pcr assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in...
TRANSCRIPT
PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays
in Drosophila
Part I: Gamma rays
Nanette Brand1
Nonhlanhla Ngwenya2
1Stellenbosch University, 2University of Pretoria, South Africa
Dr Igor Donatovich AlexandrovGenetic GroupLaboratory of Nuclear Problems
Goal To detect the quality and frequency of neutron-induced
mutational lesions in comparison to gamma ray-induced ones for different genes of Drosophila using PCR assay
Our aim: To study the molecular genetic action of gamma rays (60Co) on the black mutant of Drosophila
Polymerase Chain Reaction The polymerase chain reaction (PCR) is a technique for the
in vitro amplification of specific sequences of DNA
PCR allows the detection of different kinds of mutational changes within fragments, deletions locations
PCR result can be positive or negative
Model of study
Drosophila melanogaster (A) Wild type, (B) Black mutant
A B
Well studied example, gene structure known
Has common principal DNA structure with humans
Short life cycle (~15 days)
Permits the study of heritable gene mutation
Black gene structure
DNA Ex1 Ex2 Ex3 DNA
’ F1 R1 F3 R3 Fragment 1 Fragment 3 F2 R2
Fragment 2
In 1 In 2
A
B
5’ 3’
A. Physical map of black gene showing introns (In 1-2) and exons (Ex 1-3). B. Sizes and location of the black gene fragments studied with forward (F) and reverse (R) primers
Primer sequence for PCR
Fragment Primer Primer sequenceAnnealing
temperature (○С)
Size of the PCR
product (bp)
Size of the overlap
fragment (bp)
1F1 aggtgagatcggcacctg
64 1068R1 ttggctgcaatggggcactcac
45
2F2 acaacactcgcccgagtcca
64 1043R2 acactgttgcaggcagc
99
3F3 tggttgctcatttcgaggggt
64 859R3 tcccagttcccaaggcaaggac
Methods
DNA isolation
PCR assay
Gel electrophoresis (DNA analysis)
Results 22 black mutants studied 66 PCR assays performed Deletion of 2 fragments for 1 black mutant
was detected 21 black mutants have a small DNA
alterations not detected by PCR
Electrophoresis
1 2 3 54 76 8 9 10
Conclusion Gamma rays induce mostly small DNA
alterations which cannot be detected by PCR
This study serves as a basis for a study of the molecular genetic action of neutrons
Acknowledgements Dr I. Alexandrov, Dr M. Alexandrova and
Liliana Namolovan Co-presenter
Thank You for Your attention
Protocol for DNA Isolation
Homogenization of tissue
Binding of DNA with sorbent
Purification step
Purified DNA
1 2 3 54 76 8 9 10
Lane 1-3 = 1st fragment, Lane 4, 5 & 7 = 2nd fragment, Lane 8-10 = 3rd fragment and Lane 6 = DNA marker