on interdisciplinary science: catalyst for...

HUMBOLDT KOLLEG

On Interdisciplinary Science:

Catalyst for Sustainable Progress

September 4-6, 2014 NIAS Auditorium, IISc Campus

ABSTRACT BOOK

1

Scope of the Kolleg

The progress of science has had a profound effect on our lives and the world as a whole. There is, however, a realization that many of the advances could have been achieved in a much improved manner if the solutions were built on an interdisciplinary approach. In such a case, the benefits derived from progress of science in one area would have led to lesser conflicts in another area. Therefore, “sustainability” has increasingly become central point of public discourse for science in the new millennium. Basic scientists need to have an understanding of the realities of the environment and the context of their discoveries. Without this realization, discoveries made in one laboratory have to be buffered by discoveries made at other laboratories to maximize the benefits and minimize the pitfalls. The most desirable situation would be when scientists work together to design their discoveries and inventions in a multidisciplinary environment where there is a common goal to adopt approaches and methodologies that give best outcomes. In this context, academia, government and industry are increasingly convinced that current problems in areas such medicine, ecology, and energy, research questions are best addressed through an interdisciplinary approach. However, relevant training, formation of a good research team, funding and evaluation are challenges that are common across the world, including India. Hence, we have undertaken to organize a three day Kolleg on “Interdisciplinary science: catalyst for sustainable progress” with Humboldtians, eminent scientists, engineers and clinicians from India and Germany to deliberate various aspects of Interdisciplinary endeavors, such as energy and materials, chemical biology, computational science and interdisciplinary thinking to increase the awareness and possibilities of an interdisciplinary collaborating environment, and foster establishment of multidisciplinary network. Researchers contributing directly or indirectly in the mentioned areas or working at the interface of two or more areas will be involved in the meeting. It is expected that the Kolleg will create a platform for the participants to learn about cutting-edge research developments which requires interdisciplinary approach, draft recommendations for future research, and network with Humboldtians and eminent scientists and German scholars to strengthen interdisciplinary collaborations for sustainable progress and robust scientific endeavors.

2

Program

Page # Time Description

Day 1, 4th September, 2014 (Thursday) 8:00-9:00 Registration 9:00-9:15 Inauguration

9:15-10:30 Informative sessions for young researchers from AvH (Dr. Rekha VaidyaRajan), DAAD (Shikha Sinha/Shilpa Pandeshwar), DFG (Dr. AlexanderHansen, Krishnan Hariharan, Sangeetha R. Parthasarathi)

10:30-11:00 Tea Break

10-16

11:00-15:30

Session (Forenoon): Chemical Biology (Chairperson: S. Chandrasekaran)

10-11 11:00-11:45 Keynote 1: "Thyroid Hormones for Health - Impact of trace elements and endocrine disrupters on their synthesis, metabolism and action" by Josef Köhrle, Humboldt University, Berlin

12 11:45-12:15 Invited Lecture 1: "Glycochemical Synthesis and its Significance inMycobacteriology" by Srinivas Hotha, Indian Institute of ScienceEducation and Research, Pune

13 12:15-12:45 Invited Lecture 2: "Interfering with Interference: targeting the microRNA using small molecules" by Souvik Maiti, Institute of Genomics and Integrative Biology, New Delhi

12:45-14:00 Lunch Session (Afternoon): Chem. Biology (Chairperson: A. R. Chakravarty)

14 14:00-14:30

Invited Lecture 3: "In search of potential inhibitors of human malaria parasite Plasmodium falciparum in vitro and in vivo: a Chemical Biology approach" by Suman Kumar Dhar, Jawaharlal Nehru University, New Delhi

15 14:30-15:00

Invited Lecture 4: "Phytohormone ABA signaling controls intracellular calcium-mediated secretion and egress of merozoites in P. falciparum and a good target for limiting parasite growth" by Shailja Singh, Shiv Nadar University, Uttar Pradesh

16 15:00-15:30 Invited Lecture 5: "Interaction between Aβ and Aβ-inhibitor peptide with tubulin/microtubule" by Surajit Ghosh, Indian Institute of Chemical Biology, Kolkata

15:30-16:00 Tea/Coffee Break

29 16:00-16:45 Keynote Lecture 2 (Computational Biology): "Brain function across scales" by Upinder S. Bhalla, National Centre for Biological Sciences, Bangalore

3


16:45-17:15 Interdisciplinary Junior Researcher Session

45 16:45-17:00 Junior Researcher Lecture 1: “Base Pair Specific DNA Probe: Implicationsin Efficient Parasite Detection in Human Erythrocytes” by NagarjunNarayanaswamy, JNCASR Bangalore

60 17:00-17:15 Junior Researcher Lecture 2: “Laser assisted hatching of cleavage stageembryos” by Sachin D. Honguntikar, Kasturba Medical College, Manipal

39-79 17:15-19:00 Poster Session (Contributed by Junior Researchers)

18:00-19:00 Meeting of the Indian Humboldt Club Presidents 19:00 Dinner at NIAS

Day 2, 5th September, 2014 (Friday)

17-20 9:00-11:45 Session: Medicine and Technology (Chairperson: A. J. Rao)

17 9:00-9:45 Keynote 3: "Nematodes and Sepsis: A relationship waiting to beharnessed?" by Balachandran Ravindran, Institute of Life Sciences, Bhubaneshwar

18 9:45-10:15 Invited Lecture 6: "Hemoglobin structure function correlation in livinghuman Red Blood Cells probed by isotope exchange based MassSpectrometry" by Amit Mandal, St. Johns Research Institute, Bangalore

19 10:15-10:45 Invited Lecture 7: “Spectrum of GALNS Mutations in India” by Girisha K.M., Kasturba Medical College, Manipal


20 11:15-11:45 Invited Lecture 8: “Translating experimental approach to clinical practiceto improve Infertility success" by Pratap Kumar, Kasturba MedicalCollege, Manipal

21-24 11:45-15:00 Session: Interdisciplinary Thinking (Chairperson: N. Marehalli)

21 11:45-12:20 Invited Lecture 9: "Interdisciplinary thinking: Perspectives from the

History of Life Sciences" by Christina Brandt, Ruhr-University, Bochum

22 12:20-12:55 Invited Lecture 10: "Cross Disciplines: Exciting Possibilities" by AshokSahni, INSA Emeritus

12:55-13:50 Lunch 23 13:50-14:25

Invited Lecture 11: "Music and Technology" by Vikram Sampath, IndiraGandhi National Centre for the Arts, Bangalore

24 14:25-15:00 Invited Lecture 12: "Language Studies: Through the lens of Rashomon" byVanamala Vishwanatha, Azim Premji University, Bangalore

4


25-28 15:00-17:45 Session: Computational Science (Chairperson: G. D. V. Gowda)

25 15:00-15:45 Keynote Lecture 4: "Turbulent Flows and their Numerical Simulation" byVolker John, WIAS Berlin


26 16:15-16:45 Invited Lecture 13: "Challenges in Computing Hyperbolic ConservationLaws" by J. C. Mandal, IIT Bombay

27 16:45-17:15 Invited Lecture 14: "Meshless CFD in Aerospace Engineering" by N.Balakrishnan, IISc Bangalore

