out of balance: consequences of a partial keratin 10 knockout

2175Journal of Cell Science 110, 2175-2186 (1997)Printed in Great Britain © The Company of Biologists Limited 1997JCS4451

Out of balance: consequences of a partial keratin 10 knockout

Julia Reichelt1, Christoph Bauer2, Rebecca M. Porter3, E. Birgitte Lane3, Volker Herzog2

and Thomas M. Magin1,*1Institut für Genetik and Bonner Forum Biomedizin, Friedrich-Wilhelms-Universität, Bonn, Germany2Institut für Zellbiologie and Bonner Forum Biomedizin, Friedrich-Wilhelms-Universität, Bonn, Germany3Department of Anatomy and Physiology, Medical Sciences Institute, The University of Dundee, Dundee, Scotland

*Author for correspondence (e-mail: [email protected])

Recently we generated keratin 10 knockout mice whichprovided a valuable model for the dominantly inheritedskin disorder epidermolytic hyperkeratosis. Here we inves-tigated the molecular basis for their phenotype. Hetero-and homozygotes expressed a truncated keratin 10 peptidewhich has been identified directly by microsequencing.Epitope mapping of monoclonal antibodies to keratin 10Tenabled us to study its distribution relative to keratin 6,which is highly expressed in keratin 10 knockout mice, bydouble-immunogold electron microscopy. This revealedthat keratin 10T was restricted to complexes with keratin1 but did not mix with keratin 6. The latter did not formextended filaments with keratins 16/17 but aggregates.Keratins 6/16 were unable to compensate for the lack ofnormal keratin 1/10 filaments. Remarkably keratin 6aggregates strictly colocalized with keratohyalin granules.Residual keratin 1/10T clumps were located in the cell

periphery and at desmosomes which maintained a normalarchitecture. Surprisingly keratin 2e, a keratin tailored tosustain mechanical stress, was completely lost in paw soleepidermis of homozygous keratin 10 knockout mice,pointing to keratin 10 as its partner. The selective pairingof keratin 10T and the loss of keratin 2e indicate that invivo keratins are less promiscuous than in vitro. Skinfragility in keratin 10 knockout mice and in epidermolytichyperkeratosis is probably the consequence of two com-plementing mechanisms namely a decrease of normalkeratin 1/10 filaments and an increase in keratins 6/16 witha poor filament-forming capacity.

Key words: Keratin 10 knockout mouse, Epidermal differentiation,Epidermolytic hyperkeratosis, Keratin 2e, Keratin 6, Filaggrin,Barrier function

SUMMARY

INTRODUCTION

Transgenic and knockout mice have been valuable in unravel-ing the functional significance of many proteins in an in vivocontext. This is also exemplified for keratin intermediatefilaments (IF) which have been verified as essential structuralelements of the mammalian epidermis by the expression ofdominant-negative subunits in transgenic mice (for review seeFuchs, 1994; McLean and Lane, 1995). In this multilayeredepithelium different keratin pairs are expressed: mitoticallyactive basal keratinocytes synthesize keratins (K) 5, 14 and 15which are sequentially replaced during terminal differentiatonby K1 and K10 (Fuchs and Green, 1980; Moll et al., 1982;Roop et al., 1983). At some body sites K2e, K2p (Collin et al.,1992a,b; Moll et al., 1982) and/or K9 (Langbein et al., 1993)are additionally expressed. It has been suggested that thesekeratins are expressed at sites exposed to increased mechani-cal stress. Mutations in K2e or K9 lead to rare skin disordersin humans (Bonifas et al., 1994; McLean and Lane, 1995; Reiset al., 1994). Like in other multigene families, eg. connexins(Paul, 1995) the significance for the diversity of multiplesubunit proteins is only partially understood. In vitro data(Franke et al., 1983) suggest that different keratin pairs have

different stabilities. In vivo, however, where up to elevendifferent keratins are present in the same cell (Franke et al.,1984; Fuchs and Green, 1980; Magin et al., 1983) neither theirdistribution nor interaction with associated proteins is under-stood.

In recent years it has become clear that various blisteringskin disorders are caused by point mutations in highlyconserved regions of epidermal keratin genes (Fuchs, 1996;McLean and Lane, 1995). Among these is epidermolytichyperkeratosis (EH) with point mutations in the K1 or K10gene (Cheng et al., 1992; Chipev et al., 1992; McLean et al.,1994a; Rothnagel et al., 1992). After birth affected EH patientsexhibit erythema and extended blistering which is replaced inlater life by acanthosis and progressive hyperkeratosis (Brocq,1902; Traupe, 1989). The actual mechanisms responsible forskin fragility are poorly understood.

In terms of gene expression there are at least two profoundchanges in EH and as we show here in keratin 10 knockoutmice. One is a strong suprabasal induction of keratins 6, 16 and17, which are not expressed in normal, interfollicular epidermisbut in wound healing or hyperproliferation, and in the outerroot sheath of the hair follicle (Stark et al., 1987), esophagus,forestomach and glandular tissues (Moll et al., 1982; Quinlan

2176 J. Reichelt and others

et al., 1985; Schermer et al., 1989; Takahashi and Coulombe,1996; Weiss et al., 1984). Given the elevated expression ofK6/16/17 in EH or K10 knockout mice, the question arises ofwhether the cell fragility is augmented by the intrinsic proper-ties of K6/16 intermediate filaments. These have been shownto form relatively poor IF compared to those made from typicalepidermal keratins (Paladini et al., 1996). The explanation forcytolysis in K10 knockout mice and EH given so far was thatit is due to the dominant-negative action of mutant keratins.

The second striking change, namely an increase in size andnumber of keratohyalin granules, was noted in the granularlayer of the epidermis where the most profound alterationshave been described in EH (Holbrook et al., 1983; Ishida-Yamamoto et al., 1994; Steinert et al., 1981; Weidenthaler etal., 1993). Keratohyalin granules consist mainly of the highlyphosphorylated precursor protein profilaggrin which isexpressed in granular cells of cornified stratified epithelia (Daleet al., 1978; Steinert et al., 1981). As keratinocytes terminallydifferentiate profilaggrin is dephosphorylated and proteolyti-cally trimmed to generate the highly basic intermediatefilament binding protein filaggrin. This is proposed to alignK1/10 filaments through ionic interactions into highly orderedand condensed filament bundles found in the uppermostepidermis (Holbrook et al., 1983; Ishida-Yamamoto et al.,1994; Mack et al., 1993; Steinert et al., 1981; Weidenthaler etal., 1993). At a late stage of keratinization thesekeratin/filaggrin complexes are attached to the cornifiedenvelope where they might participate in the formation of afunctional barrier (Mack et al., 1993; Ming et al., 1994;Steinert and Marekov, 1995).

