pdcd4 is a direct target of mir-21 in oscc and … · oscc originates in the mucosal lining of...
TRANSCRIPT
PROGRAMMED CELL DEATH 4 IS A DIRECT TARGET OF MIR-21 AND
REGULATES INVASION IN ORAL SQUAMOUS CELL CARCINOMA
by
Miranda Joan Tomenson
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Medical Biophysics
University of Toronto
© Copyright by Miranda Joan Tomenson, 2009
ii
Programmed Cell Death 4 is a Direct Target of miR-21 and Regulates Invasion in Oral Squamous Cell Carcinoma
Miranda Tomenson Degree of Master of Science, 2009 Graduate Department of Medical Biophysics University of Toronto
Abstract
Programmed Cell Death 4 (PDCD4) is a known tumour suppressor, lost in carcinomas of the
breast, prostate, colon, lung and ovary. This study found significantly reduced levels of PDCD4
mRNA and protein in both primary patient oral squamous cell carcinomas (OSCCs) and OSCC
cell lines. Moreover, lower PDCD4 mRNA levels were significantly correlated with nodal
metastasis (P=0.019). To determine the functional significance of PDCD4 down-regulation in
OSCC we asked whether PDCD4 played a role in invasion. In fact, over-expression of PDCD4
decreased invasion of OSCC lines. We then sought to determine a mechanism for PDCD4
down-regulation in OSCC. Previous studies in breast and colon carcinomas suggested that
reduced PDCD4 expression was due to over-expression of miR-21. Interestingly, miR-21 was
inversely correlated to PDCD4 mRNA (P=0.002) and PDCD4 protein (P<0.001) levels in
OSCC patient samples. Moreover, we found that miR-21 directly regulated PDCD4 protein
expression in OSCC cell lines. This is the first report in OSCC that demonstrates that PDCD4 is
down-regulated by miR-21 and may play a role in OSCC invasion.
iii
This thesis is dedicated to my grandmother, Joan Tomenson, and my grandfather, Fausto Canella, who both lost their lives to cancer.
iv
Acknowledgements
I would like to thank all my family and friends for their support. I would especially like to thank
Sara and Bianca for being there when I needed a study break, my parents for their constant
encouragement and Rikki for keeping me sane. I would like to acknowledge all the members of
the Kamel-Reid lab, past and present, for their advice and support. In particular, I would like to
thank: Patricia Reis for all her help with my project and proofreading of this manuscript, Rikki
Bharadwaj and Yali Xuan for their technical assistance, Mahadeo Sukhai for all his constructive
criticism and proofreading of this manuscript and Jerry Machado for helping me get started in
the lab. I would like to thank my committee members: Jonathan Irish, Igor Jurisica, Anne Koch
and Bayardo Perez-Ordonez for all of their guidance and support. Finally, I would like to show
my sincere appreciation and thankfulness to my supervisor, Suzanne Kamel-Reid, for teaching
me how to work hard and for encouraging me to be my best.
v
Table of Contents
Abstract .......................................................................................................................................... ii
Dedication ..................................................................................................................................... iii
Acknowledgements....................................................................................................................... iv
Table of Contents ............................................................................................................................ v
List of Tables ............................................................................................................................... vii
List of Figures ............................................................................................................................. viii
Chapter 1: Oral Squamous Cell Carcinoma.................................................................................... 1
1.1 Definition and Epidemiology ................................................................................................ 2
1.2 Risk Factors ........................................................................................................................... 3
1.3 Presentation, Staging and Prognosis ..................................................................................... 4
1.4 Recurrence............................................................................................................................. 8
1.5 Metastasis .............................................................................................................................. 9
1.6 Treatment ............................................................................................................................ 12
Chapter 2: Biology of Oral Squamous Cell Carcinoma ............................................................... 15
2.1 Tumour Progression ............................................................................................................ 15
2.2 Molecular Alterations.......................................................................................................... 15
2.3 Microarrays Identify Important Genetic Alterations in OSCC ........................................... 20
Chapter 3: Programmed Cell Death 4 ........................................................................................... 22
3.1 Structure and Sub-cellular Localization .............................................................................. 22
3.2 Inhibition of Neoplastic Transformation ............................................................................. 24
3.3 Inhibition of Translation ..................................................................................................... 25
3.4 Regulation of Invasion ........................................................................................................ 26
3.5 Role in Cell-cycle and Apoptosis ........................................................................................ 28
3.6 Regulation of PDCD4 ......................................................................................................... 29
Chapter 4: Micro-RNA 21 ............................................................................................................ 32
4.1 Micro-RNAs and their Involvement in Cancer ................................................................... 32
4.2 Predicted miR-21 Targets ................................................................................................... 34
4.3 miR-21 Regulation of PDCD4 Expression and Function ................................................... 35
Chapter 5: Hypotheses and Objectives ......................................................................................... 37
vi
Chapter 6: Materials and Methods ................................................................................................ 39
6.1 Sample Collection ............................................................................................................... 39
6.2 Patient Information.............................................................................................................. 39
6.3 Cell Culture ......................................................................................................................... 42
6.4 RNA Extraction ................................................................................................................... 42
6.5 Detection of mRNA levels by quantitative RT-PCR .......................................................... 46
6.6 Detection of miR-21 levels by Taqman PCR ...................................................................... 48
6.7 Immunohistochemistry ........................................................................................................ 49
6.8 Detection of Protein by Western Blot ................................................................................. 51
6.9 Detection of PDCD4 Protein by Confocal Microscopy ...................................................... 53
6.10 Plasmids ............................................................................................................................ 53
6.11 Pre-miRs, Anti-miRs and si-RNA .................................................................................... 55
6.12 Transfection....................................................................................................................... 55
6.13 Transwell Invasion Assay ................................................................................................ 56
6.14 Flow Cytometry ............................................................................................................... 58
6.15 In Silico Analysis for miR Binding Sites ......................................................................... 58
6.16 PDCD4 Mutation Assay .................................................................................................... 59
6.17 Statistical Analysis ........................................................................................................... 61
Chapter 7: Results ......................................................................................................................... 63
7.1 PDCD4 Expression is Lost in OSCC .................................................................................. 63
7.2 PDCD4 Affects Invasion of OSCC Cell Lines ................................................................... 71
7.3 PDCD4 Does Not Affect the Cell Cycle/Apoptosis in OSCC Cell Lines .......................... 74
7.4 miR-21 is Over-expressed and Inversely Correlated to PDCD4 in OSCC ......................... 81
7.5 miR-21 Regulates PDCD4 in OSCC cell lines ................................................................... 85
7.6 PDCD4 is a Direct Target of miR-21 .................................................................................. 87
7.7 Post-translational Regulation of PDCD4 in OSCC ............................................................. 91
7.8 PDCD4 Downstream targets ............................................................................................... 94
Chapter 8: Discussion ................................................................................................................... 97
8.1 PDCD4 is a Under-expressed in OSCC .............................................................................. 97
8.2 PDCD4 Regulates Invasion in OSCC Cell Lines .............................................................. 99
8.3 The Mechanism by which PDCD4 Regulates Invasion .................................................... 100
vii
8.4 PDCD4 Effects on Cell Proliferation in OSCC ................................................................ 103
8.5 PDCD4 Regulation in OSCC ............................................................................................ 104
8.7 PDCD4 as a Potential Therapeutic in OSCC ................................................................... 107
8.8 Conclusions ....................................................................................................................... 107
Chapter 9: Future Directions ...................................................................................................... 109
Chapter 10: References ............................................................................................................... 113
viii
List of Tables
Table I: TNM classification system used for OSCC ...................................................................... 6
Table II: Molecular alterations in OSCC ...................................................................................... 19
Table III: Description of patients, tumour site, clinical, histopathological data and outcome ..... 40
Table IV: Summary of patient information .................................................................................. 41
Table V: Clinical data of patients from whom the cell lines were derived .................................. 44
Table VI: Cell line characteristics ................................................................................................ 45
Table VII: Primer sequences for quantitative RT-PCR ................................................................ 47
Table VIII: Scoring of PDCD4 expression in OSCC tissues using IHC ...................................... 50
Table IX: Antibody conditions used for Western blotting ........................................................... 52
Table X: PDCD4 median expression levels in relation to clinicopathological data .................... 65
Table XI: Summary of PDCD4 IHC in patient samples .............................................................. 68
Table XII: Association between very low PDCD4 expression and clinicopathological data ..... 69
Table XIII: Relative invasion of OSCC cell lines ....................................................................... 78
Table XIV: PDCD4 effect on cell viability of OSCC cell lines ................................................... 80
Table XV: miR-21 median expression levels in relation to clinicopathological data ................. 83
ix
List of Figures
Figure 1.1: Metastatic process ...................................................................................................... 10 Figure 1.2: Sites of cervical lymph node metastasis in the head and neck ................................... 11 Figure 2.1: Representation of phenotypic progression from normal to invasive carcinoma ........ 16 Figure 3.1: PDCD4 protein structure ............................................................................................ 23 Figure 6.1: PDCD4 expression plasmids and miR-21 binding site .............................................. 54 Figure 6.2: Transwell invasion assay............................................................................................ 57 Figure 6.3: Site-directed mutagenesis of PDCD4 plasmid ........................................................... 60
Figure 7.1: PDCD4 mRNA in OSCC patient samples ................................................................. 64 Figure 7.2: PDCD4 IHC in normal and OSCC tissues ................................................................. 67 Figure 7.3: PDCD4 mRNA and Protein levels in OSCC cell lines .............................................. 70 Figure 7.4: Optimization of PDCD4 transfection ......................................................................... 72 Figure 7.5: Optimization of invasion Assay ................................................................................ 73 Figure 7.6: Confirmation of PDCD4 transfection ........................................................................ 75 Figure 7.7: Representative sections showing cellular invasion of OSCC cell lines .................... 76 Figure 7.8: Relative invasion of OSCC cell lines ......................................................................... 77 Figure 7.9: PDCD4 effect on cell viability and cell cycle ............................................................ 79 Figure 7.10: miR-21 levels in OSCC ........................................................................................... 82 Figure 7.11: miR-21 levels in OSCC cell lines ........................................................................... 84
Figure 7.12: Optimization of miR-21 transfection and knock-down .......................................... 86
Figure 7.13: miR-21 over-expression and knock-down in OSCC ................................................ 88
Figure 7.14: miR-21 regulation of PDCD4 mRNA expression in OSCC .................................... 89
Figure 7.15: miR-21 regulation of PDCD4 protein expression in OSCC .................................... 90
Figure 7.16: Effect of PDCD4 3’UTR miR-21 Binding Site Mutation ....................................... 92
Figure 7.17: PDCD4 cellular localization and phospho-PDCD4 expression in OSCC cell lines .......... 93
Figure 7.18: PDCD4 and c-Jun protein expression in OSCC cell lines ....................................... 95
Figure 7.19: Effect of PDCD4 on MMP-2 and MMP-9 expression ............................................. 96
1
Oral cancer is a disease that is more common with increasing age, as approximately 95% of
cases occur in people who are older than 40 years old (Burket et al., 2003a; SEER Cancer
Statistics Review, 2009). From 2000 – 2004, the median age of diagnosis was 62 in the United
States (SEER Cancer Statistics Review, 2009). However, the incidence of oral cancer in
Chapter 1: Oral Squamous Cell Carcinoma
1.1 Definition and Epidemiology
Head and neck cancer includes those cancers that originate from certain locations in the upper
aerodigestive tract, including the nasal cavity, lip, paranasal sinuses, pharynx, larynx and the
oral cavity. In the oral cavity, oral squamous cell carcinoma (OSCC) comprises 90% of all oral
cancers (Scully and Felix, 2006) and 2 – 3% of all human malignancies (Parkin et al., 2005).
OSCC originates in the mucosal lining of tissues such as the tongue, floor of the mouth, cheek
lining, gingiva or palate.
The annual incidence of oral cancer world-wide is approximately 275,000 cases, making it the
eleventh most common cancer in the world and among the ten most common causes of cancer
related death (Ferlay et al., 2004; Parkin et al., 2005; Warnakulasuriya, 2008). In North
America, oral cancer accounts for approximately 3% of all cancers diagnosed and the age
adjusted mortality rates of oral cancer is estimated to be 3-4 per 100,000 men and slightly less
than 1.5 per 100,000 women (Burket et al., 2003a). Canada had an estimated oral cancer
incidence of approximately 3,400, including 2,300 males and 1,100 females in 2008 (Canadian
Cancer Statistics, 2008). The 5-year survival rate for OSCC is approximately 62%, which has
been steadily improving (~2% per year) for the past decade (Canadian Cancer Statistics, 2008).
2
younger individuals (under the age of 45) is gradually increasing in Europe and North America
(Shiboski et al., 2005; Warnakulasuriya, 2008).
The most common sites of OSCCs are the tongue and the floor of mouth, while tumours of the
gingivae, buccal mucosa and palate are less frequent. The tongue is the most common site for
oral cancer in North American populations, and accounts for 40-50% of oral cancers
(Warnakulasuriya, 2008). However, buccal cancer is more common among Asian populations.
In Sri Lanka, about 40% of oral cavity tumours are found in the buccal mucosa (National
Cancer Control Programme, 2005). In order to understand these differences in incidence rates
for various sites and in different parts of the world, it is necessary to understand the
environmental risk factors that contribute to OSCC.
1.2 Risk Factors
Current risk factors for OSCC include tobacco and alcohol abuse, betel quid chewing and some
viruses (Neville and Day, 2002). Smoking has been associated with 80% of oral carcinomas
(Burket et al., 2003a). Studies have shown a 5 – 9 times greater risk of developing oral cancer
for smokers compared to non-smokers, and as much as 17 times greater risk for heavy smokers
(> 80 cigarettes/day) (Neville and Day, 2002). Additionally, the risk is higher in current smokers
than ex-smokers and in individuals who started smoking at an early age (International Agency
for Research on Cancer, 2004). In the literature, most studies focus on smoking, but other forms
of tobacco use are associated with an increased risk of OSCC. For example, betel quid chewing
is common in India and Southeast Asia and has been strongly associated with an increased risk
of buccal cancer there (Jacob et al., 2004; Murti et al., 1995; Yen et al., 2007). The quid usually
consists of a betel leaf wrapped around a mixture of areca nut and slaked lime and can contain
tobacco and sweeteners. Chewing of betel quid results in a progressive scarring of the mouth,
3
which leads to a precancerous condition called oral submucous fibrosis, which may transform to
cancer (Murti et al., 1995). Other risk factors for OSCC include marijuana use (Silverman,
2001; Zhang et al., 1999), snuff and chewing tobacco (Warnakulasuriya and Ralhan, 2007).
All forms of alcohol, including hard liquor, beer and wine, have been implicated in the
development of OSCC. In fact, up to 50% of OSCC patients have a clinically significant history
of alcohol abuse (> 21 drinks per week; 1 drink is equal to 12 oz. beer at 4% alcohol, 1.5 oz. of
hard liquor at 40% alcohol or 5 oz. of wine at 11% alcohol) (Elwood et al., 1984). Although
ethanol is non-carcinogenic in animal models, its primary metabolite, acetaldehyde, can cause
DNA damage and heighten cancer risk (Boffetta and Hashibe, 2006). Since the oral cavity is in
direct contact with alcohol, it is at high risk for damage. The risk of oral cancer rises with an
increased amount of alcohol consumption per day, but not necessarily with the duration of use
when consumed in a moderate amount (Blot et al., 1988; Franceschi et al., 2000). Frequent
tobacco abuse (> 40 cigarettes per day) and heavy consumption of alcohol (> 4 drinks per day)
puts individuals at a risk of oral carcinogenesis, reported to be 35 times as high compared to
non-exposed individuals (Blot et al., 1988). The synergistic effect of alcohol and tobacco on risk
of oral cancer has been attributed to their ability to increase the permeability of the mucosal
lining to carcinogenic agents (Kademani, 2007).
The role of viruses in OSCC tumourigenesis has also been of interest recently, particularly the
role of human papilloma virus (HPV) subtypes 16, 18 and 31 (Gillison and Shah, 2001; Mork et
al., 2001). Analysis of samples from 47 studies world-wide showed that HPV DNA was present
in 38.1% of OSCCs, but the frequencies of HPV prevalence in different studies of OSCC varied
from 0 to 100% (Termine et al., 2008). These differences are likely due to the fact that a number
of these studies did not report the sub-sites of the OSCCs and some did not differentiate between
oropharyngeal carcinoma (OPC) and OSCC. Since OPC is associated with HPV (Gillison and
4
Shah, 2001), this may have led to an over-estimate of HPV prevalence in some studies (Termine
et al., 2008). Our laboratory has recently investigated HPV status in OSCC and has found that
4% (2/51) of cases are positive for HPV (Machado et al., unpublished data). This suggests that
HPV infection may not be a risk factor in the development of OSCC.
1.3 Presentation, Staging and Prognosis
Oral Cancer is generally painless and asymptomatic in its early stages, and, therefore, is usually
detected at later stages when symptoms develop. Indeed, symptoms are more common in
patients with advanced-stage disease (Kademani, 2007), and may include non-specific pain,
loose teeth, bleeding, ear pain, difficulty speaking and swallowing, sensory and motor nerve
alterations and a lesion or ulcers at the primary site. In particular, paresthesia and anesthesia in
the absence of trauma are suggestive of an invasive tumour (Kademani, 2007).
Tumours are currently staged by the TNM classification system (International Union Against
Cancer, 2002), which is described in detail in Table I. Briefly, this method stages tumours based
on their size (T1 – T4), the number of lymph nodes which are positive for cancer (N0 – N3) and
the presence of distant metastasis (M0 – M1). Typically, T1 and T2 lesions are associated with a
10% and 30% risk of metastasis, respectively, while T3 and T4 lesions have an even higher risk
(Woolgar et al., 1999). In some cases, however, small or undetectable primary tumours may
lead to metastasis and death and some large tumours may be slow to metastasize, suggesting that
these tumours are biologically distinct. The presence of cervical lymph node metastasis is one of
the most important predictors of prognosis and reduces the 5-year survival of patients by 50%
(Kademani, 2007; Shah, 1990a; Woolgar and Scott, 1995). OSCC patients with evidence of
distant metastasis have a mean survival of approximately 4 months and 87% of these patients
5
die of disease within a year after diagnosis (Calhoun et al., 1994). Therefore the general trend is
that prognosis becomes worse with more advanced oral cancer.
6
7
Histological assessment of the OSCC is important in order to provide information about the
tumour, which may aid in determining post-operative treatment protocols and/or patient
prognosis. Pathological examination determines tumour thickness, degree of differentiation,
invasiveness, and the presence of lymphatic and perineural invasion (Burket et al., 2003a).
Greater tumour thickness has been associated with an increased risk of local tumour recurrence,
nodal metastasis and decreased survival (Po Wing Yuen et al., 2002).
The World Health Organization (WHO) grading system (Pindborg et al., 1997) characterizes
tumours as Grade 1 (well differentiated), Grade 2 (moderately differentiated) and Grade 3
(poorly differentiated). Well differentiated tumours retain some anatomic features of the
epithelial cells and still may be able to produce keratin, whereas poorly differentiated tumours
have lost any type of epithelial structure or function (Burket et al., 2003b). Patients with poorly
differentiated tumours have a higher rate of cervical lymph node metastasis (48.5%), and thus a
higher rate of tumour recurrence, as compared to patients with well-differentiated tumours
(8.5%) (Kademani et al., 2005).
The presence of angiolymphatic invasion (tumour cells present within blood vessels or an
infiltration of blood vessels into the tumour) and perineural invasion (invasion of the nerves at
the tumour front) has been correlated with an increased risk of local recurrence and poor
survival (Woolgar, 2006).
Histological assessment of resection margins, which include the surface mucosa at the edges of
the tumour and the sub-mucosal and deeper connective tissue surrounding the malignancy, are
used to determine successful excision of the tumour during surgery. Resection margins are
classified as either involved (tumour cells present within 2 mm of the primary tumour), close
8
(tumour cells present within 3-4 mm of the primary tumour) or clear (no tumour present at 5
mm or greater distance from the primary tumour) (Batsakis, 1999). Patients with margins that
are either involved or close have an increased risk of tumour recurrence (Woolgar, 2006).
1.4 Recurrence
Tumour recurrence can be local, regional or distant. Local recurrence, defined as a tumour
recurrence within 2 cm of the primary lesion (Braakhuis et al., 2002), occurs in 18 – 30% of
patients and is the most common cause of death for patients with oral cancer (Kademani and
Dierks, 2006; Woolgar et al., 1999). Regional recurrence, defined as tumour recurrence in the
cervical lymph nodes, accounts for 7 – 15% of death (Kademani and Dierks, 2006; Woolgar et
al., 1999; Woolgar et al., 1995) and death from distant disease is relatively uncommon and
occurs in 1 – 5% of oral cancer patients (Kowalski et al., 2005; Leon et al., 2000).
