photosynthetic conversion of carbon dioxide to ethylene by the recombinant cyanobacterium,...

JOURNAL OF FERMENTATION AND BIOENGINEERING

Vol. 84, No. 5, 434-443. 1997

Photosynthetic Conversion of Carbon Dioxide to Ethylene by the Recombinant Cyanobacterium, Synechococcus sp. PCC 7942,

Which Harbors a Gene for the Ethylene-Forming Enzyme of Pseudomonas syringae

MIHO SAKAI, TAKAHIRA OGAWA,* MASAYOSHI MATSUOKA, AND HIDE0 FUKUDA

Department of Applied Microbial Technology, Kumamoto Institute of Technology, 4-22-l Ikeda, Kumamoto 860, Japan

Received 14 June 19971Accepted 30 July 1997

Photosynthetic conversion of carbon dioxide to ethylene was studied using the recombinant cyanobacterium, Synechococcus sp. strain PCC 7942 R2-SPc which expresses the ethylene-forming enzyme (EFE) from Pseudomonas syringae pv. phaseolicola PK2. The gene encoding the EFE (efe gene) from P. syringae was introduced into the cyanobacterium utilizing the pUC303 shuttle vector into which the efe gene was placed under the control of various transcriptional signals, i.e., the native promoter and terminator of the efe gene (pUC303-EFE03), the Escherichia coli ZacZ promoter and the efe gene terminator (pUC303-EFElO and pUC303-EFE30), or the promoter and terminator of the p&AI gene from Synechococcus sp. PCC7942 which codes for the Dl protein in photosystem II (pEXE3). Among these configurations, EFE activity measured in the cell-free extracts of transformants that harbored the pEXE3 was highest. However, ethylene production in vivo of the transformants carrying pEXE3 declined with the number of generations, because homologous recombination of DNA sequences on the pEXE3 plasmid and host chromosomalpsbAZlocus took place. Deletion of the 5’upstream region of thepsbAZpromoter and the 3’-downstream region of thepsbAZ terminator in pEXE3 resulted in pEXE3A8 which showed the highest level of ethylene-forming activity, although the latter plasmid was still unstable with a half-life of only 12 generations. The amount of carbon incorporated into ethylene was calculated as a percentage of the total carbon fixed, the maximum value of which was 5.84% in the recombinant cyanobacterium harboring pUC303-EFE03.

[Key words: ethylene, cyanobacteria, Synechococcus sp. PCC7942, Pseudomonas syringae, pLJC3031

Ethylene, the simplest of gaseous unsaturated hydro- carbons and the most important starting material in petroleum chemistry, is also a plant hormone that is involved in a number of physiological processes, such as fruit ripening and plant senescence (1). In considering the future global shortage of fossil fuel, it is desirable to develop a process for the microbial production of ethylene from various renewable resources and waste materials such as domestic excess sludge or carbon dioxide (2).

It is known that ethylene is not only produced by higher plants but also by microorganisms (3). Whereas in higher plants there is only one pathway involving I- aminocyclopropane-1-carboxylic acid as a sole interme- diate in ethylene biosynthesis (4, 5), two distinct pathways operate on ethylene production in microorganisms. In the first pathway, ethylene is produced from 2-keto-4- methylthiobutyric acid using an NADH:Fe(III) EDTA oxidoreductase (6). In the second pathway, ethylene is produced by microorganisms such as Pseudomonas syringae pv. phaseolicola PK2 (hereafter designated simply as P. syringae) (7, 8) and Penicillium digitatum (9, 10) from 2-oxoglutarate. The enzyme responsible for ethylene formation from 2-oxoglutarate is designated ethylene- forming enzyme (EFE) and has been characterized extensively (8, 11).

We have previously reported cloning and sequencing a gene that encodes the EFE (hereafter designated as the efe gene) from P. syringae (12). The amino acid sequence of the EFE deduced from the nucleotide sequence (350

* Corresponding author.

amino acids, M,=39,444) was found to have very little similarity to the amino acid sequences of plant enzymes and 2-oxoglutarate-dependent dioxygenases (13), although functionally significant regions appear to be conserved (3). We also observed that the efe gene could be used to express the EFE to a high level in Escherichia coli, and that this recombinant E. coli accumulated the EFE which accounted for approximately 30% of the total cellular protein (14).

To increase the utility of the efe gene, the biological conversion of carbon dioxide into ethylene utilizing cyanobacteria as a host microorganism for EFE expression has been suggested (15). Cyanobacteria perform oxy- genic photosynthesis similar to that of higher plants, and some cyanobacterial strains possess the ability to uptake exogenous DNA, making their transformation easier. The expression of the EFE in recombinant cyanobacteria can give rise to the net production of ethylene from carbon dioxide, whose concentration in the atmosphere increases by a rate of 0.05% per year. This approach suggests a possible solution to the problem of global warming which is a consequence of the greenhouse effect caused by excess carbon dioxide liberated by industry into the atmosphere (16).

A number of reports have been published on the expression of foreign proteins in cyanobacteria, e.g., a human superoxide dismutase in Synechococcus PCC 6301 (17), an insecticidal protein from Bacillus in several cyanobacterial strains (18, 19), a chloramphenicol acetyl transferase (20), and a salmon growth hormone in the cyanobacterium Agmenellum quadruplicatum (presently, Synechococcus PCC 7002) (21). However, the highest

434

VOL. 84, 1997 ETYLENE PRODUCTION BY RECOMBINANT CYANOBACTERIUM 435

amount of these foreign proteins accumulated within the cyanobacteria was less than 3% of total soluble cellular proteins. With a few exceptions (18), none of these reports referred to the genetic stability of the recombinant cyanobacteria upon long-term cultivation.

In this study, we constructed a series of efe genes with different transcriptional control regions, and introduced these efe genes via a shuttle vector plasmid into a cyanobacterium, Synechococcus sp. PCC7942. Our paper focuses on the strength and stability of efe gene expression during the long-term cultivation of recombinant cyanobacteria under photoautotrophic growth conditions using atmospheric carbon dioxide as a sole carbon source.

MATERIALS AND METHODS

Bacterial strains and plasmids Table 1 summarizes the bacterial strains and plasmids used in this study. E. coli JM109 was used for the preparation of most of the recombinant plasmids derived from pUC18 and pUC19 (22), whereas E. coli GM33 (23) was used as the dam methylation-deficient host for easy digestion of methylated restriction sites. A cyanobacterial strain, Synechococ- cus sp. PCC7942 R2-SPc, which lacked one of the cryptic plasmids (pUH24), was used for a host for recombinant plasmids derived from the pUC303 shuttle vector (24). The plasmids, pEFE03 and pUC303-EFE03, harboring the P. syringae efe gene on a 1.5 kb EcoRI fragment were described previously (12, 15). The plasmid, pPAN35R2, was kindly supplied by Dr. Y. Inoue at RIKEN via Dr. J. Hirschberg at the Hebrew University of Jerusalem. pPAN35R2 is a derivative of pBR328 whose tetracycline resistance gene possesses a 3.5 kb BamHI insert includ- ing the psbAI gene from Synechococcus sp. PCC7942 (25).