Recently we generated knockout mice for keratin 10 whichpresented a skin condition closely resembling that of patientssuffering from EH (Porter et al., 1996). Homozygous mice dieda few hours after birth while heterozygous littermatesdeveloped acanthosis and hyperkeratosis after 3-4 days. Giventhe complex keratin expression pattern of epidermis wewondered whether the phenotype of K10 knockout miceresulted exclusively from the loss of typical epidermal keratinsor also from the gain of newly expressed keratins. At presentthere are no ultrastructural data on the intracellular distributionof individual keratin pairs and their interaction with associatedproteins. Therefore we started to investigate the localization ofindividual keratins and filaggrin by light and immunogoldelectron microscopy. Our data revealed a distinct localizationof specific keratin pairs in granular keratinocytes and a signif-icant increase of the intermediate filament binding protein

Table 1. Antibodies employed for immunofluSpecificity Clone/serum Diluti

Keratin 2e 342.7.4 1:200 Keratin 9 HK9 Ty1 1:2,000Keratin 6 693-1 1:5,000 (IF), 1Keratin 1/10 K8.60 1:2 (EKeratin 10 DEK10 1:10 (IF), NeaKeratin 10 LH1 Neat (Keratin 10 LH2 Neat (Keratin 10 LH3 Neat (Filaggrin AF111 1:500 (IF), 1

693-1 and AF111 are rabbit antisera, HK9 Ty1 is a guinea pig antiserum, all otEM, electron microscopy; IF, immunofluorescence; W, western blot.*A generous gift.

filaggrin. The selective pairing of K10T and the loss of K2e innewborn homozygous mice indicate that in vivo keratins areless promiscuous than in vitro.

MATERIALS AND METHODS

Indirect immunofluorescenceExcised tissue samples were frozen in liquid nitrogen and stored at−70°C. Cryosectioning was performed at −25°C and frozen sectionsof 5 µm were air dried on APES (2-aminopropyltriethoxysilan; Roth,Karlsruhe, Germany) coated glass slides at room temperature for 5hours and then fixed for 10 minutes at −20°C in acetone and air dried.The sections were encircled with a wax pen (Dako, Hamburg,Germany) and then incubated for 1 hour in a humidified chamber with25 µl of the diluted primary antibody. The slides were washed threetimes for 5 minutes with PBS, pH 7.4, before 25 µl of secondaryantibody were applied. After 40 minutes of incubation the washingprocedure was repeated. The slides were briefly washed with water,ethanol and air-dried. Coverslips were mounted with Mowiol (Cal-biochem, Bad Soden, Germany) and examined with a fluorescencephotomicroscope (Axiophot, Zeiss, Oberkochen, Germany). Anti-bodies were diluted with PBS + 1% BSA + 0.05% Triton X-100 +0.05% Tween-20. For source and dilution of primary antibodies seeTable 1. Secondary antibodies (Dianova, Hamburg, Germany) were(i) Cy2 or Cy3-conjugated goat anti-mouse IgG (1:800), (ii) Cy3-con-jugated donkey anti-rabbit IgG (1:800), and (iii) DTAF-conjugateddonkey anti-guinea pig (1:100).

Electron microscopyTissue preparation and embeddingThe skin of newborn mice was cut into 3 mm pieces and fixed in PBScontaining 0.2% glutaraldehyde and 0.2% picric acid for 1 hour atroom temperature. After further trimming the pieces to a final size of1 mm they were incubated in freshly prepared fixative solutionovernight at 4°C. After a brief washing in PBS containing 5% sucrosefollowed by a 45 minute incubation with 0.5 M NH4Cl the sampleswere dehydrated in a graded ethanol series (30, 50, 70, 90, and 3×100% ethanol in water) and infiltrated with Unicryl (British Biocell,Cardiff, UK) according to the guidelines provided by the manufac-turer. In short, the specimens were infiltrated in a mixture of Unicryland ethanol (1:1) for 2 hours, followed by an overnight infiltration inpure resin (Chan et al., 1994). Polymerisation was performed at 4°Cusing Philips LTD 15 W/05 lamps for 5 days.

Post-embedding immunogold procedureThin sections (approx. 90 nm) were collected on Formvar-coatednickel grids, preincubated in 0.05 M glycine in PBS for 15 minutesand then in PBS containing 5% BSA for 30 minutes. All washing and

orescence studies and western blot analysison Source

(IF) Lutz Langbein, Heidelberg, Germany* (IF) Lutz Langbein, Heidelberg, Germany*:500 (EM) Manfred Blessing, Mainz, Germany*M) Sigma, Deisenhofen, Germanyt (W, EM) Dianova, Hamburg, GermanyW) Irene M. Leigh, London, GB*W) Irene M. Leigh, London, GB*W) Irene M. Leigh, London, GB*:50 (EM) Stuart Yuspa, Bethesda (MD), USA*

her antibodies are mouse monoclonals.

2177Out of balance: keratin 10 knockout

Fig. 1. Immunodetection of K10 and 10T in neonatal back skinepidermis with the mAb DEK10. Suprabasal cells were homogeneouslylabelled in all three genotypes: wild-type (A), heterozygous (B) andhomozygous (C). K1 showed the same distribution as exemplified herefor homozygous epidermis (D). Bar, 78 µm.

Fig. 2. Epitope mapping of K10 specific mAbs. Western blots ofback skin epidermis showed that LH1 recognized only the intact K10while LH2, LH3 and DEK10 detected both K10T and the wild-typeprotein.

incubation steps were performed in PBS supplemented with 0.5%BSA and 0.1% gelatin (from cold water fish skin). After pre-incuba-tion the grids were treated with primary antibodies followed by gold-labelled secondary antibodies, each for 1 hour at room temperature.For the detection of K1 and 10/10T in single label experiments,secondary antibodies coupled to 5 and 10 nm gold particles weremixed to achieve intense labelling. In single labelling experiments K6was detected with secondary antibodies coupled to 5 and 12 nm goldparticles. For double-labelling, anti-K10T was decorated with 5 nmgold-coupled anti-mouse antibodies and K6 with 12 nm gold-coupledanti-rabbit antibodies. After incubation with secondary antibodies thegrids were washed several times with PBS and postfixed with 2% glu-taraldehyde in PBS. Finally, the sections were rinsed with distilledwater, stained with uranyl acetate (4% in water) and Reynold’s leadcitrate (10 minutes each), and examined using a Philips CM120electron microscope (Philips Electron Optics, Eindhoven, NL).

RT-PCR products of K10T, of K2e and DNA sequencingFor the isolation of K10T cDNA, RNA was prepared using theRNeasy Total RNA Kit (Qiagen, Düsseldorf, Germany) from 10× 30µm cryostat sections from homozygous back skin. The RNA wasprimed with oligo dT (12-18 bases) in the presence of RNAsin(Boehringer, Mannheim, Germany) and reverse transcribed using a kitfrom the same company. A fragment was amplified from the cDNAusing primer 1 in exon 1: ATGGCAACTCAAGCCAGCGAG andprimer 2 from exon 8: GGAGTGAACCTATTTCCACAG in standardPCR buffer containing 1.5 mM MgCl2. 40 cycles were performed ona DNA thermal cycler (Hybaid, UK) consisting of denaturation for 30seconds at 94°C, annealing for 30 seconds at 55°C and extension for1 minute at 72°C. The product was gel purified using a Qiaquick PCRpurification kit and DNA cycle sequencing was performed using a kitfrom Gibco BRL (Karlsruhe, Germany) with primer 1 or 2.