The presence of tumour or dysplasia in surgical resection margins is known to be associated
with an increased risk of local recurrence (Woolgar, 2006). However, local recurrence still
occurs in 10 – 30% of OSCC patients, even with histologically normal margins (Leemans et al.,
1994; van Houten et al., 2002). This is thought to be due to minimal residual disease (the
presence of tumour cells undetected by histology) (Hermanek et al., 1999), or to the field
cancerization effect. The concept of field cancerization in OSCC was first described in 1953
(Slaughter et al., 1953), and suggests that a field of genetic alterations present in the surrounding
tissue may lead to a second malignancy. Identification of these alterations may help predict
whether an OSCC will recur.
9
1.5 Metastasis
Metastasis (Figure 1.1) of OSCC can be regional or distant. Regional metastasis involves
metastasis to the lymph nodes of the neck (cervical lymph nodes). It involves the cancer cells
breaking away from the primary OSCC, moving through the extracellular matrix, invading the
lymph vessels and then growing in the lymph nodes. Cervical lymph node metastasis of OSCCs
is found in as many as 30% of patients at the time of diagnosis (Shah et al., 1990). Patients with
tongue carcinoma have an even higher frequency (66%) of lymph node metastasis due to the
tongue’s rich blood supply and lymphatic drainage (Shah et al., 1990). OSCCs frequently
metastasize to the cervical lymph nodes (Figure 1.2) on the same side as the tumour (ipsilateral
nodes). Tumours from the floor of mouth, however, may involve the submental nodes. Opposite
side (contralateral) or bilateral cervical metastases are more frequent in advanced-stage tongue
carcinomas (Shah et al., 1990). Extra-capsular spread (ECS) occurs when the tumour has
perforated the capsule of the lymph node and has invaded into the surrounding connective tissue
(Sano and Myers, 2007). This process may lead to distant metastasis, which occurs when the
tumour cells are able invade through the blood vessel walls into surrounding tissue and
multiplying at a distant site (Steeg, 2003). The most common site for OSCC metastasis are the
lungs (50%), but distant disease can also be found in the thyroid gland, diaphragm and liver
(Takei et al., 1989).
The most important prognostic factor in OSCC is the presence of metastasis in cervical lymph
nodes at the time of diagnosis (Burket et al., 2003b; Kademani, 2007; Shah, 1990a). The
presence of a positive node in the neck reduces the 5-year survival rate to 50% (Shah, 1990a),
and the presence of a metastatic node on both sides of the neck reduces the survival rate to 25%
(Som, 1992).
10
11
12
There is considerable evidence in the literature that patients with ECS of the tumour in cervical
lymph nodes have a poor prognosis (Alvi and Johnson, 1996; Jose et al., 2003; Moor et al.,
2004). However, there are still cases of OSCCs that recur with no evidence of metastasis at
presentation (Keski-Santti et al., 2006). There has been a growing emphasis on identifying
molecular biomarkers in OSCCs, which can be used, together with histology, to improve
histopathological assessment and patient prognosis. In particular, those genes that are
associated with cervical lymph node metastasis may have prognostic implications.
1.6 Treatment
Treatment of OSCC varies and depends on the size and location of the primary tumour, lymph
node status, tumour grade (degree of differentiation), the presence or absence of distant
metastasis and the ability to achieve adequate surgical margins. The gold standard for treatment
in North America is surgery and/or radiation therapy (Burket et al., 2003b). T1 and T2 stage
tumours are generally treated with surgery or radiation, while surgery with post-operative
radiation therapy is used to treat more advanced-stage disease. Recent evidence suggested that
adjuvant chemotherapy may increase the survival of patients with advanced-stage tumours
(Scarpace et al., 2009).
Surgery for OSCC involves resection of the primary tumour and surrounding tissue (margins)
(Argiris et al., 2008). Additionally, patients with clinically staged N0 tumours are subjected to
neck dissection for nodal staging if the risk of lymph node metastasis is greater than 15%. This
occurs if the tumour has a depth of invasion into the stroma greater than 4-mm or the tumour is
classified as T2 or higher (Scully and Bagan, 2007; Shah, 1990b; Woolgar et al., 1999; Woolgar
and Scott, 1995). Typically, those patients with neck dissection specimens that are histologically
negative require no further therapy. Patients with one or more positive nodes diagnosed by
13
histology, after neck dissection, are treated with post-operative radiotherapy at the primary
tumour site and the positive cervical lymph nodes (Chang, 2006).
Neck dissection has also been shown to prevent regional recurrence. In one study of patients
with node negative, T1/T2 stage tumours, only 20% (9/46) of patients who underwent elective
neck dissection showed disease recurrence compared to 44% (15/34) of patients who did not
undergo this procedure (Keski-Santti et al., 2006). However, elective neck dissection is a radical
treatment, and may not always be necessary as this study also showed that 56% of patients who
did not undergo this procedure remained free of a second malignancy. Thus, it would be useful
to more accurately determine which patients would benefit the most from this type of therapy.
One potential approach is through the identification of molecular markers that are
predictive of nodal metastasis; such markers may be useful to help individualize treatment
and prevent unnecessary neck dissections.
In patients with advanced and/or unresectable OSCC, chemotherapy is used in combination with
radiotherapy, and has shown encouraging results (Scully and Bagan, 2007). An improved
response and survival rate of OSCC patients was shown after treatment with Cisplatin, 5-
fluoroacil (5-FU) and cetuximab, when given in combination with radiation therapy, compared
to radiation therapy alone (Scarpace et al., 2009). A study that involved an aggressive treatment
of docetaxel (TXT), cisplatin (CDDP) and 5-FU reduced the incidence of local recurrence
(Rapidis et al., 2006). Combining oxiplatin and folinic acid (FA) and 5-FU to treat patients with
recurrent, unresectable OSCC resulted in 21.1% of patients with complete response and 39.4%
of patients with a partial response to treatment (Raguse et al., 2006). Additional studies in head
and neck cancer also showed improved response and survival from the use of chemotherapy in
14
unresectable disease (Chufal et al., 2006; Yoshitomi et al., 2006). However, some of the side
effects of chemotherapy are hematologic toxicity, acute kidney disease, diarrhea, nausea and
vomiting (Scarpace et al., 2009).
Molecular targeted therapy is currently under investigation for patients with OSCC. For
example, the epidermal growth factor receptor (EGFR) inhibitor, gefitinib (Iressa) has been
tested as a therapeutic against oral cancer cell lines (Shintani et al., 2003) and oral cancer
xenographs in mice (Shintani et al., 2004). EGFR is linked to neoplastic transformation, cell
growth, invasion and metastasis and its mRNA and protein over-expression has been identified
as a common genetic change in OSCC (Table II). Gefitinib decreased the invasive phenotype of
OSCC cell lines and inhibited tumour growth and metastasis in an OSCC mouse model
(Shintani et al., 2004). A study of gefinitib treatment in OSCC patients found that gefinitib
increased OSCC patient survival (Kirby et al., 2006). These results indicate that molecular
targeted therapy may be beneficial for OSCC patients and warrants further investigation
into the identification of additional molecular alterations/genetic pathways involved in the
pathogenesis and progression of OSCC.
15
Chapter 2: Biology of Oral Squamous Cell Carcinoma
2.1 Tumour Progression
OSCC is the result of a multi-stage process that involves development of normal tissue to
dysplastic lesions to carcinoma in situ (CIS) and eventually to a squamous cell carcinoma
(Figure 2.1) (Argiris et al., 2008). Dysplastic lesions may be present before the development of
a carcinoma or they may not. These lesions are characterized as mild, moderate or severe based
on histological criteria. Mild dysplasia is characterized by dysplastic cells present in the basal
layer of the epithelium, while moderate dysplasia and severe dysplasia involve changes in
cellular morphology and increasing thickness of the epithelium. The risk of a dysplasia
progressing to OSCC is approximately 33% (Burket et al., 2003b). CIS is a lesion with
abnormal cells present in the entire epithelium without invading the basement membrane and
invasive carcinoma occurs when there is disruption of the basement membrane and invasion into
the underlying connective tissue (Burket et al., 2003b).
2.2 Molecular Alterations
It is believed that the process of malignant transformation leading to OSCC development is due
to an outgrowth of a common pre-malignant progenitor cell, followed by the expansion of clonal
populations of cells that accumulate genetic alterations (Neville and Day, 2002; Prince et al.,
2007; Tsantoulis et al., 2007). This is termed multi-step carcinogenesis and is enabled by the
increasing aberrant function of genes that positively or negatively regulate pathways involved in
proliferation, apoptosis, genome stability, angiogenesis, invasion and metastasis (Hanahan and
Weinberg, 2000).
16
17
Gene function can be deregulated in many ways: proto-oncogenes are activated to become
oncogenes as a result of point mutations, amplification, chromosomal re-arrangements or over-
expression (Croce, 2008) and tumour suppressor genes (TSGs) may be inactivated by deletions,
point mutations or promoter methylation (Tsantoulis et al., 2007).
Oncogenes increase malignant potential by promoting aberrant cell proliferation, through
deregulating the G1–S, G2–M and M checkpoints of the cell cycle, preventing apoptosis,
enabling cellular survival under unfavourable conditions and increasing invasive and metastatic
ability (Croce, 2008). Tumour suppressor genes prevent cells from acquiring malignant
characteristics. They usually regulate cell-cycle checkpoints and monitor DNA replication and
mitosis. Cellular stress and various insults can activate tumour suppressor pathways and prevent
proliferation of a damaged cell (Tsantoulis et al., 2007).
Identification of alterations in oncogenes and TSGs during OSCC progression has improved the
understanding of the molecular mechanisms of this disease. It has been postulated that
approximately 3 - 6 genetic events are required for the development of oral cancer (Wong et al.,
1996). Studies have identified that the earliest events in OSCC progression involve alterations of
genes involved in cell cycle regulation and cellular proliferation. In later steps during
progression, genes involved in angiogenesis, invasion and metastasis become deregulated
(Tsantoulis et al., 2007). A summary of some of the commonly deregulated genes in OSCC is
shown in Table II.
Expanding on this list of deregulated genes would improve our knowledge of OSCC progression
and possibly aid in patient treatment and/or prognosis. As previously discussed, the presence of
neck metastasis is predictive of recurrence. It is likely that the oncogenes or tumor suppressor
genes that are involved in metastasis are also deregulated in the primary tumour. It would
18
therefore be useful to identify which genes are deregulated in the primary OSCC and also
involved in invasion/metastasis. These genes may be useful to predict, at the time of
surgical resection, which OSCCs will have the ability to invade and metastasize.
19
20
2.3 Microarrays Identify Important Genetic Alterations in OSCC
There is a growing emphasis on improving histopathological assessment by identifying
molecular biomarkers deregulated in OSCCs, with the aim of improving diagnosis and
prognosis (Woolgar, 2006). Many groups have focused on the identification of novel molecular
markers using a high-throughput identification system, such as gene expression microarrays.
Gene expression microarrays are capable of measuring the mRNA expression of thousands of
genes within the same sample. Microarray analyses have been shown useful to determine genes
significantly associated with diagnosis, prognosis and therapy in human cancer.
Gene expression microarrays have been utilized to identify genes that are involved in
progression of OSCC, lymph node metastasis and patient prognosis. One study comparing
mRNA expression profiles of OSCC cell lines derived from normal cells, pre-malignant and
malignant lesions at different stages identified several genes involved in OSCC progression
(Hasina et al., 2003). A previous study by this laboratory (Warner et al., 2004) used cDNA
microarrays and determined that genetic profiles were able to classify OSCC based on tumour
stage. Moreover, these data were used to define a genetic signature correlated with nodal
metastasis. Additional studies comparing metastatic versus non-metastatic OSCC have
identified genes related to the extracellular matrix, adhesion, motility and protease inhibition,
which are associated with a metastatic profile (Nagata et al., 2003; Schmalbach et al., 2004).
Recently, our laboratory used oligonucleotide array analysis to identify a global genetic
signature that distinguished invasive OSCC from histologically normal tissues. Among genes
identified, the Programmed Cell Death 4 (PDCD4) gene was found to be consistently under-
expressed in tumours. These data were confirmed in an independent cohort of OSCC patients
21
and showed that PDCD4 was under-expressed or absent, both at the mRNA and protein levels,
in tumours compared to normal oral mucosa samples.
22
Chapter 3: Programmed Cell Death 4
3.1 Structure and Sub-cellular Localization
Programmed Cell Death 4, neoplastic transformation inhibitor (PDCD4), was originally
identified as up-regulated in apoptotic cells (Shibahara et al., 1995). It was first isolated from a
human glioma library by screening for an antibody against a nuclear antigen in proliferating
cells (Matsuhashi et al., 1997). PDCD4 (also known as MA-1, TIS, H731 and DUG) is highly
conserved in vertebrates throughout evolution, homolog sequences have been found in
invertebrates, such as the fruit fly, Drosophila melanogaster, as well as in the sponge Suberites
domuncula, which suggests that this gene is of functional importance (Bohm et al., 2003). In
human, PDCD4 is located on chromosome 10q24 (Soejima et al., 1999) and encodes two
mRNA transcripts, known as PDCD4 Variant 1 (H731) and PDCD4 Variant 2 (H731L). The
PDCD4 Variant 1 lacks 11 amino acids present within the N-terminus of PDCD4 Variant 2
(Yang et al., 2003a; Yang et al., 2003b), but no functional difference has yet been identified.
The PDCD4 protein (Figure 3.1) contains two copies of a highly conserved domain, MA-3,
which are located at the center (mMA-3) and the C-terminal region (cMA-3) of the protein
(LaRonde-LeBlanc et al., 2007; Shibahara et al., 1995; Suzuki et al., 2008; Waters et al., 2007).
The MA-3 domains are particularly important for protein-protein interactions. Recently, the
crystal structure of one of the MA-3 domains was resolved (LaRonde-LeBlanc et al., 2007;
Waters et al., 2007). The N-terminus of PDCD4 contains a region important for RNA binding
and two nuclear export signal (NES) regions; NES2 is particularly important for its nuclear
export (Bohm et al., 2003). PDCD4 was shown to bind RNA, suggesting that PDCD4 may be
involved in some part of nuclear RNA metabolism (Bohm et al., 2003).
23
24
Immunohistochemistry analysis of human tissue revealed PDCD4 expression is abundant and
nuclear in normal cells and reduced or absent in tumour cells from various tissue types (Goke et
al., 2004a). In normal colonic mucosa, PDCD4 shows nuclear staining in the apical and middle
portions or the crypts in the epithelia but not in the deeper portion, which showed no nuclear or
cytoplasmic staining. In normal tissues of prostate, breast, and lung, all epithelial layers showed
intense PDCD4 staining, exclusively nuclear. In addition to epithelial cells, intense PDCD4
staining was also found in the nuclei of endothelia, stromal fibrocytes, and lymphocytes. In
contrast, tissue from advanced stage lung, breast, colon and prostate carcinoma showed low or
absent PDCD4 expression. In vitro studies confirmed that PDCD4 localizes to the nucleus under
normal growing conditions, but serum withdrawal from the growth medium results in the export
of PDCD4 from the nucleus (Bohm et al., 2003). PDCD4 thus localizes to the nucleus of human
cells under normal growth conditions and may be delocalized to the cytoplasm under stress.
3.2 Inhibition of Neoplastic Transformation
PDCD4 was first identified as a transformation suppressor gene in a mouse keratinocyte (JB6
cells) model of tumour promotion, in which high levels of PDCD4 rendered cells resistant to
transformation by the tumour-promoter 12-O-tetradecanoyl-phorbol-13-acetate (TPA) (Cmarik
et al., 1999). PDCD4 suppresses skin tumour carcinogenesis in both cell culture (Cmarik et al.,
1999) (Yang et al., 2001) (Yang et al., 2003b) and animal models (Jansen et al., 2005). Further
studies showed that PDCD4 functioned as a transformation suppressor in JB6 cells by
preventing activation of activator protein 1 (AP-1) components, c-Jun and c-Fos (Yang et al.,
2003b) and inhibiting transcription of AP-1 target genes (Yang et al., 2001). Transgenic mice
that over-express PDCD4 in the epidermis (K14-PDCD4) showed significantly less papilloma
formation, carcinoma incidence and papilloma-to-carcinoma conversion when treated with TPA
(Jansen et al., 2005). Furthermore, K14-PDCD4 mice had decreased cap-dependent translation
25
and AP-1 dependent transcription. These in vivo results confirmed in vitro observations and
showed that PDCD4 plays a role in preventing neoplastic transformation. Additional in vivo
studies showed that targeted disruption of the PDCD4 gene promoted lymphomagenesis in mice
(Hilliard et al., 2006).
Loss of PDCD4 expression has been strongly implicated in the development and progression of
several kinds of human cancer. PDCD4 levels are reduced in cell lines derived from different
types of human tumours (Chen et al., 2003; Jansen et al., 2004; Zhang et al., 2006a).
Furthermore, PDCD4 expression has been found to be decreased in primary human tumour
samples from lung cancer (Chen et al., 2003), hepatocarcinoma (Zhang et al., 2006a), breast
carcinoma (Afonja et al., 2004), colon cancer (Mudduluru et al., 2007; Wang et al., 2008),
glioma (Gao et al., 2007), pancreatic cancer (Lu et al., 2008; Ma et al., 2005) and esophageal
cancer (Hiyoshi et al., 2009). Recent studies have attempted to elucidate the role of PDCD4 in
human cancer.
3.3 Inhibition of Translation
PDCD4 has been found to function as an inhibitor of translation. PDCD4 was first found to be
involved in regulating translation when it was found to interact with translation initiation factors
(eIFs) eIF4A and eIF4G1 (Goke et al., 2002; Kang et al., 2002; Yang et al., 2003a). eIF4A,
eIF4G and eIF4E are sub-units of a multiple-subunit complex, eIF4F, which is required for cap-
dependent translation. eIF4G serves as a scaffold that contains several binding sites for the cap-
binding protein, eIF4E (Mader et al., 1995), and for eIF4A (Imataka and Sonenberg, 1997).
eIF4A is a member of the DEAD-box RNA helicase family; this protein catalyzes the
unwinding of mRNA secondary structure at the 5’untranslated region to facilitate 40S ribosomal
scanning in a 5’ to 3’ direction from the initiation start codon (Hershey et al., 2000). PDCD4 has
26
been shown to directly interact with eIF4A via its MA3-c domain (LaRonde-LeBlanc et al.,
2007; Waters et al., 2007). This interaction inhibits the helicase activity of eIF4A and interrupts
the assembly of the eIF4F complex (Goke et al., 2002; Yang et al., 2003a; Yang et al., 2003b;
Zakowicz et al., 2005). In vivo translation assays further confirmed that PDCD4 inhibited cap-
dependent, but not internal ribosome entry site (IRES)-dependent translation. In fact, a mutant
inactivated for binding to eIF4A, was unable to inhibit cap-dependent or AP-1 transactivation
(Goke et al., 2002). Moreover, this mutant failed to suppress transformation of mouse
keratinocyte cell line (Yang et al., 2003a). Therefore, PDCD4 binding to eIF4A disrupts cap-
dependent translation to inhibit cell transformation.
Inhibition of translation and subsequent decreased expression of AP-1 target genes by PDCD4 is
required to suppress transformation in mice, therefore suggesting that this pathway may function
in human cells as well. Both cap-dependent translation and activation of AP-1 target genes are
important processes required for a cancer cell to grow and proliferate, survive pro-apoptotic
signals and metastasize. Thus, PDCD4 loss may be one of the crucial steps involved in cancer
progression.
3.4 Regulation of Invasion
PDCD4 has been found to regulate invasion and metastasis in human cancers. Several studies in
breast and colon cancer have attempted to elucidate the mechanism by which PDCD4 regulates
invasion. These studies have focused on correlating clinical patient data to PDCD4 expression
status and determining the effects of PDCD4 expression in vitro, using cancer cell lines.
PDCD4 was shown to regulate invasion in breast tumours. Immunohistochemical staining
revealed that PDCD4 is only slightly decreased in ductal carcinoma in situ, but is markedly
decreased in invasive ductal carcinoma, suggesting that its loss may be required for invasion
27
(Wen et al., 2007). It was also demonstrated that cytokines, PGE2 and IL-8, decreased the
expression of PDCD4 in breast cancer cell lines and increased their invasive ability (Nieves-
Alicea et al., 2009). Moreover, over-expression of PDCD4 was found to suppress invasion by
up-regulating the tissue inhibitor of matrix-metalloprotease 2 (TIMP-2) (Nieves-Alicea et al.,
2009).
