Polymerase Chain Reaction Polymerase Chain Reaction (PCR) and Its Applications(PCR) and Its Applications

What is PCR?What is PCR?

It was invented in 1983 by Dr. Kary Mullis, for which he received the Nobel Prize in Chemistry in 1993.

PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro.

What is PCR? : What is PCR? : Why Why ““PolymerasePolymerase””??

It is called “polymerase” because the only enzyme used in this reaction is DNA polymerase.

What is PCR? : What is PCR? : Why Why ““ChainChain””??

It is called “chain” because the products of the first reaction become substrates of the following one, and so on.

What is PCR? : What is PCR? : The The ““ReactionReaction”” ComponentsComponents

1) Target DNA - contains the sequence to be amplified.

2) Pair of Primers - oligonucleotides that define the sequence to be amplified.

3) dNTPs - deoxynucleotidetriphosphates: DNA building blocks.

4) Thermostable DNA Polymerase - enzyme that catalyzes the reaction

5) Mg++ ions - cofactor of the enzyme

6) Buffer solution – maintains pH and ionic strength of the reaction solution suitable for the activity of the enzyme

PCR Targets

The number of bases in the targets can vary.

TTAAGGCTCGA . . . . AATTGGTTAA

The . . . . Represents the middle DNA sequence,and does not have to be known to replicate it.

The ReactionThe Reaction

THERMOCYCLERPCR tube

Denature (heat to 95oC)

Lower temperature to 56oC Anneal with primers

Increase temperature to 72oC DNA polymerase + dNTPs

DNA copies vs Cycle number

0

500000

1000000

1500000

2000000

2500000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Cycle number

DN

A c

opie

s

PCR Denaturing

Denaturing is the first step in PCR, in which

the DNA strands are separated by heating to

95°C.

PCR Primers

Primers range from 15 to 30 nucleotides, aresingle-stranded, and are used for thecomplementary building blocks of the target sequence.

PCR Primers

A primer for each target sequence on the end of your DNA is needed. This allows bothstrands to be copied simultaneously in bothdirections.

PCR Primers

TTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and

<. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT

PCR Primers

The primers are added in excess so they willbind to the target DNA instead of the two strands binding back to each other.

PCR Annealing

Annealing is the process of allowing two sequences of DNA to form hydrogen bonds.The annealing of the target sequences andprimers is done by cooling the DNA to 55°C.

PCR Taq DNA Polymerase

Taq stands for Thermus aquaticus, which is a microbe found in 176°F hot springs in Yellow Stone National Forest.

PCR Taq DNA Polymerase

Taq produces an enzyme called DNA polymerase, that amplifies the DNA from the primers by the polymerase chain reaction, inthe presence of Mg.

Applications of PCRApplications of PCR• Classification of organisms

• Genotyping• Molecular archaeology

• Mutagenesis• Mutation detection

• Sequencing• Cancer research

• Detection of pathogens

• DNA fingerprinting

• Drug discovery• Genetic matching• Genetic engineering

• Pre-natal diagnosis

Applications of PCR

Basic Research Applied Research• Genetic matching• Detection of pathogens• Pre-natal diagnosis• DNA fingerprinting• Gene therapy

• Mutation screening• Drug discovery• Classification of organisms• Genotyping• Molecular Archaeology• Molecular Epidemiology• Molecular Ecology

• Bioinformatics

• Genomic cloning

• Site-directed mutagenesis

• Gene expression studies

Applications of PCR

Molecular Identification Sequencing Genetic Engineering

• Molecular Archaeology• Molecular Epidemiology• Molecular Ecology• DNA fingerprinting• Classification of organisms• Genotyping• Pre-natal diagnosis• Mutation screening• Drug discovery• Genetic matching• Detection of pathogens

• Bioinformatics

• Genomic cloning

• Human Genome Project

• Site-directed mutagenesis

• Gene expression studies

MMOLECULAROLECULAR IIDENTIFICATION:DENTIFICATION:

Detection of Unknown MutationsDetection of Unknown MutationsMolecular Identification:

SSCP gels:“shifts” representing a mutation in the amplified DNA fragment

Classification of OrganismsClassification of Organisms

1) Relating to each other

2) Similarities

3) Differences

* Fossils

* Trace amounts

* Small organisms

! DNA !

Molecular Identification:

Insufficient data

Rademaker et al. 2001

Detection Of PathogensDetection Of Pathogens

Molecular Identification:

Detection Of PathogensDetection Of Pathogens

Sensitivity of detection of PCR-amplified M. tuberculosis DNA. (Kaul et al.1994)

Molecular Identification:

Sensitivity of detection of PCR-amplified M. tuberculosis DNA. (Kaul et al.1994)

GenotypingGenotyping by STR markersby STR markers

Molecular Identification:

Prenatal DiagnosisPrenatal Diagnosis

644 bp440 bp

204 bp

Molecular analysis of a family with an autosomal recessive disease.

Molecular Identification:

• Chorionic Villus

• Amniotic Fluid

SSEQUENCINGEQUENCING

Nucleotides (dNTP) are modified (dideoxynucleotides = ddNTP)

NO polymerisation after a dideoxynucleotide!

Fragments of DNA differing only by one nucleotide are generated

Nucleotides are either or

Sequencing:

SummarySummary

blood, chorionic villus, amniotic fluid, semen, hair root, saliva

68,719,476,736 copies Gel Analysis, Restriction Digestion, Sequencing

ConclusionConclusionThe speedspeed and easeease of use, sensitivitysensitivity, specificityspecificity and

robustnessrobustness of PCR has revolutionised molecular biology

and made PCR the most widely used and powerful

technique with great spectrum of research and

diagnostic applications.