patterns of phenotypic and genotypic resistance to ... · lincosamides and streptogramins group of...
TRANSCRIPT
![Page 1: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/1.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
803
Patterns of Phenotypic and Genotypic Resistance to Macrolides,
Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump
and Enzymatic Modification in Methicillin Resistant Staphylococcus aureus
Luma Saeed Mohammed*, May Talib Flayyih
Deprtment of Biology, College of Science, University of Baghdad, Baghdad, Iraq.
Abstract
The study was carried out to isolate Staphylococcus aureus isolates from
differents clinical samples to detect resistance of isolates to methicillin and detect
the phenotypic and genotypic patterns of resistance to macrolides, lincosamides and
streptogramins (MLS). The results showed that from 300 clinical sample there were
40 isolate related to S.aureus and there were 38(95)% of isolates were methicillin
resistance S.aureus (MRSA). The suscepltibility test showed that there was 55% of
isolates were resistance to erythromycin , 35% were resistance to clindamycin and
2.5% had intermediate resistance to the last one . The resistance to streptogramins
determined phenotypicallyby the using of vitek 2 compact system,the results
showed that there were four types of MLS resistance (iMLS, cMLS, M phenotype
and SAB). All isolates were subjected to polymerase chain reaction teqnique in a
monoplex pattern to amplify resistance encoding genes msrA, msrB,linA/linA’ and
vga .The results showed that 36(90)% of isolates contain msrA(940bp) and
msrB(595bp) , 30 (75)% of isolates contain linA/linA’ (323bp) gene while a region
of (470bp) of vga gene was not found in any isolate.
Keywords: S. aureus, MRSA, iMLSB , cMLS, M phenotype, SAB, msrA , msrB,
linA/linA’, vga.
اللنكوسأمايد و الماكروليدات مضادات لمجموعة االنماط المظهرية والوراثية المقاومةبألية الضخ خارج المقاومة للمثيسيلين Staphylococcus aureusبكتريا في والستربتوغرامين
الخلية والتحوير االنزيمي
حــي طالــــــــــب فليـــــــــمـــــــــ *،لـمـــــى سعيــــد محمـــــد
.العراق ،بغداد ، جامعة بغداد، كلية العلوم ، قسم علوم الحياة الخالصة
عن والتحريمن نماذج سريرية مختلفة المكورات العنقودية الذهبية هذه الدراسة لعزل بكتريا اجريت لعزالت لمضاد المثيسيلين و عن االنماط الوراثية والمظهرية لمقاومة مجموعة مضادات الماكروليدات امقاومة
03عينة سريرية تم الحصول على 033واللنكوسأمايد والستربتوغرامين ، اوضحت النتائج ان من مجموع النوع المقاوم للمثيسيلين ، ها منمن )%59عزلة ) 03و Staphylococcus aureus عزلة تابعة للنوع
(% منها مقاوم 09مة لمضاد االريثرومايسين بينما )و من العزالت مقا )%99نتائج اختبار الحساسية ان )بينت
ISSN: 0067-2904
![Page 2: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/2.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
804
من العزالت لها مقاومة متوسطة للمضاد االخير . تم اختبار حساسية العزالت )%5,9للكليندامايسين و )ط مظهرية م نظام الفايتك حيث اوضحت النتائج ان هناك اربعة انمالمضاد الستربتوغرامين مظهريًا بأستخدا
( . عرضت كل العزالت لتفاعل SABو M phenotypeو cMLSو (iMLS لمقاومة هذه المجموعة هي (vga,linA/linA’,msrB,msrA)و النمط االحادي لتضخيم الجينات المشفرة للمقاومة وهيذالبلمرة المتسلسل
و msrA(940bp)من العزالت حاوية على الجينين )%53عزلة ) 03،اوضحت النتائج ان msrB(595bp) حاوية على الجين )%59عزلة ) 03و linA/linA’ (323bp) بينما لم تحتوي اي عزلة
vga(470bp). على الجين
Introduction Antimicrobial resistance is one of most serious health threats , infections from resistant bacteria
are now too common and some pathogens have even become resistant to multiple types or classes of
antibiotics , S. aureus has become a major public health concern as a result of the steadily increasing
incidence of antimicrobial resistance particularly methicillin-resistant S. aureus (MRSA) [1].
Macrolides (e.g. erythromycin, azithromycin, spiramycin), lincosamides (e.g.,clindamycin,
lincomycin), and streptogramin (e.g., quinupristin) are groups of antibiotic collectively name MLS
, they are chemically different, but have similar inhibitory effects on bacterial protein synthesis ,
MLS commonly used in treatment of staphylococcal infections and clindamycin is a frequent choice
for some staphylococcal infections particularly skin and soft tissue infections and it is an alternative in
the penicillin-allergic patients [2]. Due to the high resistance to most of the antibiotics by
MRSA, vancomycin is normally the drug of choice. As vancomycin has many side effects, it
leads to interest in the alternatives for vancomycin especially MLS antibiotics [3]. The
resistance phenotypes are:
*M Phenotype: Staphylococcal isolates exhibiting resistance to erythromycin or while sensitive to
clindamycin [4].