Increased expression of PDCD4 has been shown to decrease the invasive potential of colon
cancer cells (Leupold et al., 2007; Yang et al., 2006), and down-regulation of PDCD4 has been
shown to enhance invasion of colon cancer cells (Wang et al., 2008). Decreased invasion of
colon cancer cell lines by PDCD4 is believed to be due to its down-regulation of AP-1. AP-1 is
a transcription factor composed of Jun-Jun homodimers or Jun-Fos heterodimers. The Fos
protein family includes c-Fos, Fra-1, Fra-2 and FosB. The Jun family members consist of
protein c-Jun, JunB and JunD. AP-1 has been found to regulate certain events that are required
for cell invasion, including MMP expression (Benbow and Brinckerhoff, 1997; Crawford and
Matrisian, 1996; Curran and Murray, 2000) and cell motility (Pilcher et al., 1997; Shin et al.,
2001). Over-expression or activation of AP-1 component proteins increased invasion (Dong et
al., 1997; Hennigan et al., 1994; Marconcini et al., 1999), and inhibition of AP-1 activity
suppressesed invasion in keratinocytes (Dong et al., 1997), fibroblasts (Lamb et al., 1997), and
squamous carcinomas (Yuspa, 1998) and inhibited progression of papillomas to carcinomas
(Cooper et al., 2003). AP-1 activity is induced through activation of the mitogen activated
kinase (MAPK) cascade, which includes three signal transduction pathways; jun N-terminal
kinase (JNK), ERK and p38 signalling (Robinson et al., 1998).
PDCD4 has been shown to interfere upstream of AP-1 to inhibit its activation, and subsequently
decrease neoplastic transformation or invasion. There are several mechanisms that appear to be
responsible for the inhibition of c-Jun activation by PDCD4. Conditional expression of PDCD4
28
in colon cancer cell lines showed PDCD4 interacted with c-Jun and prevented its
phosphorylation by JNK and prevented its recruitment of p300, a histone acetyl transferase
required for transcription of AP-1 target genes by c-Jun (Bitomsky et al., 2004). Additionally,
PDCD4 was found to decrease the transcription of the gene encoding the protein kinase,
MEKK1, resulting in inhibition of the JNK-signalling pathway, but not p38 or ERK (Yang et
al., 2006). These mechanisms lead to inhibition of c-Jun activity and down-regulation of AP-1
responsive promoters and a less invasive phenotype in colon cancer cell lines (Yang et al.,
2006).
Loss of PDCD4 expression in breast and colon carcinomas has been shown to be an important
step leading to increased invasion. However, PDCD4 was first identified because it was induced
upon apoptosis. While the reports cited above do not find that PDCD4 affects the cell-cycle or
apoptosis, some studies have found that PDCD4 plays a role in these pathways.
3.5 Role in Cell-cycle and Apoptosis
A variety of studies showed that up-regulation of PDCD4 inhibits cell growth through a range of
mechanisms. In carcinoid cell lines, HEK293 and Bon-1, PDCD4 suppressed carbonic
anhydrase type II protein expression and inhibited cell growth (Goke et al., 2004b; Lankat-
Buttgereit et al., 2004). In colon cancer cells, NS-398, a selective cyclo-oxygenase-2 inhibitor,
increased mRNA levels of PDCD4 and inhibited cell growth (Zhang and DuBois, 2001). In
prostate cancer cells, PDCD4 was shown to interact directly with the DNA binding domain of
the transcription factor Twist1 and reduced cell growth via down-regulation of the Twist1 target
gene Y-box binding protein-1 (YB-1) (Shiota et al., 2009). Growth suppression by PDCD4
expression was completely recovered by either Twist1 or YB-1 expression. Also, an inverse
29
correlation between nuclear PDCD4 and YB-1 expression levels was observed in 37 clinical
prostate cancer specimens.
PDCD4 has also been reported to be involved in apoptosis of cancer cell lines when stimulated
with cytotoxic agents. In the human hepatocellular cell line (Huh7), PDCD4 up-regulation
enhanced TGF-β1 induced apoptosis (Zhang et al., 2006a). Another study in renal cell
carcinoma (RCC) cells demonstrated that fluvastatin, a new generation of statins
(pharmacologic inhibitors of the 3-hydroxy-3-methylglutaryl-coenzyme A reductase), induced
apoptosis mediated by down-regulation of the Akt/mammalian target of rapamycin pathway
(mTor) pathway and up-regulation of PDCD4 (Woodard et al., 2008). Moreover, PDCD4 over-
expressing cells were more sensitive to chemotherapeutics, cisplatin and paclitaxel but not to
etoposide or 5-fluorouracil (Shiota et al., 2009).
In summary, PDCD4 seems to play an important role in cell cycle arrest, which perhaps
explains why it sensitizes cells to cytotoxic agents. However, the mechanism by which PDCD4
induces cell cycle arrest appears to be dependent on cell type. Thus, it is important to determine
whether PDCD4 is more important to promote cell cycle arrest/apoptosis or to inhibit invasion
in OSCC.
3.6 Regulation of PDCD4
Mechanisms that are frequently involved in the down-regulation of TSGs commonly involve
mutational inactivation and deletion (Tsantoulis et al., 2007), but studies indicate that these
mechanisms do not apply to PDCD4. Several mechanisms of down-regulation of PDCD4 have
been reported such as hypermethylation of its promoter region, increased proteasomal
degradation and silencing by the micro-RNA, miR-21.
30
PDCD4 down-regulation in human glioma has been attributed to methylation of its 5’ promoter
region (Gao et al., 2008). Loss of PDCD4 mRNA in glioma tissue was significantly associated
with methylation of the 5’ CpG islands in the PDCD4 promoter and was correlated with worse
patient prognosis. Additionally, treatment of glioma cells with the DNA methyltransferase
inhibitor, 5’aza-2’-deozycytidine, restored PDCD4 gene expression, in vitro.
Mitogen-activated signalling via the phosphoinositide-3 kinase (PI3K)-Akt-mTOR pathway, has
been shown to down-regulate PDCD4 (Dorrello et al., 2006). In response to various survival
and growth factors, PI3K activation leads to phosphorylation of Thr308 and Ser473 of Akt via
PDK-1 (Bellacosa et al., 1998; Chan et al., 1999). Akt plays a crucial role in the induction of
antiapoptotic, pro-survival signals and has multiple targets, including PDCD4 (Palamarchuk et
al., 2005) and mTOR, which is upstream of the kinase, p70/S6K1 (Bhaskar and Hay, 2007; Hay,
2005; Li et al., 2004). Additional studies have shown that PDCD4 is phosphorylated at Ser67
and Ser457 by Akt, which prevented its inhibition of AP-1 responsive promoters (Palamarchuk et
al., 2005). Additionally, PDCD4 phosphorylation of Ser457 by Akt caused nuclear translocation
of PDCD4. Another study established that PDCD4 is also a substrate for p70/S6K1 and that
p70/S6K1 phosphorylation of Ser67 leads to binding of the E3-ubiquitin ligase β-TrCP and
subsequent ubiquitylation and proteasomal degradation (Dorrello et al., 2006). MEK-ERK
signalling has been shown to facilitate the proteasomal degradation of PDCD4 (Schmid et al.,
2008). Considering that PI3K is frequently deregulated in cancer, including OSCC (Table II;
Kozaki et al., 2006), this pathway may be responsible for PDCD4 under-expression.
PDCD4 has also been reported to be a functional target of miR-21 in various aspects of tumour
progression. In breast cancer, miR-21 down-regulated PDCD4 and increased cell proliferation,
invasion, metastasis, and neoplastic transformation (Lu et al., 2008; Zhu et al., 2007; Zhu et al.,
2008). In colon cancer, miR-21 decreased PDCD4 levels and increased invasion and metastasis
31
of colon cancer cell lines (Asangani et al., 2008). In esophageal cancer, down-regulation of
miR-21 led to an increase in PDCD4 protein levels and a decrease in cellular proliferation and
invasion of esophageal cell lines (Hiyoshi et al., 2009). In cholangiocarcinomas, miR-21 is
over-expressed and inhibits PDCD4 (Selaru et al., 2009). Thus, over-expression of miR-21 is
associated with PDCD4 regulation in many tumour types.
32
Chapter 4: MicroRNA-21
4.1 Micro-RNAs and their involvement in Cancer
Micro-RNAs (miRs) are naturally occurring, non-coding RNAs that control gene expression by
either targeting mRNAs for degradation or repressing their translation (Berezikov et al., 2005;
Pillai, 2005; Zamore and Haley, 2005). Primary miRs are transcribed by RNA polymerase II
from non-coding regions of the genome (Kim, 2005). These transcripts are then cleaved by
Drosha into pre-miRs of 70 nucleotides, which are then processed to 17- to 24-nucleotide
miRs by Dicer (Bartel, 2004). These mature miRs are transferred to Argonaute proteins in the
RNA-induced silencing complex (RISC).
Currently, it is known that miRs inhibit expression of their target genes by two main
mechanisms: degradation of its target mRNA and/or translational repression of mRNA without
degradation. The former involves the miR guiding the RISC complex to its target mRNA,
where it binds with perfect complementarity to a site within the 3’ untranslated region of the
mRNA (Tomari and Zamore, 2005). The Argonaute protein, within the RISC complex, then
cleaves the mRNA and subsequently, exonucleases complete its degradation (Orban and
Izaurralde, 2005). However, in mammalian systems miRs usually bind their target with
imperfect complementarity. Although the mechanism is not perfectly worked out, it is believed
that imperfect binding of a miR to its target mRNA results in the sequestration of the mRNA
into cytoplasmic processing bodies (P-bodies) (Liu et al., 2005). Thus, the P-bodies act as
storage sites for mRNAs inhibited by miRs. When miR expression decreases, its target mRNAs
are released back into the cytoplasm and can be translated. However, if a miR remains over-
expressed, its target mRNA will likely be degraded (Bhattacharyya et al., 2006).
33
The human genome contains over 700 miRs (Griffiths-Jones et al., 2006; Saini et al., 2007) and
miRs are expressed in a tissue-specific manner (Volinia et al., 2006). Recently, the cell- and
tissue-specific expression map of several hundred miRs, in multiple mammalian cell systems,
has been compiled (Landgraf et al., 2007). It has been established that each miR targets over 200
transcripts, directly or indirectly (Zhang et al., 2006b). miRs may also increase translation of
select mRNAs (Vasudevan et al., 2007).
MiRs play an important regulatory role in processes such as cell differentiation, proliferation,
and inhibition of apoptosis (Chen et al., 2004; Croce and Calin, 2005). Importantly, it has been
shown that some of these miRs can act as either tumour suppressor genes or oncogenes, known
as oncomirs (Esquela-Kerscher and Slack, 2006). miRs with a tumour suppressive function are
commonly under-expressed in cancer. For example, miRs let-7, miR-15, and miR-16 are
typically found down-regulated or deleted in lung cancer and leukemia (Calin et al., 2002;
Takamizawa et al., 2004). Oncomirs tend to be over-expressed in tumours.
miR-21 stands out as the microRNA most often over-expressed in diverse types of malignancy,
and miR-21 expression and cancer-related processes such as proliferation, apoptosis, invasion,
and metastasis have been correlated (Volinia et al., 2006). It has been suggested that miR-21 can
function as an oncogene in breast cancer (Iorio et al., 2005; Volinia et al., 2006), brain tumours
(Chan et al., 2005), lung cancer (Markou et al., 2008; Volinia et al., 2006), prostate cancer
(Volinia et al., 2006), ovarian cancer (Iorio et al., 2007), pancreatic cancer (Roldo et al., 2006;
Volinia et al., 2006), colon cancer (Slaby et al., 2007; Volinia et al., 2006), gastric cancer (Chan
et al., 2008; Volinia et al., 2006), cholangiocarcinoma (Meng et al., 2006), hepatocellular
cancer (Meng et al., 2007; Tran et al., 2007) head and neck cancer (Chang et al., 2008; Tran et
al., 2007) and esophageal cancer (Feber et al., 2008). Inhibition of miR-21 has been found to
34
suppress tumour cell growth in vitro and tumour growth in a xenograph mouse model (Si et al.,
2007).
Our laboratory has recently used high-throughput micro-RNA expression arrays to determine a
micro-RNA expression profile associated with progression of OSCC. miR-21 was among the
micro-RNAs consistently identified to be involved in early stages of tumour progression. Thus,
over-expression of miR-21 is likely an important event and identification of its protein
targets may be important for better understanding its role in OSCC tumourigenesis.
4.2 Predicted miR-21 Targets
Studies have identified several miR-21 target genes associated with cancer progression: the
phosphatase and tensin homologue (PTEN; Meng et al., 2006; Meng et al., 2007), tropomysin 1
(TPM1; Zhu et al., 2007), maspin (Zhu et al., 2008) and PDCD4 (Asangani et al., 2008; Frankel
et al., 2008; Hiyoshi et al., 2009; Zhu et al., 2008), among other predicted targets.
PTEN is involved in inhibiting the growth stimulatory effects of the PI3K pathway. A decrease
in PTEN activity results in constitutive activation of Akt, a downstream mediator of the PI3K
pathway, which leads to tumour progression and metastasis (Sansal and Sellers, 2004). Aberrant
expression of miR-21 was shown to down-regulate the tumour suppressor PTEN and result in
increased proliferation, invasion and migration in vitro in human hepatocellular cell lines (Meng
et al., 2007).
TPM1 stabilizes actin microfilaments and is thus an important regulator of cellular migration
(Boyd et al., 1995) and maspin is a serine protease inhibitor. Both TPM-1 and maspin are direct
targets of miR-21 (Zhu et al., 2008). Down-regulation of TPM1 by over-expression of miR-21
led to an increase in anchorage-independent cell growth (Lu et al., 2008). Moreover, over-
expression of TPM1 or maspin decreased cellular invasion of breast cancer cell lines (Zhu et al.,
35
2008). Thus, miR-21 is believed to promote invasion by targeting multiple genes that regulate
this process.
4.3 miR-21 Regulation of PDCD4 Expression and Function
Recently, many studies have focused on the regulation of PDCD4 by miR-21. In breast cancer,
miR-21 targets were identified by knocking down miR-21 in MCF-7 cells and using micro-array
analysis to identify its potential targets (Frankel et al., 2008). About 737 transcripts had altered
mRNA expression (either due to direct binding by miR-21 or by secondary effects) indicating
the important role of miR-21 in cellular function. Among the transcripts that showed altered
expression by miR-21, PDCD4 and p53-regulated genes were under-expressed. Subsequent
experiments in this study confirmed that miR-21 inhibition increased endogenous PDCD4
protein and decreased cellular proliferation. Moreover, the effect of miR-21 inhibition on
decreased proliferation was abrogated when mutations were introduced in the miR-21 binding
site in the PDCD4 3’ untranslated region (UTR). This study implicated a role for the miR-
21/PDCD4 pathway in regulating cellular proliferation in cells with a functional p53 protein.
Other studies in aggressive breast cancer cell lines have shown that miR-21 down-regulated
PDCD4 and increased invasion and metastasis (Zhu et al., 2008). In this study, miR-21 down-
regulated wild type PDCD4, but not PDCD4 with a mutated miR-21 binding site. miR-21 had
no affect on cell proliferation. However, transfection of these cell lines with anti-miR-21
reduced the ability of cells to migrate through a matrigel by approximately 60%. Additionally,
when anti-miR-21 transfected cell lines were injected into mice, lung metastasis was
significantly reduced. Also, primary breast cancer specimens showed an inverse correlation
between PDCD4 protein expression and miR-21 in 8 tissue samples.
36
An inverse correlation between miR-21 and PDCD4 was also observed in colon cancer cell lines
(Asangani et al., 2008). Using a luciferase reporter system, in which a luciferase gene replaced
the translated region of the PDCD4, miR-21 over-expression decreased luciferase activity in the
RKO colorectal cancer cell line. Moreover, a mutation of the miR-21 binding site in the PDCD4
3’UTR prevented this down-regulation by miR-21. This indicated that miR-21 regulates PDCD4
translation by binding to its 3’UTR. Also, this study found that knock down of miR-21
decreased invasion and metastasis (Asangani et al., 2008).
In esophageal cancer, PDCD4 has been found to be an important target of miR-21. miR-21 and
PDCD4 protein expression were inversely correlated in a study of 20 esophageal carcinomas
(Hiyoshi et al., 2009). Additionally, down-regulation of miR-21 led to an increase in PDCD4
protein levels and a decrease in cellular proliferation and invasion of esophageal cell lines
(Hiyoshi et al., 2009).
In glioblastoma cell lines, miR-21 inversely correlated with PDCD4 protein expression. Knock-
down and over-expression of miR-21 increased and decreased PDCD4 expression, respectively,
in the glioblastoma cell line, T98G. Moreover, over-expression of miR-21 inhibited PDCD4
induced apoptosis in this cell line (Chen et al., 2008).
In conclusion, it is evident that the miR-21/PDCD4 pathway is crucial for various aspects of
tumourigenesis, including cell proliferation, invasion and metastasis. However, the downstream
effects of this pathway seem to be cell type specific. Therefore, it is necessary to investigate
this pathway further in other cancers, such as OSCC, in order to gain further insight into
its cellular effects.
37
Chapter 5: Hypotheses and Objectives
(1) Hypothesis: PDCD4 under-expression is associated with clinicopathological characteristics
(nodal metastasis) of OSCC
Rationale: Preliminary findings by our lab showed that PDCD4 was frequently under-
expressed in OSCC (Dos Reis et al., in preparation). In this study, we attempted to verify
PDCD4 under-expression and determine whether PDCD4 loss was associated with any
clinical or pathological characteristics.
Objectives:
(i) Quantify PDCD4 mRNA and protein expression in primary human OSCC samples
and OSCC cell lines.
(ii) Use statistical analysis to determine whether PDCD4 expression is associated with
clinicopathological variables, such as smoking and/or alcohol abuse, tumour site,
stage, grade, status of the cervical lymph nodes, presence of angiolymphatic or
perineural invasion and tumour recurrence.
(2) Hypothesis: Restored PDCD4 expression decreases invasion of OSCC cell lines and down-
regulates proteins involves in invasion and metastasis
Rationale: PDCD4 over-expression has been found to decrease the invasive and metastatic
potential of breast, colon and esophageal cancer cell lines. Since lymph node metastasis is
common in OSCC and is correlated with poor prognosis, we aimed to determine whether
PDCD4 regulated the invasive potential of OSCC cell lines.
38
Objectives:
(i) Measure invasive potential of OSCC cell lines using the transwell invasion assay
following over-expression or knock-down of PDCD4.
(ii) Determine down-stream targets of PDCD4 that are also known invasion and
metastasis-related proteins.
(3) Hypothesis: PDCD4 under-expression in OSCC is due, in part, to regulation by miR-21
Rationale: In order to determine the cause of PDCD4 under-expression in OSCC, we sought
to determine a possible mechanism for its down-regulation. miR-21 has been reported to be
over-expressed in HNSCC and has been previously demonstrated to target PDCD4 and
reduce its expression in vitro in various other cell types.
Objectives:
(i) Quantify miR-21 expression in primary human OSCC samples and determine
whether it is inversely correlated with PDCD4 expression
(ii) Determine whether PDCD4 is a direct target of miR-21 in OSCC cell lines
(iii) Investigate other possible mechanisms of PDCD4 regulation in OSCC
39
Chapter 6: Materials and Methods
6.1 Sample Collection
Forty oral cavity samples from OSCC and adjacent normal mucosa were obtained at the time of
surgery from the Toronto General Hospital (Toronto, Canada). The research ethics board (REB)
of the University Health Network (UHN) approved this work, and informed consent was
obtained from all patients prior to sample collection. These tissues were snap-frozen in liquid
nitrogen and stored at -80°C until use. Corresponding hemotoxylin-eosin (H&E) stained
sections were examined by an experienced head and neck pathologist, Dr. Bayardo Perez-
Ordonez. Histopathological diagnosis confirmed the presence of tumour in at least 80% of cells
from each OSCC specimen and confirmed that adjacent normal tissue was free of tumour or
dysplasia.
6.2 Patient Information
Medical records were examined in order to obtain detailed clinical data for each patient,
including age, sex, history of tobacco and alcohol consumption, histopathological diagnosis and
disease stage (Tables III,IV). Tumours were staged according to the current TNM classification
system as recommended by the AJCC (American Joint Committee on Cancer) and the UICC
(International Union against Cancer. et al., 2002). This patient cohort is representative of a
typical oral cancer population within North America (SEER Cancer Statistics Review, 2009).
However, the mean and median age is slightly higher, 64 and 65.6, respectively, since this
patient cohort does not include younger patients (age < 40 years).
40
41
42
6.3 Cell Culture
The OSCC cell lines used in this study were provided by Dr. Reidar Grenman from the
University of Turku, Finland (Lansford et al., 1999). Clinical data of patients from whom
tumour cell lines were derived is described in Table IV. UT-SCC-15, 20A, 24A, 28, 74A, 87
and 90A oral cancer cell lines were maintained in Dulbecco’s Modified Eagle Media (DMEM)
containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine at 37 °C in a 5% CO2
humidified incubator. Human Oral Keratinocyte cell lines (HOK; Invitrogen) were derived from
normal oral mucosa and used as a control. HOK were maintained in Oral Keratinocyte Media
(OKM) supplemented with 1% keratinocyte growth factor/epithelial growth factor mixture.
6.4 RNA Extraction
Total RNA was obtained from patient samples (Table III, IV) and cell lines (Table V, VI).
Patient tissue was kept frozen in liquid nitrogen and homogenized using a mortar and pestle.