Growth conditions E. coli cells were routinely grown at 37°C in Luria-Bertani (LB) medium. Synechococcus cells were grown in BG-11 medium (26) at 25°C with con- stant illumination by fluorescent lamps at 1.39 x 104 erg/ cm2/s (ca. 8 klx) with reciprocal shaking in cotton-

plugged Erlenmeyer flasks under ambient air. Cell concentrations of E. coli and Synechococcus were measured using a spectrophotometer and expressed in ODei and 0DT3,,, respectively. Transformation of E. coli was carried out following Hanahan’s method (27), whereas Synecho- coccus cells were transformed following the procedure as described by Kuhlemeier and van Arkel (24). Plates containing IPTG (isopropyl p-n-thiogalactopyranoside) and 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X- gal plates) were prepared for the selection of insert- containing pUC18 or pUC19 plasmids in E. coli JM109 (22). E. coli or cyanobacterial transformants that harbor plasmids were selected on agar media to which appropri- ate antibiotics were added at concentrations of 50 pg ampicillin (Ap)/ml, 100 pg streptomycin (Sm)/ml, or 35 /lg chloramphenicol (Cm)/ml. Cyanobacterial transformants were cultivated in BG-11 liquid medium containing 10 pg Sm/ml .

Recombinant DNA techniques To prepare recombinant plasmids, the standard operating procedures of Sambrook et al. (28) were followed. PCR (polymerase chain reaction) amplification was performed using Vent DNA polymerase (New England Biolabs Inc., Beverly, MA, USA). Oligonucleotide primers were synthesized by the phosphoramidite method using a model 391 DNA synthesizer (Applied Biosystems Japan, Tokyo). The nucleotide sequences were determined following the method of Sanger et al. (29) using the DNA Sequencing kit (Perkin-Elmer Applied Biosystems Division, Chiba). Other enzymes and reagents were purchased from Gibco BRL (Life Technologies, Inc., Tokyo), Takara Shuzo Co. Ltd. (Kyoto), Toyobo Co. Ltd. (Osaka) and Wako Pure Chemicals, Ltd. (Osaka).

Construction of pEXE plasmids In order to construct the EFE expression (pEXE) plasmids containing a promoter/terminator region of the psbAZ gene, we used WindIII-digested pPAN35R2 as a template and amplified the promoter and the terminator regions of the psbAI gene separately by PCR. Based on the nucleotide sequences of the tetracycline resistance gene (30) and the psbAI gene (25), the following oligonucleotide primer

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype or feature Reference

Strains E. coli JM109 recA1, endAl, gyrA96, thi, hsdR17, supE44, relA1, 2, A(lac-proAB), [F’, traD36, proAB,

lacIqZaM 151 (22) E, coli GM33 dam-3 (23) Synechococcus sp. pUH24- (24) PCC7942 R2-SPc

Plasmids pUCl8, pUC19 lac promoter, ApT, ori(ColE1) (22) pPAN35R2 psbAZ gene from Synechococcus sp. PCC7942 inserted in pBR328, Apt, Cm1 from J. Hirschberg puc303 Sm’, Cm’, ori(pl5A), rep(pUH24) (24) pEFE03 pUCl8 derivative containing the 1.5 kb efe gene of P. syringae (12) pEFEl0 pUC18 derivative containing the 1.4 kb efe gene pEFE30 pUCl8 derivative containing the 1.3 kb efe gene I::; pUC303-EFE03 pUC303 derivative containing the 1.5 kb efe gene with the promoter and terminator of the efe gene

of P. syringae (15) pUC303-EFElO pUC303 derivative containing the 1.4 kb efe gene with the promoters of lac and efe genes and the

terminator of the efe gene This work pUC303-EFE30 pUC303 derivative containing the 1.3 kb efe gene with the lac promoter and the efe terminator This work pEXE3 pUC303 derivative containing the ORF for the efe gene flanked by the promoter and terminator of

the psbAZ gene This work pEXE3bseries pEXE3 derivatives in which the 5-upstream region of the psbAZ promoter and the 3’.down-

stream region of the psbAZ terminator were deleted This work

436 SAKAI ET AL. J. FERMENT. BIOENG..

sets were designed; for the psbAI promoter region, 5’- GCGACCACACCCGTCCTGTGGATCC-3’ and S-ATG GCGGCCGCATCGATCTTGAGGTTGTAAAGGGCAA G-3’; for the psbAI terminator region, 5’-ACGATGCG TCCGGCGTAGAGGATCC-3’ and 5’-TAAGCGGCCGC ATTACAGCAGTCTGAATAATCAAAAA GCG-3’ (BarnHI sites are underlined, Not1 sites are doubly underlined, and the Ban111 site is italicized). The amplified fragments of the psbAI promoter region (1.8 kb) and the terminator region (0.5 kb) were purified using the Wizard PCR Preps DNA purification kit (Promega Corp., Madison, WI, USA), followed by digestion with BamHI and NotI, and were ligated with pUC19 linearized with BamHI. After transforming E. coli JM109 with the ligation mixture and selecting Ap’ white colonies on X-gal plates, one of the transformants was shown to contain a plasmid with inserts that consisted of one copy each of the psbAI promoter and terminator joined at a NotI site. The resulting plasmid (5.0 kb) was named pEXE1. Within pEXE1 the direction of transcription of the psbAI promoter was opposite to that of the IacZ promoter.

The open reading frame (ORF) of the efe structure gene on pEFEO1 (12) was amplified by PCR using the following two primers; 5’-GAGA TCGA TATGACCAAC CTACAGACTTTCGAGTTG-3’ and 5’-AGGGCGGCCGC TTATGAGCCTGTCGCGCGGGTGTCC-3’ (Ban111 site is italicized and Not1 sites are doubly underlined). The amplified 1.0 kb fragment was directly ligated into the SmaI site of pUC18, using the SureClone Ligation kit (Pharmacia Biotech, Uppsala, Sweden). One of the resulting plasmids, named pUC18-EFE2 (3.7 kb), contained an efe cassette which was flanked by Ban111 and Not1 sites and whose translational reading frame was in frame with an N-terminal peptide of the IacZ gene product. E. coli JM109 cells that harbored pUC18-EFE2 produced ethylene at a high level when the cells were induced with IPTG, indicating functional expression of the EFE. The efe cassette was excised from pUC18-EFE2 with Ban111 and NotI, and was ligated between the Ban111 and Not1 sites of the pEXE1 plasmid (both pUC18-EFE2 and pEXE1 plasmids were prepared from E. coli GM33 since the Ban111 sites were methylated). One of the constructed plasmids containing the EFE cassette between the promoter and terminator of the psbAI gene was designated pEXE2 (6.0 kb). In pEXE2, the psbAI ORF is precisely replaced with the ORF of the efe gene; thus this configuration was designated as psbA f: :efe.