*Inducible MLS (iMLS) Phenotype:Staphylococcal isolates show resistance to erythromycin and
clindamycin [5].
*Constitutive MLS Phenotype (cMLS): resistant to macrolide, lincosamide and streptogramin
antibiotics [6].
*SAB: resistance to streptogramines A and B antibiotics [7].
Materials and Methods:
Sample collection:
Three hundreds clinical specimens including urine, ear, sputum, blood and skin swabs, were
collected from patients attending Baghdad Hospitals, for the period from January to April 2015.
Isolation of staphylococci:
The isolation of staphylococci from various clinical sample by specific way depending on routine
laboratory techniques, all samples were streaked on mannitol salt agar all plates were incubated
aerobically for 24 hrs. at 37°C. [8].
S.aureus isolates were identified depending on the morphological features on culture media and
biochemical tests according to Bergey’s Manual [9], and confirmed diagnosis by the use of vitek2
compact system.
Detection of MRSA The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S.
aureus isolates to oxacillin.
MLS susceptibility pattern:
Macrolide-lincosamide and streptogramines susceptibility pattern determined by using of vitek 2
compact system by estimation of MIC values of erythromycin and clindamycin, resistance to
streptogramines determined phenotypically.
DNA extraction from S.aureus isolates by using Wizard® Genomic DNA Purification Kit
Promega (USA):
![Page 3: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/3.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
805
1. S.aureus isolates were streaked on mannitol salt agar, after incubated for 24 hrs. at 37ºC. There
after the bacterial isolates were inoculated in tubes contained 5 ml of sterile brain heart infusion
broth , incubated overnight 18 hrs. at 37 ºC.
2. From bacterial growth 1.5 ml was transferred to a 2ml microcentrifuge tubes and centrifuged at
14000g for 2 min. to pellet the cells, the supernatant was removed.
3. The pellet cells were resuspended in 480μl of 50mM EDTA and 120 μl of lysozyme was added to
the resuspended cells and pipetting gently to mix, after incubation at 37ºC for 2hrs. in water bath,
the microcentrifuge tubes were centrifuged for 2 min. at 14000g and the supernatant was
removed.
4. Nuclei Lysis Solution 600μl was added to the pellet cells and pipetting gently to mix then
incubated in water bath at 80ºC for 10 min., the microcentrifuge tubes allowed to cool at room
temperature.
5. RNase solution 3µl was added to the cell lysate, the microfuge tubes were inverted gently to mix,
the tubes were incubated in water bath for 60 min. at 37ºC.
6. Protein Precipitation Solution 200 µl was added to the RNase treated cell lysate, vortex
vigorously at high speed for 20 sec. to mix the protein precipitation solution with the cell lysate,
the microfuge tubes incubated in ice bath for 10 min.
7. The microcentrifuge tubes were centrifuged at 14000g for 3 min.
8. The supernatant contained DNA was transferred to new clean 1.5 microfuge tubes containing 600
µl of room temperature isopropanol at room temperature , gently mix by inversion until the
thread-like strands of DNA form a visible mass, centrifuged the tubes at 14000g for 2 min.
9. The supernatant carefully poured off and the tubes drained on clean absorbant paper, 70% ethanol
was added to wash the DNA pellet at room, centrifuged the tubes at 14000g for 2 min. and the
ethanol was aspirated.
10. DNA Rehydration Solution 100μl was added to the DNA in the microfuge tubes and rehydrate
through incubation at room temperature overnight.
11. The DNA was stored in -20ºC.
Determination of DNA quality
Estimating of DNA concentration and purity: The DNA concentration and purity were determined by using nano drop instrument from ACT
gene (China), the principle of this instrument is measuring the absorbency of nucleic acid in the wave
length 260/280 (according to company instructions).
Agarose Gel Preparation and Electrophoresis:
Agarose gel was prepared in 1% concentration for quality of the extracted DNA, by dissolving 1
gm of agarose powder in 100 ml of 1 x TBE buffer and melted, then the agarose gel was cooled to 50-
60ᵒC, 5 μL of ethidium bromide dye was added with mixing , DNA samples were first mixed with
aloading dye, so that 8 μL of each DNA sample were mixed with 2 μL loading dye, then this 10 μL of
loaded DNA were carefully transferred to a well of the agarose electrophoresis gel, electric current
was matched (72 volt for 90 min.) [10].