28 17:15-17:45

Invited Lecture 15: "A Generalized analysis for wave and energy balanceequations during microwave propagations within food dielectrics ofvarious shapes" by T. Basak, IIT Madras

80 18:00-19:00 Cultural Program 19:00 Banquet Dinner

Day 3, 6th September, 2014 (Saturday) Plenary Lecture

9 9:00-10:00 "What Can We Learn From Insect Societies?" by Raghavendra Gadagkar, President, Indian National Science Academy, New Delhi

30-32 10:00-12:45 Session: Computational Biology (Chairperson: Manju Bansal)

30 10:00-10:30 Invited Lecture 16: "Combining Biology and Computing: Challenges and Opportunities" by Ramesh Hariharan, Strand Life Sciences, Bangalore


31 11:00-11:30 Invited Lecture 17: "Analysis of protein structures - identification of anew turn, and redefining the buried surface area in complexes" by PinakChakrabarti, Bose Institute, Kolkata

32 11:30-12:00 Invited Lecture 18: "Microscopic Structure of DNA Nanotubes" by Prabal Maiti, IISc Bangalore

12:00-12:45 Interdisciplinary Junior Researcher Session

46 12:00-12:15 Junior Researcher Lecture 3: “Amino acid racemases: Novel regulators of Salmonella pathogenesis” by Namrata Iyer, IISc Bangalore

71 12:15-12:30 Junior Researcher Lecture 4: “Do not Call Me α, I am π-helix” by Prasun Kumar, IISc Bangalore

5


74 12:30-12:45 Junior Researcher Lecture 5: “Metal nanoparticle immobilized on metal-organic frameworks (MOFs) for heterogeneous catalysis” by BappadityaGole, IISc Bangalore

12:45-13:45 Lunch 33-36 13:45-16:00 Session: Materials and Energy (Chairperson: E. D. Jemmis)

33 13:45-14:30 Keynote Lecture 5: "Electrochemical Energy Systems: MaterialsChallenges" by S. Sampath, IISc Bangalore

34 14:30-15:00 Invited Lecture 19: "Tailored light emitting organic nanoaggregates from

π-conjugates oligomers" by Arne Luetzen, University of Bonn

35 15:00-15:30 Invited Lecture 20: "H2O → H2 + O2" Abhishek Dey, Indian Association for the Cultivation of Science, Kolkata

36 15:30-16:00 Invited Lecture 21: "Light Harvesting Soft-Hybrids" by Subi J. George, JNCASR Bangalore


37-38 16:30-17:30 Sub-Session: Water (Chairperson: M. S. Mohan Kumar)

37 16:30-17:00 Invited Lecture 23: "Sustainable Wastewater Management: Challengesand Way Forward" by Ligy Philip, IIT Madras

38 17:00-17:30

Invited Lecture 22: "Climate Change and its Impact on Water Resources of a River Basin" by D. Nagesh Kumar, IISc Bangalore

17:30 Discussion and Closing Remarks

6

Poster Index

Page Title Author(s)

Chemical Biology

40 Targeted delivery of cytotoxic metal complexes to cancer cells using gold nanoparticles

Anup K. Pramanik, Siddik Uzzaman, Kumaravel Somasundaram, Ashoka G. Samuelson

41 Deiodination of Thyroxine by Deiodinase Mimics: Nature of Chalcogen Atom Alters the Regioselectivity

K. Raja, G. Mugesh

42 Synthesis of Hybrid Cyclic Peptoids and Identification of Autophagy Enhancer

K. Rajasekhar, N. Narayanaswamy, Piyush Mishra, S. N. Suresh, Ravi Manjithaya, T. Govindaraju

43 Photocytotoxic Ferrocenyl-Terpyridine Platinum(II) Complexes

Koushambi Mitra

44 Biomimetic molecular organization of naphthalene diimide in the solid state: tunable (chiro-) optical, viscoelastic and nanoscale properties

M. Pandeeswar, H. Khare, S. Ramakumar, T. Govindaraju

45 Base Pair Specific DNA Probe: Implications in Efficient Parasite Detection in Human Erythrocytes

Nagarjun Narayanaswamy, Manoj Kumar, Sadhan Das, Rahul Sharma, Suman K. Dhar, Tapas. K. Kundu, T. Govindaraju

46 Amino acid racemases: Novel regulators of Salmonella pathogenesis

Namrata Iyer, Dipshikha Chakravortty

47 Cellular changes in oocytes of Swiss albino mice subjected to repeated superovulation

Neetha Nirupama Jathanna, Deepthi Dhanya, Ramya Nair, Sujith Raj Salian, Guruprasad Kalthur, Satish Kumar Adiga

48

Microbial production of a solvent, metal ion, detergent and oxidizing agent tolerant amylase using Pongamia pinnata cake meal as substrate by solid state fermentation

Pankajam Thyagarajan, Amitabha Das, Geetha Bali

49 Reactivity of [RuHCl(CO)(PNP)] (PNP = PhCH2N (CH2CH2PPh2)2) Complex with Electrophilic Reagents X-OTf (X = H, Me3Si and Me)

Ramaraj A, Balaji R. Jagirdar

50 ER-targeted photochemotherapeutics: remarkable photocytotoxicity in visible light of oxovanadium(IV) vitamin-B6 complex

Samya Banerjee

7


51

Identification of a potent inhibitor of enoyl ACP reductase FabI from Burkholderia pseudomallei - Crystal structure, Mode of Action and Biological Activity

Sarah Joseph, Anirudha Lakshminarasimhan, Narasimha Rao, K, Swathi U. Lekshmi, Lau Xiang, Mohammed Takhi, K. Sreenivas, Shiela Nathan, Rohana Yusof, Noorsaadah A. Rehman, Thomas Antony, Subramanya H.

52 Carbohydrate Appended Iron Complexes for Tumor Targeting and Photocytotoxicity in Red Light

Uttara Basu

53 Potential Economic Impact of Biofortified Maize in Indian Poultry Sector

Vijesh V. Krishna, Olaf Erenstein, Prakash Sadashivappa, B. S. Vivek

Medicine and Technology

55 Effect of Streptomycin on testicular function in adult Swiss albino mice

Amratha D. Prabhu, Ramya Nair, Sandhya Kumari, Guruprasad Kalthur, Satish Kumar Adiga

56 Modulation of preimplantation embryo metabolism in response to genotoxic stress: An NMR based non invasive approach

Fiona D’Souza, Shivanand M. Pudakalakatti, Shubhashree Uppangala, Sujit Raj Salian, Guruprasad Kalthur, Hanudatta S. Atreya, Satish Kumar Adiga

57 Alcoholic extract of Moringa oleifera leaves ameliorates cyclophosphamide induced testicular toxicity and tragenerational changes in mice

Guruprasad Nayak, Aarti Vadinkar, Guruprasad Kalthur, Satish Kumar Adiga

58 Sperm derived factors enhances the developmental potential of mouse parthenotes

Ramya Nair, Shahin Aboobacker, Pallavi K. Shetty, Srinivas Mutalik, Guruprasad Kalthur, Satish Kumar Adiga