For cDNA synthesis of K2e total RNA was prepared from pawepidermis as described above. RT-PCR from 2 µg of total RNA wascarried out with the Titan kit (Boehringer) according to the manufac-turer’s instructions. Mouse K2e-specific forward primer GACTC-CGCAGATGCAGAG (positions 1,362-1,379) and reverse primerTAGATGCCATAGATGAGGAGA (positions 1,640-1,620) (acrossthe rod end intron) were used. The PCR product of 278 bp was char-acterized by restriction analysis.

SDS-PAGE and western blotTotal protein was extracted from neonatal skin in SDS-PAGE samplebuffer. Gel electrophoresis was performed by standard procedures(8% gel). The proteins were electrotransferred to nitrocellulosemembranes (Immobilon, Millipore Eschborn, Germany) according tothe method of Towbin et al. (1979). Membranes were blocked in 1%FCS in TBS with Tween-20 (TBST) according to the method of Porteret al. (1996). The primary antibody LH1 was used neat and LH2, LH3and DEK10 were diluted 1:100. For detection we used an alkalinephosphatase-conjugated rabbit anti-mouse antibody, 1:1,000 (Dako,Bucks, UK).

RESULTS

Identification of keratin 10TThe previous analysis of keratin 10 knockout mice had estab-lished the absence of intact K10 by immunofluorescence andsensitive western blotting. During more detailed immunoflu-orescence analysis of various stratified epithelia from homo-zygous pups we noted a persistent reactivity of the monoclonalantibody DEK10 specific for K10. The presence of K1 albeitreduced in homozygotes indicated that a type I keratin might bepresent because otherwise it should be degraded in the absence

of a type I partner keratin (Kulesh et al., 1989; Magin et al.,1990). As expected DEK10 also stained the upper epidermis ofheterozygotes and normal mice (Fig. 1). Western blotting oftotal protein extracts from neonatal epidermis was carried outwith several monoclonal antibodies directed against K10.RKSE 60 (not shown, Porter et al., 1996) and LH1 recognizedonly intact K10 while LH2, LH3 and DEK10 in addition to theintact K10 reacted with a polypeptide of molecular mass 24kDa, presumably a truncated K10 polypeptide (Fig. 2). It wasconcluded that the epitopes for RKSE 60 and LH1 are locatedin the carboxy-terminal part of K10. Inspection of the targetingconstruct showed that K10T comprised the 230 amino-terminalresidues of K10 in good agreement with the observed molecularmass of K10T on SDS-PAGE gels.

Interestingly K10 was also present in cytoskeletal extractsindicating that the head, coil 1A and 27 amino acids of coil 1Bwere sufficient to form insoluble higher order structures witha type II keratin, most likely K1 (see below). The presumptiveK10T was isolated from 2-D gels and subjected to proteinmicrosequencing. The sequence obtained from two trypticpeptide fragments confirmed the identity of the 24 kDapolypeptide with the murine K10 coil 1A and 1B sequences(Fig. 3A). Additionally DNA sequence analysis of an RT-PCR


Fig. 3. Identification of K10T mRNA and corresponding polypeptidein the K10 transgenic mice. (A) The results from microsequencing ofthe isolated presumptive K10T peptide from 2-D gels showedsequence identities in rod segments 1A and 1B. (B) cDNA sequenceof K10T. The start of exons 2 and 8 is indicated by arrowheads, theprimer sequences are marked by arrows.

product verified the presence of a mRNA coding for K10T inhetero- and homozygous mice and clearly demonstrated thefusion between exons 2 and 8 (Fig. 3B).

Localization of K6 in diseased epidermisA remarkable observation in EH is the increased expression ofK6 and 16 in groups of suprabasal keratinocytes. In normalneonatal murine trunk epidermis K6/16 are restricted to theouter root sheath cells of hair follicles (Fig. 4A). Heterozygousnewborn K10 mice expressed considerable amounts of K6 andK16 in suprabasal cells (Fig. 4B). The strong K6 staining waseven more extensive and evenly distributed among allsuprabasal layers in homozygous mice (Fig. 4C). Interestinglythe sites of maximal keratin 6 expression coincided with sitesof cytolysis in homozygotes (Fig. 5A). On the other hand het-erozygotes that do still express a normal K10 allele neverdeveloped cytolysis. Induction of K6 started in some but notall upper spinous keratinocytes of K10 knockout mice whileK1/10T was distributed evenly from the lower spinous celllayer onwards as shown by double immunofluorescence (Fig.5). We also noted a generally increased cell size in the spinousand granular keratinocytes of mutant K10 mice. Despite the

concomitant expression of K10T and K1, the vast majority ofIF in the spinous layer was intact and showed a normal distri-bution with IF attached to desmosomes (data not shown). Thisprompted us to study in greater detail the relationship betweenK6/16 and residual K1/10T in order to understand why theadditional keratins 6/16 were unable to provide sufficientstability to K10-deficient epidermis.

Localization of suprabasal and hyperproliferativekeratins by immunogold electron microscopyElectron micrographs of normal and homozygous (not shown)neonate epidermis indicated the presence of IF in typicalarrangement found in murine skin (Fig. 6). IF in basal cells didnot stain with immunogold labelled antibodies against K1/10(Ks 8.60) or K10 (RKSE 60, data not shown), in agreementwith the established keratin expression pattern (Moll et al.,1982). In epidermis of wild-type mice the rare occurrence ofkeratin aggregates alongside parallel filament bundles wasnoted (Fig. 6B). There was no evidence for nuclear keratinaccumulation (Bader et al., 1991). In the cytoplasm of granularkeratinocytes of homozygous mice we observed the accumu-lation of light and dark electron dense amorphous clumps ofvarious size and shape (Figs 7 and 8). The light aggregatesaccumulated at desmosomes or were scattered throughout thecytoplasm. They displayed a distinct reaction with immuno-gold-labelled specific antibodies directed against K10T andwere, therefore, defined as keratin granules. Most of keratin 6was detected in dark electron-dense granules (Figs 7B, 8B)later identified as keratohyalin granules (KHG, see below).Additional short tufts of K6-positive filaments were foundelsewhere in the cytoplasm or emanating from KHGs. Keratinclumps were at places still interconnected with short filament-like structures (Fig. 7A) and decorated almost exclusively withanti K10T. Despite the attachment of massive keratin 1/10T-positive clumps to desmosomes, the latter appeared normal(Fig. 8A). In cytolysed cells, however, split desmosomes wereobserved (not shown). Suprabasal keratins persisted well intothe cornified layer (Fig. 8C,D) in agreement with biochemicaldata (Mack et al., 1993).