To facilitate the deletion of the 5’-upstream region of the psbAI promoter, pEXE2 was digested using KpnI, which cut at the border of the psbAI promoter fragment and the pUC19 vector. The linearized pEXE2 was then digested using X/z01 which cut at the 5’-upstream region of the psbAI promoter, and the KpnI-XhoI digested plasmid was subjected to exonuclease III treatment to produce a series of unidirectional deletions from the 5’ end upstream of the psbAI promoter as described by Henikoff (31). The mutant plasmids that have deletions in the 5-upstream region of the psbAI promoter were designated as pEXE2 1 series (Al to A9). In one case, a restriction site for &flu1 within the 5’-upstream region of the psbAI promoter was used to create a plasmid designated as pEXE2 AKM in which a fragment between the KpnI and MluI sites was removed via blunt-end ligation.

Cloning of efe genes on pUC303 All of the DNA fragments that contained various efe genes with different promoters and terminators were cloned into a dephos-

phorylated EcoRI site within the chloramphenicol resistance (Cmr) gene of pUC303, and Cm’ and Srn’ colonies were selected as described previously (15). The orientation of inserts in pUC303 was confirmed by restriction analysis. The transcriptional direction of the efe gene in pUC303-EFE03 was the same as that of the Cm’ gene.

Two plasmids, designated pUC303-EFElO and pUC303- EFWO, were constructed by cloning efe genes from pEFEl0 and pEFE30 (14), respectively, into pUC303. Approxi- mately 1.4 kb and 1.3 kb efe gene fragments from pEFEl0 and pEFE30, respectively, were amplified by PCR using two oligonucleotide primers with the following sequences based on the IacZ gene of pUC19; 5’-TTTCTCGAGA CTGGAAAGCGGGCAGTGAGCG-3’ and 5’-TTTCTCGA GTCACGACGTTGTAAAACGACGGCC-3’ (XhoI sites flanking the 5’-termini are indicated in italics). The amplified fragments were blunt-ended using Klenow DNA polymerase, and the fragmentswere then phosphorylated with T4 polynucleotide kinase and treated with EcoRI methylase in order to protect EcoRI sites in the promoter region of the efe genes in pEFEl0 and pEFE30 (14). The methylated DNA fragments were ligated to an EcoRI linker, digested with EcoRI, and cloned into the EcoRI site of pUC303. The final plasmids containing /acZ promoter-efe genes were designated pUC303-EFElO and pUC303-EFE30 in which the direction of transcription of the efe genes was opposite to that of the Cm’ gene on pUC303.

The DNA fragment containing the psbAl::efe gene on pEXE2 was cloned into pUC303 to produce pEXE3. For this purpose, a 3.3 kb BamHI fragment from pEXE2 was blunted with Klenow DNA polymerase, ligated to an EcoRI linker, and cut with EcoRI. Since there were two EcoRI sites in the upstream region of the psbAI promoter, the resulting 3.1 kb EcoRI fragment was cloned into the EcoRI site of pUC303 in two orienta- tions. In one plasmid named pEXE3-I, the direction of transcription from the psbAI promoter was opposite to that of the Cm’ gene on pUC303, while in the other plasmid named pEXE3-II, the insert has the same transcriptional orientation as the Cm’ gene. To insert the efe gene fragments of the pEXE2 1 series of plasmids into pUC303, the fragments were amplified by PCR with the following oligonucleotide primers; 5’-ATTAAGTTGGG TAACGCCAGG-3’ and 5’-GGGGAATTCGGTTGTCTA CAATCAATATCCAA-3’ (the EcoRI site is underlined). The former primer hybridizes with a pUC19 vector sequence close to the EcoRI site, while the latter was designed to anneal to a sequence downstream of the psbAI terminator. Thus, the length of the psbAI terminator was shortened from approximately 500 bp in pEXE3 to 85 bp in the pEXE3 9 series. The PCR-generated fragments from the pEXE2 A series were then cloned into the SlnaI site of pUC18 using the SureClone Ligation kit. After isolating the correct fragments, the 1 series of psbAI::efe gene fragments were excised with EcoRI and cloned into the EcoRI site of pUC303. All the pEXE3 A-series plasmids had the same orientation of inserts as that in pEXE3-I.

Southern blotting analysis Southern blotting hybridization was carried out using digoxigenin-labeled DNA probes which were prepared by PCR using a labeling mixture that contained digoxigenin-1 l-dUTP (Boehringer Mannheim GmbH, Germany). Hybridization was performed on nylon membranes (Hybond-N + , Amersham, England) and carried out essentially as recommended in


the manufacturer’s protocol. The PCR-generated DNA probes used were the 1.5 kb EcoRI-Hind111 fragment of pEFE03 that contained the entire coding sequence of the efe gene from P. syringae and the 1.1 kb DNA fragment of the ORF of the psbAZ gene of Synechacoccus in pPAN35R2.

Assay of ethylene-forming activity In vivo ethylene- forming activity using intact cells and in vitro ethylene- forming activity using cell-free extracts were measured by gas chromatography as described previously (8). For in vivo assays, 2 ml of cultured Synechococcus cells (OD730 was approximately 2.0) was transferred to a sterile flask (64 ml capacity), sealed with a sterile rubber stopper, and incubated for one h under the same conditions as those for cultivating the cells, For in vitro assays, cell-free extracts were prepared from Synechococcus cells using ultrasonic disruption, and the ethylene-forming activities were measured in a standard reaction mixture (8). One unit of ethylene-forming activity was defined as that amount of enzyme which catalyzed the formation of 1 nmol of ethylene per min and the specific activity was expressed in units/mg protein,

RESULTS

Effect of different promoters and terminators on the expression of EFE activity in recombinant cyanobacteria We constructed several derivatives of the pUC303 shuttle vector in which various efe genes with different promoters and terminators were inserted at a unique EcoRI site. These plasmids are summarized in Table 1. The previously constructed pUC303-EFE03 contains the efe gene from P. syringae, and transcription of the efe gene occurs from a P. syringae promoter. In pUC303- EFElO, the E. coli lac promoter was placed near the 5’- upstream region of the efe gene, enabling transcription from both lac and efe gene promoters. In pUC303- EFE30, the P. syringae efe gene promoter was removed by deletion, allowing transcription of the efe gene solely from the lac promoter. In all of the above constructs, transcription termination signal was provided by the efe gene from P. syringae.