Primers selection:
All the primers listed in Table-1 were selected for this study, these primers were provided in a
lyophilized form (Bioneer) , dissolved in sterile distilled water to give a final concentration of 100
pmol ∕ μL and stored in deep freezer until used in PCR amplification , vga primer also designed
according to NCBI BLAST http://www.ncbi.nlm.gov. Table-1.
![Page 4: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/4.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
806
Table1-The primers and their sequnces used in convential PCR.
Target
gene
Primer
name Primer sequences5-3
PCR
frag-
ment
size(bp)
References
msrA MsrA F GGCACAATAA GAGTGTTTAA
AGG 940 [11]
msrA MsrAR AAGTTATATC ATGAATAGAT
TGTCCTGTT
msrB MsrB F TATGATATCC ATAATAATTA
TCCAATC 595 [11]
msrB MsrB R AAGTTATATC ATGAATAGAT
TGTCCTGTT
linA/linA′ linA/linA′ F GGTGGCTGGG GGGTAGATGT
ATTAACTGG 323 [12]
linA/linA′ linA/linA′ R GCTTCTTTTG AAATACATGG
TATTTTTCGA TC
Vga Vga F CCAGAACTGC TATTAGCAGA
TGAA 470 [13]
Vga Vga R AAGTTCGTTT CTCTTTTCGA CG
Vga Vga F CTCTTTGTACGAGTATATGG 198 Promega
/USA
Vga Vga R GTTTCTTAGTAGCTCGTTGAGC
Polymerase Chain Reaction (PCR) Technique:
The extracted DNA, primers and PCR premix (promega), were thawed at 4ᵒC, vortex and
centrifuged briefly to bring the contents to the bottom of the tubes.PCR mixture was set up in a total
volume of 25 μL included 5μL of PCR premix 2 μL of each primer, 5 μL of template DNA have been
used , the rest volume was completed with sterile neuclease free water water, then vortexed
(tempalate DNA was added finally) , PCR reaction tubes were centrifuged briefly to mix and bring
the contents to the bottom of the tubes then placed into thermocycler PCR instrument where DNA
was amplified as indicating in the Tables-2 ,3 and 4 after optimization .
Table 2- Program used to amplify the msrA and msrB gene.
Stage Temperature (time)
Initial denaturation 95°C (5min.)
Denaturation 95°C (30sec.)
30 cycles Annealing 50°C (35sec.)
Extension 72°C (50sec.)
![Page 5: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/5.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
807
Final extension 72°C (7min.)
Hold 4°C
Table 3- Program used to a mplify the linA/linA′ gene.
Table 4- Program used to amplify the vga gene.
Stage Temperature (time)
Initial denaturation 95°C (5min.)
Denaturation 95°C (30sec.)
30 cycles Annealing 54°C (35sec.)
Extension 72°C (50sec.)
Final extension 72°C (7min.)
Hold 4°C
Determination of PCR product:
Agarose gel was prepared in 1 % concentration there after, 5 µl DNA ladder were placed in the
first left well of the agarose electrophoresis gel, 5 μL of each PCR product loaded carefully to other
wells of the agarose electrophoresis gel, then the electrophoresis tank closed with its special lid, and
electric current was matched (72 volt for 90 mim.) [14].
Results and discussion:
Based on biochemical characteristics , from 300 sampels 40 isolats (SA1 to SA40) were identified
as S.aureus.
Detection of MRSA:
The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S.
aureus isolates to oxacillin, these two tests confirmed phenotypically by presence of modification of
mecA gene, the results showed that 38 (95) % of S. aureus isolates gave positive results to cefoxitin
screen test indicated that these isolates were MRSA, 2 (5 %) isolates (SA34 and SA38) were negative
for this test indicated that these two isolates were MSSA, 95 % of S. aureus isolates resistant oxacillin
(MIC ≥ 4 μg/ml) and 5% of isolates were sensitive (MIC ≥ 0.5 μg/ml), Oxacillin-resistant S. aureus
(ORSA), more commonly referred as MRSA [15]. The results showed that all S. aureus isolates
which gave positive test of cefoxitin screen and resistance to oxacilline had modification of penicillin
binding protein (mecA) (95 %).
Susceptibility of S. aureus isolates to MLS antibiotics
S.aureus isolates were 55% and 32.5% resistance to erythromycin and clindamycin respectively.
(MIC>=8 µg/ml for both antibiotics and (<=0.25 µg/ml) for clindamycin for isolates (which had
inducible ressistance to it), (2.5)% of isolates had intermediate resistance to clindamycin (MIC=2
µg/ml) . MLS resistance pattern showed that there are four types of MLS resistance phenotypes,
22.5% of S.aureus isolates was iMLS, 3% was cMLS while M phenotype found in 25% of S.aureus
isolates resistance to streptogramins determined phenotypically results showed that 18 isolates (45)%
had SAB resistance phenotype.
Stage Temperature (time)
Initial denaturation 95°C (5min.)