The lack of keratin 10 causes additional changes inthe upper epidermisIn addition to the increased expression of K6/16 we foundchanges in the expression of filaggrin and K2e contributing tothe extraordinary fragility of the epidermis in K10 knockoutmice. The typical distribution of profilaggrin starting as finegranules in the upper spinous layer and extending to largerstellate aggregates in the granular layer is depicted in Fig. 6A.Heterozygous and even more homozygous K10 neonatesdisplayed a strong increase in filaggrin as demonstrated byimmunofluorescence analysis (Fig. 4D-F). This would suggestan inverse relationship between the amount of K1/10 filamentsand that of filaggrin. Using anti-filaggrin antibodies the darkelectron-dense aggregates were identified as KHG (Fig. 9A-C).As mentioned before, KHG were also positive for K6 (Figs 7B,8B) often surrounded by the light electron-dense K10T-positiveclumps (Fig. 9A,B). Outside KHG, small filaggrin-positivearrays were found next to short filament arrays. Preliminary dataindicate that the barrier function of the epidermis as measuredby transepidermal water loss was impaired as a consequence ofthe keratin 10 knockout (J.-M. Jensen et al., unpublished).


Fig. 4. Immunodetection of K6 in neonatal back skin epidermis. In the wild-type (A) K6 is only seen in the hair follicle outer root sheath whereits expression is known to occur constitutively. In heterozygotes the specific staining extended to suprabasal single cells and cell patches (B)while in homozygous epidermis K6 was present in the entire suprabasal layer (C). Immunodetection of filaggrin in neonatal paw sole revealedan increased labelling of the granular layer in heterozygous pups (E) and an immense increase in the homozygous littermates (F) in comparisonto the sparse labelling of the wild-type (D). Bar, 72 µm.

The importance of a balanced keratin expression for thefunction of a proper epidermis was underlined by the changesin paw sole where the additional keratins 2e and 9 areexpressed. As described for the human footsole epidermis(Collin et al., 1992a,b) we identified K2e in normal neonateepidermis where its expression is confined to isolated groupsof lower suprabasal cells located apical from the dermal ridges(Fig. 10). This is in contrast to earlier findings from Schweizeret al. (1987) who by in situ hybridization could detect K2e onlyin postnatal epidermis from day 5 on. Much to our surprise thestaining for K2e was lost completely in homozygous pups andreduced slightly in heterozygous neonates. Using RT-PCR oftotal paw RNA we detected the K2e mRNA in wild-type andhomozygous mice. We concluded that the loss of K2e inhomozygotes is a post-transcriptional event, reflecting mostlikely proteolysis of the K2e polypeptide in the absence of apartner (Kulesh et al., 1989). In adults K2e expression in het-

erozygotes was comparable to that in wild-type mice. K9expression was low and restricted to single granular ker-atinocytes in normal mice and not changed in K10 knockoutmice (not shown). Interestingly paw epidermis was one of themost fragile body sites in K10 knockout mice (inset in Fig.10C). We concluded that K2e is an essential keratin whoseabsence together with that of K10 renders foot sole epidermisextremely susceptible to mechanical stress.

DISCUSSION

The role of keratins 6 and 16 expression in skinfragilityEpidermolytic hyperkeratosis is caused by mutations inkeratins 1 or 10. The dominant inheritance of this disorder hasbeen explained by the incorporation of mutant keratins into

Fig. 5. Double-labelimmunofluorescence analysis ofK6 and K1/10T expression inpaw sole epidermis ofhomozygous CK10 knockoutpups. Both keratins were foundsuprabasally although CK6 isabsent from the lowermostspinous cells (A) while K1/10Twere expressed in allkeratinocytes but the basal cells(B). Bar, 80 µm.


Fig. 6. Electron microscopy. (A) Survey of wild-type neonatal epidermis (kh: keratohyalin granule, arrowheads: L-granules in the cytoplasmand nucleus, arrow: dermo-epidermal junction). Higher magnifications of stratum granulosum (B) and stratum spinosum (C) demonstrated thepresence of K10 in bundles (B,C) and densely packed aggregates (B) of keratin filaments (mAb K8.60, 5 nm and 10 nm gold). Bars: 5 µm (A);200 nm (B,C).

keratin polymers, causing skin fragility, acanthosis and hyper-keratosis in a dominant-negative fashion (Cheng et al., 1992;Chipev et al., 1992; McLean et al., 1994a; Rothnagel et al.,1992). This is in agreement with in vitro data where purifiedmutant keratin subunits interfered with ordered filamentassembly and also with cell transfection experiments (Albersand Fuchs, 1987, 1989; Coulombe and Fuchs, 1990; Hatzfeldand Weber, 1992) whereby the overexpression of mutant butalso of normal keratin subunits can cause the collapse ofexisting IF (Blessing et al., 1989). In order to understand themore complex in vivo situation we would like to propose thatskin fragility is not only caused by the dominant-negativelyacting keratin 10T (or point mutated keratins in disorders likeEH) but also by the particular properties of the newly expressedkeratin pair 6/16 (Paladini et al., 1996) and its interaction withassociated proteins. Additional keratin changes like the loss ofK2e have to be considered as well. This is based on thefollowing findings:

Keratin 6 (and K16/17, see Porter et al., 1996) was stronglyexpressed in the suprabasal epidermis of K10 knockout mice,starting in some but not all spinous keratinocytes and becameprominent in the granular layer. K1/10T at the same time wasdistributed evenly in all spinous cells. Remarkably the sites ofcytolysis coincided well with sites of maximal keratin 6/16/17expression in homozygotes. On the other hand, the vast

majority of IF in the spinous layer was intact and showed anormal distribution with IF attached to desmosomes despite theexpression of K10T. It is worth noting that in heterozygoteswhich showed lower and patchy expression of K6 and do stillhave one normal K10 allele cytolysis was never observed. Thisfinding is not consistent with a general dominant-negativeaction of K10T as proposed by the promiscuity hypothesis ofHatzfeld and Franke (1985). It could be explained if K10Twould pair only with K1 but not with other keratins (K5/14)present in the same cell.

Our immunogold EM analysis confirmed that neitherK1/10T nor K6/16 were present as extended IF but insteadformed two distinct types of aggregates in granular cells. K10Tpositive clumps were represented by light roundish aggregatesin the cytoplasm or attached to desmosomes whereas darkaggregates reacted only with anti-K6. These aggregates werealways separated from those containing K1/10T and mostlycolocalized with keratohyalin. Additional K6 labelling wasfound elsewhere in the cytoplasm as short filament tufts butnever on extended IFs. Paladini et al. (1996) also reported thatkeratin combinations containing K16 were unable to formtypical IF in transgenic mice or in transfected cells.