59 Laser assisted hatching of cleavage stage embryos impairs developmental potential and increases genetic instability in blastocysts

Sachin D. Honguntikar, Shubhashree Uppangala, Sujith R. Salian, Guruprasad Kalthur, Satish Kumar Adiga

60 Influence of sperm DNA fragmentation on human preimplantation embryo metabolism

Shubhashree Uppangala, Shivananda Pudakalakatti, Fiona D’Souza, Sujith Raj Salian, Guruprasad Kalthur, Pratap Kumar, Hanudatta Atreya, Satish Kumar Adiga

8


61 Biotin enhances sperm motility in human semen samples and developmental potential of mouse embryos

Sujith Raj Salian, Sandesh Patel, Shruthi Gowda, Yashashwini Shenoy, Sandhya Patil, Guruprasad Kalthur, Satish Kumar Adiga

Computational Science

63 Optimal Design of Wave Energy Conversion System Abdus Samad, Rameez Badhurshah

Computational Biology

65 DNA elasticity from short DNA to nucleosomal DNA Ashok Garai, Suman Saurabh, Prabal K. Maiti

66 Molecular basis for nucleocytoplasmic transport of tRNA by Exportin-t

Asmita Gupta, Senthilkumar Kailasam, Manju Bansal

67 Intrinsic variations in the structure of spacer regions can critically influence transcription

Arvind Marathe, Prasun Kumar, Manju Bansal

68 Comparison of Accuracy for Exact and Heuristic Alignment of Next Generation Sequencing Data for Clinical SNP Detection of Complex Diseases

Baban Wagh, Debnath Pal

69 A Graph-Theoretical Approach to the Identification of T cell Epitopes

Chandan Raychaudhury, Debnath Pal

70 Study of Protein Kinetics Dibyajyoti Maity

71 Do not Call Me α, I am π-helix Prasun Kumar, Manju Bansal

72 Protein dynamics and function correlation using a new knowledge based coarse grained force field

Pratiti Bhadra, Debnath Pal

Materials and Energy

74 Metal nanoparticle immobilized on metal-organic frameworks (MOFs) for heterogeneous catalysis

Bappaditya Gole

75-76 Self-Assembly of [2 + 2] Metallamacrocycles using Semi-rigid Diplatinum (II) Acceptor and Their Fluorescence Sensing of Nitroaromatic Explosives

Bijan Roy, Sankarasekaran Shanmugaraju, Rupak Saha, Partha Sarathi Mukherjee

77 Influence of nucleophilicity of the N-heterocyclic carbene ligands on the elongation of H-H bond in ruthenium(II) complexes

Deep Mala, Balaji R. Jagirdar

78 Synthesis and Mechanistic study of metal nanosponge formation

Sourav Ghosh, Balaji R. Jagirdar

79 Pillar[n]arene in Host-Guest Chemistry Suvankar Dasgupta, Partha Sarathi Mukherjee

9

PLENARY LECTURE

Gadagkar ‘Insect Societies’

What Can We Learn From Insect Societies?

Raghavendra Gadagkar

Centre for Ecological Sciences, Indian Institute of Science Bangalore, 560012, India

E-mail: [email protected]

URL: http://ces.iisc.ernet.in/hpg/ragh

Abstract

Many species of insects organize themselves into groups with social organization, division of labour, communication, coordination, cooperation and conflict paralleling and sometimes surpassing human societies. Why do these insects organize themselves into societies and how they manage to achieve such sophisticated social organization are both fundamental questions. Benefits of group living and decentralized self-organization are emerging as the two fundamental principles that might help answer these questions. Unsurprisingly, understanding these complex and fascinating societies appear impossible without an interdisciplinary approach. Somewhat more surprisingly however, such understanding appears to yield significant benefits for our own society. In this lecture I will introduce some ant, bee and wasp societies and attempt to span fields such as natural history, mathematical modelling, synthetic organic chemistry, sustainable agriculture and robotics to give flavours both of the interdisciplinarity required to study them as well as the benefits that might accrue by doing so.

10

Köhrle ‘Thyroid, Trace Elements & Endocrine Disrupters’

Thyroid Hormones for Health – Impact of trace elements and endocrine disrupters on their synthesis, metabolism and action

Josef Köhrle

Institut für Experimentelle Endokrinologie & Endokrinologisches Forschungs-Centrum der Charité EnForCé; Charité Universitätsmedizin Berlin, Campus Virchow-Klinikum

Humboldt-Universität zu Berlin Augustenburger Platz 1, D-13353 Berlin, Germany

Email: [email protected]

Keywords: Thyroid Hormone, Iodine, Selenium, Iron, Transporter, Selenoprotein, Endocrine Disrupter, Drug, Thyroid Disease.

Abstract Thyroid hormones (TH) regulate development, differentiation, growth, body temperature, energy metabolism, anabolic and catabolic reactions in vertebrates including humans. Adequate supply of the essential trace elements iodine, selenium, iron and zinc is required for normal synthesis, transport, metabolism and action of TH in developing, adult and aging healthy or diseased individuals. Trace element deficiency and inadequate caloric intake still are a world-wide problem affecting almost two thirds of our planet’s population and resulting in TH- dependent inadequate intellectual IQ, delayed physical development and impaired health. TH synthesis requires efficient accumulation of iodide into the angiofollicular functional units of the highly vascularized thyroid gland. Iodide organification and TH synthesis is catalyzed by the hemoprotein thyroperoxidase (TPO) and involves life-long enzymatic production of the TPO co-substrate and strong oxidant H2O2. Selenocysteine-containing enzymes (thioredoxin reductases and glutathione peroxidases) control thyroid redox state and act as thyroid antioxidant defense. The iodinated and charged amino-acid derived TH need TH transmembrane transporters for thyroidal secretion and uptake by their target cells. Availability of TH for their intracellular nuclear, mitochondrial and membrane receptors is locally controlled by 3 deiodinase selenoenzymes. We solved the crystal structure of deiodinase 3 catalytic domain, structurally similar to atypical 2-Cys peroxiredoxins, providing first insight into reductive deiodination mechanism. We identified several classes of inhibitors of TPO, TH serum binding proteins, TH transporters and deiodinases, which might be promising leads for new antithyroid drugs. Humans are widely exposed to endocrine disrupters which disturb thyroid axis via nutrition, daily life products and environmental contaminants. References (1). Wirth, E.K., Schweizer, U. & Köhrle J. (2014). Transport of thyroid hormone in brain. Front. Endocrinol. (Lausanne). 5, 98. (2). Schweizer, U., Schlicker, C., Braun, D., Köhrle, J. & Steegborn, C, (2014). Crystal structure of mammalian selenocysteine-dependent iodothyronine deiodinase suggests a peroxiredoxin-like catalytic mechanism. Proc. Natl. Acad. Sci. USA. 111, 10526-10531.

11

(3). Murk, A.J., Rijntjes, E., Blaauboer, B.J., Clewell, R., Crofton, K.M., Dingemans, M.M., Furlow, J.D., Kavlock, R., Köhrle, J., Opitz, R., Traas, T., Visser, T.J., Xia, M. & Gutleb, A.C (2013). Mechanism-based testing strategy using in vitro approaches for identification of thyroid hormone disrupting chemicals. Toxicol. In Vitro 27, 1320-1346. (4). Rijntjes, E., Scholz, P.M., Mugesh, G. & Köhrle, J. (2013). Se- and S-based thiouracil and methimazole analogues exert different inhibitory mechanisms on type 1 and type 2 deiodinases. Eur. Thyroid. J. 27, 252-258.