After grinding, tissue was re-suspended in 1 mL TRIzol reagent (Invitrogen). TRIzol contains a
buffer to lyse the cell membrane, phenol to dissolve protein and isoamyl alcohol to dissolve the
nucleic acids (Chomczynski and Sacchi, 1987). Next, the aqueous phase containing RNA was
separated from the organic phase by adding 200 uL of chloroform followed by centrifugation at
10,000 rpm for 15 minutes at 4°C. The aqueous phase was mixed with 500 uL of isopropanol
and incubated at -70°C for 30 minutes to precipitate the RNA. The isopropanol solution
containing the RNA was transferred to the appropriate columns provided by the RNeasy Kit
(Qiagen). The columns were then washed with solutions provided (to remove impurities from
the RNA), as per manufacturer’s instructions, and then RNA was dissolved in 30 uL nuclease-
free water (Sigma). For cell lines, media was removed, cells were collected in 1 mL TRIzol
43
reagent and total RNA was extracted as described above. Total RNA was quantified using
Nanodrop 1000 (Nanodrop).
44
45
46
6.5 Detection of mRNA levels by quantitative RT-PCR
Total RNA (120 ng; determined to be the lowest amount of RNA required) from 31 patient
tissues (Table III; some patients were excluded due to low RNA yield) and 7 cell lines was used
to make cDNA using the Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase
(Invitrogen) as per manufacturer’s protocol. Briefly, RNA was denatured at 65°C for 5 minutes
in the presence of 0.8 uM T20 primers and 0.8 mM dNTPs. Reverse transcription (RT) was
carried out at 37°C for 50 minutes using M-MLV (200 units) in the presence of 50 mM Tris-
HCl (pH 8.3 at room temperature), 75 mM KCl, 3 mM MgCl2, 0.01 M DTT and 50 units RNase
Inhibitor (Ambion). An RT- (no template control) was included.
Quantitative PCR was used to determine mRNA levels of PDCD4, MMP-2 and MMP-9 using
the Applied Biosystems Prism 7900 Sequence Detection System (Applied Biosystems, Foster
City, CA). GAPDH was used as the internal control, as it was determined by the laboratory to
have similar and reproducible Ct values in OSCC and adjacent normal samples (mean=14.53 ±
1.51; OSCC, mean=14.47± 1.38; normal, mean=14.99± 1.20). GAPDH is also frequently used
as a control in quantitative studies using DNA or RNA (Bustin, 2000; Reis et al., 2002).
Quantitative PCR was carried out using 1X SYBR Green 1 dye (a fluorescent dye that binds to
double-stranded DNA), 1 uM primers (Table VII) and 1 uL cDNA. Primers were designed using
mRNA sequences obtained from a public online database, https://www.genome.ucsc.edu (Kuhn
et al., 2009), using Primer 3 primer design software (Rozen and Skaletsky, 2000).
47
48
Gene expression in tumours was calculated as fold-change relative to adjacent normal tissue
using the ΔΔCt method (Livak and Schmittgen, 2001). Briefly, quantification of expression of
our genes of interest was accomplished by measuring the fractional cycle number at which the
amount of expression reached a fixed threshold (Ct), which was directly related to the amount of
product, and therefore the mRNA levels of our genes of interest. The relative quantification
given by the Ct values was determined for duplicate reactions for each sample. Duplicate Ct
values were averaged and the control gene Ct subtracted to achieve ΔCt [ΔCt = Ct (gene of
interest) - Ct (control gene)]. Then relative expression level was determined as 2-ΔΔCt, where ΔΔ
Ct = ΔCt (target sample) - ΔCt (reference sample). For the reference sample, ΔΔCt equals 0 and
20 equals 1, so the fold change in the reference sample equals 1 by definition. For the unknown
samples, evaluation of 2-ΔΔCt indicates the fold change in gene expression relative to the
reference sample. A fold change was considered significant if greater than 1.5 (over-expressed)
or less than 0.67 (under-expressed). This was based on a false-positive rate of 0.05(Crowley and
Ankerst, 2006). Values are expressed as log10 n-fold differences in target gene expression and
are representative of 2 independent experiments. To ensure primer specificity, dissociation
curves were run for all reactions.
6.6 Detection of miR-21 levels by Taqman PCR
Total RNA from the 32 patient tissues and all 7 cell lines (Table III,IV,V,VI; these samples
were also used for PDCD4 mRNA expression analysis) was used for detection of miR-21 levels.
PCR-based detection of mature miR-21 was performed using the TaqMan micro-RNA assays
(Applied Biosystems). RT reactions were carried out using 100 ng total RNA by Multi-Scribe
Reverse Transcriptase (50 units) in the presence of 1 mM dNTPs, 1X Reverse Transcription
Buffer (Ambion) and RNase inhibitor (0.25 units) and miR-specific primers against the target
sequences (miR-21, 5’UAGCUUAUCAGACUGAUGUUGA3’; RNU44 endogenous control,
49
5’CCUGGAUGAUGAUAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUA
ACUGACU3’). The RT products were subjected to real-time quantitative PCR. miR-21 levels
were normalized against then internal control, RNU44, and then expressed as log10 fold-change
using the ΔΔCt method, as described in Section 6.5. RNU44 has been described as expressed at
similar levels in oral tissues (Cervigne et al., under review) and other tissue types (Mestdagh et
al., 2009) and it was thus reliable as the internal control miR.
6.7 Immunohistochemistry
Tissue blocks from 35 patients were available for immunohistochemistry (IHC) analysis (Table
III). Of these 35, 26 had RNA available (Table III) and were used for gene expression analysis
(Described in Section 6.5 and 6.6). Subsequently, IHC was used to evaluate PDCD4 protein
expression in both the OSCC and its adjacent normal oral mucosa. PDCD4 expression was
evaluated semi-quantitatively for each sample (Table VIII), considering staining intensity (0 =
absent; 1 = weak; 2 = moderate; 3 = strong) and percentage of cells positively stained (0 = no
detectable immunostaining; 1 = immunostaining detected in 10% or less of cells; 2 = 11 – 30%;
3 = 31 – 60%; 4 = greater than 60%). The PDCD4 IHC score for each sample (tumour and
normal) was obtained by adding the intensity and percentage positive scores, as previously
published (Dos Reis et al., 2008). The PDCD4 IHC score in normal oral tissues ranged from 4 –
6, with a median score of 5.0 and a mean score of 5.2. Therefore, PDCD4 expression in the
OSCC was characterized as absent, very low, low, unchanged or high depending on its PDCD4
IHC score (absent = 0; very low = 2,3; low = 4; unchanged = 5,6; high = 7). Slides were scored
in a blinded fashion by a pathologist, Dr. Bayardo Perez-Ordonez and myself.
50
51
6.8 Detection of Protein by Western Blot
OSCC cells (Table V, VI) were pelleted, washed once in PBS and lysed in RIPA buffer [NaCl,
150 mmol/L; NP-40, 1%; deoxycholic acid, 0.5%; SDS, 0.1%, Tris (pH 8.0), 50 mmol/L; with
protease inhibitor cocktail tablet (Roche). Total protein was extracted from cells and protein
concentration was determined using the Bradford Assay (Bio-Rad) as per manufacturer’s
instructions. Western blotting was done according to standard procedures. Briefly, protein (25
ug) was resolved by SDS-PAGE (10% acrylamide gel) and electrotransferred onto a PVDF
membrane (Bio-Rad) at 30V for 16 hours then 70V for 1 ½ hours at 4°C. Immunodetection was
carried out using antibodies directed toward the protein targets of interest (c-Jun, MMP-2,
MMP-9, PDCD4, phospho-PDCD4; Table IX), followed by incubation with secondary antibody
(horseradish peroxidise (HRP)-conjugated; Table IX) for chemiluminescent detection. β-Actin
(HRP-conjugated; Table IX) was detected to correct for unequal protein loading. The protein
signals were detected with the ECL plus Detection System (GE Healthcare), and signal intensity
was determined by NIH-ImageJ (Girish and Vijayalakshmi, 2004). PDCD4 protein expression
was determined semi-quantitatively based on ratio of the signal intensity of PDCD4 to Β-Actin.
Phosphorylated PDCD4 protein expression was determined semi-quantitatively based on the
ratio of the signal intensity of phospho-PDCD4 to PDCD4. c-Jun protein expression was
determined based on the signal intensity of c-Jun to β-Actin. Relative expression of PDCD4 and
phospho-PDCD4 in OSCC cell lines was determined compared to the HOK cell line.
52
53
6.9 Detection of PDCD4 Protein by Confocal Microscopy
Cell lines (5x104 cells; Tables IV,V) were grown on glass coverslips (22mm x 22mm) in
DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine at 37 °C in a
5% CO2 humidified incubator for 24 hours. Subsequently, cells were washed in 1X warm PBS,
dried and fixed in 4% paraformadehyle (PFA)/PBS and incubated with anti-PDCD4 rabbit
antibody (1:200; Rockland), followed by anti-rabbit fluorescent conjugated secondary antibody
(1:500; DyLight 594; Jackson Immunoresearch). Cells were co-stained with DAPI (Invitrogen)
and mounted onto glass slides. Fluorescence was analyzed by confocal microscopy (LSM 510
Confocal; Advanced Optical Microscopy Facility).
6.10 Plasmids
Plasmids used in this study included a commercially available control plasmid, PCMV6-XL4
(PCMV6; Origene) and a PDCD4 expressing plasmid, PCMV6-XL4-PDCD4 (PDCD4;
Origene). The basic structures of both plasmids are presented in Figure 6.1 A,B. The PDCD4
plasmid consists of the 2,640 base pair PDCD4 cDNA sequence (RefSeq: NM014456) inserted
into the multi-cloning site of the PCMV6 plasmid. Both PCMV6 and PDCD4 plasmids were
expanded in E. coli in the presence of ampicillin (50 ng/mL). Briefly, 1 uL aliquot of either
plasmid was incubated with 25 uL of concentrated E. coli cells on ice for 30 minutes. E. coli
were heat shocked at 42°C for 2 minutes to allow for uptake of the plasmid and then incubated
at 37°C for 1 hour. Cells were further expanded at 37°C for 16 hours in the presence of
ampicillin (50 ng/mL). Thus, only cells expressing the plasmid (which contains the ampicillan
resistance gene) would grow. Surviving E. coli were pelleted at 5,500 rpm for 10 minutes and
plasmid DNA was then extracted using the Plasmid Midi-prep Kit (Qiagen). DNA was
quantified using using Nanodrop 1000 (Nanodrop).
54
55
6.11 Pre-miRs, Anti-miRs and si-RNA
Commercially available pre-miR-21, anti-miR-21 and control miR were purchased from
Ambion and re-suspended in nuclease-free water to a concentration of 50 μM. PDCD4 siRNA
and control siRNA was purchased from Santa Cruz Biotechnology (Santa Cruz, California) and
re-suspended in nuclease-free water to a concentration of 50 μM. The specific miR and siRNA
sequences were kept confidential by the company.
6.12 Transfection
Cell lines (Table V, VI; UT-SCC24A, 74A, 87 and 90A) were seeded in 6-well plates (2x105
cells/well) in DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine.
Subsequently, cells were transiently transfected with either empty vector, PCMV6-XL4
(PCMV6; Origene), PCMV6-XL4-PDCD4 (PDCD4; Origene), 50 pmol of control si-RNA or
PDCD4 si-RNA (Santa Cruz); 50 pmol of scramble-miR, pre-miR-21 or anti-miR-21 (Ambion)
using 3 uL Lipofectamine-2000 reagent (Invitrogen). After 72 hours, media was removed and
cells were washed with 2 mL PBS. Cells were then detached from the plate by adding 0.5 mL
trypsin and incubating at 37 °C in 5% CO2 for 5 minutes. 2 mL DMEM containing 10% FBS,
1% Penicillin-Streptomycin and 1% L-Glutamine was added to neutralize the trypsin. For each
transfection condition, the cell suspension was collected and separated into two parts, one for
RNA and the other for protein. The cell suspensions were pelleted by centrifugation at 1,400
rpm for 3 minutes and media was removed. For each transfection condition, one pellet was re-
suspended in 1.0 mL Trizol for RNA extraction (Section 6.4) and the other was washed in cold
PBS and then subjected to protein extraction (Section 6.8). Transfection was confirmed by
quantitative RT-PCR and Western blotting.
56
6.13 Transwell Invasion Assay
The invasive potential of cell lines (Table V, VI; UT-SCC-24A, 74A, 87 and 90A) transfected
with PDCD4, PDCD4 si-RNA or controls (mock, PCMV6 vector or si-scramble transfected)
was evaluated using the transwell invasion assay. Cells were transfected as described in Section
6.12. After 48 hours, media was removed and cells were washed with 2 mL PBS. Cells were
then detached from the plate by adding 0.5 mL trypsin and incubating at 37 °C in 5% CO2 for 5
minutes. 2 mL DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine
was added to neutralize the trypsin. An aliquot of 50 uL of cells per well was mixed with 50 uL
trypan blue and counted using a haemocytometer. The remaining cells were spun at 1,400 rpm
for 3 minutes, media was removed and then cells were re-suspended at a concentration of either
5.0x105 or 7.5x105 cells/mL in DMEM containing 2% FBS, 1% Penicillin-Streptomycin and 1%
L-Glutamine As per protocol, cells (either 5x104 or 7x104) were plated on a Matrigel (BD
Biosciences) coated membrane with 8-μM pores (VWR) for 24 hours. Using these same cell
lines, our laboratory previously demonstrated that 24 hours after plating the cells was an optimal
time to allow cells to invade through the chamber (Dos Reis et al., 2008). Cells were incubated
in 200 uL low-serum media (DMEM containing 1% FBS, 1% Penicillin-Streptomycin and 1%
L-Glutamine). Contained on the other side of the membrane was 600 ul high-serum media
(DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine) used as a
chemo attractant. Thus, cells would migrate toward the serum-supplemented media (Figure 6.3).
Cells that invaded the lower surface of the Matrigel-coated membrane were stained using the
Diff Quick Stain set (Dade Behring, Newark, Del) and fixed onto a glass slide. The number of
invading cells was quantified using NIH-ImageJ (Girish and Vijayalakshmi, 2004) and
normalized to controls. Data are representative of 3 experiments.
57
58
6.14 Flow Cytometry Analysis
Flow cytometry analysis was used to determine the percentage of cells in each phase of the cell
cycle. OSCC cell line, UT-SCC-87, was transfected with PDCD4 or control (untransfected,
mock or PCMV6 transfected) as described in Section 6.12. After 48 hours, media was collected
into 5 mL polystyrene round-bottom tubes to collect any floating/dead cells. The viable cells
were then detached from the plate by adding 0.5 mL trypsin and incubating at 37 °C in 5% CO2
for 5 minutes. 2 mL DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-
Glutamine was the added and cells were collected into the round-bottom tubes. Next, the cells
were pelleted by centrifugation at 1,400 rpm for 3 minutes and media was removed. Cells were
incubated on ice with 400 uL propidium iodide (PI) staining solution containing 5 uL PI/1 mL
hypotonic buffer (0.1% sodium citrate, 0.1% Triton X-100 in ddH2O). The isotonic buffer
permeabilizes the cells to the PI, which binds to the major groove of double-stranded DNA.
Thus, the amount of PI within the cell indicates what phase of the cell cycle each individual cell
is in. PI content was measured using the Becton Dickinson FACS calibur flow cytometer. Data
acquisition and analysis was performed using CellQuest software.
6.15 In Silico Analysis for miR Binding Sites
In order to determine the sequence of potential miR binding sites in the 3’UTR of PDCD4 an
online resource, microRNA.org (Betel et al., 2008; John et al., 2004), was consulted. Typing the
gene name, PDCD4, and the species, Homo sapiens, into the search engine located all
mammalian miRs that have the potential to bind to sites within the PDCD4 3’ UTR. Only those
miRs with an alignment score ≥ 140 are predicted to bind the mRNA of interest. This alignment
score is based on the number of matching base pairs between the miR and its predicted binding
site. Therefore, this software tool is valuable for predicting whether such an interaction occurs in
59
vivo. miR-21 was predicted to bind PDCD4 with an alignment score of 157. Previous reports
confirmed the potential miR-21 binding site (Frankel et al., 2008; Zhu et al., 2008).
6.16 PDCD4 Mutation Assay
The full length PDCD4 plasmid (Origene; Figure 6.1B) containing the miR-21 binding site
within the 3’UTR of PDCD4 was used as a template to make miR-21 binding site mutations
(Figure 6.2). The miR-21 binding site was mutated using the QuikChange Lightning Site-
Directed Mutagenesis Kit (Stratagene). Briefly, PCR (18 cycles; annealing temperature of 68°C)
was performed using PDCD4 as template (Figure 6.2A) and primers (Forward Primer: 5’-
GGAGGGACAGAAAAGTAACCTCTTAAGTGGAATATTCTAAGGAATTCCCTTTTGTA
AGTGCC-3’; Reverse Primer: 5’GGCACTTACAAAAGGCCCGGGCTTAGAATATTCCAC
TTAAGAAGAGGTTACTTTTCTGTGTCCCTCC-3’; mutation is in bold) designed to
introduce point mutations in the miR-21 binding site. PCR product (Figure 6.2B) was then
digested with the restriction enzyme, DpnI, to remove any template (unmutated) DNA. The
digestion product (Figure 6.2C) was transformed into competent DH5-alpha cells and plated
onto ampicillin (50 ng/mL) coated agar plates (Figure 6.2D). Colonies were expanded and
plasmid DNA was extracted using the Plasmid Mini-prep Kit (Qiagen). The mutated PDCD4
plasmid, PDCD4-UTRmut (Figure 6.1E), was sequenced (DNA Sequencing Facility, UHN) to
confirm the presence of the mutation (Figure 6.2E). PDCD4-UTRmut plasmid was expanded in
E. Coli (as described in Section 6.10) and plasmid DNA was then extracted using the Plasmid
Midi-prep Kit (Qiagen). 200 ng PDCD4 or PDCD4-UTRmut plasmid were co-transfected with
50 pmol pre-miR-21 or scramble-miR (control) using 3 uL Lipofectamine-2000 (Invitrogen)
into UT-SCC74A (described in Section 6.12) and RNA and protein was isolated after 72 hrs.
Transfection of PDCD4 and pre-miR-21 was confirmed by Western blot and TaqMan real time
PCR, respectively.
60
61
6.17 Statistical Analysis
Statistical analyses were performed using the SPSS Software Version 12.0 (Prentice Hall).
Correlation between PDCD4 mRNA and protein levels in patient samples was performed using
the Wilcoxon signed rank test (Wilcoxin, 1947). This method is a non-parametric version of the
paired T-test. Moreover, this method tests the null hypothesis that both samples have the same
distribution within a population (Downing and Clark, 1997). In this case, the samples we
compared were PDCD4 mRNA (Sample A) and PDCD4 protein levels (Sample B). The
absolute value of difference between the samples from A and B were pooled and ranked as
either positive or negative differences, giving T- and T+. Since the sample size was large (>8), T
has an approximately normal distribution with the parameters:
μT = N(N+1)/4 and σT2= N(N+1)(2N+1)/24
The standard normal random variable, (T-μT)/σT is used to either accept or reject the null
hypothesis. If this value is within the 95% confidence interval, then you accept the null
hypothesis. For example, when comparing PDCD4 mRNA and protein expression, T = 41, μT =
162.5 and σT = 37.5 and the standard normal variable is -3.3, Degrees of Freedom = N-1 = 24.
Our cut-off is P < 0.05 for significance. Thus we accept the null hypothesis with P = 0.002.
Correlation between PDCD4 mRNA and miR-21 levels, and PDCD4 protein and miR-21 levels
was also performed using the Wilcoxon signed rank test.
Statistical analysis of the relationship between PDCD4 mRNA or miR-21 levels in OSCCs to
clinicopathological data was performed using the Wilcoxon rank sign test as was previously
used by our lab to compare the relationship of CLDN-1 mRNA expression to clinicopathological
variables (Dos Reis et al., 2008). This method is a non-parametric test used to compare
62
numerical values between 2 groups, such as the distribution of PDCD4 mRNA level in smokers
versus non-smokers.
Statistical analysis of the relationship between PDCD4 IHC score in OSCCs to
clinicopathological data was performed using the chi-squared test as was previously used by our
lab to compare the relationship of CLDN-1 protein expression to clinicopathological data (Dos
Reis et al., 2008). This method is a non-parametric test used to compare ordinal values between
2 groups, such as the PDCD4 IHC scores in smokers versus non-smokers.
Statistical analysis of in vitro experiments was performed using One-way Anova. This method
of analysis is used to make a comparison between 2 or more samples (the independent variable)
on one dependent variable (Urdan, 2005). The question addressed by One-way Anova is
whether the average difference/variation between the values of the different samples is large or
small compared to the difference/variation between values within the same samples. First, the
average amount of variation, Mean Square Error (MSE), between each sample is calculated.
Next, the variation between groups, Mean Square Between (MSB), is calculated. The F stastic is
then calculated by dividing MSB/MSE. If F is statistically significant (P < 0.05) then there are
differences between the sample means. Fisher’s test was used to determine whether the mean
value between two groups was significantly different. Differences were considered significant
if P-values were less than 0.05.