The EM data confirmed that different keratins formeddistinct pairs, namely K6 with its partners K16 and 17 and K1with K10T. Future biochemical experiments will be required


Fig. 7. Electron microscopy of back skin epidermis of homozygous K10 knockout mice. Light electron-dense filament aggregates abundant instratum granulosum as well as in stratum spinosum (not shown) were labelled with the K10/10T specific antibody DEK10 (A). Filamentbundles in the lower spinous layer that appeared regular (C) were not decorated with gold particles (mAb DEK10, 5 nm and 10 nm gold). Thesefilament bundles probably originated from the basal layer and presumably consisted of K5 and 14. Double immunogold labelling for K10 (mAbDEK10, 5 nm gold) and K6 (mAb 693-1, 12 nm gold) revealed that the light electron-dense keratin aggregates contained K10T whereas K6labelling was predominantly found at the dark electron-dense keratohyalin granules (B). Bars, 200 nm.

to explore whether K1 would form IF with K16 and/or K10with K6. Beside numerous aggregates decorated with K6 orK10T a few intact filament bundles which remained unlabelledwere detected in granular cells. They most likely consisted ofK5/14.

Our findings as well as the neoexpression of K6 and 16 intransgenic mice overexpressing either a truncated human K1or human K14/10 hybrid in the suprabasal epidermis (Bicken-bach et al., 1996; Fuchs et al., 1992; Rothnagel et al., 1993;Takahashi et al., 1994, 1995) suggest that cytolysis is a conse-quence of two complementing mechanisms: The depletion ofnormal K1/10 IF seems to weaken the interaction between ker-atinocytes mediated through desmosomes. In addition, keratins6 and 16 were shown to be unable to form stable extended IF(Paladini et al., 1996; Takahashi et al., 1994) and to interactwith desmosomes as efficiently as other keratins do. Thegreater extent of cell fragility in homozygotes indicates that athreshold amount of intact K1 and 10 is required to maintain

cellular integrity. An interesting observation in K10 knockoutmice was the consistently increased size of granular ker-atinocytes. In the light of the finding from Ingber’s lab(Maniotis et al., 1997), suggesting that mechanical signals canbe transmitted via the cytoskeleton, it is conceivable that theobserved change in keratinocyte shape may lead to intracellu-lar signalling.

The presence of K6/16 in the normal cytoskeleton of palmarepidermis might argue against their possible negative influenceon the stability of suprabasal keratinocytes. There are,however, several important considerations. Several active K6genes with unknown expression domains (Takahashi et al.,1995) give rise to similar but not identical proteins with poten-tially different filament-forming abilities. Also, in plantarepidermis K6/16 are expressed de novo together with otherkeratins while in EH they are expressed on top of a preexist-ing cytoskeleton. That might influence their intracellular dis-tribution and interaction (for such changes see: Chan et al.,


1994; Rugg et al., 1994). Finally the amount of K6/16 inplantar epidermis might be small relative to other keratinscompared to the situation in K10 knockout mice or in EH.

The loss of K2e in paw epidermis occurs post-transcriptionally and reveals the limits of keratinpairingKeratins 2e and 9 are two specialized keratins with anexpression domain confined to the upper spinous and granular

Fig. 8. EM analysis of the upper epidermis of homozygous K10 knockouwere mostly absent. (A) The desmosomal structure and number appearedinstead of proper tonofilament bundles only keratin aggregates were assonm and 10 nm gold) while K6 was localized to keratohyalin granules (mnm and 10 nm gold) and K6 (D) localized to corneocytes in the stratum

layer of stratified epithelia in humans (Collin et al., 1992a,b)and were suggested to sustain mechanical stress particularlywell. In contrast to previous in situ hybridization results sug-gesting a delayed K2e expression in mice commencing in thefirst postnatal week (Herzog et al., 1994; Rentrop et al., 1987)we have detected K2e in neonatal paw epidermis, using aspecific antibody. This most likely reflects the increased sensi-tivity of immunofluorescence compared to in situ hybridiz-ation. In humans, point mutations in K2e lead to ichthyosis

t mice. In the granular layer normal intermediate filament bundles to be normal as compared to the wild-type (not shown), thoughciated with them. These aggregates contained K10T (mAb DEK10, 5Ab 693-1, 5 nm and 12 nm gold) (B). Both K10T (C; mAb DEK10, 5corneum. Bars, 200 nm.


Fig. 9. Electron microscopy of profilaggrin/filaggrin in the upperepidermis of homozygous K10 knockout mice. Immunogoldlabelling revealed a dense labelling of keratohyalin granules (A-C)while the cytoplasm showed only few gold particles and keratinaggregates were not decorated (A and B, higher magnification).Bars, 200 nm.


Fig. 10. Immunodetection of K2e in neonatal paw sole. In wild-type paw sole epidermis K2ewas expressed exclusively in suprabasal cells apical to the dermal ridges (A). K2e wasreduced in heterozygous K10 knockout pups (B) and lost in homozygotes (C). The inset in Cshows the paw sole of a homozygous pup which had lost the upper epidermis completely.Bar, 72 µm. (D) Detection of K2e mRNA among total RNA from paw epidermis by RT-PCR.Lane 1: size marker (100 bp ladder). Lane 2: RT-PCR product synthesized from RNA ofnormal neonatal mice. Lane 3: negative control. Lane 4: RT-PCR product synthesized fromRNA of K10 homozygous mice. The size of PCR fragments is 278 bp. An arrowheadindicates the position of the 300 bp size marker.

bullosa of Siemens which is already manifest at birth (McLeanand Lane, 1995; McLean et al., 1994b) in agreement with theearly onset of K2e expression in mice. In neonatal wild-typemice the expression of K2e was restricted to small groups ofspinous and lower granular cells apical from the dermal ridgesbut extended throughout the corresponding cell layer in adultmice. One might speculate that mechanical stress in the pawcould lead to an increase of K2e seen in later life. An influenceof mechanical stress on specific gene expression has beenshown to act in cardiomyocytes (Komuro et al., 1990, 1991;Yamazaki et al., 1993). Most recent observations indicated thatmolecules of the cytoskeleton may be involved in signal trans-duction (Chen and Grinnell, 1995; Maniotis et al., 1997). Thiscould indicate novel functions of keratins worthwile to explore.The unexpected loss of K2e in homozygous paw epidermissuggests that it is a major partner of K10. As we have shownby RT-PCR the K2e mRNA is present at comparable levels inhomozygous and normal mice. Most likely K2e is beingdegraded due to the lack of its type I partner K10. Alterna-tively, translational control mechanisms might be in place assuggested for the human K6 mRNA (Tyner and Fuchs, 1986).At the same time K9 expression, albeit low in mouse comparedto humans persisted (Langbein et al., 1993; Schweizer et al.,1989), strongly suggesting that K2e and 9 are not partners invivo. It can be inferred that K1 and K9 are in vivo partners.Probably K1 has a higher affinity to K10T in paw epidermisleaving K2e ready for degradation (Kulesh et al., 1989; Maginet al., 1990).