12

Hotha et al. ‘Glycochemical Synthesis and its Significance in Mycobacteriology’

Glycochemical Synthesis and its Significance in Mycobacteriology

Shivaji A. Thadke, Bijoyananda Mishra, Venkateswara Rao Boddu, Maidul Islam and Srinivas

Hotha

Department of Chemistry Indian Institute of Science Education and Research

Pune – 411 008, Maharashtra, India


Keywords: Oligosaccharides, Glycochemistry, Synthesis, Tuberculosis, Arabinan

Abstract Mycobacterium tuberculosis is the etiological agent that causes tuberculosis, a disease that kills millions every year. Occurrence of tuberculosis in humans can be traced back to pre- medieval times and Robert Koch observed that M. tuberculosis has a thick waxy cell wall which could be one of the factors for its survival in the presence of drugs. Indeed, some of the front line drugs that are used in the clinic actually inhibit the cell wall biosynthesis. Pioneering efforts from Brennan group resulted into the unravelling of the fine structure of mycobacterial cell wall. Importantly, MTb cell wall contains both arabinose, galactose in furanosyl form and there are two major parts viz. Lipoarabinomannan (LAM) and Arabinogalactan (AG). Additionally, the terminal residues of AG are esterified with cyclopropane containing mycolic acids. These unique and characteristic features and biological significance enticed many to develop strategies for the synthesis of them. However, synthesis of oligofuranosides is still a daunting task due to the absence of strong stereoelectronic effects. Our group discovered the use of gold(III) chemistry for the glycosidation using alkynalated sugars as glycosyl donors. Several glycopyranosyl donors had undergone gold-catalyzed glycosidation to synthesize glycomimetics, glycopolyacrylates, glycopolyacrylamides, glycopolypeptides etc. which are otherwise very difficult to synthesize.

In this presentation, our efforts toward the synthesis of full length arabinogalactan will be discussed with special emphasis on the development of a diagnostic tool for the detection of non-pulmonary MTb infections exploiting mycobacterial cell envelop molecules.

13

Maiti ‘microRNA and small molecules’

Interfering with Interference: targeting the microRNA using small molecules

Souvik Maiti1,2

1CSIR-Institute of Genomics and Integrative Biology, Mathura Road, Delhi 110025

2CSIR-National Chemical Laboratory, Dr. Homi Bhabha Road, Pune 411008, India

Email: [email protected] Abstract MicroRNAs (miRNAs) play crucial roles in regulating gene expression in many cellular contexts. Deregulation of miRNAs has been implicated in a number of disease conditions and thus, methods that can modulate mature miRNA levels in cells can have immense therapeutic potential. We describe a simple in vitro screening method using a DNA based molecular beacon which overcomes the limitations associated with earlier screens. We used this method to identify inhibitors of miR27a function from a library of 14 aminoglycosides as a pilot study. With this proof of concept study we illustrate the utility of a scalable molecular beacon based screening strategy for miRNA inhibitors. We also screened this library to test their inhibitory capacity to silence another oncomir, miR-21. We found that streptomycin was able to do so by structural perturbation of the process of dicing giving it a potential new indication as a candidate anticancer agent. Subsequently, we show that cyclic peptides and naphthyridine are the promising scaffolds to develop small molecules that can selectively inhibit miRNA function.

References (1). Nahar, S., Bose, D., Kumar Panja, S., Saha, S. & Maiti S. (2014). Anti-cancer therapeutic potential of quinazoline based small molecules via global upregulation of miRNAs. Chem. Commun. (Camb) 50, 4639-42. (2). Bose, D., Jayaraj, G. G., Kumar, S. & Maiti, S. (2013). A Molecular-Beacon-Based Screen for Small Molecule Inhibitors of miRNA Maturation. ACS Chem. Biol. 17, 930-938. (3). Suryawanshi, H., Lalwani, M. K., Ramasamy, S., Rana, R., Scaria, V., Sivasubbu, S. & Maiti, S. (2012). Antagonism of microRNA function in zebrafish embryos by using locked nucleic acid enzymes (LNAzymes). Chembiochem 13, 584-589. (4). Bose, D., Jayaraj, G., Suryawanshi, H., Agarwala, P., Pore, S. K., Banerjee, R. & Maiti, S. (2012). The tuberculosis drug streptomycin as a potential cancer therapeutic: inhibition of miR- 21 function by directly targeting its precursor. Angew. Chem. Int. Ed. Engl. 51, 1019-1023. (5). Kaur, H., Scaria, V. & Maiti, S. (2010). “Locked onto the target”: increasing the efficiency of antagomirzymes using locked nucleic acid modifications. Biochemistry 49, 9449-9456. (6). Suryawanshi, H., Scaria, V. & Maiti, S. (2010). Modulation of microRNA function by synthetic ribozymes. Mol. Biosyst. 10, 1807-1809. (7). Jadhav, V. M., Scaria, V. &Maiti, S. (2009). Antagomirzymes: oligonucleotide enzymes that specifically silence microRNA function. Angew. Chem. Int. Ed. Engl. 48, 2557-2560.

14

Dhar et al. ‘Inhibitors of malarial parasite’

In search of potential inhibitors of human malaria parasite Plasmodium falciparum in vitro and in vivo: a Chemical Biology approach

Srikanta Dana1, Dhaneswar Prusty1, Devender Dhayal2, Rahul Sharma1, Tridibesh Adak2, T.

Govindaraju3 and Suman Kumar Dhar1

1Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi 110067 2National Institute of Malaria Research, New Delhi 110067

3Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore 560064, India

Email: [email protected], [email protected]

Abstract Malaria kills more than one million people worldwide each year. It is extremely important to find new antimalarials. P. falciparum contains high AT-rich genome (~80%) and upon infection in the erythrocyte, parasite specific uptake pathways for nutrients and solutes are activated. These two features can be exploited for screening and synthesis of parasite specific drugs. Here we report, the potent antimalarial activity of Acriflavine (ACF) which is a mixture of trypflavine and proflavine. ACF is known as antibacterial agent and more recently as an anticancer agent. Interestingly, ACF inhibits both chloroquine (CQ) sensitive and resistant strains of P. falciparum in-vitro at low nanomolar concentration. ACF also clears the parasites from the mice infected with P. berghei. We find that ACF is accumulated in the parasitized red blood cells (RBCs) possibly using parasite specific transporters. Enzymatic activities of apicoplast specific PfGyrase protein and DNA replication foci formation in the parasites are affected in the presence of ACF. We further show that inhibitory effect of ACF may be attributed to its affinity towards DNA which in turn affects DNA mediated pathways like DNA replication and transcription in the parasites. Use of ACF as a combinatorial therapy may be found useful in the backdrop of high incidences of drug resistant malaria strains. Further, we have developed a fluorescent probe that binds preferentially to AT-rich DNA and kills P. falciparum parasites at low micromolar concentration without any effect on mammalian cells suggesting the potential of using AT-rich DNA binding probes for anti-malarial activity.