63
Chapter 7: Results
7.1 PDCD4 Expression is Lost in OSCC
Using microarray analysis, previous findings by our lab showed that PDCD4 expression was
lost in tumours compared to their adjacent normal mucosa in a cohort of patients with OSCC.
Preliminary IHC studies of an independent set of OSCC specimens showed that PDCD4 protein
expression was lost in tumours (Dos Reis et al., in preparation). This current study aimed to
measure PDCD4 mRNA and protein in an expanded cohort of OSCC specimens in order to
verify these previous findings. Moreover, we aimed to determine whether PDCD4 loss was
associated with clinicopathological variables.
The fold change of PDCD4 mRNA levels in each OSCC compared to its adjacent normal was
determined for 31 of 40 patients. PDCD4 mRNA (median, 0.32; range, 0.05 – 5.28) was
decreased (fold change < 0.67) in 80.6% (25/31), unchanged in 12.9% (4/31) and over-
expressed (fold change > 1.5) in 6.4% (2/31) of OSCCs. PDCD4 mRNA log10 fold change for
each OSCC was plotted for better visualization (Figure 7.1). To determine whether loss of
PDCD4 mRNA was related to clinicopathological data, univariate analysis was performed to
compare PDCD4 mRNA levels with clinical variables. Loss of PDCD4 mRNA expression was
significantly lower in tumours of patients with nodal metastasis (0.22 versus 0.45; P=0.019;
Table X). Also, although not significant, median PDCD4 mRNA levels were lower in tumours
with angiolymphatic invasion (0.20 vs 0.34, P=0.245). PDCD4 mRNA loss was not associated
with any other clinical variables.
64
65
66
Immunohistochemical analysis of PDCD4 protein (Figure 7.2) showed that PDCD4 was
strongly expressed in the nuclei of normal oral squamous epithelia. However, PDCD4
expression was considerably decreased in a majority of OSCC samples. Also noteworthy is that
PDCD4 expression, although still positive, seemed to decrease slightly in dysplastic lesions and
carcinoma in situ (CIS). Using IHC, PDCD4 expression score (Table XI A,B) was absent in
5.7% (2/35), very low in 54.3% (19/35), low in 28.6% (10/35) and unchanged in 11.4% (4/35)
of cases. Thus, PDCD4 was under-expressed in 88.6% (31/35) of OSCCs. Loss of PDCD4
protein expression was significantly associated with more well differentiated tumour grade
(P=0.038, Table XII) and there was a trend towards lower PDCD4 protein expression in cases
with nodal metastasis versus no nodal metastasis (P=0.115; Table XII). PDCD4 mRNA and
protein levels were significantly correlated (P=0.002, Wilcoxon signed rank test).
In order to determine whether the UT-SCC cell lines were representative of our primary patient
OSCCs and to assess whether they could be used for functional studies involving PDCD4, we
quantified their PDCD4 mRNA expression and protein expression (Figure 7.3A,B). The fold-
change of PDCD4 mRNA expression in OSCC cell lines (Table IV,V; UT-SCC-15, 20A, 24A,
28, 74A, 87 and 90A) was determined compared to a normal oral keratinocyte cell line (HOK;
Invitrogen). PDCD4 mRNA levels were decreased in all but one OSCC cell line (UT-SCC-15).
PDCD4 protein expression was lower in all seven OSCC cell lines compared to the HOK cell
line (Figure 7.3B). Indeed, UT-SCC-74A expresses the lowest amount of mRNA and protein
(Relative Ratio to HOK (RR) = 0.23), while UT-SCC-20A, 24A, 87 express similar levels of
PDCD4 mRNA and protein (RR = 0.6, 0.49, 0.43, respectively) as each other. Moreover, UT-
SCC-90A (RR = 0.82) expresses the highest levels of PDCD4 protein, although it is still under-
expressed when compared to the HOK cell line (RR = 1.0).
67
68
69
70
71
7.2 PDCD4 Affects Invasion of OSCC Cell Lines
In other studies, down-regulated PDCD4 expression was implicated in breast, colon, lung and
esophageal cancer cell invasion and metastasis. Since lymph node metastasis is common in
OSCC patients and is associated with poor prognosis (Burket et al., 2003a), we decided to
investigate whether PDCD4 regulates invasion of OSCC cell lines using a transwell matrigel
invasion assay (Katerinaki et al., 2006).
To determine an optimal amount of PDCD4 or PCMV6 control plasmid to transfect, we tested
the toxicity of various amounts of plasmid in UT-SCC-24A (Figure 7.4A). We found that a
concentration of plasmid greater than 500 ng was toxic to the cells (less than 60% cell viability
after 72 hrs). Next, we determined the effect of 200 and 500 ng of plasmid on PDCD4 mRNA
and protein expression by quantitative RT-PCR and western blot, respectively. We found that
both 200 ng and 500 ng of PDCD4 plasmid led to an increase in PDCD4 mRNA (Figure 7.4B)
and protein (Figure 7.4C) compared to control.
We then tested whether UT-SCC-24A cells could invade through a matrigel following
transfection of 200 ng or 500 ng of PDCD4 (Figure 7.10A,B) compared to PCMV6. Our results
indicated that 200 ng PDCD4 plasmid effectively decreased invasion compared to control (22 ±
6% versus 80 ± 11%). However, both 500 ng PDCD4 and PCMV6 control plasmid also
decreased invasion (1 ± 0% and 24 ± 2%). Thus, we chose to use 200 ng PDCD4 and PCMV6
control plasmid for all subsequent experiments. Also, to obtain a higher level of invasion in our
control, subsequent experiments were performed using 7x104 cells per matrigel insert instead of
5x104 cells used in this experiment.
72
73
74
To confirm our preliminary findings suggesting that PDCD4 up-regulation decreases OSCC
invasion, we determined the effect of PDCD4 over-expression and knock-down in 4 OSCC cell
lines (UT-SCC-24A, 74A, 87 and 90A; as determined to be our only OSCC cell lines that were
reproducibly transfected with PDCD4 plasmid). Effective over-expression and suppression of
PDCD4 was confirmed by western blot (Figure 7.6). Representative examples of invading cells
are shown in Figure 7.7. Our results (Figure 7.8) indicated that over-expression of PDCD4 in
OSCC cell lines, UT-SCC-24A, UT-SCC-74A, UT-SCC-87 and UT-SCC-90A, significantly
decreased invasion as only 10.0% (p<0.01), 19% (p<0.05), 18% (p<0.05) and 16% (p<0.05)
of each cell line, respectively, migrated through the matrigel compared to mock transfected
control (Table XIII A). Moreover, knock-down of PDCD4 increased invasion by 118%
(p<0.01), 230% (p<0.01), 128% (N.S.) and 108% (N.S.) in UT-SCC-24A, UT-SCC-74A, UT-
SCC-87 and UT-SCC90A (Table XI B). These data suggested that PDCD4 plays a role in
regulating invasion of OSCC cell lines.
7.3 PDCD4 Does Not Affect the Cell Cycle/Apoptosis in OSCC Cell Lines
Previous reports showed that PDCD4 affects cell proliferation by inhibiting cell cycle
progression (Goke et al., 2004b). Thus, PDCD4 induction may have decreased invasion by the
same mechanism in OSCC cell lines. The affect of PDCD4 transfection on cell viability was
determined relative to controls (untransfected, mock or PCMV6). As shown in Figure 7.9A,
PDCD4 had no effect on cell viability. To further confirm that PDCD4 did not induce cell cycle
arrest, we determined the % of cells in each phase of the cell cycle using flow cytometry. In
OSCC cell lines, we found that ~65% of our cells were in G1, ~12% in S-phase, ~10% in G2
and ~11% in G0 (Figure 7.9E). These values were unchanged in PDCD4 transfected cells. Thus,
PDCD4 does not appear to regulate cell growth or the cell cycle.
75
76
77
78
79
80
81
7.4 miR-21 is Over-expressed and Inversely Correlated to PDCD4 in OSCC
miR-21 has been shown to regulate PDCD4 in numerous studies (Section 3.6) and has been
reported to be over-expressed in HNSCC (Chang et al., 2008; Tran et al., 2007). Therefore, we
sought to verify these data in OSCC and determine whether miR-21 may be involved in
regulation of PDCD4 in OSCC. miR-21 expression was measured in OSCCs and their adjacent
normal mucosa (n = 32; Figure 7.10A) and in OSCC cell lines (n=7; Figure 7.11). miR-21
(median = 1.95; range, 0.42 – 30.03) was over-expressed (fold change > 1.5) in 66.6% (21/32),
unchanged in 25.0% (8/32) and under-expressed (fold change < 0.67) in 9.4% (3/31) of primary
patient OSCCs and over-expressed in all OSCC cell lines. Statistical analysis showed that over-
expression of miR-21 was not associated with any clinical variables (Table XV). However, there
was a trend that showed median miR-21 expression was higher in more advanced stage tumours
(2.66 vs 1.82, P=0.260).
miR-21 was inversely correlated to PDCD4 mRNA (P=0.001, Wilcoxon signed rank test) and
PDCD4 protein (P <0.001, Wilcoxon signed rank test) in patient OSCCs. When we grouped the
samples based on PDCD4 protein expression scores (absent, very low, low or unchanged), the
average miR-21 expression level was higher in those samples that expressed the lowest amount
of PDCD4 protein (Figure 7.10B; P < 0.01, One-way Anova). Taken together, these results
point toward a possible role for miR-21 in the down-regulation of PDCD4 in OSCC.
82
83
84
85
7.5 miR-21 Regulates PDCD4 in OSCC Cell Lines
In order to investigate whether miR-21 regulated endogenous PDCD4 in OSCC cell lines, we
determined the effect of transient transfection of miR-21 on PDCD4 protein levels. First, we
transfected a range (25, 50, 75 or 100 pmol) of scramble-miR into UT-SCC-74A (Figure
7.12A). Thus, we were able to determine the maximum concentration that could be transfected
for 72 hours without causing significant toxicity to the cells. Using either 25 or 50 pmol of
scramble-miR did not significantly decrease cell viability (91.3 ±5.7% and 89.3 ± 2.4%,
respectively) compared to mock transfected. However, 75 and 100 pmol of scramble-miR did
significantly decrease cell viability (61.7 ± 2.5% and 29.0 ± 5.8%, respectively). Thus, we did
not perform subsequent transfections with greater than 50 pmol. Next, we tested the effect of
transfection using 25 and 50 pmol of scramble-miR, pre-miR-21 and anti-miR-21 in UT-SCC-
74A. Cell viability was measured and both concentrations were non-toxic (Figure 7.12B).
Moreover, we confirmed that pre-miR-21 and anti-miR-21 led to over-expression and knock-
down of miR-21, respectively (Figure 7.12C), using Taqman real-time PCR. Additionally, both
concentrations of pre-miR-21 and anti-miR-21 caused a decrease and increase in PDCD4
protein expression, respectively (Figure 7.12D), by Western blot. These preliminary findings
suggested that miR-21 regulates PDCD4 and prompted us to investigate if this was the case in
additional OSCC cell lines. To ensure sufficient over-expression and knock-down in these
OSCC cell lines, we chose to perform our subsequent transfections with 50 pmol pre- or anti-
miR-21.
86
87
We performed transfections using pre-miR-21 or anti-miR-21 (compared to scramble-miR
control) in the highest PDCD4 expressing OSCC cell line, UT-SCC-90A, the moderate PDCD4
expressing cell lines, UT-SCC24A and 87 and lowest PDCD4 expressing cell line, UT-SCC-
74A (Figure 7.3B). Taqman real-time PCR was used to measure miR-21 and confirmed
transfection (Figure 7.13). PDCD4 mRNA and PDCD4 protein expression was determined by
quantitative RT-PCR (Figure 7.14) and Western blot (Figure 7.15), respectively. We found that
pre-miR-21 successfully inhibited PDCD4 protein expression in all cell lines, although had a
more profound effect in low and low/moderate PDCD4 expressing cell lines (UT-SCC-24A,
74A and 87). We also found that anti-miR-21 was capable of up-regulating PDCD4 protein
levels in UT-SCC-74A, but not to the same degree in UT-SCC-24A, 87 and 90A. However,
mRNA levels of PDCD4 were unchanged in all cell lines transfected with pre- or anti-miR-21.
Taken together, these results indicated that miR-21 regulates PDCD4 at the protein level, but not
at the mRNA level, in OSCC cell lines.
7.6 PDCD4 is a Direct Target of miR-21
miR-21 is predicted to have hundreds of target genes (Griffiths-Jones et al., 2006; Grimson et
al., 2007; Krek et al., 2005). We thus sought to determine whether PDCD4 was a direct target of
miR-21 in OSCC or whether miR-21 was indirectly regulating PDCD4 by targeting another
gene. In order to answer this question, we performed in silico analysis (Section 6.14) to
determine the miR-21 binding site in the 3’UTR of PDCD4 (Figure 6.1C). Using site-directed
mutagenesis, we mutated the PDCD4 plasmid at this site so that it would no longer be bound by
mir-21 and called this PDCD-UTRmut (Figure 6.1E). Sequencing analysis was performed and
confirmed the presence of this mutation prior to its use.
88
89
90
91
Transient transfection of PDCD4 and PDCD4-UTRmut into UT-SCC-74A confirmed that both
plasmids led to upregulation of PDCD4 compared to control (Figure 7.16A). However, when
miR-21 was co-transfected with PDCD4, a significant decrease in protein expression of PDCD4
was observed, compared to co-transfection with PDCD4-UTRmut (Figure 7.16B). Thus, these
results suggested that miR-21 directly binds to the PDCD4 3’UTR and this is a potential
mechanism by which miR-21 regulates its expression.
7.7 Post-translational Regulation of PDCD4 in OSCC cell lines
In addition to down-regulation by miR-21, previous studies in colon cancer showed that PDCD4
is down-regulated due to phosphorylation by p70/S6K, delocalization to the cytoplasm and
subsequent proteasomal degradation (Dorrello et al., 2006). Therefore, we attempted to
determine whether PDCD4 may be also regulated by this mechanism in OSCC. First, we
determined PDCD4 localization in OSCC cell lines using confocal microscopy. Our data
showed that PDCD4 was localized in the nucleus and in the cytoplasm in OSCCs but localized
mainly to the nucleus in HOK (Figure 7.17A). In some cell lines, such as UT-SCC-74A,
PDCD4 appeared predominantly in the cytoplasm. To determine whether phosphorylation of
PDCD4 may be responsible for its cytoplasmic translocation, the levels of phosphorylated
PDCD4 were measured in OSCC cell lines. We detected similar levels of phosphorylated
PDCD4 in OSCC cell lines and HOK (Figure 7.17B). However, the ratio of phosphorylated
PDCD4 to PDCD4 was less in HOK than OSCC cell lines, which suggests that there is more
phosphorylated PDCD4 in OSCC cell lines. Also, UT-SCC-74A seems to express the highest
amount of phosphorylated PDCD4 and appears to be almost completely localized to the
cytoplasm. Our preliminary data suggest that phosphorylation and cytoplasmic translocation of
PDCD4 may occur in OSCC cell lines, and could be another possible mechanism by which
PDCD4 is down-regulated in OSCC.
92
93
94
7.8 PDCD4 Downstream Targets (Preliminary Data)
Decreased invasion of colon cancer cell lines by PDCD4 is believed to be due to its down-
regulation of activator protein-1 (AP-1). AP-1 is a transcription factor composed of Jun-Jun
homodimers or Jun-Fos heterodimers. In the OSCC cell lines, we noticed a possible inverse
correlation between PDCD4 and cJun (Figure 7.18 A,B). These preliminary data suggested that
PDCD4 may be down-regulating c-Jun, and possibly AP-1, in OSCC. AP-1 has been found to
increase expression of MMP-2 and MMP-9, proteases implicated in enhancing tumour invasion
(Benbow and Brinckerhoff, 1997). We reasoned that if PDCD4 is regulating the AP-1
component protein, c-Jun, then may also be regulating expression of MMPs. In fact, PDCD4
over-expression has been shown to decrease protease activity in colon cancer cell lines (Yang et
al., 2006). Therefore, we investigated whether PDCD4 affected MMP expression to determine
whether this was a possible mechanism for the effect of PDCD4 on OSCC cell invasion.
Following transfection of PDCD4 or PCMV6 (control), we measured the expression of MMP-2
and MMP-9 by quantitative PCR (Figure 7.19A,B) and western blot (Figure 7.19C). Although
we detected no affect of PDCD4 on MMP-2 and MMP -9 mRNA expression, we did notice a
decrease in MMP-2 and -9 protein levels in OSCC cell lines. Over-expression of PDCD4 was
associated with decreased MMP-2 protein expression in UT-SCC-74A and 90A and decreased
MMP-9 protein expression in UT-SCC24A, 74A and 90A. These data suggested that PDCD4
has an effect on protein expression of MMP-2 and -9, but not at the mRNA level.
95
96
97
Chapter 8: Discussion
8.1 PDCD4 is Under-expressed in OSCC
We showed that PDCD4 is under-expressed at both the mRNA and protein levels in primary
patient OSCCs and cell lines (Figure 7.1, 7.2, 7.3). This finding is consistent with work showing
reduced PDCD4 expression in lung cancer (Chen et al., 2003), hepatocarcinoma (Zhang et al.,
2006a), breast cancer (Afonja et al., 2004), colon cancer (Mudduluru et al., 2007; Wang et al.,
2008), glioma (Gao et al., 2007), pancreatic cancer (Lu et al., 2008; Ma et al., 2005) and
esophageal cancer (Hiyoshi et al., 2009). Although our patient sample set consisted of tumours
that were predominantly derived from older patients, some of our cell lines were derived from
younger patients and also showed PDCD4 under-expression. PDCD4 mRNA and protein
expression were correlated (P<0.001) in primary patient samples and for most cell lines.
However, UT-SCC-15 expressed higher levels of PDCD4 mRNA and lower levels of PDCD4
protein than HOK. Therefore, a possible mechanism of PDCD4 down-regulation in most OSCC
cell lines is at the level of gene expression, but not in UT-SCC-15.
Interestingly, our IHC data confirmed reduced PDCD4 expression in invasive carcinomas
compared to normal oral mucosa, dysplasia and CIS (Figure 7.2), suggesting that PDCD4 loss
could play a role in OSCC invasion. Moreover, our results showed that lower PDCD4 mRNA
levels were significantly correlated with nodal metastasis. Indeed, other studies in OSCC have
shown that deregulation of genes whose protein products are involved in invasion, are correlated
with metastasis (Nagata et al., 2003; Schmalbach et al., 2004). For example, mRNA expression
of invasion related genes, such as MMP-1, MMP-3, and urokinase plasminogen activator
receptor ligand (uPA), were all increased in primary OSCC tumours with cervical lymph node
metastasis versus tumours without evidence of nodal metastasis (Nagata et al., 2003). Also,
98
serpine protease inhibitor-2 (SERPINB2) mRNA, which down-regulates proteins involved in
degradation of the extra-cellular matrix, was found to be down-regulated in metastatic
oropharyngeal squamous cell carcinomas (OPSCCs) and OSCCs (Schmalbach et al., 2004).
These data suggest that reduced or absent PDCD4 expression may be associated with OSCC
invasion and metastasis.
Interestingly, in our sample set, loss of PDCD4 protein expression was significantly associated
with a well differentiated tumour grade. This contrasts to previous findings in other cancers
which demonstrate that PDCD4 expression is lost in poorly differentiated tumours (Chen et al.,
2003). However, our data set only contained 2 cases of well differentiated tumours and 6 poorly
differentiated tumours in comparison to 27 cases of moderately differentiated tumours, thus
these findings may represent a Type I error (false positive), which is commonly encountered
when applying statistical analyses to such a small sample size. Expanding on the number of
cases of well and poorly differentiated tumours would be necessary to verify or disprove these
findings.
It would also be useful to determine an alternative method for measuring PDCD4 protein
expression that was more quantitative than IHC. Although IHC has its benefits, such as the
ability to visualize protein expression, it is hard to quantify this expression. Perhaps using
additional methods to quantify protein expression should be used, such as quantitative imaging.
It has also been reported that IHC can sometimes lead to false negative results, due to improper
tissue fixation, poor antigen retrieval methods or other experimental error (Kok et al., 2009).
These factors may even explain the fact that lower PDCD4 protein levels were not significantly
correlated with nodal metastasis, even though lower PDCD4 mRNA level was.
99
8.2 PDCD4 Regulates Invasion of OSCC Cell Lines
Using OSCC cell lines, we showed that PDCD4 over-expression decreased the ability of OSCC
cell lines to invade through a matrigel and that the converse, knock-down of PDCD4, increased
invasion. The finding that PDCD4 acted as a negative regulator of invasion in OSCC cell lines
is similar to findings in other human carcinoma cells. In particular, in colon cancer cells,
PDCD4 suppressed the invasion and intravasation (ability of tumour cells to enter the
bloodstream) implicating PDCD4 as regulator of invasion and metastasis (Asangani et al.,
2008). Taken together, our findings provide evidence that PDCD4 may regulate invasion and
metastasis in OSCC.