Keratohyalin granules interact with keratin 6 but notwith keratin 1 and 10T in homozygous K10 knockoutmiceIn EH patients an increased filaggrin expression and accumu-lation of abnormal keratohyalin granules have been described(Holbrook et al., 1983; Ishida-Yamamoto et al., 1994; Wei-denthaler et al., 1993). As shown by immunofluorescence

microscopy filaggrin expression was clearly increased inkeratin 10 knockout mice adding another feature of thedisorder to those reproduced in our mouse model. Immunogoldelectron microscopy showed that the majority of keratin 1/10Tclumps in homozygous mice did not colocalize with kerato-hyalin. Surprisingly much of K6 was embedded in keratohyalingranules. Outside these granules only very little filaggrin wasdetected, mostly attached to short tufts of keratin. This couldeither reflect the lack of an intact keratin cytoskeleton to whichfilaggrin normally binds or to a delayed conversion of pro-filaggrin to filaggrin. Given the recent biochemical dataproposing that filaggrin’s glycine loops interact with thecoiled-coil domain of keratins in an ionic zipper mode (Macket al., 1993) our EM data seem to confirm the requirement ofintact heterodimeric coiled-coils like those present in K6/16but largely absent in K1/10T.

An intact keratin cytoskeleton seems to be a prerequisite forthe formation of a normal cornified envelope where keratinsand filaggrin were identified by chemical cross-linking (Salihet al., 1985; Steinert and Marekov, 1995). The consequencesof disrupted keratin filaments are reflected morphologically bythe vastly thickened cornified layer and functionally by the lossof the water barrier function in K10 knockout mouse epidermis(J.-M. Jensen et al., unpublished), consistent with similarobservations in EH patients (Fine, 1986; Frost and Van Scott,1966). It will be interesting to analyze the barrier lipids in K10knockout mice.

In summary we have shown that the increase in K6/16expression in K10 knockout mice does not compensate for thelack of K1/10 IF. We speculate that the phenotype of K10knockout mice and probably of EH patients is not only causedby the presence of dominant-negative keratin subunits but addi-tionally by the poor filament-forming quality of keratins 6 and16. The selective pairing of K10T and the loss of K2e indicatethat in vivo keratins are less promiscuous than in vitro.Moreover, the various keratins seem to associate with different


affinities to desmosomes and filaggrin. Finally, an intact keratincytoskeleton seems to be required for the formation of a func-tional cornified layer.

We are very grateful to Prof. Klaus Weber for microsequencing theK10T peptide. We also thank Profs Leigh and Yuspa and DrsLangbein and Blessing for generous antibody gifts. Supported by SFB284 (V.H. and T.M.M), Bonner Forum Biomedizin (V.H. and T.M.M.),Fonds der Chemischen Industrie (V.H.) and the Wellcome Trust(R.M.P. and E.B.L.).

REFERENCES

Albers, K. and Fuchs, E. (1987). The expression of mutant epidermal keratincDNAs transfected in simple epithelial and squamous cell carcinoma lines. J.Cell Biol. 105, 791-806.

Albers, K. and Fuchs, E. (1989). Expression of mutant keratin cDNAs inepithelial cells reveals possible mechanisms for initiation and assembly ofintermediate filaments. J. Cell Biol. 108, 1477-1493.

Bader, B. L., Magin, T. M., Freudenmann, M., Stumpp, S. and Franke, W.W. (1991). Intermediate filaments formed de novo from tail-less cytokeratinsin the cytoplasm and in the nucleus. J. Cell Biol. 115, 1293-1307.

Bickenbach, J. R., Longley, M. A., Bundman, D. S., Dominey, A. M.,Bowden, P. E., Rothnagel, J. A. and Roop, D. R. (1996). A transgenicmouse model that recapitulates the clinical features of both neonatal andadult forms of the skin disease epidermolytic hyperkeratosis. Differentiation61, 129-139.

Blessing, M., Jorcano, J. L. and Franke, W. W. (1989). Enhancer elementsdirecting cell-type specific expression of cytokeratin genes and changes ofthe epithelial cytoskeleton by transfection of hybrid cytokeratin genes.EMBO J. 8, 117-126.

Bonifas, J. M., Matsumura, K., Chen, M. A., Berth-Jones, J., Hutchinson,P. E., Zloczower, M., Fritsch, P. O. and Epstein, H. E. Jr (1994). Mutationsof keratin 9 in two families with palmoplantar epidermolytic hyperkeratosis.J. Invest. Dermatol. 103, 474-477.

Brocq, L. (1902). Erythrodermie congenitale ichthyosiforme avechyperepidermotrophie. Ann. Dermatol. Syphilol. (Paris) 4, 1-31.

Chan, Y.-m., Anton-Lamprecht, I., Yu, Q.-C., Jäckel, A., Zabel, B., Ernst,J.-P. and Fuchs, E. (1994). A human keratin 14 ‘knockout’: the absence ofK14 leads to severe epidermolysis bullosa simplex and a function for anintermediate filament protein. Genes Dev. 8, 2574-2587.

Chen, B.-M. and Grinnell, A. D. (1995). Integrins and modulation oftransmitter release from motor nerve terminals by stretch. Science 269, 1578-1580.

Cheng, J., Syder, A. J., Yu, Q.-C., Letai, A., Paller, A. S. and Fuchs, E.(1992). The genetic basis of epidermolytic hyperkeratosis: a disorder ofdifferentiation-specific epidermal keratin genes. Cell 70, 811-819.

Chipev, C. C., Korge, B. P., Markova, N., Bale, S. J., DiGiovanna, J. J.,Compton, J. G. and Steinert, P. M. (1992). A leucine – proline mutation inthe H1 subdomain of keratin 1 causes epidermolytic hyperkeratosis. Cell 70,821-828.

Collin, C., Moll, R., Kubicka, S., Ouhayoun, J.-P. and Franke, W. W.(1992a). Characterization of human cytokeratin 2, an epidermal cytoskeletonprotein synthesized late during differentiation. Exp. Cell. Res. 202, 132-141.

Collin, C., Ouhayoun, J.-P., Grund, C. and Franke, W. W. (1992b).Suprabasal marker proteins distinguishing keratinizing squamous epithelia:cytokeratin 2 polypeptides of oral masticatory epithelium and epidermis aredifferent. Differentiation 51, 137-148.

Coulombe, P. A. and Fuchs, E. (1990). Elucidating the early stages of keratinintermediate filament assembly. J. Cell Biol. 111, 153-169.

Dale, B. A., Holbrook, K. A. and Steinert, P. M. (1978). Assembly of stratumcorneum basic protein and keratin filaments in macrofibrils. Nature 276, 729-731.