During construction of the other subset of EFE expression plasmids, transcription of efe gene cassette (namely the ORF of the efe gene) was regulated by the promoter and terminator of the psbAI gene that codes for one of the Dl proteins in photosystem II in Synechococcus sp. PCC7942. In order to construct the pEXE3 plasmid, we employed relatively large fragments of the psbAZ promoter (1.6 kb) and terminator (0.5 kb) ligated to the Ban111 (5’) and Not1 (3’) digested efe cassette, respectively. The Ban111 site precedes the initiation codon in the

natural psbA1 gene, while the Not1 site was engineered to occur immediately after the stop codon of the psbAZ gene using PCR. The final configuration of the efe gene in pEXE3 was a precise replacement of the psbA1 gene ORF with an ORF of the efe gene, and was designated as psbAl::efe gene. Afterwards, we constructed a successive deletion derivatives of the 5’upstream region of the psbAZ promoter to obtain the pEXE3 A series. In each plasmid of the pEXE3 A series, the psbAZ terminator region was also shortened to 85 bp.

The plasmids constructed as above were introduced into Synechococcus sp. PCC7942 R2-SPc, and the Smr transformants were cultivated photoautotrophically in BG-11 medium. Table 2 shows the ethylene-forming activities of these transformants in vivo and in vitro that were assayed when the OD730 reached approximately I .O. As shown in the third column of Table 2, the highest specific activity in vivo of 33.4 nl/ml/OD,&h, was manifested by a transformant harboring pUC303-EFE03. Transformants harboring pUC303-EFElO and pUC303- EFE30 in which the luc promoter was placed upstream of the efe gene exhibited ethylene-forming activities in vivo that were from l/7 to half of that of a pUC303- EFE03 transformant. Furthermore, transformants harboring pEXE3-I that contained the psbAI::efe gene in the opposite transcriptional orientation to that of the Cm’ gene on pUC303 exhibited only l/15 specific ethylene- forming activity in vivo as compared with that of transformants harboring pUC303-EFE03. The transformant harboring pEXE3-II, whose psbAl::efe gene insert had the opposite orientation to that in pEXE3-I, did not show any ethylene-forming activity.

We also observed the ethylene-forming activities of the E. coii transformants that harbored the above recombinant plasmids. E. coli transformants harboring pUC303-EFE03, pUC303-EFEIO, and pUC303-EFE30 exhibited quite high ethylene-forming activities in vivo, whereas no activity was detected in E. coli transformants harboring pEXE3-I or pEXE3-II (data not shown). This result shows that the psbA1 promoter does not function in E. coli. In addition, the E. coli transformants harboring the &-promoter-containing pUC303-EFElO and pUC303-EFE30 exhibited enhanced in viva ethylene-

forming activities after induction with IPTG (data not shown). On the other hand, no effect of IPTG addition on the ethylene-forming activities was observed in Syn- echococcus transformants (Table 2), which is consistent with the absence of the lactose operon repressor in cyanobacteria.

In contrast to the ethylene-forming activities in vivo, ethylene-forming activities in vitro of the Synechococcus transformants were different (Table 2, last column).

TABLE 2. Comparison of ethylene-forming activities in vivo and EFE activities in vitro with various types of recombinant Synechococcus sp. PCC7942

Plasmid IPTGa Ethylene-forming activity in vivo (nl/ml culture broth/OD&h)

EFE activity in vitro (units/mg protein)

puc303 pUC303-EFE03 pUC303-EFElO pUC303-EFEIO pUC303-EFE30 pUC303-EFE30 pEXE3-I pEXE3-II

- +

0 0 33.4 0.143 ’

7.64 0.093 4.43 0.055

10.4 0.083 18.3 0.158 2.24 0.277 0 0

a The final concentration of IPTG added was 1 mM.

438 SAKAI ET AL. J. FERMENT. BIOENG.,

(A) Eco RI

145678910111: (6)

Eco RI

178910111:

probe : efe ORF probe : p&A/ ORF FIG. 1. Southern blotting analysis of plasmids extracted from 12 different Synechococcus sp. PCC 7942 R2-SPc transformants harboring

pEXE3-I. Lanes 1 to 12 in the agarose gel each contained 0.4 /lg of plasmid DNA that had been digested with EcoRI. The size of bands is indicated by an arrow. Hybridization conditions: Temperature, 68°C; 5 ‘* SSC; with digoxigenin-labeled probes. (A) efe gene probe (1050 bp); (B) psbAZ gene probe (1080 bp).

Ethylene-forming activity in vitro assayed using cell-free extracts of the transformant harboring pEXE3-I was the highest recorded for all the transformants. We consistently observed 2 to 3 fold higher values of ethylene-forming activities in vitro for the pEXE3-I transformant than for those harboring other plasmids, although the in vitro ethylene-forming activities of transformants harboring pEXE3-I fluctuated considerably depending on the time at which transformant cells were analyzed (see below).

Instability of plasmids containing the psbAI promoter/ terminator sequences in cyanobacterial transformants Among the pEXE3-I transformants, we selected 12 strains

at random and measured their in vivo ethylene-forming activities. We found that some transformants produced ethylene at relatively high rates, while the others exhibited very low ethylene-forming activities. The plasmids were extracted from all of these transformant strains and analyzed by Southern hybridization (Fig. 1). As shown in panel (A) in Fig. 1, the plasmids in transformants exhibiting little or no ethylene-forming activities scarcely hybridized with the efe gene probe (Fig. 1, lanes 3-7, 9, 10). The same plasmids, however, hybridized with the psbAI gene probe (Fig. 1, panel B). In contrast, the transformants exhibiting high level of ethylene-

Length of psbAl promoter region

(bp) 1800 1400 1000 800 200 0

pEXE3

Al

A2

A3

AKM

A4

A5

A8

A7

A8

A9

w OL=--- pEXE3 A 1 A2 A3 AKM A4 A5 A6 A7 A8 A9

FIG. 2. Effect of the length of the psbAZ promoter upstream region on the specific rate of ethylene production by Synechococcus sp. PCC 7942 harboring various EFE expression plasmids. Upper panel: the length of the psbAZ promoter region. The lengths are expressed in bp from the translational start codon of the efe gene. pEXE3 ?IKM represents a deletion plasmid obtained by deleting a sequence between KpnI and MIuI sites in the S’kipstream region of the psbAZ promoter. Lower panel: in vivo ethylene-forming activities of the transformants harboring various plasmids.