Future studies may be warranted to determine whether loss of PDCD4 expression can be used
clinically to determine the risk of cervical lymph node metastasis. Currently, staging of the
primary tumour determines whether or not a patient is subject to neck dissection (removal of the
cervical lymph nodes) (Scully and Bagan, 2007). However, this is a particularly radical
treatment and if PDCD4 can be used as a reliable biomarker of nodal metastasis then it would
reduce the number of patients that undergo this procedure unnecessarily.
Knock-down of PDCD4 did not significantly decrease invasion in UT-SCC-87 and 90A. These
cell lines are highly invasive, compared to the other cell lines, which may have masked any
effect caused by knock-down of PDCD4. In fact, it has previously been shown that it is difficult
to modify invasion of such highly invasive cell lines. For example, previous experiments
performed in our laboratory showed that knock-down of CLDN-1 decreased invasion of UT-
SCC-74A and 90A and over-expression of CLDN-1 increased invasion of UT-SCC-24A, but
did not significantly increase invasion of UT-SCC-90A cells (Dos Reis et al., 2008).
Additionally, just one study shows that PDCD4 knock-down increases invasion (Wang et al.,
100
2008), while most studies in other cancers focus on the effect of PDCD4 over-expression on
decreasing invasion (Asangani et al., 2008; Leupold et al., 2007; Nieves-Alicea et al., 2009;
Yang et al., 2006; Zhang et al., 2009). This one study examined HT29 colon carcinoma cells,
which showed very little invasion prior to PDCD4 knock-down. Taken together, these findings
suggest that, although PDCD4 knock-down did not significantly increase invasion of all the UT-
SCC cell lines tested, PDCD4 may still play an important role because its over-expression was
associated with a significant decrease in OSCC cell invasion.
8.3 The Mechanism by which PDCD4 Regulates Invasion
The mechanism by which PDCD4 regulates invasion in OSCC and other cancers is not well-
understood, although several studies have attempted to clarify it. PDCD4 has been shown to
decrease mRNA and protein expression of E-cadherin (Wang et al., 2008), a trans-membrane
glycoprotein, which is an important component of the tight junctions found between epithelial
cells and is involved in regulation of β-catenin (Cavallaro and Christofori, 2004). In fact,
decreased expression of E-cadherin following PDCD4 knock-down was required to increase
invasion of these cell lines (Wang et al., 2008). Loss of E-cadherin also resulted in the
translocation of β-catenin to the nucleus, where it dimerized with T cell factor/lymphoid
enhancer factor (TCF4) and activated transcription (Wang et al., 2008). Transcriptional targets
of β-catenin/TCF include genes which are involved in cell proliferation, invasion and metastasis
(Lo Muzio, 2001). In OSCC, IHC analysis showed loss of E-cadherin expression at the invasive
tumour front (Dos Reis et al., 2008). Thus, there is evidence that loss of E-cadherin may be a
consequence of PDCD4 under-expression in OSCC as well.
A separate study showed that PDCD4 over-expression decreased invasion and metastasis in
colon cancer cell lines by down-regulation of uPAR mRNA and protein (Leupold et al., 2007).
101
Interestingly, u-PAR is a transcriptional target of β-catenin/TCF (Lo Muzio, 2001). u-PAR is a
cell surface receptor and, when bound by its ligand (u-PA), promotes degradation of extra-
cellular matrix component proteins such as collagen and fibrin. u-PAR protein expression is
found to be increased in OSCC and is correlated with increased invasion, lymph node metastasis
(Nozaki et al., 1998) and poor prognosis (Bacchiocchi et al., 2008; Nozaki et al., 1998). Also,
knock-down of u-PAR has been shown to inhibit progression and metastasis of OSCC
xenografts in nude mice (Zhou et al., 2009). Our preliminary data in OSCC cell lines were
inconclusive as to whether over-expression of PDCD4 increased mRNA levels of E-cadherin
and u-PAR (data not shown). Further experiments are warranted to investigate whether PDCD4
suppressed invasion in OSCC through up-regulation of E-cadherin and down-regulation of u-
PAR.
Several studies have shown that another β-catenin/TCF4 target, c-Jun, is also a targeted by
PDCD4. Inhibition of c-Jun by PDCD4 is necessary to inhibit invasion in vitro (Yang et al.,
2006). c-Jun is a component of the AP-1 transcription factor complex, which has been found to
up-regulate transcription of genes required for cell invasion (Dong et al., 1997; Hennigan et al.,
1994; Marconcini et al., 1999). In addition to down-regulation of c-Jun expression (Wang et al.,
2008), PDCD4 has been shown to regulate c-Jun post-translationally. PDCD4 interacts with c-
Jun and prevents its phosphorylation by Jun terminal kinase (JNK) (Yang et al., 2001). Also,
PDCD4 has also been found to inhibit expression of mitogen activated protein 4 kinase 1
(MAP4K1), a kinase upstream of JNK, subsequently decreasing JNK activity (Yang et al.,
2006). The consequence is decreased JNK-dependent phosphorylation of c-Jun, which
destabilizes it and prevents it from promoting transcription of AP-1 target genes (Bitomsky et
al., 2004; Wang et al., 2008). Our preliminary data showed that c-Jun and PDCD4 protein
expression may be inversely correlated; suggesting that PDCD4 may regulate c-Jun in OSCC. c-
102
Jun has been reported to be over-expressed and localized to the nucleus in OSCC compared to
normal oral mucosa (de Sousa et al., 2002; Turatti et al., 2005). It is possible that loss of
PDCD4 may be, in part, responsible for increased c-Jun expression. If so, it would be interesting
to determine whether over-expression of c-Jun is able to rescue the effect of PDCD4, thus
leading to increased invasion in OSCC.
Target genes of AP-1, including MMP-2 and -9, are known to code for proteins involved in
invasion and metastasis (Benbow and Brinckerhoff, 1997; Crawford and Matrisian, 1996;
Curran and Murray, 2000). Our preliminary data showed that MMP-2 and -9 protein expression
were decreased by PDCD4 in OSCC. However, PDCD4 doesn’t seem to regulate MMP-2 and -9
mRNA expression. This may indicate that PDCD4 is regulating MMP protein expression
independent of AP-1 in OSCC. Indeed, PDCD4 has been shown to inhibit cap-dependent
translation (Yang et al., 2003a), which would include translation of MMPs. However, we did
not observe a decrease in MMP-2 expression in all cell lines that over-expressed PDCD4; this
indicates that a more selective mechanism of inhibiting the expression of MMPs may exist in
OSCC. This mechanism may be disrupted in UT-SCC-24A, explaining why MMP-2 protein
expression is unchanged in this cell line. Alternatively it is possibly that down-regulation of
MMPs in PDCD4 transfected OSCC cell lines is mediated by u-PAR., as knock-down of u-PAR
led to an increase in MMP-2 and -9 protein expression in OSCC xenograft mice (Zhou et al.,
2009), Another possible explanation for why PDCD4 does not affect MMP-2 and -9 mRNA
levels may be because we missed any transcriptional changes in our experiments, since the cells
were harvested 72 hours after transfection. Also, since transient transfection is never 100%
efficient, it may be more useful to look at downstream mRNA targets of PDCD4 using stably
transfected PDCD4 cell lines. We can therefore hypothesize that the mechanism by which
PDCD4 decreased invasion of OSCC cells may require its upregulation of E-cadherin and/or its
103
down-regulation of u-PAR, c-Jun and MMPs. Future studies are required to determine, which, if
any, of these targets are important for OSCC cell invasion.
8.4 PDCD4 Affects on Cell Proliferation in OSCC
Our results showed that PDCD4 does not affect cell growth or affect the cell cycle in OSCC cell
lines. This is in contrast to some reports that identify PDCD4 as playing a role in decreasing cell
proliferation in neuroendocrine (Goke et al., 2004b), glioma (Gao et al., 2008) and ovarian
carcinoma cell lines (Wei et al., 2009). It also contrasts reports that PDCD4 over-expression can
induce apoptosis in breast (Afonja et al., 2004) and hepatocellular carcinoma cell lines (Zhang
et al., 2006a). However, our findings agree with other studies (Frankel et al., 2008; Nieves-
Alicea et al., 2009; Wang et al., 2008; Yang et al., 2006), which show that PDCD4 regulates
invasion, but not cell proliferation or apoptosis. These observations indicate that PDCD4
function may be cell type or tissue specific. PDCD4 may be only capable of inhibiting cell
cycle, thus affecting proliferation, if functional p53 is present. In fact, PDCD4 has been shown
to induce cell cycle arrest by up-regulation of p53 target genes (Bitomsky et al., 2008). In breast
cancer cell lines, knock down of p53 partially abrogated the proliferation decrease that followed
PDCD4 over-expression (Frankel et al., 2008). Since all our OSCC cell lines harbour p53
mutations (Lansford et al., 1999), this may explain why their growth does not appear to be
affected by PDCD4 expression. However, more studies are necessary to provide conclusive
evidence whether the function of PDCD4 depends on the p53 status of the cell. One potential
mechanism is that although PDCD4 is unable to induce growth arrest/apoptosis, it can still
interfere with other downstream targets that regulate invasion.
104
8.5 PDCD4 Regulation in OSCC
In this study, we sought to understand the mechanism of PDCD4 down-regulation, in order to
elucidate the upstream pathways of PDCD4, which may also be deregulated in OSCC.
Regulation of PDCD4 has been attributed to post-translational PI3K induced p70/S6K1
phosphorylation of PDCD4, leading to cytoplasmic translocation and subsequent proteasomal
degradation (Dorrello et al., 2006). Our preliminary data indicated a decrease in nuclear PDCD4
and a possible increase in phosphorylated PDCD4 in OSCC cell lines. In fact, PI3K has been
found to be over-expressed in OSCC tissue, but not pre-malignant lesions (Fenic et al., 2007;
Kozaki et al., 2006). Thus, down-regulation of PDCD4 may be by activation of this pathway
later during OSCC progression.
In addition to post-translational regulation, PDCD4 has been shown to be regulated post-
transcriptionally by miR-21 in breast (Frankel et al., 2008), colon (Asangani et al., 2008) and
esophageal carcinoma (Hiyoshi et al., 2009). Furthermore, miR-21 is over-expressed in HNSCC
(Chang et al., 2008; Tran et al., 2007), making it a potential upstream regulator of PDCD4. In
our patient cohort, miR-21 expression inversely correlated with PDCD4 mRNA and protein.
This prompted our investigations to determine whether miR-21 could affect endogenous
PDCD4 in OSCC cell lines.
miR-21 over-expression and knock-down in OSCC cell lines led to decreased and increased
PDCD4 protein expression, respectively. We observed that the effect of miR-21 on PDCD4
protein expression varied between cell lines. This is consistent with reports showing that miR-21
had diverse effects in different breast cancer cell lines (Frankel et al., 2008; Zhu et al., 2008).
Although miR-21 had a tumour suppressive function in both, its specific function varied. In
MCF-7 cells it inhibited proliferation and in MDA-MB-231 cells it inhibited invasion but not
105
proliferation. Thus, the functional effects of miR-21 likely depend on the genetic make-up of the
cell lines. In this study, the UT-SCC cell lines that expressed low levels of endogenous PDCD4
(UT-SCC-74A and -87) were most sensitive to PDCD4 regulation by miR-21. UT-SCC-90A
expressed higher levels of PDCD4, and miR-21 did not seem to affect PDCD4 expression to the
same extent. These differences may be explained by the involvement of other mechanisms of
PDCD4 regulation, since PDCD4 plays key roles in cellular function. If PDCD4 and miR-21
expression are both high in the same cell line, that cell line might not be as dependent on miR-
21 to regulate PDCD4 levels. It is also possible that complete inhibition of PDCD4 expression
by miR-21 requires other miRs that have yet to be identified. This means that in order for miR-
21 to alter expression of its target genes, such as PDCD4, it would require co-operative
regulation between miR-21 and other miRs, which has been shown to be a common mechanism
(Hobert, 2004).
These data demonstrated that miR-21 affects PDCD4 protein levels. However, mRNA levels of
PDCD4 were unchanged in all cell lines transfected with pre- or anti-miR-21 (Figure 7.7). This
contrasted with our data that showed a significant inverse correlation between PDCD4 mRNA
and miR-21 in both patient OSCC samples and cell lines. Similar results were shown in a study
in colon cancer (Asangani et al., 2008); miR-21 affected PDCD4 protein, but not mRNA
expression in vitro, and there was a trend in which PDCD4 mRNA was inversely correlated to
miR-21 levels in patient samples. In breast cancer cell lines, PDCD4 mRNA levels increased
after stably knocking down miR-21 (Frankel et al., 2008). These studies suggest that miR-21
could also regulate PDCD4 mRNA levels, but this does not appear to be the case in our system.
In mammalian systems, miRs regulate mRNA expression by binding imperfectly to their target
mRNA; interfering with translation initiation factor binding and relocating the mRNA to P-
bodies (Liu et al., 2005). Once the mRNA is in the P-body, it is not translated and may re-enter
106
the cytoplasm, but can also be degraded over time (Bhattacharyya et al., 2006). Thus, even
though most miRs show quick inhibition of protein expression, long term heightened expression
of miRs may be able to promote mRNA degradation as well. If this was the case it would
explain why miR-21 is inversely correlated with PDCD4 mRNA in vivo but transient, short-term
miR-21 over-expression does not regulate PDCD4 mRNA in a cell line model.
It is also known that miR-21 may target several genes, which led us to investigate whether miR-
21 was directly targeting PDCD4 and not regulating another protein upstream of PDCD4.
Studies to date have shown that miR-21 directly binds to a construct expressing only the
PDCD4 3’UTR in esophageal cancer cell lines (Hiyoshi et al., 2009) and immortalized kidney
cell lines (Zhu et al., 2008) or a tagged PDCD4 mRNA construct in breast cancer cell lines
(Frankel et al., 2008). These studies they did not take into account the fact that secondary
structure in PDCD4 mRNA may interfere with miR-21 binding in vivo. This study improved
upon previous findings by expressing the full length PDCD4 mRNA with the mutation in its
3’UTR, a more accurate way of reflecting the in vivo situation (Figure 6.1). Our findings
indicated that miR-21 directly targeted and down-regulated PDCD4 in OSCC.
As with over-expression of PDCD4, miR-21 knock-down has been shown to inhibit neoplastic
transformation (Lu et al., 2008), cell proliferation (Frankel et al., 2008; Lu et al., 2008) or
invasion (Hiyoshi et al., 2009; Zhu et al., 2008). Several studies have shown that PDCD4 is an
essential downstream target of miR-21 in various cell systems. For example, expression of miR-
21 in 12-O-tetetradecanoylphorbol-13-acetate (TPA)-resistant JB6 cells (mouse cells that do not
undergo neoplastic transformation after treatment with TPA versus TPA-sensitive JB6 cells and
have high endogenous PDCD4 expression compared to TPA-sensitive JB6 cells) rendered cells
sensitive to TPA-induced transformation and increased cell proliferation by down-regulating
PDCD4 (Lu et al., 2008). Also, knock-down of PDCD4 significantly reversed the anti-
107
proliferative effect of miR-21 depletion in MCF-7 breast cancer cells (Frankel et al., 2008).
Finally, knock-down of miR-21 decreased invasion and metastasis and concurrently upregulated
PDCD4 (Zhu et al., 2008). These findings indicate that PDCD4 is a crucial mediator of the
oncogenic affects of miR-21. Furthermore, it warrants more study into whether PDCD4 is also a
crucial downstream target of miR-21 in OSCC invasion.
8.7 PDCD4 as a Potential Therapeutic Target in OSCC
The fact that PDCD4 is down-regulated in a number of different cancers, including OSCC,
suggests that restoring its expression could be a promising mode of therapy. Aerosol gene
delivery was used to effectively deliver the PDCD4 gene into the lungs of mice with lung cancer
(Jin et al., 2006). Moreover, delivered PDCD4 facilitated apoptosis, inhibited pathways
involved in cell proliferation and suppressed pathways that are known to be involved in tumour
angiogenesis. In another study, aerosol-based PDCD4 was delivered into the lungs of AP-1
luciferase reporter mice. PDCD4, but not a mutant PDCD4 that doesn’t bind eIF4A, induced
apoptosis, regulated proteins involved in cell-cycle control and suppressed AP-1 activity
(Hwang et al., 2007). Studies such as these showed that it is possible to effectively deliver a
functional PDCD4 gene to tumours. Although our data do not demonstrate that PDCD4 inhibits
apoptosis, it does inhibit invasion. Since invasion is required for the tumour to metastasize,
PDCD4 gene delivery may help to treat unresectable OSCC tumours in order to decrease or
prevent metastatic spread.
8.8 Conclusions
PDCD4 has been previously implicated in invasion, cell-cycle regulation or apoptosis in a
number of cancers. Our data demonstrated that PDCD4 is under-expressed in primary patient
OSCCs and OSCC cell lines. Lower PDCD4 mRNA levels were associated with OSCCs from
108
patients with nodal metastasis. Moreover, PDCD4 affected invasion of OSCC cell lines. PDCD4
protein expression was down-regulated in OSCC cell lines by direct binding of miR-21. These
data indicate a possible role for loss of PDCD4 in OSCC tumourigenesis, specifically in its
potential for invasion and metastasis. Future studies are warranted to elucidate a mechanism for
PDCD4’s involvement in invasion and to determine whether these findings can be extended in
vivo and in the clinical setting.
109
Chapter 9: Future Directions
We have answered our questions that asked whether restoring PDCD4 expression can decrease
invasion of OSCC cell lines and whether PDCD4 is regulated by miR-21 in OSCC. Future
studies should determine whether PDCD4 has prognostic value specific to clinical and
pathological variables, using a larger patient cohort. Also, a focus should be on identifying a
mechanism for PDCD4’s role in decreasing OSCC invasion, and whether PDCD4 can regulate
invasion in vivo. Finally, other mechanisms of PDCD4 regulation should be explored to give a
more thorough understanding of PDCD4 regulation.
In order to determine whether PDCD4 has prognostic value specific to clinical and pathological
variables, it would be important to validate our findings in a larger and independent sample set.
This sample set should consist of enough patients so that a correlation between PDCD4
expression in T1 and T2 stage tumours can be made with nodal metastasis. Since most of the
uncertainty as to whether or not nodal neck dissection will be beneficial arises in these patients,
knowledge of whether PDCD4 status is predictive of nodal metastasis is particularly important
for this patient cohort. Additionally, this sample set would ideally consist of both younger and
older patients.
The use of high-throughput screens comparing PDCD4 over-expressed cell lines with controls,
in order to delineate important molecular differences in each, would contribute to understanding
the mechanism(s) by which PDCD4 affects invasion. Using microarray analysis of PDCD4
over-expressing cell lines versus control could be used to identify differentially expressed genes
that may be regulated by PDCD4.
Also, it may be useful to perform additional studies to determine whether PDCD4 can affect
invasion in vivo. Using a mouse model similar as to what has been described previously using
110
HNSCC cell lines (Kudo et al., 2006), we could determine the effect of PDCD4 over-expression
in a mouse model. Briefly, OSCC cell lines stably over-expressing PDCD4 versus control could
be injected into the tongue of athymic (nude) mice. Animals would be monitored for tumour
formation, and eventually sacrificed. Tongue tumours, cervical lymph nodes and lungs (a
common site of distant metastasis for OSCC) would be removed. Tumour volume and the
presence or absence of metastasis would be determined. Should PDCD4 over-expression reduce
invasion in this model, then it would verify the findings of this report that PDCD4 plays an
important role in decreasing invasion in OSCC.
It is known that a functionally important protein, such as PDCD4, may have multiple
mechanisms of regulation. Therefore, it is likely that PDCD4 is regulated by multiple miRs. In
fact, there are many miRs predicted to bind to PDCD4 mRNA sequence based on the
computational algorithm, miRanda (Betel et al., 2008; John et al., 2004). It would be useful to
determine which of these miRs are likely to regulate PDCD4 in vivo. Using additional
computation algorithms, such as miRBase (Griffiths-Jones et al., 2008) or miRacle (Scaria et
al., 2009), would help determine which miRs are most likely to bind PDCD4. miRBase is based
on a similar algorithm to miRanda and miRacle and takes into account miR secondary structure
when determining whether a miR will interact with a given mRNA. Those miRs that are
predicted to bind PDCD4 by multiple algorithms and have been linked to OSCC or other
cancers might be important for PDCD4 regulation and it would be useful to verify their
interaction both in vitro and in vivo. Interestingly, miR-158b, also over-expressed in OSCC
(Cervigne et al., submitted) is predicted to bind the PDCD4 3’UTR by miRanda (Betel et al.,
2008; John et al., 2004). Currently, there is no role for miR-158b in cancer but that does not
mean it isn’t important. Future studies could be aimed at identifying whether it interacts with
PDCD4 in a similar fashion as miR-21 does.