15

Singh ‘Limiting parasite growth’

Phytohormone ABA signaling controls intracellular calcium-mediated secretion and egress of merozoites in P. falciparum and a good target for

limiting parasite growth

Shailja Singh Department of Life Sciences

Shiv Nadar University, Gautam Budh Nagar Uttar Pradesh 203207

India


Keywords: Malaria, blood stage, abscisic acid, calcium

Abstract Egress of Plasmodium falciparum by rupture of infected red blood cells (RBCs) leads to release of invasive parasites into the bloodstream for subsequent reinvasion into new host cells and proliferation. The egress event is a highly coordinated multistep process, which is initiated at precise time upon maturation of invasive merozoites. Recent studies highlight a key role of intracellular calcium in regulation of egress of merozoites by inducing discharge of parasite protease and perforin like protein that trigger the degradation of parasite and host membranes. While the Ca2+ regulation of the egress of P. falciparum in erythrocytes is well established, the trigger for intracellular Ca2+ in parasite egress is poorly understood. This study analyzed the involvement of phytohormone abscisic acid (ABA) in rise of intracellular free Ca2+ in infected RBC during the egress of merozoites. The production of ABA in parasite was confirmed by detection of ABA in the lysates of intra-erythrocytic merozoites of schizont stage P. falciparum using HPLC and LC-MS. Selective disruption of ABA synthesis was observed in schizonts by the treatment of ABA biosynthesis pathway inhibitor fluridone (FLU). Distruption of ABA synthesis by the FLU blocked parasite egress and addition of ABA rescued the egress of merozoites. Further, addition of exogenous ABA triggered intracellular Ca2+ in late stage schizonts indicating that ABA induces release of Ca2+ from parasite intracellular Ca2+ stores similar to as reported for other apicomplexan. The inhibition of ABA production by treatment of FLU inhibited the discharge of perforin like protein to the limiting membrane and premeabilization. These results indicate that ABA serves as the major signal that triggers discharge of PfPLP1 from micronemes a step critical to egress of merozoites, by trigerring intracellular calcium in mature schizonts. The plant like nature of ABA production pathway can be explored to target for inhibiting the egress process and limiting the growth of malaria parasites.

16

Ghosh ‘Interaction of inhibitor with microtubule’

Interaction between Aβ and Aβ-inhibitor peptide with tubulin/microtubule

Surajit Ghosh Chemistry Division

CSIR-Indian Institute of Chemical Biology Kolkata 700 032

West Bengal, India

Email: [email protected] Keywords: Alzheimer disease, Aβ peptide, Amyloid inhibitor peptide, cancer, tubulin, microtubule

Abstract Patients suffering from Alzheimer’s (AD) and cancer diseases are extremely rare (1). AD is a chronic neurodegenerative disease with a deposition of amyloid-β proteins (Aβ) and neurofibrillary tangles causes loss of memory (2). Proteolytic cleavage of the transmembrane amyloid precursor protein (APP) during cell metabolism produced Aβ peptide (3, 4). Cancer is the cause of uncontrolled cell division (5). Eukaryotic cell division controlled by many important players, among them microtubules is a crucial cytoskeleton proteins formed by polymerization of αβ- tubulin heterodimer. Microtubules are dynamic in nature and a key target for anticancer drugs. Because of this contrasting fact exploring the link between these two diseases is extremely important. The key players from these two diseases are Aβ peptide and tubulin/microtubule. This presentation will focus on two aspects first, how Aβ peptide interacts with tubulin/microtubule and caused apoptotic death of breast cancer cell line MCF7, second, a short amyloid inhibitor peptide, which inhibits the fibrillation process of Aβ, but simultaneously form fibrillar structure alone and interacts with tubulin/microtubule lattice three times stronger than known microtubule associated protein (6).

References (1) Demetrius, L. A. & Simon, D. K. (2013). The inverse association of cancer and Alzheimer's: a bioenergetic mechanism. J. R. Soc. Interface 10, 20130006. (2) Hardy, J. (2006). A hundred years of Alzheimer's disease research. Neuron. 52, 3-13. (3) Barrow, C, J. & Zagorski, M. G. (1991). Solution structures of beta peptide and its constituent fragments: relation to amyloid deposition. Science 253, 179-182. (4) La Ferla, F. M., Green, K. N. & Oddo, S. (2007). Intracellular amyloid-beta in Alzheimer's disease. Nat. Rev. Neurosci. 8, 499-509. (5) Hanahan, D. & Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70. (6) Biswas, A., Kurkute, P., Jana, B., Laskar, A. & Ghosh, S. (2014). An amyloid inhibitor octapeptide forms amyloid type fibrous aggregates and affects microtubule motility. Chem. Commun. 50, 2604-2607.

17

Ravindran ‘Nematodes and sepsis’

Nematodes and Sepsis: A relationship waiting to be harnessed?

B. Ravindran

Institute of Life Sciences (An autonomous Institute under Department of Biotechnology)

Bhubaneswar, India

Email: [email protected], [email protected] Abstract Endotoxin (LPS) is a major component of the outer membrane of Gram-negative bacteria and a critical factor in pathogenesis of sepsis. Development of antagonists that inhibit the storm of inflammatory molecules by blocking Toll like receptors (TLR) has been the main stay of research efforts. We report here that a filarial glycoprotein binds to murine macrophages and human monocytes through TLR4 and activates them through alternate pathway and in the process inhibits LPS mediated classical activation that leads to inflammation associated with endotoxemia. The active component of the nematode glycoprotein mediating alternate activation of macrophages was found to be a carbohydrate residue, Chitohexaose. Murine macrophages and human monocytes up regulated Arginase-1 and released high levels of IL-10 when incubated with chitohexaose. Macrophages of C3H/HeJ mice (non-responsive to LPS) failed to get activated by chitohexaose suggesting that a functional TLR4 is critical for alternate activation of macrophages also. Chitohexaose inhibited LPS induced production of inflammatory molecules TNF-α, IL-1β and IL-6 by macropahges in vitro and in vivo in mice. Intraperitoneal injection of chitohexaose completely protected mice against endotoxemia when challenged with a lethal dose of LPS. Furthermore, Chitohexaose was found to reverse LPS induced endotoxemia in mice even after its onset. Monocytes of subjects with active filarial infection displayed characteristic alternate activation markers and were refractory to LPS mediated inflammatory activation suggesting an interesting possibility of subjects with filarial infections being less prone to develop of endotoxemia. Chitohexose thus offers therapeutic promise for reprogramming inflammatory monocytes for clinical management of Sepsis.