Denaturation 95°C (30sec.)
30 cycles Annealing 57°C (35sec.)
Extension 72°C (50sec.)
Final extension 72°C (7min.)
Hold 4°C
![Page 6: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/6.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
808
DNA Extraction from S.aureus isolates
Staphylococcus is gram positive bacteria; it's peptidoglycan is the basic component of the cell wall,
and makes up 50% of the cell wall mass [16]. Thick cell peptidoglycan layer makes DNA extraction
difficult work and expensive because of requirements lysozyme andlysostaphin DNA of 40 isolates
of S.aureus were extracted by Wizard® Genomic DNA purification kit. Purity of Genomic DNA was
estimated by Nano drop instrument in wave length 260/280, it ranged between (1.8-2), this indicates
to the methods efficiency was utilized in extraction and the purification of DNA as shown in Figure -1
,the purpose of DNA extraction was for detection of genes responsible for resistance to MLS group of
antibiotics.
Figure 1- Gel electrophoresis of DNA bands extracted from 16 isolates of S.aureus (agarose 1%
TBE buffer(1x) , 72 volt for 90 min.) stained with ethidium bromide lanes (1-16)were DNA extracted
band for isolates (SA1 to SA16).
msrA gene amplification by monoplex PCR technique:
To detect S. aureus isolates with msrA gene, it was subjected to PCR technique in a monoplex
pattern, msrA positivity was confirmed by agarose gel electrophoresis , Figure -2 .The result showed
that 36 isolates of S.aureus 90% ; (34 isolates of MRSA and 2 isolates of MSSA) had 940 bp band
(msrA) gene, this gene confer the inducible resistance (cross resistance) to macrolides and
streptogramines by pumping the antibiotics out of bacterial cell and prevent the accumulation in side
the cell [17]. Lina et al. (1999) found that the msrA gene was detected in 3 of S. aureus strains and 17
strains of CoNS conferring resistance to erythromycin . This gene was responsible for erythromycin
resistance in 36.4 % of clinical isolates of CoNs [18]. While [19] reported that msrA found in 33% of
CoNs. Other study showed that the frequency of erythromycin resistance gene (msrA) in S. aureus
was 10.2% [20].
Figure 2- Gel electrophoresis of amplified PCR products of msrA gene (940 bp) of S.aureus isolates
in monoplex PCR technique (agarose 1%, TBE buffer (1X) , 72 volt for 90 min. stained with ethidium
bromide). M:The DNA molecular weight marker (1500 bp ladder). All lanes for isolates
(SA1,SA2,SA3,SA4,SA5,SA6,SA7,SA8,SA9,SA10) gave positive results to msrA gene.
16
![Page 7: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/7.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
809
MsrB gene amplification by monoplex PCR technique
msrB gene had been detected in S.aureus isolates by PCR technique in a monoplex pattern ,msrB
positivity was confirmed by agarose gel electrophoresis , Figure- 3 .The result showed that 36 (90)%
isolates of S.aureus MRSA and MSSA had 595 bp band . The msrB gene responsible for macrolides
and streptogramines resistance in S.aureus and other bacteria [21]. [22] reported that msrB genes
presence in (6)% in S.aureus isolates and it was responsible for macrolide resistance . Other study
showed that msrB found in S. xylosus [23].While [24] reporetd that this gene found in (1.8) % of
MRSA.
Figure 3-Gel electrophoresis of amplified PCR products of msrB gene (595 bp) of 10 S.aureus
isolates in monoplex PCR technique (agarose 1%, TBE buffer (1X), 72 volt for 90 min. stained with
ethidium bromide). M: The DNA molecular weight marker (1500 bp ladder),all lanes gave positive
amplification for isolates ( SA1 ,SA3, SA4, SA5,SA6 ,SA7,SA8, SA9, SA10) except lane 2 for the
isolate (SA2) : negative amplification of 595 bp for msrB gene .
linA/linA′ gene amplification by monoplex PCR technique:
To detect S.aureus isolates with linA/linA′ gene, it was subjected to PCR technique in a monoplex
pattern linA/linA′ positivity was confirmed by agarose gel electrophoresis , Figure- 4.The results
showed 30 isolates of S.aureus (75)% (MRSA and MSSA) had 323 bp band . Other studies showed
that linA/linA′ was found among 98 isolates (30)% of methicillin-resistant coagulase-negative
staphylococci caused additionally resistant to macrolides and lincosamides [25]. This gene conferring
resistance to lincosamide by nucleotidyltransferase catalyzing the adenylation of the hydroxyl group
in position 3 of lincosamides [26].
linA/linA′ conferring resistance to lincomycin detected in one strain of S. aureus and seven strains
of CoNS [12] . linA/linA′ genes in S. aureus found in combination with ermC in one strain, giving a
resistance phenotype which was the addition of an MLSB-inducible resistance due to the erm gene
plus a constitutive resistance to lincomycin due to linA/linA′. Other study showed that linA/linA′ of S.
epidermidis was the single resistance gene [27].