111
PDCD4 protein expression has also been shown to be down-regulated by increased PI3K
activity (Dorrello et al., 2006). PI3K induced p70/S6K1 phosphorylation of PDCD4 on serine
67, leads to its cytoplasmic translocation and subsequent proteasomal degradation. Preliminary
data suggested that PDCD4 is delocalized to the cytoplasm and is phosphorylated, indicating
that perhaps this mechanism may also regulate PDCD4 protein levels. Future studies, in which
components of the PI3K pathway are inhibited, may be able to determine whether PDCD4 is
regulated by this pathway in OSCC.
Our studies do not show that miR-21 regulates PDCD4 mRNA in cell lines, however,
endogenous PDCD4 mRNA was decreased in both OSCC cell lines and primary patient
samples. In order to identify whether miR-21 is in fact capable of down-regulating PDCD4
mRNA, as well as protein, future studies could involve creating stable cell lines over-expressing
miR-21. Such a model would be more representative of the mechanism of miR-21 inside the
primary tumour. Moreover, this model could be used to determine whether consistent over-
expression of miR-21 affects PDCD4 mRNA level. These studies would provide a possible
mechanism for the inverse correlation found when comparing PDCD4 mRNA and miR-21
levels in primary OSCC tumours. Also, they may explain the puzzling lack of a similar
correlation using in vitro manipulation.
It may also be important to determine if there are other mechanisms of PDCD4 mRNA
regulation. To date, it is unknown whether there are deletions or mutations in the chromosomal
sequence containing PDCD4. Sequencing analysis would provide a definitive answer as to
whether genetic mutations are present in the PDCD4 gene. It could then be determined whether
these genetic mutations have an effect on mRNA expression using site-directed mutagenesis.
Additionally, to test whether PDCD4 under-expression is due to silencing by histone
deacetylases (HDACs) or methylation, one could treat cell lines with HDAC or methylation
112
inhibitors and examine the affect on PDCD4 mRNA. Should PDCD4 expression be increased
upon treatment, additional experiments in patient samples would be warranted to investigate
methylation or the presence of HDACs at the PDCD4 promoter.
It would also be important to determine whether a functional difference exists between the two
different PDCD4 isoforms. While our studies were focused on identifying the relevance and
function of PDCD4 Variant 1, which lacks 11 amino acids present in Variant 2, it would be
important to determine whether PDCD4 Variant 2 has a different function. Perhaps performing
micro-array analysis comparing cell lines over-expression each of the isoforms would help us to
gain insight into whether they have different targets and, therefore, different functions. Since
both variants are picked up by mRNA and IHC analysis, this would be an important factor when
deciding whether loss of PDCD4 expression can be used as a biomarker in the clinic.
113
Chapter 10: References
Afonja O, Juste D, Das S, Matsuhashi S, Samuels HH (2004). Induction of PDCD4 tumor suppressor gene expression by RAR agonists, antiestrogen and HER-2/neu antagonist in breast cancer cells. Evidence for a role in apoptosis. Oncogene 23: 8135-45. Alvi A, Johnson JT (1996). Extracapsular spread in the clinically negative neck (N0): implications and outcome. Otolaryngol Head Neck Surg 114: 65-70. Argiris A, Karamouzis MV, Raben D, Ferris RL (2008). Head and neck cancer. Lancet 371: 1695-709. Asangani IA, Rasheed SA, Nikolova DA, Leupold JH, Colburn NH, Post S et al (2008). MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 27: 2128-36. Bacchiocchi R, Rubini C, Pierpaoli E, Borghetti G, Procacci P, Nocini PF et al (2008). Prognostic value analysis of urokinase-type plasminogen activator receptor in oral squamous cell carcinoma: an immunohistochemical study. BMC Cancer 8: 220. Bartel DP (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281-97. Batsakis JG (1999). Surgical excision margins: a pathologist's perspective. Adv Anat Pathol 6: 140-8. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D et al (1998). Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene 17: 313-25. Benbow U, Brinckerhoff CE (1997). The AP-1 site and MMP gene regulation: what is all the fuss about? Matrix Biol 15: 519-26. Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E (2005). Phylogenetic shadowing and computational identification of human microRNA genes. Cell 120: 21-4. Betel D, Wilson M, Gabow A, Marks DS, Sander C (2008). The microRNA.org resource: targets and expression. Nucleic Acids Res 36: D149-53. Bhaskar PT, Hay N (2007). The two TORCs and Akt. Dev Cell 12: 487-502. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W (2006). Stress-induced reversal of microRNA repression and mRNA P-body localization in human cells. Cold Spring Harb Symp Quant Biol 71: 513-21. Bitomsky N, Bohm M, Klempnauer KH (2004). Transformation suppressor protein Pdcd4 interferes with JNK-mediated phosphorylation of c-Jun and recruitment of the coactivator p300 by c-Jun. Oncogene 23: 7484-93. Bitomsky N, Wethkamp N, Marikkannu R, Klempnauer KH (2008). siRNA-mediated knockdown of Pdcd4 expression causes upregulation of p21(Waf1/Cip1) expression. Oncogene 27: 4820-9. Blot WJ, McLaughlin JK, Winn DM, Austin DF, Greenberg RS, Preston-Martin S et al (1988). Smoking and drinking in relation to oral and pharyngeal cancer. Cancer Res 48: 3282-7.
114
Boffetta P, Hashibe M (2006). Alcohol and cancer. Lancet Oncol 7: 149-56. Bohm M, Sawicka K, Siebrasse JP, Brehmer-Fastnacht A, Peters R, Klempnauer KH (2003). The transformation suppressor protein Pdcd4 shuttles between nucleus and cytoplasm and binds RNA. Oncogene 22: 4905-10. Boyd J, Risinger JI, Wiseman RW, Merrick BA, Selkirk JK, Barrett JC (1995). Regulation of microfilament organization and anchorage-independent growth by tropomyosin 1. Proc Natl Acad Sci U S A 92: 11534-8. Braakhuis BJ, Tabor MP, Leemans CR, van der Waal I, Snow GB, Brakenhoff RH (2002). Second primary tumors and field cancerization in oral and oropharyngeal cancer: molecular techniques provide new insights and definitions. Head Neck 24: 198-206. Burket LS, Greenberg MS, Glick M (2003a). Burket's Oral Medicine: Diagnosis & Treatment, 10 edn. PMPH-USA. Burket LW, Greenberg MS, Glick M (2003b). Burket's oral medicine : diagnosis & treatment, 10th edn. BC Decker: Hamilton, Ont., xiii, 658 p.pp. Bustin SA (2000). Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25: 169-93. Calhoun KH, Fulmer P, Weiss R, Hokanson JA (1994). Distant metastases from head and neck squamous cell carcinomas. Laryngoscope 104: 1199-205. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E et al (2002). Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99: 15524-9. Cancer IAfRo (2004). Tobacco smoke and involuntary smoking. IARC Monogr Eval Carcinog Risks Hum 83: 1-1438. Cavallaro U, Christofori G (2004). Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer 4: 118-32. Chan JA, Krichevsky AM, Kosik KS (2005). MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 65: 6029-33. Chan SH, Wu CW, Li AF, Chi CW, Lin WC (2008). miR-21 microRNA expression in human gastric carcinomas and its clinical association. Anticancer Res 28: 907-11. Chan TO, Rittenhouse SE, Tsichlis PN (1999). AKT/PKB and other D3 phosphoinositide-regulated kinases: kinase activation by phosphoinositide-dependent phosphorylation. Annu Rev Biochem 68: 965-1014. Chang AE (2006). Oncology : an evidence-based approach. Springer: New York, NY, xli, 2005 p.pp. Chang SS, Jiang WW, Smith I, Poeta LM, Begum S, Glazer C et al (2008). MicroRNA alterations in head and neck squamous cell carcinoma. Int J Cancer 123: 2791-7. Chen CZ, Li L, Lodish HF, Bartel DP (2004). MicroRNAs modulate hematopoietic lineage differentiation. Science 303: 83-6.
115
Chen Y, Knosel T, Kristiansen G, Pietas A, Garber ME, Matsuhashi S et al (2003). Loss of PDCD4 expression in human lung cancer correlates with tumour progression and prognosis. J Pathol 200: 640-6. Chen Y, Liu W, Chao T, Zhang Y, Yan X, Gong Y et al (2008). MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98G. Cancer Lett 272: 197-205. Chomczynski P, Sacchi N (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-9. Chufal KS, Rastogi M, Srivastava M, Pant MC, Bhatt ML (2006). Late chemo-intensification with cisplatin and 5-fluorouracil as an adjunct to radiotherapy: a pragmatic approach for locally advanced head and neck squamous cell carcinoma. Oral Oncol 42: 517-25. Cmarik JL, Min H, Hegamyer G, Zhan S, Kulesz-Martin M, Yoshinaga H et al (1999). Differentially expressed protein Pdcd4 inhibits tumor promoter-induced neoplastic transformation. Proc Natl Acad Sci U S A 96: 14037-42. Cooper SJ, MacGowan J, Ranger-Moore J, Young MR, Colburn NH, Bowden GT (2003). Expression of dominant negative c-jun inhibits ultraviolet B-induced squamous cell carcinoma number and size in an SKH-1 hairless mouse model. Mol Cancer Res 1: 848-54. Crawford HC, Matrisian LM (1996). Mechanisms controlling the transcription of matrix metalloproteinase genes in normal and neoplastic cells. Enzyme Protein 49: 20-37. Croce CM (2008). Oncogenes and cancer. N Engl J Med 358: 502-11. Croce CM, Calin GA (2005). miRNAs, cancer, and stem cell division. Cell 122: 6-7. Crowley J, Ankerst DP (2006). Handbook of statistics in clinical oncology, 2nd edn. Chapman & Hall/CRC: Boca Raton, 617 p.pp. Curran S, Murray GI (2000). Matrix metalloproteinases: molecular aspects of their roles in tumour invasion and metastasis. Eur J Cancer 36: 1621-30. de Sousa SO, Mesquita RA, Pinto DS, Jr., Gutkind S (2002). Immunolocalization of c-Fos and c-Jun in human oral mucosa and in oral squamous cell carcinoma. J Oral Pathol Med 31: 78-81. Dong Z, Crawford HC, Lavrovsky V, Taub D, Watts R, Matrisian LM et al (1997). A dominant negative mutant of jun blocking 12-O-tetradecanoylphorbol-13-acetate-induced invasion in mouse keratinocytes. Mol Carcinog 19: 204-12. Dorrello NV, Peschiaroli A, Guardavaccaro D, Colburn NH, Sherman NE, Pagano M (2006). S6K1- and betaTRCP-mediated degradation of PDCD4 promotes protein translation and cell growth. Science 314: 467-71. Dos Reis PP, Bharadwaj RR, Machado J, Macmillan C, Pintilie M, Sukhai MA et al (2008). Claudin 1 overexpression increases invasion and is associated with aggressive histological features in oral squamous cell carcinoma. Cancer 113: 3169-80. Downing D, Clark J (1997). Statistics the easy way, 3rd edn. Barron's: Hauppauge, N.Y., x, 394 p.pp.
116
Elwood JM, Pearson JC, Skippen DH, Jackson SM (1984). Alcohol, smoking, social and occupational factors in the aetiology of cancer of the oral cavity, pharynx and larynx. Int J Cancer 34: 603-12. Esquela-Kerscher A, Slack FJ (2006). Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 6: 259-69. Feber A, Xi L, Luketich JD, Pennathur A, Landreneau RJ, Wu M et al (2008). MicroRNA expression profiles of esophageal cancer. J Thorac Cardiovasc Surg 135: 255-60; discussion 260. Fenic I, Steger K, Gruber C, Arens C, Woenckhaus J (2007). Analysis of PIK3CA and Akt/protein kinase B in head and neck squamous cell carcinoma. Oncol Rep 18: 253-9. Ferlay J, Pisani P, Parkin D (2004). Cancer incidence, mortality and prevalence worldwide. IARC Cancer Base (2002 Estimates). Lyon: IARC Press. Franceschi S, Levi F, Dal Maso L, Talamini R, Conti E, Negri E et al (2000). Cessation of alcohol drinking and risk of cancer of the oral cavity and pharynx. Int J Cancer 85: 787-90. Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH (2008). Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem 283: 1026-33. Gao F, Wang X, Zhu F, Wang Q, Zhang X, Guo C et al (2008). PDCD4 gene silencing in gliomas is associated with 5'CpG island methylation and unfavorable prognosis. J Cell Mol Med. Gao F, Zhang P, Zhou C, Li J, Wang Q, Zhu F et al (2007). Frequent loss of PDCD4 expression in human glioma: possible role in the tumorigenesis of glioma. Oncol Rep 17: 123-8. Gillison ML, Shah KV (2001). Human papillomavirus-associated head and neck squamous cell carcinoma: mounting evidence for an etiologic role for human papillomavirus in a subset of head and neck cancers. Curr Opin Oncol 13: 183-8. Girish V, Vijayalakshmi A (2004). Affordable image analysis using NIH Image/ImageJ. Indian J Cancer 41: 47. Goke A, Goke R, Knolle A, Trusheim H, Schmidt H, Wilmen A et al (2002). DUG is a novel homologue of translation initiation factor 4G that binds eIF4A. Biochem Biophys Res Commun 297: 78-82. Goke R, Barth P, Schmidt A, Samans B, Lankat-Buttgereit B (2004a). Programmed cell death protein 4 suppresses CDK1/cdc2 via induction of p21(Waf1/Cip1). Am J Physiol Cell Physiol 287: C1541-6. Goke R, Gregel C, Goke A, Arnold R, Schmidt H, Lankat-Buttgereit B (2004b). Programmed cell death protein 4 (PDCD4) acts as a tumor suppressor in neuroendocrine tumor cells. Ann N Y Acad Sci 1014: 220-1. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ (2006). miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 34: D140-4. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ (2008). miRBase: tools for microRNA genomics. Nucleic Acids Res 36: D154-8. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP (2007). MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27: 91-105.
117
Hanahan D, Weinberg RA (2000). The hallmarks of cancer. Cell 100: 57-70. Hasina R, Hulett K, Bicciato S, Di Bello C, Petruzzelli GJ, Lingen MW (2003). Plasminogen activator inhibitor-2: a molecular biomarker for head and neck cancer progression. Cancer Res 63: 555-9. Hay N (2005). The Akt-mTOR tango and its relevance to cancer. Cancer Cell 8: 179-83. Health Mo, Programme NCC (2005). Cancer incidence data: Sri Lanka year 2000, 6 edn. Maharagam: Sri Lanka. Hennigan RF, Hawker KL, Ozanne BW (1994). Fos-transformation activates genes associated with invasion. Oncogene 9: 3591-600. Hermanek P, Hutter RV, Sobin LH, Wittekind C (1999). International Union Against Cancer. Classification of isolated tumor cells and micrometastasis. Cancer 86: 2668-73. Hershey JWB, Mathews M, Sonenberg N (2000). Translational control of gene expression, 2nd edn. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, x, 1020 p.pp. Hilliard A, Hilliard B, Zheng SJ, Sun H, Miwa T, Song W et al (2006). Translational regulation of autoimmune inflammation and lymphoma genesis by programmed cell death 4. J Immunol 177: 8095-102. Hiyoshi Y, Kamohara H, Karashima R, Sato N, Imamura Y, Nagai Y et al (2009). MicroRNA-21 Regulates the Proliferation and Invasion in Esophageal Squamous Cell Carcinoma. Clin Cancer Res 15: 1915-22. Hobert O (2004). Common logic of transcription factor and microRNA action. Trends Biochem Sci 29: 462-8. Horner M, Ries L, Krapcho M, Neyman N, Aminou R, Howlader N et al (2009). SEER Cancer Statistics Review, 1975-2006. Hwang SK, Jin H, Kwon JT, Chang SH, Kim TH, Cho CS et al (2007). Aerosol-delivered programmed cell death 4 enhanced apoptosis, controlled cell cycle and suppressed AP-1 activity in the lungs of AP-1 luciferase reporter mice. Gene Ther 14: 1353-61. Imataka H, Sonenberg N (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. Mol Cell Biol 17: 6940-7. International Union against Cancer., Sobin LH, Wittekind C (2002). TNM : classification of malignant tumours, 6th edn. Wiley-Liss: New York, xxiii, 239 p.pp. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S et al (2005). MicroRNA gene expression deregulation in human breast cancer. Cancer Res 65: 7065-70. Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P et al (2007). MicroRNA signatures in human ovarian cancer. Cancer Res 67: 8699-707. Jacob BJ, Straif K, Thomas G, Ramadas K, Mathew B, Zhang ZF et al (2004). Betel quid without tobacco as a risk factor for oral precancers. Oral Oncol 40: 697-704.
118
Jansen AP, Camalier CE, Colburn NH (2005). Epidermal expression of the translation inhibitor programmed cell death 4 suppresses tumorigenesis. Cancer Res 65: 6034-41. Jansen AP, Camalier CE, Stark C, Colburn NH (2004). Characterization of programmed cell death 4 in multiple human cancers reveals a novel enhancer of drug sensitivity. Mol Cancer Ther 3: 103-10. Jin H, Kim TH, Hwang SK, Chang SH, Kim HW, Anderson HK et al (2006). Aerosol delivery of urocanic acid-modified chitosan/programmed cell death 4 complex regulated apoptosis, cell cycle, and angiogenesis in lungs of K-ras null mice. Mol Cancer Ther 5: 1041-9. John B, Enright AJ, Aravin A, Tuschl T, Sander C, Marks DS (2004). Human MicroRNA targets. PLoS Biol 2: e363. Jose J, Coatesworth AP, Johnston C, MacLennan K (2003). Cervical node metastases in squamous cell carcinoma of the upper aerodigestive tract: the significance of extracapsular spread and soft tissue deposits. Head Neck 25: 451-6. Kademani D (2007). Oral cancer. Mayo Clin Proc 82: 878-87. Kademani D, Bell RB, Bagheri S, Holmgren E, Dierks E, Potter B et al (2005). Prognostic factors in intraoral squamous cell carcinoma: the influence of histologic grade. J Oral Maxillofac Surg 63: 1599-605. Kademani D, Dierks E (2006). Management of locoregional recurrence in oral squamous cell carcinoma. Oral Maxillofac Surg Clin North Am 18: 615-25. Kang MJ, Ahn HS, Lee JY, Matsuhashi S, Park WY (2002). Up-regulation of PDCD4 in senescent human diploid fibroblasts. Biochem Biophys Res Commun 293: 617-21. Katerinaki E, Haycock JW, Lalla R, Carlson KE, Yang Y, Hill RP et al (2006). Sodium salicylate inhibits TNF-alpha-induced NF-kappaB activation, cell migration, invasion and ICAM-1 expression in human melanoma cells. Melanoma Res 16: 11-22. Keski-Santti H, Atula T, Tornwall J, Koivunen P, Makitie A (2006). Elective neck treatment versus observation in patients with T1/T2 N0 squamous cell carcinoma of oral tongue. Oral Oncol 42: 96-101. Kim VN (2005). MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol Cell Biol 6: 376-85. Kirby AM, A'Hern RP, D'Ambrosio C, Tanay M, Syrigos KN, Rogers SJ et al (2006). Gefitinib (ZD1839, Iressa) as palliative treatment in recurrent or metastatic head and neck cancer. Br J Cancer 94: 631-6. Kok LF, Lee MY, Tyan YS, Wu TS, Cheng YW, Kung MF et al (2009). Comparing the scoring mechanisms of p16(INK4a) immunohistochemistry based on independent nucleic stains and independent cytoplasmic stains in distinguishing between endocervical and endometrial adenocarcinomas in a tissue microarray study. Arch Gynecol Obstet. Kowalski LP, Carvalho AL, Martins Priante AV, Magrin J (2005). Predictive factors for distant metastasis from oral and oropharyngeal squamous cell carcinoma. Oral Oncol 41: 534-41. Kozaki K, Imoto I, Pimkhaokham A, Hasegawa S, Tsuda H, Omura K et al (2006). PIK3CA mutation is an oncogenic aberration at advanced stages of oral squamous cell carcinoma. Cancer Sci 97: 1351-8.