18

Mandal et al. ‘Structure function’

Hemoglobin structure function correlation in living human Red Blood Cells probed by isotope exchange based Mass Spectrometry

Sreekala Narayanan, Gopa Mitra, Monita Muralidharan, Boby Mathew and Amit Kumar Mandal

Clinical Proteomics Unit, Division of Molecular Medicine, St. John’s Research Institute, St. John’s National Academy of Health Sciences, 100 ft Road, Koramangala,

Bangalore 560 034, Karnataka, India


Keywords: Hemoglobin, structure, function, in vivo, red blood cell (RBC), deuterium, mass spectrometry

Abstract To understand the complex mechanisms of different biological events, it is important to study the structure function correlation of proteins within cells. The conventional spectroscopic tools, e.g., X-ray crystallography, fluorescence, circular dichroism, NMR spectroscopy, used to visualize protein structure are mostly intrinsic chromophore specific that are identical across all proteins. Therefore structural studies are restricted to purified proteins in vitro, and these findings are extrapolated in cell to correlate their functions in vivo. However, due to cellular complexity, in vivo and in vitro environments are radically different. Previously, protein structure has been reported in-cell with genetically engineered or chemically modified proteins (Sakakibara et al., 2009; Koopmann et al., 2012; Ignatova and Gierasch, 2004; Ghaemmaghami and Oas, 2001) thereby diverting from its endogenous environment. Here we show a novel way to monitor the structural transition of human hemoglobin upon oxygen binding in living RBCs, using hydrogen/deuterium exchange based mass spectrometry (H/DX-MS). Using MALDI-MS, H/DX kinetics of peptide backbone amide hydrogens of hemoglobin in oxy and deoxy states was monitored in vivo. The obtained exchange parameters were analyzed using a built-in kinetic model to explore the conformational transition associated with oxygenation of hemoglobin inside RBC. The very high content of hemoglobin in RBC made it feasible to correlate the observed in vivo structural transition with the established in vitro literature. The novelty of present method lies in its applicability to investigate ligand/substrate binding, post-translational modification and folding of any protein inside a living cell irrespective of its location and structural complexity.

References (1). Ghaemmaghami, S. & Oas, T. G. (2001). Quantitative protein stability measurement in vivo. Nat. Struct. Biol. 8, 879-882. (2). Ignatova, Z. & Gierasch, L. M. (2004). Monitoring protein stability and aggregation in vivo by real-time fluorescent labeling. Proc. Natl. Acad. Sci. USA. 101, 523-528. (3). Koopmann, R. et al. (2012). In vivo protein crystallization opens new routes in structural biology. Nat. Methods 9, 259-262. (4). Sakakibara, D. et al. (2009). Protein structure determination in living cells by in-cell NMR spectroscopy. Nature 458, 102-105.

19

Girisha et al. ‘GALNS mutations in India’

Spectrum of GALNS Mutations in India

Abdul Mueed Bidchol,1 Ashwin Dalal,2 Hitesh Shah,3 Suryanarayana S,4 Sheela Nampoothiri,5 Madhulika Kabra,6 Neerja Gupta,6 Sumita Danda,7 Kalpana Gowrishankar,8 Shubha R Phadke,9

Seema Kapoor,10 Mahesh Kamate,11 IC Verma,12 Ratna Dua Puri,12 VH Sankar,13 A Radha Rama Devi,14 SJ Patil,15 Prajnya Ranganath,16 S Jamal Md Nurul Jain,2 Meenal Agarwal,9 Ankur Singh,10 Pallavi Mishra,6 Parag M Tamhankar,17 Puthiya Mundyat Gopinath,18 Nagarajaram HA,4 Kapaettu Satyamoorthy18 and Katta Mohan Girisha1 1Dept. Medical Genetics, Kasturba Medical College (KMC), Manipal University, Manipal, 2Diagnostics Division, Centre for DNA Fingerprinting & Diagnostics, Hyderabad, 3Pediatric Orthopedic Services, Dept. Orthopedics, KMC, Manipal University, Manipal, 4Laboratory of Comput. Biol. & Bioinf. Facility, Centre for DNA Fingerprinting & Diagnostics, Hyderabad, 5Dept. Pediatric Genetics, Amrita Institute of Medical Sciences & Research Center, Kochi, 6Genetics Unit, Dept. Pediatrics, All India Institute of Medical Sciences, New Delhi, 7Dept. Clinical Genetics, Christian Medical College, Vellore, 8Dept. Medical Genetics, Childs Trust Medical Research Foundation, Kanchi Kamakoti Childs Trust Hospital, Chennai, 9Dept. Medical Genetics, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, 10Dept. Pediatrics, Moulana Azad Medical College, New Delhi, 11Pediatric Neurology, KLE University JNMC, Belgaum, 12Center of Medical Genetics, Sir Ganga Ram Hospital, New Delhi, 13Genetic Clinic, Dept. Pediatrics, SAT Hospital, Government Medical College, Thiruvananthapuram, 14Genetic Division, Rainbow Children Hospital, Hyderabad, 15Naryana Hrudayalaya Institute of Medical Sciences, Bangalore, 16Department of Medical Genetics, Nizam’s Institute of Medical Sciences, Hyderabad, 17Genetic Research Centre, National Institute for Research in Reproductive Health, Mumbai, 18Division of Biotechnology, School of Life Sciences, Manipal University, Manipal, India


Keywords: Mucopolysaccharidosis, Morquio syndrome, GALNS, mutations

Abstract Mucopolysaccharidosis IV A (Morquio syndrome A, MPS IVA) is a lysosomal storage disease caused by the deficiency of N-acetylgalactosamine-6-sulfatase (GALNS). All the exons and the adjacent intronic regions of GALNS gene were amplified and sequenced in seventy-nine unrelated Indian families. We identified 153 mutant alleles comprising of 43 different mutations. We report twenty-two novel mutations that comprise of seventeen missense (p.Asn32Thr, p.Leu36Arg, p.Pro52Leu, p.Pro77Ser, p.Cys79Arg, p.His142Pro, p.Tyr191Asp, p.Asn204Thr, p.Gly188Ser, p.Phe216Ser, p.Trp230Cys, p.Ala291Ser, p.Gly317Arg, p.His329Pro, p.Arg386Ser, p.Glu450Gly, p.Cys501Ser), three splice-site variants (c.120+1G>C, c.1003- 3C>G, c.1139+1G>A), one nonsense mutation (p.Gln414*) and one frameshift mutation (p.Pro420Leufs*440). Twenty-one mutations have been reported earlier. We could not detect the second mutation in one family and in two other families no mutations were identified. The missense mutations p.Ser287Leu (8%), p.Phe216Ser (7.33%) and p.Asn32Thr (6.66%) were the most common mutations in Indian patients but were rare in the mutational profiles reported in other populations. These results indicate that the Indian patients may have a distinct mutation spectrum compared to those of other populations. Mutant alleles in exon 1, 7 and 8 accounted for 46% of the mutations, and sequencing of these first may be a cost-effective strategy. Mutations demonstrated a specific pattern of geographic distribution. Bioinformatics analysis predicts that all the novel mutations are pathogenic. This is one of the large studies on molecular analysis of patients with MPS IVA reported in the literature, and the first report from India. Molecular genetic methods were used for prenatal diagnosis of seven cases in seven families.