Plasmid

TABLE 3. Ethylene formation of various recombinant Synechococcus sp. PCC7942 strains

Ethylene Color (h’l)

Max. specific ethylene-forming activity in vivo (nl/ml/OD&h)

formationb Carbon recovery for ethylene

(&ml) (%)

puc303 blue-green 0.075 0 0 0 pUC303-EFE03 blue-green 0.048 52.9 16.4 5.84 pUC303-EFElO blue-green 0.051 17.6 6.64 2.12 pUC303-EFE30 blue-green 0.037 11.1 2.82 0.84 pEXE3-I green 0.041 15.9 0.0709 0.02 pEXE3Al yellow-green 0.038 130 0.236 0.05 pEXE384 yellow-green 0.043 242 5.04 1.62 pEXE3A8 yellow-green 0.035 323 7.06 3.47 pEXE3A9 blue-green 0.065 15 5.07 1.15

a p, Specific growth rate (h-l). i=12 b Ethylene formation was calculated by the equation, Z. vi x 24, in which vi denotes ethylene-forming rate at any time (&ethylene/ml/h).

forming activities harbored plasmids that hybridized with the efe gene probe but not with the psbAI gene probe (Fig. 1, lanes 1, 2, 8, 1 l), except for one plasmid (lane 12) which did not hybridize with either probe. This means that the psbAI::efe gene on pEXE3-I was rear- ranged to a copy of the psbAI gene during propagation of Synechococcus transformants. The conversion from the psbAI::efe gene to the psbAI gene might have taken place via recombination at the homologous DNA sequences of the psbAZ promoter and terminator on the pEXE3-I plasmid and the psbAI gene on the host chromosome.

Since pEXE3-I contained approximately 1600 bp of the 5’-upstream and approximately 500 bp of the 3’-downstream regions of the psbAI gene flanking the efe gene cassette, we had anticipated that deletion of some of the unnecessary sequences from pEXE3-I might stabilize the plasmids within the Synechococcus cells. We thus constructed the pEXE3 A series of plasmids in which both the 5’-upstream region of the psbAI promoter and the 3’- downstream region of the psbAZ terminator were deleted. As shown in the upper panel of Fig. 2, the length of the 5’-upstream region of the psbAI promoter was shortened from 1600 bp in pEXE3-I to as short as 100 bp in pEXE3 A9. From the nucleotide sequence analysis of the psbA genes that code for Dl proteins in Synechococcus sp. PCC7942 previously performed by S. S. Golden et al. (25), it was inferred that the putative promoter sequence for the psbAZ gene is included within - 100 bp from the initiation codon and that the terminator sequence of psbAI gene was included within approximately 80 bp immediately after the stop codon. There- fore, we constructed all the deletion derivatives so that they had a fixed terminator sequence of 85 bp in length.

Figure 2 shows the ethylene-forming activities in viva of transformants that harbored the pEXE3 A series of plasmids. The specific ethylene-forming activity in vivo of the transformants that harbored pEXE3 A series of plasmids was increased by deleting the upstream region of the psbAI promoter (shown in the lower panel of Fig. 2), achieving the maximum specific activity of the transformant harboring pEXE3 As. However, even a deletion as small as 250 bp from the 5’-end of the promoter fragment resulted in higher ethylene-forming activity in pEXE3 Al than that in pEXE3-I. As the length of the deletion in the 5’-upstream region of the psbAI promoter increases, the transformants harboring recombinant plasmids exhibited a substantially high ethylene-forming activities in vivo which were between 1 to 3 fold the ethylene-forming activity of pEXE3 Al transformant.

However, the specific ethylene-forming activity decreased sharply when the psbAI promoter sequence had been shortened to 100 bp in pEXE3 89.

Stability of the ethylene-forming activity in vivo of various recombinant Synechococcus strains was tested by successive transfers of batch cultures. We usually obtained a single colony of transformants at 15 d after transformation, inoculated cells from that single colony into a liquid BG-11 medium, and allowed a pre-culture to grow for 10d. Then, we made batch cultures which were each incubated for 3 d and then was transferred to new media. As shown in Fig. 3, the relative ethylene- forming activities of transformants harboring pUC303- EFE03, pUC303-EFElO and pUC303-EFE30, all of which had no homology to the host cyanobacterial chromosome, were completely stable. The ethylene-forming activity of transformant which harbored unstable pEXE3-I declined completely within 5 generations in batch culture. The transformants bearing pEXE3 A series of plasmids exhibited partially stabilized ethylene-forming activities, the degree of stabilization being proportional to the extent of deletion of the 5’-upstream sequence of the psbAZ promoter on the plasmids (compare pEXE3 A 1,4, and 8 in Fig. 3). However, even the transformant harboring the pEXE3 A8 plasmid with a large deletion exhibited unstable ethylene-forming activity which decreased with a half-life of 12 generations.

Relationship between ethylene production and growth rate Table 3 summarizes the specific growth rates and the ethylene productivity of recombinant Sun- echococcus transformants. The specific growth rate (CL) gradually decreased with increasing ethylene productivity. It was also noted that cultures of transformants with high ethylene-forming activities (such as those harboring pEXE3 Al,4 and 8) turned a yellowish-green to green color as compared with the usual blue-green color of the control culture of transformants which harbored pUC303 (Table 3, second column). This change in color of the transformant cultures exhibiting high ethylene- forming activities was not simply caused by ethylene gas accumulated in the culture flasks, since Synechococcus sp. PCC7942 R2-SPc cells harboring pUC303 did not change color even when they were grown under authen- tic ethylene gas (0.01% in air). Thus, the change of pigment content in ethylene-producing transformants might have resulted from some kind of metabolic stress within the cells.

The maximum ethylene-forming activities in vivo of the different transformants are compared in the fourth column of Table 3. Among the transformants with


100

-e 10 L .c 2 , 2 g 0.1 ‘G s d 0.01

0.001

Generations

FIG. 3. Comparison of the stability of the ethylene-forming activities in Synechococcus sp. PCC 7942 transformants harboring various plasmids. Symbols: q , pUC303-EFE03; n , pUC303-EFElO; 0, pUC303-EFE30; 0, pEXE3; n, pEXE391; A, pEXE3A4; V, pEXE3A8; v, pEXE3119.

ethylene-forming activities, the values ranged from the highest for the transformant harboring pEXE3 A8 to the lowest for that harboring pUC303-EFE30, with a 29-fold difference. In order to compare the in vivo activity with the in vitro activity, both activities were measured using recombinant Synechococcus harboring various plasmids that were harvested on the 4th d of cultivation when the highest ethylene-forming activities were attained. Figure 4 shows the relationship between the in vivo ethylene- forming activity and the in vitro EFE activity of recombinant Synechococcus. Both activities correlated well and were proportional, suggesting that no physiological limitation had been imposed on the production of ethylene within the cyanobacterial cells, i.e., the EFE was saturated with substrates. Assuming that the purified EFE protein has a specific activity of 660 nmol/mg-protein/min (8), the amount of EFE protein was maximal in the transformant harboring pEXE3 A4 at 0.29% of the total cellular protein (data not shown).