119
Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ et al (2005). Combinatorial microRNA target predictions. Nat Genet 37: 495-500. Kudo Y, Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM et al (2006). Periostin promotes invasion and anchorage-independent growth in the metastatic process of head and neck cancer. Cancer Res 66: 6928-35. Kuhn RM, Karolchik D, Zweig AS, Wang T, Smith KE, Rosenbloom KR et al (2009). The UCSC Genome Browser Database: update 2009. Nucleic Acids Res 37: D755-61. Lamb RF, Hennigan RF, Turnbull K, Katsanakis KD, MacKenzie ED, Birnie GD et al (1997). AP-1-mediated invasion requires increased expression of the hyaluronan receptor CD44. Mol Cell Biol 17: 963-76. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A et al (2007). A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129: 1401-14. Lankat-Buttgereit B, Gregel C, Knolle A, Hasilik A, Arnold R, Goke R (2004). Pdcd4 inhibits growth of tumor cells by suppression of carbonic anhydrase type II. Mol Cell Endocrinol 214: 149-53. Lansford C, Grenman R, Bier H (eds) (1999) Human cell culture, cancer cell lines. Kluwer Academic Press: Dordrecht, the Netherlands, 185-255pp. LaRonde-LeBlanc N, Santhanam AN, Baker AR, Wlodawer A, Colburn NH (2007). Structural basis for inhibition of translation by the tumor suppressor Pdcd4. Mol Cell Biol 27: 147-56. Leemans CR, Tiwari R, Nauta JJ, van der Waal I, Snow GB (1994). Recurrence at the primary site in head and neck cancer and the significance of neck lymph node metastases as a prognostic factor. Cancer 73: 187-90. Leon X, Quer M, Orus C, del Prado Venegas M, Lopez M (2000). Distant metastases in head and neck cancer patients who achieved loco-regional control. Head Neck 22: 680-6. Leupold JH, Yang HS, Colburn NH, Asangani I, Post S, Allgayer H (2007). Tumor suppressor Pdcd4 inhibits invasion/intravasation and regulates urokinase receptor (u-PAR) gene expression via Sp-transcription factors. Oncogene 26: 4550-62. Li Y, Srivastava KK, Platanias LC (2004). Mechanisms of type I interferon signaling in normal and malignant cells. Arch Immunol Ther Exp (Warsz) 52: 156-63. Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R (2005). MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol 7: 719-23. Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-8. Lo Muzio L (2001). A possible role for the WNT-1 pathway in oral carcinogenesis. Crit Rev Oral Biol Med 12: 152-65. Lu Z, Liu M, Stribinskis V, Klinge CM, Ramos KS, Colburn NH et al (2008). MicroRNA-21 promotes cell transformation by targeting the programmed cell death 4 gene. Oncogene 27: 4373-9.
120
Ma G, Guo KJ, Zhang H, Ozaki I, Matsuhashi S, Zheng XY et al (2005). [Expression of programmed cell death 4 and its clinicopathological significance in human pancreatic cancer]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 27: 597-600. Machado J, Reis P, Kamel-Reid S (unpublished data). Mader S, Lee H, Pause A, Sonenberg N (1995). The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the translational repressors 4E-binding proteins. Mol Cell Biol 15: 4990-7. Marconcini L, Marchio S, Morbidelli L, Cartocci E, Albini A, Ziche M et al (1999). c-fos-induced growth factor/vascular endothelial growth factor D induces angiogenesis in vivo and in vitro. Proc Natl Acad Sci U S A 96: 9671-6. Markou A, Tsaroucha EG, Kaklamanis L, Fotinou M, Georgoulias V, Lianidou ES (2008). Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT-PCR. Clin Chem 54: 1696-704. Matsuhashi S, Yoshinaga H, Yatsuki H, Tsugita A, Hori K (1997). Isolation of a novel gene from a human cell line with Pr-28 MAb which recognizes a nuclear antigen involved in the cell cycle Research Communications in Biochemistry and Cell & Molecular Biology 1: 11. Meng F, Henson R, Lang M, Wehbe H, Maheshwari S, Mendell JT et al (2006). Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology 130: 2113-29. Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T (2007). MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 133: 647-58. Mestdagh P, Van Vlierberghe P, De Weer A, Muth D, Westermann F, Speleman F et al (2009). A novel and universal method for microRNA RT-qPCR data normalization. Genome Biol 10: R64. Moor JW, Jose J, Johnston C, Coatesworth AP, MacLennan KA (2004). Upper aerodigestive tract squamous cell carcinoma: distribution of extracapsular spread and soft tissue deposits in the neck. Acta Otolaryngol 124: 97-101. Mork J, Lie AK, Glattre E, Hallmans G, Jellum E, Koskela P et al (2001). Human papillomavirus infection as a risk factor for squamous-cell carcinoma of the head and neck. N Engl J Med 344: 1125-31. Mudduluru G, Medved F, Grobholz R, Jost C, Gruber A, Leupold JH et al (2007). Loss of programmed cell death 4 expression marks adenoma-carcinoma transition, correlates inversely with phosphorylated protein kinase B, and is an independent prognostic factor in resected colorectal cancer. Cancer 110: 1697-707. Murti PR, Bhonsle RB, Gupta PC, Daftary DK, Pindborg JJ, Mehta FS (1995). Etiology of oral submucous fibrosis with special reference to the role of areca nut chewing. J Oral Pathol Med 24: 145-52.
121
Nagata M, Fujita H, Ida H, Hoshina H, Inoue T, Seki Y et al (2003). Identification of potential biomarkers of lymph node metastasis in oral squamous cell carcinoma by cDNA microarray analysis. Int J Cancer 106: 683-9. Neville BW, Day TA (2002). Oral cancer and precancerous lesions. CA Cancer J Clin 52: 195-215. Nieves-Alicea R, Colburn NH, Simeone AM, Tari AM (2009). Programmed cell death 4 inhibits breast cancer cell invasion by increasing tissue inhibitor of metalloproteinases-2 expression. Breast Cancer Res Treat 114: 203-9. Nozaki S, Endo Y, Kawashiri S, Nakagawa K, Yamamoto E, Yonemura Y et al (1998). Immunohistochemical localization of a urokinase-type plasminogen activator system in squamous cell carcinoma of the oral cavity: association with mode of invasion and lymph node metastasis. Oral Oncol 34: 58-62. Orban TI, Izaurralde E (2005). Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA 11: 459-69. Palamarchuk A, Efanov A, Maximov V, Aqeilan RI, Croce CM, Pekarsky Y (2005). Akt phosphorylates and regulates Pdcd4 tumor suppressor protein. Cancer Res 65: 11282-6. Parkin DM, Bray F, Ferlay J, Pisani P (2005). Global cancer statistics, 2002. CA Cancer J Clin 55: 74-108. Pilcher BK, Dumin JA, Sudbeck BD, Krane SM, Welgus HG, Parks WC (1997). The activity of collagenase-1 is required for keratinocyte migration on a type I collagen matrix. J Cell Biol 137: 1445-57. Pillai RS (2005). MicroRNA function: multiple mechanisms for a tiny RNA? RNA 11: 1753-61. Pindborg J, Reichart P, Smith C, van der Waal I (1997). World Health Organisation histological typing of cancer and precancer of the oral mucosa, 2 edn. Springer: New York. Po Wing Yuen A, Lam KY, Lam LK, Ho CM, Wong A, Chow TL et al (2002). Prognostic factors of clinically stage I and II oral tongue carcinoma-A comparative study of stage, thickness, shape, growth pattern, invasive front malignancy grading, Martinez-Gimeno score, and pathologic features. Head Neck 24: 513-20. Prince ME, Sivanandan R, Kaczorowski A, Wolf GT, Kaplan MJ, Dalerba P et al (2007). Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 104: 973-8. Raguse JD, Gath HJ, Oettle H, Bier J (2006). Oxaliplatin, folinic acid and 5-fluorouracil (OFF) in patients with recurrent advanced head and neck cancer: a phase II feasibility study. Oral Oncol 42: 614-8. Rapidis AD, Trichas M, Stavrinidis E, Roupakia A, Ioannidou G, Kritselis G et al (2006). Induction chemotherapy followed by concurrent chemoradiation in advanced squamous cell carcinoma of the head and neck: final results from a phase II study with docetaxel, cisplatin and 5-fluorouracil with a four-year follow-up. Oral Oncol 42: 675-84.
122
Reis PP, Rogatto SR, Kowalski LP, Nishimoto IN, Montovani JC, Corpus G et al (2002). Quantitative real-time PCR identifies a critical region of deletion on 22q13 related to prognosis in oral cancer. Oncogene 21: 6480-7. Robinson MJ, Stippec SA, Goldsmith E, White MA, Cobb MH (1998). A constitutively active and nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell transformation. Curr Biol 8: 1141-50. Roldo C, Missiaglia E, Hagan JP, Falconi M, Capelli P, Bersani S et al (2006). MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors are associated with distinctive pathologic features and clinical behavior. J Clin Oncol 24: 4677-84. Rozen S, Skaletsky H (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365-86. Saini HK, Griffiths-Jones S, Enright AJ (2007). Genomic analysis of human microRNA transcripts. Proc Natl Acad Sci U S A 104: 17719-24. Sano D, Myers JN (2007). Metastasis of squamous cell carcinoma of the oral tongue. Cancer Metastasis Rev 26: 645-62. Sansal I, Sellers WR (2004). The biology and clinical relevance of the PTEN tumor suppressor pathway. J Clin Oncol 22: 2954-63. Scaria V, Hariharan M, Kumar S, Maiti S, Kumar S (2009). miRacle: Server for microRNA Target Prediction incorporating RNA secondary structure. submitted. Scarpace SL, Brodzik FA, Mehdi S, Belgam R (2009). Treatment of head and neck cancers: issues for clinical pharmacists. Pharmacotherapy 29: 578-92. Schmalbach CE, Chepeha DB, Giordano TJ, Rubin MA, Teknos TN, Bradford CR et al (2004). Molecular profiling and the identification of genes associated with metastatic oral cavity/pharynx squamous cell carcinoma. Arch Otolaryngol Head Neck Surg 130: 295-302. Schmid T, Jansen AP, Baker AR, Hegamyer G, Hagan JP, Colburn NH (2008). Translation inhibitor Pdcd4 is targeted for degradation during tumor promotion. Cancer Res 68: 1254-60. Scully C, Bagan JV (2007). Recent advances in Oral Oncology. Oral Oncol 43: 107-15. Scully C, Felix DH (2006). Oral medicine--update for the dental practitioner oral cancer. Br Dent J 200: 13-7. SEER, Horner M, Ries L, Krapcho M, Neyman N, Aminou R et al. (2009). National Cancer Institute: Bethesda, MD. Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y et al (2009). MicroRNA-21 is overexpressed in human cholangiocarcinoma and regulates programmed cell death 4 and tissue inhibitor of metalloproteinase 3. Hepatology. Shah JP (1990a). Cervical lymph node metastases--diagnostic, therapeutic, and prognostic implications. Oncology (Williston Park) 4: 61-9; discussion 72, 76.
123
Shah JP (1990b). Patterns of cervical lymph node metastasis from squamous carcinomas of the upper aerodigestive tract. Am J Surg 160: 405-9. Shah JP, Candela FC, Poddar AK (1990). The patterns of cervical lymph node metastases from squamous carcinoma of the oral cavity. Cancer 66: 109-13. Shibahara K, Asano M, Ishida Y, Aoki T, Koike T, Honjo T (1995). Isolation of a novel mouse gene MA-3 that is induced upon programmed cell death. Gene 166: 297-301. Shiboski CH, Schmidt BL, Jordan RC (2005). Tongue and tonsil carcinoma: increasing trends in the U.S. population ages 20-44 years. Cancer 103: 1843-9. Shin EY, Kim SY, Kim EG (2001). c-Jun N-terminal kinase is involved in motility of endothelial cell. Exp Mol Med 33: 276-83. Shintani S, Li C, Mihara M, Nakashiro K, Hamakawa H (2003). Gefitinib ('Iressa'), an epidermal growth factor receptor tyrosine kinase inhibitor, mediates the inhibition of lymph node metastasis in oral cancer cells. Cancer Lett 201: 149-55. Shiota M, Izumi H, Tanimoto A, Takahashi M, Miyamoto N, Kashiwagi E et al (2009). Programmed Cell Death Protein 4 Down-regulates Y-Box Binding Protein-1 Expression via a Direct Interaction with Twist1 to Suppress Cancer Cell Growth. Cancer Res. Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY (2007). miR-21-mediated tumor growth. Oncogene 26: 2799-803. Silverman S, Jr. (2001). Demographics and occurrence of oral and pharyngeal cancers. The outcomes, the trends, the challenge. J Am Dent Assoc 132 Suppl: 7S-11S. Slaby O, Svoboda M, Fabian P, Smerdova T, Knoflickova D, Bednarikova M et al (2007). Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. Oncology 72: 397-402. Slaughter DP, Southwick HW, Smejkal W (1953). Field cancerization in oral stratified squamous epithelium; clinical implications of multicentric origin. Cancer 6: 963-8. Sobin L, Wittekind C (2002). TNM classification of malignant tumours., 6 edn. Wiley-Liss: New York. Soejima H, Miyoshi O, Yoshinaga H, Masaki Z, Ozaki I, Kajiwara S et al (1999). Assignment of the programmed cell death 4 gene (PDCD4) to human chromosome band 10q24 by in situ hybridization. Cytogenet Cell Genet 87: 113-4. Som PM (1992). Detection of metastasis in cervical lymph nodes: CT and MR criteria and differential diagnosis. AJR Am J Roentgenol 158: 961-9. Steeg PS (2003). Metastasis suppressors alter the signal transduction of cancer cells. Nat Rev Cancer 3: 55-63. Suzuki C, Garces RG, Edmonds KA, Hiller S, Hyberts SG, Marintchev A et al (2008). PDCD4 inhibits translation initiation by binding to eIF4A using both its MA3 domains. Proc Natl Acad Sci U S A 105: 3274-9.
124
Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H et al (2004). Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 64: 3753-6. Takei K, Inoue T, Shimono M, Takahashi S, Shigematsu T, Noma H et al (1989). [A statistical study of autopsies performed on cases of oral cancer: with reference to distant metastasis in tongue cancer]. Shikwa Gakuho 89: 627-38. Termine N, Panzarella V, Falaschini S, Russo A, Matranga D, Lo Muzio L et al (2008). HPV in oral squamous cell carcinoma vs head and neck squamous cell carcinoma biopsies: a meta-analysis (1988-2007). Ann Oncol 19: 1681-90. Tomari Y, Zamore PD (2005). Perspective: machines for RNAi. Genes Dev 19: 517-29. Tran N, McLean T, Zhang X, Zhao CJ, Thomson JM, O'Brien C et al (2007). MicroRNA expression profiles in head and neck cancer cell lines. Biochem Biophys Res Commun 358: 12-7. Tsantoulis PK, Kastrinakis NG, Tourvas AD, Laskaris G, Gorgoulis VG (2007). Advances in the biology of oral cancer. Oral Oncol 43: 523-34. Turatti E, da Costa Neves A, de Magalhaes MH, de Sousa SO (2005). Assessment of c-Jun, c-Fos and cyclin D1 in premalignant and malignant oral lesions. J Oral Sci 47: 71-6. Urdan TC (2005). Statistics in plain English, 2nd edn. Lawrence Erlbaum Associates: Mahwah, N.J., xiii, 184 p.pp. van Houten VM, Tabor MP, van den Brekel MW, Kummer JA, Denkers F, Dijkstra J et al (2002). Mutated p53 as a molecular marker for the diagnosis of head and neck cancer. J Pathol 198: 476-86. Vasudevan S, Tong Y, Steitz JA (2007). Switching from repression to activation: microRNAs can up-regulate translation. Science 318: 1931-4. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F et al (2006). A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103: 2257-61. Wang Q, Sun Z, Yang HS (2008). Downregulation of tumor suppressor Pdcd4 promotes invasion and activates both beta-catenin/Tcf and AP-1-dependent transcription in colon carcinoma cells. Oncogene 27: 1527-35. Warnakulasuriya KA, Ralhan R (2007). Clinical, pathological, cellular and molecular lesions caused by oral smokeless tobacco--a review. J Oral Pathol Med 36: 63-77. Warnakulasuriya S (2008). Global epidemiology of oral and oropharyngeal cancer. Oral Oncol. Warner GC, Reis PP, Jurisica I, Sultan M, Arora S, Macmillan C et al (2004). Molecular classification of oral cancer by cDNA microarrays identifies overexpressed genes correlated with nodal metastasis. Int J Cancer 110: 857-68. Waters LC, Veverka V, Bohm M, Schmedt T, Choong PT, Muskett FW et al (2007). Structure of the C-terminal MA-3 domain of the tumour suppressor protein Pdcd4 and characterization of its interaction with eIF4A. Oncogene 26: 4941-50.
125
Wei ZT, Zhang X, Wang XY, Gao F, Zhou CJ, Zhu FL et al (2009). PDCD4 inhibits the malignant phenotype of ovarian cancer cells. Cancer Sci 100: 1408-13. Wen YH, Shi X, Chiriboga L, Matsahashi S, Yee H, Afonja O (2007). Alterations in the expression of PDCD4 in ductal carcinoma of the breast. Oncol Rep 18: 1387-93. Wilcoxin F (1947). Probability tables for individual comparisons by ranking methods. Biometrics 3: 119-22. Wong DT, Todd R, Tsuji T, Donoff RB (1996). Molecular biology of human oral cancer. Crit Rev Oral Biol Med 7: 319-28. Woodard J, Sassano A, Hay N, Platanias LC (2008). Statin-dependent suppression of the Akt/mammalian target of rapamycin signaling cascade and programmed cell death 4 up-regulation in renal cell carcinoma. Clin Cancer Res 14: 4640-9. Woolgar JA (2006). Histopathological prognosticators in oral and oropharyngeal squamous cell carcinoma. Oral Oncol 42: 229-39. Woolgar JA, Rogers S, West CR, Errington RD, Brown JS, Vaughan ED (1999). Survival and patterns of recurrence in 200 oral cancer patients treated by radical surgery and neck dissection. Oral Oncol 35: 257-65. Woolgar JA, Scott J (1995). Prediction of cervical lymph node metastasis in squamous cell carcinoma of the tongue/floor of mouth. Head Neck 17: 463-72. Woolgar JA, Scott J, Vaughan ED, Brown JS, West CR, Rogers S (1995). Survival, metastasis and recurrence of oral cancer in relation to pathological features. Ann R Coll Surg Engl 77: 325-31. Yang HS, Jansen AP, Komar AA, Zheng X, Merrick WC, Costes S et al (2003a). The transformation suppressor Pdcd4 is a novel eukaryotic translation initiation factor 4A binding protein that inhibits translation. Mol Cell Biol 23: 26-37. Yang HS, Jansen AP, Nair R, Shibahara K, Verma AK, Cmarik JL et al (2001). A novel transformation suppressor, Pdcd4, inhibits AP-1 transactivation but not NF-kappaB or ODC transactivation. Oncogene 20: 669-76. Yang HS, Knies JL, Stark C, Colburn NH (2003b). Pdcd4 suppresses tumor phenotype in JB6 cells by inhibiting AP-1 transactivation. Oncogene 22: 3712-20. Yang HS, Matthews CP, Clair T, Wang Q, Baker AR, Li CC et al (2006). Tumorigenesis suppressor Pdcd4 down-regulates mitogen-activated protein kinase kinase kinase kinase 1 expression to suppress colon carcinoma cell invasion. Mol Cell Biol 26: 1297-306. Yen AM, Chen SC, Chen TH (2007). Dose-response relationships of oral habits associated with the risk of oral pre-malignant lesions among men who chew betel quid. Oral Oncol 43: 634-8. Yoshitomi I, Kawasaki G, Yanamoto S, Mizuno A (2006). Orotate phosphoribosyl transferase mRNA expression in oral squamous cell carcinoma and its relationship with the dihydropyrimidine dehydrogenase expression and the clinical effect of 5-fluorouracil. Oral Oncol 42: 880-7. Yuspa SH (1998). The pathogenesis of squamous cell cancer: lessons learned from studies of skin carcinogenesis. J Dermatol Sci 17: 1-7.
126
Zakowicz H, Yang HS, Stark C, Wlodawer A, Laronde-Leblanc N, Colburn NH (2005). Mutational analysis of the DEAD-box RNA helicase eIF4AII characterizes its interaction with transformation suppressor Pdcd4 and eIF4GI. RNA 11: 261-74. Zamore PD, Haley B (2005). Ribo-gnome: the big world of small RNAs. Science 309: 1519-24. Zhang H, Ozaki I, Mizuta T, Hamajima H, Yasutake T, Eguchi Y et al (2006a). Involvement of programmed cell death 4 in transforming growth factor-beta1-induced apoptosis in human hepatocellular carcinoma. Oncogene 25: 6101-12. Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A et al (2006b). microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci U S A 103: 9136-41. Zhang S, Li J, Jiang Y, Xu Y, Qin C (2009). Programmed cell death 4 (PDCD4) suppresses metastastic potential of human hepatocellular carcinoma cells. J Exp Clin Cancer Res 28: 71. Zhang Z, DuBois RN (2001). Detection of differentially expressed genes in human colon carcinoma cells treated with a selective COX-2 inhibitor. Oncogene 20: 4450-6. Zhang ZF, Morgenstern H, Spitz MR, Tashkin DP, Yu GP, Marshall JR et al (1999). Marijuana use and increased risk of squamous cell carcinoma of the head and neck. Cancer Epidemiol Biomarkers Prev 8: 1071-8. Zhou H, Tang Y, Liang X, Yang X, Yang J, Zhu G et al (2009). RNAi targeting urokinase-type plasminogen activator receptor inhibits metastasis and progression of oral squamous cell carcinoma in vivo. Int J Cancer 125: 453-62. Zhu S, Si ML, Wu H, Mo YY (2007). MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1). J Biol Chem 282: 14328-36. Zhu S, Wu H, Wu F, Nie D, Sheng S, Mo YY (2008). MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res 18: 350-9.