Fine, J. D. (1986). Epidermolysis bullosa. Int. J. Dermatol. 25, 143-157.Franke, W. W., Schiller, D. L., Hatzfeld, M. and Winter, S. (1983). Protein

complexes of intermediate-sized filaments: melting of cytokeratin complexesin urea reveals different polypeptide separation characteristics. Proc. Nat.Acad. Sci. USA 80, 7113-7117.

Franke, W. W., Schiller, D. L., Hatzfeld, M., Magin, T. M., Jorcano, J. L.,Mittnacht, S., Schmid, E., Cohlberg, J. A. and Quinlan, R. A. (1984).Cytokeratins: complex formation, biosynthesis, and interactions with

desmosomes. In Cancer Cells 1: The Transformed Phenotype (ed. A. J.Levine, G. F. Vande Woude, W. C. Topp and J. D. Watson), pp. 177-190. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY.

Frost, P. and Van Scott, E. J. (1966). The ichthyosiform dermatoses.Classification based on anatomic and biometric observations. Arch.Dermatol. 94, 113-126.

Fuchs, E. and Green, H. (1980). Changes in keratin gene expression duringterminal differentiation of the keratinocyte. Cell 19, 1033-1042.

Fuchs, E., Esteves, R. A. and Coulombe, P. A. (1992). Transgenic miceexpressing a mutant keratin 10 gene reveal the likely genetic basis forepidermolytic hyperkeratosis. Proc. Nat. Acad. Sci USA 89, 6906-6910.

Fuchs, E. (1994). Intermediate filaments and disease: Mutations that cripplecell strength. J. Cell Biol. 125, 511-516.

Fuchs, E. (1996). The cytoskeleton and disease: Genetic disorders ofintermediate filaments. Annu. Rev. Genet. 30, 197-231.

Hatzfeld, M. and Franke, W. W. (1985). Pair formation and promiscuity ofcytokeratins: Formation in vitro of heterotypic complexes and intermediate-sized filaments by homologous and heterologous recombinations of purifiedpolypeptides. J. Cell Biol. 101, 1826-1841.

Hatzfeld, M. and Weber, K. (1992). A synthetic peptide representing theconsensus sequence motif at the carboxy-terminal end of the rod domaininhibits intermediate filament assembly and disassembles preformedfilaments. J. Cell Biol. 116, 157-166.

Herzog, F., Winter, H. and Schweizer, J. (1994). The large type II 70-kDakeratin of mouse epidermis is the ortholog of human keratin K2e. J. Invest.Dermatol. 102, 165-170.

Holbrook, K. A., Dale, B. A., Sybert, V. P. and Sagebiel, R. W. C. (1983).Epidermolytic hyperkeratosis: ultrastructure and biochemistry of skin andamniotic fluid cells from two affected fetuses and a newborn infant. J. Invest.Dermatol. 80, 222-227.

Ishida-Yamamoto, A., Eady, R. A. J., Underwood, R. A., Dale, B. A. andHolbrook, K. A. (1994). Filaggrin expression in epidermolytic ichthyosis(epidermolytic hyperkeratosis). Br. J. Dermatol. 131, 767-779.

Komuro, I., Kaida, T., Shibazaki, Y., Kurabayashi, M., Katoh, Y., Hoh, E.,Takaku, F. and Yazaki, Y. (1990). Stretching cardiac myocytes stimulatesprotooncogene expression. J. Biol. Chem. 265, 3595-3598.

Komuro, I., Katoh, Y., Kaida, T., Shibazaki, Y., Kurabayashi, M., Hoh, E.,Takaku, F. and Yazaki, Y. (1991). Mechanical loading stimulates cellhypertrophy and specific gene expression in cultured rat cardiac myocytes. J.Biol. Chem. 266, 1265-1268.

Kulesh, D. A., Cecena, G., Darmon, Y. M., Vasseur, M. and Oshima, R. G.(1989). Posttranslational regulation of keratins: degradation of mouse andhuman keratins 18 and 8. Mol. Cell. Biol. 9, 1553-1565.

Langbein, L., Heid, H. W., Moll, I. and Franke, W. W. (1993). Molecularcharacterization of the body site-specific human epidermal cytokeratin 9:cDNA cloning, amino acid sequence, and tissue specificity of geneexpression. Differentiation 55, 57-71.

Mack, J. W., Steven, A. C. and Steinert, P. M. (1993). The mechanism ofinteraction of filaggrin with intermediate filaments: The ionic zipperhypothesis. J. Mol. Biol. 232, 50-66.

Magin, T. M., Jorcano, J. L. and Franke, W. W. (1983). Translationalproducts of mRNAs coding for non-epidermal cytokeratins. EMBO J. 2,1387-1392.

Magin, T. M., Bader, B. L., Freudenmann, M. and Franke, W. W. (1990). Denovo formation of cytokeratin filaments in calf lens cells and cytoplasts aftertransfection with cDNAs or microinjection with mRNAs encoding humancytokeratins. Eur. J. Cell Biol. 53, 333-348.

Maniotis, A. J., Chen, C. S. and Ingber, D. E. (1997). Demonstration ofmechanical connections between integrins, cytoskeletal filaments andnucleoplasm that stabilize nuclear structure. Proc. Nat. Acad. Sci USA 94,849-854.

McLean, W. H. I., Eady, R. A. J., Dopping-Heppenstal, P. J. C., McMillan,J. R., Leigh, I. M., Navsaria, H. A., Higgins, C., Harper, J. I., Paige, D. G.,Morley, S. M., et al. (1994a). Mutations in the rod 1A domain of keratins 1and 10 in bullous congenital ichthyosiform eythroderma (BCIE). J. Invest.Dermatol. 102, 24-30.

McLean, W. H. I., Morley, S. M., Lane, E. B., Eady, R. A. J., Griffiths, W. A.D., Paige, D. G., Harper, J., Higgins, C. and Leigh, I. M. (1994b).Ichthyosis bullosa of Siemens – a disease involving keratin 2e. J. Invest.Dermatol. 103, 277-281.

McLean, W. H. I. and Lane, E. B. (1995). Intermediate filaments in disease.Curr. Opin. Cell Biol. 7, 118-125.

Ming, M. E., Daryanani, H. A., Roberts, L. P., Baden, H. P. and Kvedar, J.C. (1994). Binding of keratin intermediate filaments (K10) to the cornified


envelope in mouse epidermis: Implications for barrier function. J. Invest.Dermatol. 103, 780-784.

Moll, R., Franke, W. W., Schiller, D. L., Geiger, B. and Krepler, R. (1982).The catalog of human cytokeratins: Patterns of expression in normal epitheliatumors and cultured cells. Cell 31, 11-24.

Paladini, R. D., Takahashi, K., Bravo, N. S. and Coulombe, P. A. (1996).Onset of re-epithelialization after skin injury correlates with a reorganizationof keratin filaments in wound edge keratinocytes: defining a potential role forkeratin 16. J. Cell Biol. 132, 381-397.

