol; 1 slide/probe and 5 slides/berry.Slides were then washed for 1 minute in increasingly concentrated solutions ofEtOH to remove residual OCT compound. Samples were allowed to dry and thenstored at -20°C until further processing.

B. CARD-FISH:

Because of auto-fluorescent signals present in the berries we decided to useCARD-FISH. This technique provides a much stronger signal than standardmono-labeled FISH. The protocol provided in the lab manual was followed withnotable exceptions listed below.

1) Samples were not embedded in agrose2) After the inactivation of endogenous peroxidases each cross-section

was circled with a special pen. This prevents liquid from spilling off ofthe sample during later steps.

3) For permeabilization treatment, 200µL of the lysozyme solution wasplaced directly on the sections and then the whole slide was placedinto a 50mL flacon tube containing moist paper.

4) In the hybridization step we used a 1:100 rather than 1:300 solution ofprobe and hybridization buffer.

5) We inadvertently omitted 10% SDS from the washing buffer but this didnot seem to have any ill affect.

Based on the results from the 16S rRNA trees we chose the probes listed in table2 for our analysis. Unfortunately we did not have delta-proteobacterial probes atthe time of this investigation.

Table 2: Probes used in CARD-FISH analysis

Discussion

The goal of this project was three-fold: 1) to determine the broad communitycomposition of the pink and purple berries of Sippewissett Salt Marsh; 2)Ascertain whether there is organismal organization within the berries and; 3)qualify the differences, if any, between the pink and purple berries.

Phylogenetic analysis of cloned sequences revealed that there are three maingroups within the berries. Our work indicates that organisms related toHalochromatium (γ-proteobacteria), “Desulfobacterium” (δ-proteobacteria), and“Flavobacterium/Cytophaga” (CFB) are the main organisms within the berries.Only clones that grouped within the gamma subdivision had close relatives in theARB database. The majority of representative from both the delta-proteobacteriaand the CFB were considerably different from any close relative.

CARD-FISH analysis proved very successful. Figure 7 shows the results of thisanalysis from the EUBI-III, Alf986, Gam42a and CF319a on the pink berrysamples. On the left is the DAPI stain only and on the right the FITC labeledimage. Image D reveals the presence of α-proteobacteria throughout the matrixhowever they appear to be in relatively low abundance when compared with thegeneral eubacterial probe from image B. Image F indicates that γ-proteobacteriacomprise the vast majority of organisms within the matrix. Perhaps the mostinteresting result is shown in image H. This image shows the presence ofrepresentative from the CFB-group but more importantly indicates distinct spatialpatterns of distribution. These organisms seem to be located along the peripheryof the berry structures.

Probe Sequence (5’→3”) Label FA inHB[%] Target

NON 35 nothingArch915 GTGCTCCCCCGCCAATTCCT HRP FITC 35 archaeaCF319a TGGTCCGTGTCTCAGTAC HRP FITC 35 CFBGam42a GCCTTCCCACATCGTT HRP FITC 35 γ-proteoEubI-III GCWGCCWCCCGTAGGWGT HRP FITC 35 eubacteriaAlf986 GGTAAGGTTCTGCGCGTT HRP FITC 35 α-proteo

Figure 2: DAPI stained cross-sections on the left and FITC labeled cells on the right.B = EUBI-III; D = Alf986; F= Gam42a; H=CF319a. (Note: The DAPI stain in panelA was much brighter than is shown here)

Our results indicate that there are no noticeable differences between the pinkand purple berries, either phylogentically or organizationally. Though only CARD-FISH images were shown for pink berries, the patterns were similar in the purpleberries.

In the future it would be nice to design more specific probes in order to betterunderstand spatial organization at a finer scale.

Acknowledements:

I am honored that I was admitted to the Microbial Diversity course and verydelighted that I accepted the offer. I would like to thank the directors, faculty,staff, classmates and the MBL for a wonderful learning experience. I would alsolike to thank Kristen DeAngelis and Tracy Teal for help with molecular work. Mostimportantly I would like to acknowledge Dagmar Woebken for her extremely highlevels of patience and enthusiasm. This work would have been impossiblewithout the input and support of all parties