Calculation of carbon recovery The recovery of carbon from carbon dioxide and its incorporation into ethylene was calculated as a percentage of the total amount of carbon fixed. Assuming that Synechococcus transformant cells growing in synthetic BG-11 medium fixed atmospheric carbon dioxide into cellular materials and ethylene without secreting any by-products into the medium, the total amount of carbon fixed is the sum of the amount of carbon fixed into cells and ethylene. The

2500

Ethylene-forming activity (in viva )

(nl / ml / OD730 I h)

FIG. 4. Relationship between the ethylene-forming activity in vivo and the EFE activity in vitro of the recombinant Synechococcw sp. PCC 7942 cells harboring various plasmids. Nine recombinant cyanobacterial strains harboring various plasmids represented in Table 3 were cultivated for 4d under illumination at 8 klx with fluorescent lamps at 25°C.

rate of fixation of carbon into cells is denoted as Vz (pg- cell carbon/ml/h) = AOD&h x (dry weight conversion factor, 250 ~g-cell/ml/OD,,O) x 0.5, where carbon content in the cells was estimated as 50%. The rate of fixation of carbon into ethylene is denoted as V3 (pg-ethylene carbon/ml/h)=Vi x 24/22.4, where Vi is the rate of ethylene production (~1 ethylene/ml/h). Thus, the rate of the fixation of total carbon was calculated as V1=V2 +V3. Recovery of carbon from carbon dioxide and its incorporation into ethylene was therefore calculated as vj/(vz+v3)x 100%.

The rates of recovery of carbon and incorporation into ethylene are shown in the last column of Table 3. The maximum amount of carbon recovered and incorporated into ethylene during 12d of cultivation was 5.84% and was attained for the transformant harboring pUC303-EFE03. Although the highest ethylene-forming activity in vivo was observed for the transformant harboring pEXE3 A8, the latter plasmid was unstable as compared with pUC303-EFE03. Thus, the recovery of carbon and its incorporation into ethylene for the entire cultivation period of transformants harboring unstable plasmids was less than that of transformants harboring stable plasmids.

P psbA1 T P psbAI T

+

c;;b 3 Gene Conv;lon ~~

FIG. 5. Schematic representation of the gene conversion of pEXE3-I in cyanobacteria. P and T denote the promoter and terminator

sequences of the p&AI gene, respectively. Wavy lines represent the chromosomal DNA of Synechococcus sp. PCC 7942.


DISCUSSION

The final goal of this study is the establishment of recombinant cyanobacterial strains producing ethylene from carbon dioxide in the atmosphere at high rates. We have chosen a unicellular, obligately photoautotrophic cyanobacterium, Synechococcus sp. PCC7942 as a model microorganism in which the efe gene from P. syringae could be expressed to full potential. The replicating plasmid system employed in this study depends upon the availability of a host-vector system and various promoter and terminator sequences that function in cyanobacteria. The shuttle vector pUC303 contains an autonomously replicating sequence from a cryptic plasmid, pUH24, in Synechococcus sp. PCC7942 (24), whereas the host R2- SPc strain had lost the pUH24. Therefore, pUC303 derivatives exhibiting no homology with the host DNA could be stably maintained.

We have investigated three kinds of promoters to test expression of the EFE in cyanobacteria. Considering the alignment of promoter sequences that function in Syn- echococcus sp. PCC 7942 previously reported (32), it is considered that promoter sequences with the sigma70- type consensus sequence are possible candidates for a promoter of the efe gene. The native Pseudomonas efe gene contained a promoter that resembled the sigma70- type consensus sequence (33), and pUC303-EFE03 containing the efe gene operated in Synechococcus and conferred ethylene-forming activities in vivo and in vitro on Synechococcus that were consistently three to five times higher than those of Synechococcus harboring the lac promoter-containing plasmids, pUC303-EFElO and pUC303-EFE30 (compare Tables 2 and 3). This result indicated that the promoter sequence of the native efe gene could be compatible with the cyanobacterial transcription apparatus. On the other hand, transformants harboring pUC303-EFE30 exhibited slightly higher ethylene-forming activities in vivo and in vitro than those harboring pUC303-EFElO (Table 2). This may reflect the efficient translation of the EFE from the gene on pUC303-EFE30 in which the EFE was expressed as a fusion protein with a short N-terminal peptide encoded by the lad gene (14).

The highest level of ethylene-forming activity was obtained in the recombinant cyanobacteria that harbored the plasmids carrying the p&AZ promoter-driven efe gene. When the maximum ethylene-forming activities in vivo are compared among different cyanobacterial transformants (Table 3), the ethylene-forming activity exhibited by the transformant harboring pEXE3 A8 was approximately six times higher than that of the transformant harboring pUC303-EFE03. The high efficiency of transcription as well as of translation of the psbAZ gene encoding one of the Dl proteins in photosystem II in Synechococcus sp. PCC7942 may contributed to the high level of expression of the efe gene cassette which was inserted precisely between the psbAZ promoter and terminator on the plasmid. Since the psbAZ promoter does not contain any sigma70-type consensus sequence or an E. coli-type ribosomal binding site, the high efficiency of the psbAZ promoter and terminator sequences in directing the efe gene expression would be due to the specific nucleotide sequence(s) that could act only in cyanobacteria. Indeed, the psbAZ promoter did not function in E. coli. In addition, the psbAZ promoter was affected by transcription from the Cm’ gene promoter, since the

psbAI::efe gene was functional in the reverse orientation but not in the same orientation as that for transcription of the Cm’ gene on pUC303 (cf. pEXE3-I and pEXE3-II in Table 2).

The stability of the ethylene-forming activities in vivo of the transformants that harbored the various plasmids as described in Table 3 could reflect the intactness of the efe genes on the plasmids, i.e., the efe gene has been damaged or inactivated during cultivation of the transformants. In the transformants harboring pEXE3 which contained both the 5’ and 3’ flanking regions of the psbAZ gene that had been derived from the same host, an extensive rearrangement was observed in the psbAl::efe gene leading to a replacement of the efe gene cassette by the psbAZ gene ORF (see Fig. 1). Although we did not verify the nucleotide sequence of the rear- ranged plasmids, Southern hybridization and restriction mapping indicated that the efe gene cassette on pEXE3 appeared to be converted into a copy of the psbAZ gene ORF as shown in Fig. 5. This phenomenon might result from a gene conversion rather than a reciprocal recombination between homologous DNA sequences of the psbAZ loci on the plasmids and chromosome, because the ethylene-forming activity of the transformants harboring pEXE3 decreased in parallel to the loss of the efe gene. The loss of the efe gene copy from the recombinant cyanobacteria is in accordance with the one-way transfer of genetic information via gene conversion (34).