The frequently use of macrolides and lincosamides antibiotics in treatment of infections caused by
S.aureus led the high distribution of these genes in clinical S.aureus isolates [28].
Figure 4- Gel electrophoresis of amplified PCR products of linA/linA' gene 323 bp of 10 S.aureus
isolates in monoplex PCR technique (agarose 1%, TBE buffer (1X), 72 volt for 90 min. and stained
![Page 8: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/8.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
810
with ethidium bromide). M:The DNA molecular weight marker (1500 bp ladder). All lanes gave
positive amplification for this gene for isolates (SA1, SA3,SA4,SA5,SA6,SA7,SA8,SA9 SA10)
except lane2 for isolate SA2 gave negative amplification for this gene.
Vga gene amplification by monoplex PCR technique:
Vga gene had been detected by PCR technique in a monoplex pattern, Vga was confirmed by
agarose gel electrophoresis in a 1% agarose staind with ethidium bromide, electrophoresed in 72 volt
for 90 min. and photographed under ultraviolet (UV) transilluminator, the results showed that 470 bp
band was not found in any isolates of S.aureus as shown in Figure-5. S.aureus isolates which had
resistance phenotypes to streptogramines had msrA and msrB genes conferring resistance to
macrolides and streptogramin B [29].
Figure 5- Gel electrophoresis of amplified PCR products of Vga gene (470bp): negative amplification
of all S.aureus isolates to this gene.
Distribution of genes among MLS resistance phenotypes in S.aureus isolates:
The resuts showed that among 9 S.aureus isolates had an iMLS resistance phenotype there were 7
isolates had not linA/linA' gene but there were resistance to clindamycin Table -5 , this occurred due
to the presence of msrA and msrB (one of them or both) conferring resistance to macrolides and
induced the resistance of S.aureus isolates to lincosamide after induction with macrolides (cross
resistance), because the resistance to lincosamide was closely tied to erythromycin through the
acquisition of MDR efflux pump [30, 31] Isolates (SA32 and SA40) had linA/linA' , msrA and msrB
for SA32 and msrB for SA40 , in this case linA/linA did not had any role in the resistance, because
one of resistance mechanisms to clindamycin in staphylococci is the active efflux pump of the
antibiotic from the periplasmic spase encoded by msrA gene [32, 33]. Other studies reported that
efflux pump of lincosamide is controlled by lmr, car and lsa genes [34]. Other study showed that
clindamycin resistance in S.aureus caused skin and soft tissue infections was due to vgaA allelic
variant for a putative efflux pump [35]. Clindamycin was problematic because it is exported from the
bacteria by the same inducible efflux pump that renders MRSA resistance to macrolides and it should
not be used if there is resistance to erythromycin or azithromycin, vancomycin, linezolid or
daptomycin [36].
In cMLS reistance phenotype the isolates SA13, SA30 and SA33 had linA/linA' gene which
conferring resistance to by drug modification mechanism via lincosamide nucleotidyl transferase
encoded by linA gene [37] . msrA gene in (SA13 ,SA30 and SA 33) and msrB gene in (SA30 and
SA33) responsible for macrolide resistance (erythromycin). In M resistance phenotype which
included S.aureus isolates showed resistance to macrolide only ,msrA gene found in 9 islates out of 10
,msrB found in all 10 isolates, msrA and msrB genes confered this resistance .
SAB resistance phenotype included S.aureus isolates had resistance phenotype to streptogramines
A and B but the streptogramines resistance determinant (vga) was not found in isolates ,antibiotics
conferred by msrA and msrB genes ,there were (94.7)% of the these two genes in S.aureus isolates
which had this resistance phenotype. This result agree with result of other study found that the
streptogramines resistance determinants vatA, vatB, vga were not found in S.aureus isolates and msrA
and msrB genes conferring resistance to these antibiotics [38]. linA/linA' found in (94.7)% of these
isolate, genes conferring resistance to one of the MLS antibiotics may confer cross-resistance to
![Page 9: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/9.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
811
others, because they have similar effects on inhibition of bacterial protein synthesis [39]. This
illustrated the importance of msrA and msrB genes in resistance of macrolides and other antibiotics
related to this group like lincosamides in local S.aureus isolates, this led t the increasing in numbers
of S.aureus isolates with iMLS phenotype [40]. Other study showd that linA/linA' gene found in
(52)% of iMLS phenotype, in 26% of cMLS phenotype and (13)% of MS phenotype [41]. Other
study reported that msrA induce the resistance of staphylococci to telithromycin (iMTS) phenotype,
telithromycin related to ketolide antibiotics belong to MLS group [28]. According to the types of
specimens the results showed that MLS resistance determinants genes distributed in S.aureus isolated
from different specimens especially from blood and skin, MLS resistance genes distributed in these
isolates , gave rise to the use of alternative antibiotics such as macrolides and clindamycin which led
to the high percentages of these genes in different clinical samples of S.aureus . Other studies showed
that msrA and msrB genes presence in S.aureus isolated from various human infections in 46.29%
for msrA and 49.07% for msrB [42]. msrA gene presence in S.aureus isolated from respiratory tract
S.aureus isolated from blood, respiratory tract infections, wound infections and abscess with a high
percent in respiratory tract infections. infections and wound infections [43].