20

Kumar ‘Improving research for increasing pregnancy rates’

Translating experimental approach to clinical practice to improve Infertility success

Pratap Kumar Dept of Obstetrics & Gynecology

Kasturba Medical College Manipal University

Manipal 576104 Karnataka, India


Keywords: Research, pregnancy rates

Abstract In the recent years, basic scientists and clinicians recognize the importance of applying the discoveries directly from the bench to clinical practice through interdisciplinary collaborative approach. This process is frequently referred to as ‘translational research’. Despite the numerous developments, the field of Assisted Reproductive Technology (ART) today faces major challenges such as low rate of successful implantation (currently estimated as ~30%) and increased incidence of multiple pregnancies resulting from transfer of more than one embryo. Data have been emerging from both in vitro and in vivo experimental models in several aspects such as modulating ovarian response, improving the gamete and embryo, identifying the potential non-invasive markers to enhance implantation potential of the embryos. It is hoped that the further exploration of this line of research will allow the development of a more efficient protocols to derive functionally competent embryos and reduce the complications associated with ART.

21

Brandt ‘Interdisciplinary thinking’

Interdisciplinary thinking: Perspectives from the History of Life Sciences"

Christina Brandt Mercator Research Group “Spaces of Anthropological Knowledge”

Institute for Philosophy I, Ruhr University Bochum Universitaetsstraße 150, 44801 Bochum, Germany


Keywords: History of genomics, history of molecular biology, information concept

Abstract In this paper, I will discuss issues of interdisciplinarity from the perspective of the history of sciences. In the first part of the paper, two examples of interdisciplinary research and discussions from the history of 20th century sciences are given: The emergence of molecular biology and the origin of concepts of ‘genetic information’ and metaphors of genetic programs (1950s to 1970s) as well as the discussion about the information concept (and related notions of the genetic code as a ‘natural language’) from the perspective of scholars from linguistics and humanities in the 1960s and 1970s. The second part will discuss the implication of these historical cases for understanding also more recent developments: On the one hand, these cases show the productive epistemic role of interdisciplinary approaches, and they can raise the question whether the "discipline" (in a strict sense) is still a useful category to understand 20th century sciences. On the other hand, however, these case studies also exemplify the difficulties related to interdisciplinary work, for example, the use of different concepts and the development of different meanings of concepts in different research approaches.

References (1). Kay, L. (2000). Who wrote the Book of Life? A History of the Genetic Code, Stanford University Press. (2). García-Sancho, M. (2011). From metaphors to practices: the introduction of information engineers into the first DNA sequence database. History and Philosophy of the Life Sciences 33, 71-104. (3). Brandt, C. (2006). Genetic Code, Text, and Scripture: Metaphors and Narration in German Molecular Biology, Science in Context 18, 629-648. (4). Brandt, C. (2012). Stem Cells, Reversibility, and Reprogramming: Historical Perspectives, in: R. Mazzolini, H.-J. Rheinberger (eds): Differing Routes Towards Stem Cell Research: Germany and Italy (55-91) Berlin: Duncker & Humblot.

22

Sahni ‘Exciting possibilities across disciplines’

Cross Disciplines: Exciting Possibilities

Ashok Sahni Birbal Sahni Institute for Palaeobotany

98 Mahatma Gandhi Marg, Lucknow 226001, India

Email: [email protected] Abstract Many modern dating techniques such as tree ring analysis (dendrochronology) and stalagmite growth allow for a high resolution reconstruction of past climates for the last two millennia. It is now possible using this type of data to work out the chronology of major climatic events such as droughts, monsoon initiation, snow cover and temperature variations at the annual, decadal and century scales. Several studies have now emerged that wish to relate human dispersals around the globe, specifically invasions by conquering armies to climatic triggers such as prolonged droughts in their own regions or promise of bounty in more fertile lands. Here, though admittedly on shaky grounds, I still want to raise the issue that many of the invasions from Central Asia into medieval India starting around the 10th century AD were not merely for the fulfillment of imperial dreams, or for plain loot but may have had their roots in the fact that the climate in that part of the world changed from a wet phase to a dry one at about that time. Droughts have been common in Central Asia throughout the last millennium and feedback from traders using the ancient Silk Route about the perceived riches of South Asia may have ignited a desire for conquest. From about the 10th century AD onwards, repeated onslaughts were made through the Khyber Pass in what is now politically known as India and Pakistan. This exercise went on for another 500 years or so until Mughal rule was established in South Asia.

Below is an illustration from the Baburnamah that emphasizes how tropical diversity and richness near Peshawar and other places all along the major Panjab rivers must have appeared to those living in the parched barren lands of Afghanistan and beyond.

Reference: (1). Fagan, B. 2000. The Little Ice Age: How Climate Made History 1300-1850. Basic Books NY. 1-246.

Babur hunting Rhinoceros near Peshawar (Pakistan) 15 AD; Bounty of South Asia

The second and last issue that I (as a palaeontologist) wish to touch upon is on the making of a fossil. I wish to use this platform to convey to the participants the beauty and rarity of this phenomenon and perhaps to demystify the process of fossilization in the hope that scientists from other disciplines and other academics may give new perspectives and insights.

23

Sampath ‘Music and technology’

Music and Technology

Vikram Sampath Indira Gandhi National Centre for the Arts

Mallathahalli, Bangalore 560056, India


Keywords: Recording technology, gramophone, phonograph, classical music Abstract The curiosity of imprinting the human voice on a physical device and having it play back has fascinated mankind from time immemorial. It is this very eagerness that has spurred several scientific inventions over the centuries to evolve better and more convenient modes of recording technology. In this paper, I will explore some of these earliest attempts to record, reproduce and disseminate music (and in a way the human voice). Starting with the phonoautograph (1857), the paper mainly dwells on the early and successful attempts of the phonograph (1877) and gramophone (1888) and analyzes how technology impacted the manner in which music is understood, appreciated and consumed. I wish to briefly trace the journey thereafter of the Electrical recording era, radio, spools, cassettes and tape recorders. The key aspect of the impact of early recording technology on the lives of classical musicians and the musical idiom itself will be covered in this paper. Very little scholarly/academic work has been hitherto done in this important area of Indian classical music history that deals with the intersection of music and technology. References (1). Gronow, Pekka and Ilpa Saunio. An International History of the Recording Industry. London: Cassel, 1997. (2). Gronow, Pekka. The Recording Industry: an Ethnomusicological Approach. Finland: University of Tampere Press, 1996. (3). Hughes, Stephen Putnam. "Music in the Age of Mechanical Reproduction: Drama, Gramophone, and the Beginnings of Tamil Cinema." The Journal of Asian Studies 66.1 (2007): 3-34. "The 'Music Boom' in Tamil South India: Gramophone, Radio and the Making of Mass Culture." Historical Journal of Film, Radio and Television 22.4 (2002): 445-473. (4). Kinnear, Michael S. The Gramophone Company's First Indian Recordings, 1899-1908. Bombay: Popular Prakashan, 1994.