Paul, D. L. (1995). New functions for gap junctions. Curr. Opin. Cell Biol. 7,665-672.

Porter, R. M., Leitgeb, S., Melton, D. W., Swensson, O., Eady, R. A. J. andMagin, T. M. (1996). Gene targeting at the mouse cytokeratin 10 locus:severe skin fragility and changes of cytokeratin expression in the epidermis.J. Cell Biol. 132, 925-936.

Quinlan, R. A., Schiller, D. L., Hatzfeld, M., Achtstätter, T., Moll, R.,Jorcano, J. L., Magin, T. M. and Franke, W. W. (1985). Pattern ofexpression and organization of cytokeratin intermediate filaments. Ann. NYAcad. Sci. 455, 282-306.

Reis, A., Hennies, H., Langbein, L., Digweed, M., Mischke, D., Drechsler,M., Schröck, E., Royer-Pokora, B., Franke, W. W., Sperling, K., et al.(1994). Keratin 9 gene mutations in epidermolytic palmoplantarkeratoderma. Nat. Genet. 6, 174-179.

Rentrop, M., Nischt, R., Knapp, B., Schweizer, J. and Winter, H. (1987). Anunusual type-II 70-kilodalton keratin protein of mouse epidermis exhibitingpostnatal body-site specificity and sensitivity to hyperproliferation.Differentiation 34, 189-200.

Roop, D. R., Hawley-Nelson, P., Cheng, C. K. and Yuspa, S. H. (1983).Keratin gene expression in mouse epidermis and cultured epidermal cells.Proc. Nat. Acad. Sci USA 80, 716-720.

Rothnagel, J. A., Dominey, A. M., Dempsey, L. D., Longley, M. A.,Greenhalgh, D. A., Gagne, T. A., Huber, M., Frenk, E., Hohl, D. andRoop, D. R. (1992). Mutations in the rod domains of keratins 1 and 10 inepidermolytic hyperkeratosis. Science 257, 1128-1130.

Rothnagel, J. A., Greenhalgh, D. A., Wang, X.-J., Sellheyer, K.,Bickenbach, J. R., Dominey, A. M. and Roop, D. R. (1993). Transgenicmodels of skin diseases. Arch. Dermatol. 129, 1430-1436.

Rugg, E. L., McLean, W. H. I., Lane, E. B., Pitera, R., McMillan, J. R.,Dopping-Hepenstal, P. J. C., Navsaria, H. A., Leigh, I. M. and Eady, R.A. J. (1994). A functional ‘knockout’ for human keratin 14. Genes Dev. 8,2563-2573.

Salih, M. A. M., Lake, B. D., El Hag, M. A. and Atherton, D. J. (1985).Lethal epidermolytic epidermolysis bullosa: a new autosomal recessive typeof epidermolysis bullosa. Br. J. Dermatol. 113, 135-143.

Schermer, A., Jester, J. V., Hardy, C., Milano, D. and Sun, T.-T. (1989).Transient synthesis of K 6 and K 16 keratins in regenerating rabbit cornealepithelium: keratin markers for an alternative pathway of keratinocytedifferentiation. Differentiation 42, 103-110.

Schweizer, J., Fürstenberger, G. and Winter, H. (1987). Selective

suppression of two postnatally acquired 70-kDa and 65-kDa keratin proteinsduring continuous treatment of adult mouse tail epidermis with vitamin A. J.Invest. Dermatol. 89, 125-131.

Schweizer, J., Baust, J. and Winter, H. (1989). Identification of murine type Ikeratin 9 (73-kDa) and its immunolocalization in neonatal and adult mousefoot sole epidermis. Exp. Cell. Res. 184, 193-206.

Stark, H.-J., Breitkreutz, D., Limat, A., Bowden, P. and Fusenig, N. E.(1987). Keratins of the human hair follicle: ‘Hyperproliferative’ keratinsconsistently expressed in outer root sheath cells in vivo and in vitro.Differentiation 35, 236-248.

Steinert, P. M., Cantieri, J. S., Teller, D. C., Lonsdale-Eccles, J. D. and Dale,B. A. (1981). Characterization of a class of cationic proteins that specificallyinteract with intermediate filaments. Proc. Nat. Acad. Sci. USA 78, 4097-4101.

Steinert, P. M. and Marekov, L. N. (1995). The proteins elafin, filaggrin,keratin intermediate filaments, loricrin, and small proline-rich proteins 1 and2 are isodipeptide cross-linked components of the human epidermal cornifiedcell envelope. J. Biol. Chem. 270, 17702-17711.

Takahashi, K., Folmer, J. and Coulombe, P. A. (1994). Increased expressionof keratin 16 causes anomalies in cytoarchitecture and keratinization intransgenic mouse skin. J. Cell Biol. 127, 505-520.

Takahashi, K., Paladini, R. D. and Coulombe, P. A. (1995). Cloning andcharacterization of multiple human genes and cDNAs encoding highlyrelated type II keratin isoforms. J. Biol. Chem. 270, 18581-18592.

Takahashi, K. and Coulombe, P. A. (1996). A transgenic mouse model withan inducible skin blistering disease phenotype. Proc. Nat. Acad. Sci USA 93,14776-14781.

Towbin, H., Staehelin, T. and Gordon, J. (1979). Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets. Procedure andsome application. Proc. Nat. Acad. Sci. USA 76, 4350-4354.

Traupe, H. (1989). The epidermolytic (acanthokeratolytic) ichthyoses. In TheIchthyoses (ed. H. Traupe), pp. 139-153. Springer-Verlag, Berlin.

Tyner, A. L. and Fuchs, E. (1986). Evidence for posttranscriptional regulationof the keratins expressed during hyperproliferation and malignanttransformation in human epidermis. J. Cell Biol. 103, 1945-1955.

Weidenthaler, B., Hausser, I. and Anton-Lamprecht, I. (1993). Is filaggrinreally a filament-aggregating protein in vivo? Arch. Dermatol. Res. 285, 111-120.

Weiss, R. A., Eichner, R. and Sun, T.-T. (1984). Monoclonal antibodyanalysis of keratin expression in epidermal diseases: A 48- and 56-kdaltonkeratin as molecular markers for hyperproliferative keratinocytes. J. CellBiol. 98, 1397-1406.

Yamazaki, T., Tobe, K., Hoh, E., Maemura, K., Kaida, T., Komuro, I.,Tamemoto, H., Kadowaki, T., Nagai, R. and Yazaki, Y. (1993).Mechanical loading activates mitogen-activated protein kinase and S6peptide kinase in cultured rat cardiac myocytes. J. Biol. Chem. 268, 12069-12076.

(Received 24 May 1997 – Accepted 8 July 1997)

out of balance: consequences of a partial keratin 10 knockout

Documents