Table 5- Distribution of msrA, msrB and linAllinA'genes in MLS resistance phenotypes in S.aureus.
Genes
linA/linA' msrB msrA No.of isolates Resistance phenotype
- + + SA27
- - + SA2
+ + + SA32
+ + - SA40 iMLS
- + + SA26
- + + SA18
- + - SA28
- + + SA35
- - + SA15
+ - + SA13
+ + + SA30 cMLS
+ + + SA33
- + + SA36
- + - SA29o/
“{}IOL
+ + + SA12
+ + + SA14
+ + + SA10 M
+ + + SA6
+ + + SA5
+ + + SA25
+ + + SA37
+ + + SA11
+ + + SA1
+ + + SA31
+ + + SA17
+ + - SA39
+ + + SA34
+ + + SA22 SAB
+ + + SA21
+ + + SA23
+ + + SA8
+ + + SA9
+ + + SA19
![Page 10: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/10.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
812
+ + + SA24
- - + SA20
+ + + SA7
+ + + SA38
+ + + SA3
+ + + SA4
+ + + SA16
References 1. Evangelista, S. S. and Oliveira, A. C. 2015. Community-acquired methicillin-resistant
Staphylococcus aureus: a global problem. J. Rev. Bras. Enferm, 68(1): 128-35.
2. Adaleti, R., Nakipoglu, Y., Ceran, N., Tasdemir, C., Kaya, F. and Sdemir, S. 2010. Prevalence of
phenotypic resistance of Staphylococcus aureus isolates to macrolide, lincosamide, streptogramin
B, ketolid and linezolid antibiotics in Turkey. Braz. J. Infect. Dis. 14(1): 11-14.
3. Reddy, M. C., Bindu, H., Soumendranath, M., Kanta, R. C. and Indu, K. 2014. Prevalence of
inducible clindamycin resistance in Staphylococcus aureus from clinical samples: a study from a
teaching hospital in Andhra Pradesh, India. Int. J. Curr. Microbiol. App. Sci., 3(3): 402-409.
4. Jain, S., Rukadikar, A. and Jain, A. 2016. Inducible clindamycin resistance in Staphylococcus
aureus isolated from clinical samples at C. U. Shah Medical College and Hospital, Surendranagar,
Gujarat, India. Int. J. Curr. Microbiol. App. Sci., 6: 875-879.
5. Vandana, K. E., Singh, J., Chiranjay, M. and Bairy, I. 2009. Inducible clindamycin resistance in
Staphylococcus aureus: reason for treatment failure. J. Glob. Infect. Dis. 1(1): 76-77.
6. Lim, J., Kwon, A., Kim, S., Chong,Y., Lee, K. and Choi, E. 2002. Prevalence of resistance to
macrolide ,lincosamide and streptogramin antibiotics in Gram-positive cocci. J. Antimicrob.
Agents Chemother. 49(3): 489-95.
7. Leclercq, R. and Courvalin, P.1991. Bacterial resistance to macrolide, lincosamide, and
streptogramin antibiotics by target modification. J. Antimicrob.Agents Chemother. 35(7): 1267-
1272.
8. Mendez-Vilas, A. 2012. Microbs in Applied Research. Current Advances and Challenges.World
Scientific Publishing Co.
9. Holt, J. G., Krieg, N. R., Sneath, P.H.A., Staley, J.T. and Williams, S.T. 1994. Bergey’s
Manual of Determinative Bacteriology, 9th ed. Williams and Wilkins, Baltimore, Maryland.
10. Das, S. and Dash, H.R. 2015. Microbial Biotechnology a Laboratory Manual for Bacterial
Systems.Springer.
11. Ross, J.I., Eady, E.A., Cove, J.H., Cunliffe, W.J., Baumberg, S. and Wootton, J.C. 1990.
Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding
transport super-gene family. Mol. Microbiol. 4(7): 1207-14.
12. Lina, G., Quaglia, A., Reverdy, M., Leclercq, R., Vandenesch, F. and Etienne, J. 1999.
Distribution of genes encoding resistance to macrolides, lincosamides and streptogramins among
staphylococci. J. Antimicrob. Agents Chemother. 43(5): 1062-1066.