The causal effect of gene conversion originates from the homology between the plasmids and host chromosome, since the stabilities of the pEXE3 A series of plasmids were much improved by deleting the S-upstream region of the psbAZ promoter as well as the 3’-downstream region of the psbAZ terminator (Fig. 3). Both upstream and downstream sequences might be responsible for the plasmid instability, since reduction of the 5’- upstream region of the psbAI promoter from 1,600 bp in pEXE3 to 1,350 bp in pEXE3 Al resulted in much higher level of expression of the efe gene (see Fig. 2). This may simply be explained by the simultaneous reduction in the length of the 3’-downstrean region of the psbAZ terminator from approximately 500 bp in pEXE3 to 85 bp in the pEXE3 A series of plasmids. However, the length of the 5’-upstream region of the psbAZ promoter had an effect on the plasmid stability as exem- plified by the gradual improvement in the plasmid stability following successive deletion of the 5’-upstream region of the psbAZ promoter in the pEXE3 A series of plasmids (see Fig. 3). Thus, it was concluded that both the lengths of the 5’-and 3’-flanking regions of thepsbAZ gene homologous with the chromosomal psbAZ locus would be proportional to the frequency with which the gene conversion events within cyanobacterial cells were triggered. We still do not know the stability of plasmids in which only one side of the efe gene was flanked by a sequence homologous to the chromosomal sequence of the cyanobacterial host. The latter type of plasmid configuration for the efe gene might suggest a mecha- nism of gene conversion in cyanobacterial cells.

Notable pigment disorder was observed in the cyanobacterial cultures expressing the efe gene under the control of the psbAZ promoter (Table 3). Because we did not observe any change in the color of the cultures of the transformants harboring the efe gene controlled by promoters other than the psbAZ promoter, we suspect that the psbAZ promoter per se might have affected the


pigment stoichiometry which was reflected by the change of color from blue-green to yellowish green. The nucleotide sequence of the ?-upstream region of the psbAZ gene was determined to assess the role of this region in the psbAZ promoter activation, but no sequence(s) clear- ly responsible for the regulation of the psbAI gene have been revealed to date (data not shown). However, the promoter of the psbAZ gene with approximately 150 bp upstream region has been shown to be subjected to circadian rhythm regulation (35). It is quite possible that the psbAI promoter provides binding site(s) for transcription factor(s) essential for the expression of a number of photosystem genes. Thus, an increased dose of the psbAI promoter on a multicopy plasmid’ derived from pUC303 would result in the limitation of transcriptional factor(s) within the cyanobacterial cells due to titration, causing a malfunction of photosystem gene expression.

3.

4.

5.

6.

7.

8. In order to overcome the instability of the psbAI-

controlled expression of the efe gene, we will have to con- sider the construction of cyanobacterial strains in which the psbAI::efe gene or similar efe genes with artificial promoters are integrated into the host chromosome. Such integration of the efe gene into the chromosome would eliminate the instability of plasmids caused by homologous gene recombination or gene conversion. Several DNA sequences on the cyanobacterial chromosome not containing an essential gene were isolated on plasmids and were designated as neutral sites (36). In- tegration of foreign genes into these neutral sites might cause no problems in host function, although we should remain aware of the possible effects imposed by foreign gene expression or the adverse effects of artificial promoters.

9.

10.

11.

12.

The results in Fig. 4, which shows the positive correla- tion between the in vivo and in vitro ethylene-forming activities, might suggest that the rate-limiting step of the ethylene production in this study was the concentration of the EFE within the cells. We observed previously that overexpression of the EFE in E. coli resulted in a progressive saturation of ethylene production due to the metabolite shortage in the tricarboxylic acid cycle, resulting from the elimination of 2-oxoglutarate through the reaction catalyzed by the EFE (14). When the overexpression of the EFE in cyanobacteria begins to cause a problem with respect to metabolite shortage, it would be- come necessary to reinforce other key enzymes responsible for carbon dioxide fixation, such as phosphoenol- pyruvate carboxylase and carbonic anhydrase.

13.

14.

15.

16.

ACKNOWLEDGMENTS

We are indebted to Prof. J. Hirschberg, at the Hebrew Univer- sity of Jerusalem, Israel for providing us with pPAN35R2. We thank K. Yoneyama and A. Kobayashi for their assistance in plasmid construction and hybridization experiments. This work was supported by the Original Industrial Technology R & D Promotion Program of the New Energy and Industrial Technology Develop- ment Organization (NEDO) of Japan.

17.

18.

19.

20.