13. Castro-Alarcon, N., Ribas-Aparicio, R.M., Silva-Sanchez, J., Calderon-Navarro A., Sanchez-
Perez, A., Parra-Rojas, I. and Aparicio-Ozores, G. 2011. Molecular typing and characterization
of macrolide, lincosamide and streptogramin resistance in Staphylococcus epidermidis strains
isolated in a Mexican hospital. J. Med. Microbiol. 60(6): 730-6.
14. Dubey, R.C. and Maheshwari, D.K. 2012. Practical Microbiology. Revised edition .S.Chand and
Company LTD. New Delhi.New Delhi .India.
15. McDougal, L.K., Steward, C.D., Killgore, G.E., Chaitram, J.M., McAllister, S.K. and Tenover,
F.C. 2003. Pulsed-field gel ectrophoresis typing of oxacillin-resistant Staphylococcus aureus
isolates from the United States:establishing a national database. J.Clin.Microbiol. 41(11): 3115 -
3115
16. Dmitriev, B.A., Toukach, F.V., Holst, O., Rietschel, E.T. and Ehlers, S. 2004. Tertiary structure
of Staphylococcus aureus cell wall murein. J. Bacteriol. 186(21): 7141-7148.
17. Chaieb, K., Zmantar,T., Chehab, O., Bouchami, O., Ben, H. A., Mahdouani, K. and Bakhrouf, A.
2007. Antibiotic resistance genes detected by multiplex PCR assays in Staphylococcus
![Page 11: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/11.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
813
epidermidis strains isolated from dialysis fluid and needles in a dialysis service. Jpn. J. Infect.
Dis. 60 (4): 183-187.
18. Eady, E. A., Ross, J.I., Tipper, J.L., Walters, C.E., Cove, J.H. and Noble, W.C. 1993. Distribution
of genes encoding erythromycin ribosomal methylases and an erythromycin efflux pump in
epidemiologically distinct groups of staphylococci. J. Antimicrob. Agents Chemother. 31(2):211-
217.
19. Wondrack, L., Massa, M., Yang, B.V. and Sutcliffe, J. 1996. Clinical strain of Staphylococcus
aureus inactivates and causes efflux of macrolides. J.Antimicrob. Agents Chemother. 40 (4): 992-
998.
20. Zmantar, T., Kouidhi, B., Miladi, H. and Bakhrouf. A. 2011. Detection of macrolide and
disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative
staphylococci. BMC. Res. Notes. 4: 453.
21. Hershberger, E., Donabedian, S., Konstantinou, K. and Zervos, M.J. 2004. Quinupristin-
Dalfopristin resistance in Gram-positive bacteria: mechanism of resistance and epidemiology. J.
Clin. Infect. Dis. 38(1): 92-98.
22. Schmitz, F., Sadurskia, R., Kraya, A., Boosa, M., Geisela, R., Kohrer, K., Verhoef, J. and Fluitb,
C. 2000. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus
faecium isolates from 24 European university Hospitals. J. Antimicrob. Agents Chemother. 45 (6):
891-894.
23. Milton, I. D., Hewitt, C. L. and Harwood, C. R. 1992. Cloning and sequencing of a plasmid-
mediated erythromycin resistance determinant from Staphylococcus xylosus. FEMS Microbiology
Letters. 97 (1-2):141–147.
24. Ozansoy F. A., Cevahir, N. and Kaleli, I. 2015. Investigation of macrolide, lincosamide and
streptogramin B resistance in Staphylococcus aureus strains isolated from clinical samples by
phenotypical and genotypical methods. Mikrobiyol. Bul. 49(1):1-14.
25. Novotna, G., Adamkova,V., Janata, J., Melter, O. and Spizek, J. 2005. Prevalence of resistance
mechanisms against macrolides and lincosamides in methicillin-resistant coagulase-negative
staphylococci in the Czech Republic and occurrence of an undefined mechanism of resistance to
lincosamides. J. Antimicrob. Agents Chemother. 49(8): 3586-3589.
26. Bozdogan, B. and Leclercq, R. 1999. Effects of genes encoding resistance to streptogramins A
and B on the activity of quinupristin-dalfopristin against Enterococcus faecium. J. Antimicrob.
Agents Chemother. 43(11): 2720-2725.
27. Mendez, E., Baroni,M., Mendosa, M., Segovia, G., Bellon, A., Mollerach, A.and Alicia, A. 2015.
Staphylococcus aureus: an unusual resistance mechanism. J. Bacteriol. Parasitol. 6: 213.
28. Gherardi, G., De Florio, L., Lorino, G., Fico, L. and Dicuonzo, G. 2009. Macrolide resistance
genotypes and phenotypes among erythromycin resistant clinical isolates of Staphylococcus
aureus and coagulase-negative staphylococci, Italy. FEMS. Immunol Med. Microbiol. 55: 62-
67.
29. Delialioglu, N., Aslan, G., Ozturk, C., Baki, V., Sen, S. and Emekdas, G. 2005. Inducible
clindamycin resistance in staphylococci isolated from clinical samples. Jpn. J. Infect. Dis. 58(2):
104-6.
30. Kaplan, S. L. 2004. New antibiotics and bacterial resistance.In : Hot Topics in Infection and
Immunity in Children.P:5-8.Vol.549.(eds. Pollard,A.J.;MacCracken,G.H. and Finn,A.).Springer
Science, LLC.
31. King,T. L., Mitchell, A. M., Lannen, B. J. and Daly, M. 2010. Essential drug categories.
In:Phamacology for Women’s Health.P:249-306 .Vol.11 (eds. King,T.L. and Brucher,M.C.).Jones
and Bartlent Publishers. Texas.
32. Kluytmans, J., Belkum, A. and Verbrugh, H. 1997. Nasal carriage of Staphylococcus aureus:
epidemiology, underlying mechanisms, and associated risks. J. Clin. Microbiol. Rev. 10(3): 505-
520.
33. Cain, C. L. 2013. Antimicrobial resistance in staphylococci in small animals. In: Clinical
Dermatology.P:19-34.Vol.43. (eds.Morris,D.O. and Kennis, R.A.).Elsevier.Philadelphia.
![Page 12: Patterns of Phenotypic and Genotypic Resistance to ... · Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec626e05f82bf17b1612a4b/html5/thumbnails/12.jpg)
Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814
DOI:10.24996.ijs.2017.58.2B.4
814
34. Kirst, H. A. 2014. Protein synthesis inhibitors from smaller antibiotic classes. In:Antimicrobials
,New and Old Molecules in the Fight Against Multi-Resistance Bacteria. P: 267-283.Vol.14
(eds.Marinelli,F.and Genilloud,O.). Springer Heidelberg.London.
35. Qin, X., Poon, B., Kwong, J., Niles, D., Schmidt, B. Z., Rajagopal, L. and Gantt, S. 2011. Two
paediatric cases of skin and soft-tissue infections due to clindamycin-resistant Staphylococcus
aureus carrying a plasmid-encoded vga (A) allelic variant for a putative efflux pump. Inter. J.
Chemother. 38(1): 81-83.
36. Adams L.V. and Taylor,T. H. 2013. Evaluation and management of infectious diseases.
In:Primery Care . A Collection Practice.P:1242-1263. Vol.4 (eds.Buttaro,T.M.;Trybulski,J.;
Bailey,P.P. and Sandberg-Cook,J.). Elsevier.United State.
37. Petinaki, E., Guerin-Faublee, V., Pichereau, V., Villers, C., Achard, A., Malbruny, B., and
Leclercq, R. 2008. Lincomycin resistance gene lnu (D) in Streptococcus uberis .J. Antimicrob.
Agents Chemother. 52(2): 626-630.
38. Osman, M., Al Nasbeh, A., Rafei, R., Mallat, H., Achkar, M., Dabboussi, F. and Hamze, M. 2015.
Characterization of resistance genes to macrolides, lincosamides and streptogramins (MLS)
among clinical isolates of Staphylococcus aureus in North Lebanon. Inter. J. Antimicrob. Agents.
5(4):1-8, 2(2): 626-630.
39. Kim, H. B., Lee, B., Jang, H. C., Kim, S. H., Kang, C. I., Choi, Y. J., Park, S.W., Kim, B. S.,
Kim, E. C., Oh, M. D. and Choe, K.W. 2004. A high frequency of macrolide-lincosamide-
streptogramin resistance determinants in Staphylococcus aureus isolated in South Korea. Microb.
Drug. Resist. 10(3): 248-254.
40. Durmaz, S., Kiraz, A., Ozer,T.T. and Percin, D. 2014. Macrolide-lincosamide-streptogramin B
resistance phenotypes in Staphylococcus aureus. Eur. J. Gen. Med. 11(4): 217-220.
41. Sakar, H., Mumcuoglu, I., Aksu, N., Karahan, Z. C., Kursun, S. and Kustimur, S. 2012. The rare
genes related to resistance to macrolide-lincosamide and streptogramin B group antibiotics among
coagulase-negative staphylococci. Mikrobiyol. Bul. 46(2):170-179.
42. Heidari, M., Momtaz, H., and Madani, M. 2011. Detection of the antibiotic resistance genes in
Staphylococcus aureus isolated from human infections and bovine mastitis. Afr. J. Microbiol. Res.
5(31): 5745-5749.
43. Momtaz, H. and Hafezi, L. 2014. Meticillin-resistant Staphylococcus aureus isolated from
Iranian Hospitals: virulence factors and antibiotic resistance properties. Bosn. J. Basic. Med. Sci.
14(4): 219-226.