Fukuda, H.. Ogawa, T., and Tanase, S.: Ethylene production of micro-organisms, p. 275-306. In Rose, A. H. (ed.), Adv. Microbial Physiol., vol. 35. Academic Press Inc., London (1993). Adams, D. 0. and Yang, S. F.: Ethylene biosynthesis: iden- tification of l-aminocyclopropane-1-carboxylic acid. Proc. Natl. Acad. Sci. USA, 76, 170-174 (1978). Pirrung, C. M., Kaisen, M. L., and Chen, J.: Purification and properties of the appIe fruit ethylene-forming enzyme. Bio- them., 32, 7445-7450 (1993). Fukuda, H., Takahashi, M., Fujii, T., and Ogawa, T.: An NADH:Fe(III)EDTA oxidoreductase from Cryptococcus albi- dus: an enzyme involved in ethylene production in vivo? FEMS Microbial. Lett., 60, 107-l 12 (1989). Nagahama, K., Ogawa, T., Fujii, T., Tazaki, M., Goto, M., and Fukuda, H.: L-Arginine is essential for the formation in vitro of ethylene by an extract of Pseudomonas syringae. J. Gen. Microbial., 137, 1641-1646 (1991). Nagahama, K., Ogawa, T., Fujii, T., Tazaki, M., Tanase, S., Morino, Y., and Fukuda, H.: Purification and properties of an ethylene-forming enzyme from Pseudomonas syringue. J. Gen. Microbial., 137, 2281-2286 (1991). Fukuda, H., Fujii, T., and Ogawa, T.: Preparation of a cell- free ethylene-forming system from Penicillium digitatum. Agric. Biol. Chem., 50, 977-981 (1986). Fukuda, H., Kitajima, H., Fujii, T., Tazaki, M., and Ogawa, T.: Purification and some properties of a novel ethylene-forming enzyme produced by Penicillium digitarum. FEMS Micro- biol. Lett., 59, l-6 (1989). Fukuda, H., Ogawa, T., Tazaki, M., Nagahama, K., Fujii, T., Tanase, S., and Morino, Y.: Two reactions are simultaneously catalyzed by a single enzyme: the arginine-dependent simultaneous formation of two products, ethylene and succinate, from 2-oxoglutarate by an enzyme from Pseudomonas svringae. Bio- them. Biophys. Res. Commun., 188, 483-489 (1992). Fukuda, H., Ogawa, T., Ishihara, K., Fujii, T., Tanase, S., and Morino, Y.: Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem. Biophys. Res. Commun., 188, 826-832 (1992). Matsuda, J., Okahe, S., Hashimoto, T., and Yamada, Y.: Molecular cloning of hyoscyamine 6,%hydroxylase, a 2- oxoglutarate-dependent dioxygenase, from cultured roots of Hyosyamus niger. J. Biol. Chem., 266, 9460-9464 (1991). Ishihara, K., Matsuoka, M., Inoue, Y., Tanase, S., Ogawa, T., and Fukuda, H.: Overexpression and in vitro reconstitution of the ethylene-forming enzyme from Pseudomonas syringae. J. Ferment. Bioeng., 79, 205-211 (1995). Fukuda, H., Sakai, M., Nagahama, K., Fujii, T., Matsuoka, M., Inoue, Y., and Ogawa, T.: Heterologous expression of the gene for the ethylene-forming enzyme from Pseudomonas svringae in the cyanobacterium Synechococrus. Biotechnol. Lett., 16, l-6 (1994). Wang, W. C., Dudek, M. P., Liang, X. Z., and Kiehl, J. T.: Inadequacy of effective CO* as a proxy in simulating the greenhouse effect of other radiatively active gases. Nature, 350, 573- 577 (1991). Takeshima, Y., Takatsugu, N., Sugiura, M., and Hagiwara, H.: High-level expression of human superoxide dismutase in the cyanobacterium Anacystis nidulans 6301. Proc. Natl. Acad. Sci. USA, 91, 9685-9689 (1994). Chungjatupornchai, W.: Expression of the Mosquitocidal-protein genes of BaciNus thuringiensis subsp. israelensis and the herbicide-resistance gene bar in Synechocystis PCC6803. Curr. Microbial., 21, 283-288 (1990). Sortes-Rak, E., Kushner, D. J., Williams, D. D., and Coleman, J. R.: Factors regulating cryWB expression in the cyanobacterium Synechococcus PCC7942. Mol. Gen. Genet., 246, 301- 308 (1995). Dzelzkalns, V. A., Owens, G. C., and Bogorad. L.: Chlo- roplast promoter driven expression of the chloramphenicol acetyl transferase gene in a cyanobacterium. Nucl. Acids Res., 12, 8917-8925 (1984).

1.

2.

REFERENCES

Imaseki, H.: The biochemistry of ethylene biosynthesis, p. l- 20. In Mattoo, A. K. and Suttle, J. C. (ed.), The plant hormone ethylene. CRC Press, Boca Raton (1991). Ogawa, T. and Fukuda, H.: Microbial ethylene-forming enzyme; perspectives on microbial ethylene production from CO?. Kagaku to Seibutu, 34, 286-287 (1996). (in Japanese)


21. Kawata, Y., Yamano, N., Kojima, H., and Itoh, S.: Expres- sion of salmon growth hormone in the cyanobacterium AgmeneNum quadruplicatum. Biotechnol. Lett., 13, 851-856 (1991).

22. Yanisch-Perron, C., Vieira, J., and Messing, J.: Improved Ml3 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene, 33, 103- 119 (1985).

23. MarInus, M. G. and Morris, N. R.: Pleiotropic effects of a DNA adenine methylation mutation (dam-3) in Escherichia coli K12. Mutation Res., 28, 15-26 (1975).

24. Kuhlemeier, C. J. and van Arkel, G. A.: Host-vector systems for gene cloning in cyanobacteria, p. 199-215. In Wu, R. and Grossman, L. (ed.), Methods in enzymology, vol. 153. Academic Press Inc., San Diego (1987).

25. Golden, S. S., Brusslan, J., and Haselkorn, R.: Expression of a family of psbA genes encoding a photosystem II polypeptide in the cyanobacterium Anacystis nidulans R2. The EMBO J., 5, 2789-2798 (1986).

26. Allen, M. M.: Simple conditions for growth of unicellular blue- green algae on plates. J. Phycol., 4, l-4 (1968).

27. Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166, 557-580 (1983).

28. Sambrook, J., Fritsh, E. F., and Maniatis, T.: Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labora- tory Press, Cold Spring Harbor, New York (1989).

29. Sanger, F., Nicklen, S., and Coulson, A.R.: DNA sequencing

with chain-terminating inhibitors. Proc. NatI. Acad. Sci. USA, 74, 5463-5467 (1977).

30. Sutcliffe, J. G.: Complete nucleotide sequence of the Esch- erichia coli plasmid pBR322. Cold Spring Harbor Symp. Quant. Biol., 43, 77-90 (1979).

31. Henikoff, S.: Unidirectional digestion with exonuclease III in DNA sequence analysis, p. 156-165. In Wu, R. (ed.), Methods in enzymology, vol. 155, Academic Press Inc., San Diego (1987).

32. Takeshima, Y.: Efficient expression of foreign genes in cyanobacteria, p. 100-104. In Bioscience and Industry, vol. 54. Bioindustry Development Center, Tokyo (1996). (in Japanese)

33. Grihskov, L. M. and Gross, C.: The ~1’~ family: sequence con- servation and evolutionary relationships. J. Bacterial., 174, 3843-3849 (1992).

34. Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J., and Stahl, F. W.: The double-strand-break repair model for recombination. Cell, 33, 25-35 (1983).

35. Kondo, T., Strayer, C. A., Kulkarni, R. D., Taylor, W., Ishiura, M., Golden, S. S., and Johnson, C. H.: Circadian rhythms in prokaryotes: luciferase as a reporter of circadian gene expression in cyanobacteria. Proc. Natl. Acad. Sci. USA, 90, 5672-5676 (1993).

36. Bustos, S. A. and Golden, S. S.: Light-regulated expression of the psbD gene family in Synechococcus sp. strain PCC7942: evidence for the role of duplicated psbD genes in cyanobacteria. Mol. Gen. Genet., 232, 221-230 (1992).

photosynthetic conversion of carbon dioxide to ethylene by the recombinant cyanobacterium,...

Documents