24

Viswanatha ‘Language and culture’

Language Studies: Through the lens of Rashomon

Vanamala Viswanatha English Studies, School of Education

Azim Premji University Bangalore 560 100 Karnataka, India


Abstract Something as ubiquitous as language and as pervasive as culture, and therefore always already multiple by definition, cannot be easily captured by the explanatory powers of a single discipline. For instance, literature, that special thing which uses language as its basic material, teaches us this founding assumption that there are multiple entry points to all representations of experience and reality. I believe that a rigorous study of languages demands a holistic, interdisciplinary ‘Language Studies’ approach rather than a narrowly-defined ‘Linguistic Science’ approach. Invoking well-established traditions of scholarship on the study of language, I wish to demonstrate that the relationship between our 'nade-nudi' (the two words are, in fact, a collocational phrase in Kannada), the way we live and the way we talk, in other words, culture and language is inalienable. Using the proverb as a linguistic/cultural text, I would like to explore the making of language, which lies essentially at “the intersection of cognition, communication and culture” (Everett, 2012). This perspective on language demands simultaneously a micro vision and focused attention to its structure and composition as well as a broader perspective of culture and society for its meaning and use in context. Hence any attempt at understanding language has to necessarily draw on diverse but related disciplines such as Psychology, Sociology, Theory of Evolution, Translation Studies and Multilingualism. The purpose, function, and context of use will determine the nature and content, the important questions and constitution of that discourse. I wish to locate this discussion in the teaching context of an interdisciplinary course titled, 'Language, Mind and Society' in the MA in Education programme at the Azim Premji University.

25

John ‘Turbulent Flows and their Numerical Simulation’

Turbulent Flows and their Numerical Simulation

Volker John Weierstrass Institute for Applied Analysis and Stochastics (WIAS)

Mohrenstr. 39 10117 Berlin, Germany


Keywords: turbulent incompressible flows, scale separation, turbulence modeling

Abstract The talk will start with an introduction on the physics of turbulent flows. In particular, the variety of scales will be highlighted. It will be shown that standard numerical methods fail if they are applied to problems with a large range of scales. Finally, some ideas of modeling the small scales, the so-called turbulence modeling, will be discussed and numerical examples will be presented.

26

Mandal ‘Hyperbolic conservation laws’

Challenges in Computing Hyperbolic Conservation Laws

J.C. Mandal Department of Aerospace Engineering Indian Institute of Technology Bombay

Mumbai 400076, Maharashtra, India


Keywords: Hyperbolic conservation laws, Euler equations, Riemann solvers

Abstract Many practical problems in science and engineering take the form of hyperbolic conservation laws. The hyperbolic conservation laws are known to admit discontinuous solutions even with smooth initial conditions. As a consequence, numerical computations of these hyperbolic conservation laws are very challenging due to the presence of these discontinuities. The difficulty gets compounded in multi-dimensions and brings in many uncertainties in the computations. In order to ensure greater reliability in the computations, many criteria, like conservations, upwinding, monotonicity, positivity and entropy conditions, are imposed into the discretization process. In spite of great advances made over the years, many of the computational problems are still not resolved satisfactorily. Some of the difficulties associated with higher order formulation on unstructured grids (Mandal and Rao, 2011), catastrophic failure due to numerical shock instabilities (Mandal and Panwar, 2012), genuinely multidimensional upwinding (Balsara, 2010, Balsara, 2012, Mandal and Sharma, 2014), low Mach number flow computations (Volpe, 1993), etc. are still eluding the computational scientists. The personal experience in dealing with some of the above issues will be narrated during the talk.

References (1). Mandal, J.C. & Rao, S. (2011). High Resolution Finite Volume Computations on Unstructured Grids using Solution Dependent Weighted Least Squares Gradients. Computers and Fluids 44, 23-31. (2). Mandal, J.C. & Panwar, V. (2012). Robust HLL-type Riemann Solver Capable of Resolving Contact Discontinuity. Computers and Fluids 63, 148-164. (3). Balsara, D.S. (2010). Multidimensional HLLE Riemann solver application to Euler and magneto-hydrodynamic flows. Journal of Computational Physics 229, 1970-1993. (4). Balsara, D.S. (2012). A two-dimensional HLLC Riemann solver for conservation laws: application to Euler and MHD flows. Journal of Computational Physics 231, 7476--7503. (6). Mandal, J.C. & Sharma, V. (2014). A genuinely two-dimensional convective-pressure splitting scheme for Euler equations. Proceedings of the Eighth International Conference on Computational Fluid Dynamics (ICCFD8), Chengdu, China, July 14-18, 2014. (7). Volpe, G. (1993). Performance of compressible flow codes at low Mach number. AIAA Journal 31, 49-56.

27

Balakrishnan ‘Meshless CFD in Aerospace Engineering’

Meshless CFD in Aerospace Engineering

N. Balakrishnan Computational Aerodynamics Laboratory

Department of Aerospace Engineering Indian Institute of Sciencce

Bangalore 560012, India


Abstract The talk will trace the developments in the meshless solver LSFD-U (Upwind Least Squares based Finite Difference Procedure) in the last decade (Sridar and Balakrishnan, 2003). It will broadly cover the inspiration behind the LSFD-U framework and its advantages. It will also address the limitations of meshless framework and its performance in comparison to competing methods employing Finite Volume framework. The talk will also present an emerging trend which projects the LSFD-U framework as a hybrid Cartesian grid method, particularly in the context of RANS computations (Munikrishna and Balakrishnan, 2011). The talk will also cover the present status of the LSFD-U methods (Yousuf et al., 2014) and what needs to be done further to make them truly attractive from the view point of industrial computations. References (1). Sridar, D. & Balakrishnan, N. (2003). An Upwind finite difference scheme for meshless solvers, Journal of Computational Physics 189, 1-29. (2). Munikrishna, N & Balakrishnan, N. (2011). Turbulent flow computations on a hybrid cartesian point distribution using meshless solver LSFD-U, Computers and Fluids 40, 118-138. (3). Yousuf, Md., Munikrishna, N., Parthiban, A. & Balakrishnan, N. Demonstration of automated CFD process using meshless technology, ECFD VI, July 2014, Barcelona.

28

Basak ‘Generalized analysis for wave and energy balance equations’

A Generalized analysis for wave and energy balance equations during microwave propagations within food dielectrics of various

shapes

Tanmay Basak Department of Chemical Engineering Indian Institute of Technology Madras

Chennai 600036, India


Keywords: Microwave heating, lateral/radial incidence, finite element, food dielectrics, material invariant

Abstract This presentation addresses guidelines on forecasting heating patterns in microwave processed foods which influence their final properties and quality. Food materials have been assumed to be exposed to lateral and radial incident microwaves. Microwave power absorption within samples have been studied using dimensionless parameters, viz. (i) fp and fw: represents the effect of dielectric properties on power absorption (ii) Nw: represents the effect of sample size on power absorption. Helmholtz equations for complex electric field have been solved using radiation boundary condition. Note that, radiation boundary conditions are derived from scattering theory of electromagnetic wave propagation. Further, parabolic type energy balance equation has been solved via finite element method to predict temperature dynamics. Food materials were classified into 4 Groups with various fp and fw. Power and temperature profiles have been studied in representative materials from each Group. It is found that power absorption profiles for all groups of food occur in three regimes in increasing order of sample size, i.e (i) thin regime: characterized by uniform power absorption (ii) intermediate regime: resonances in absorbed power and (iii) thick regime: exponential attenuation of power within sample. Formation and location of hot-spots within material is found to be dependent on the type of incidence and sample dimensions. Significant thermal runaway occurs for all groups of food beginning from intermediate regime. It is observed that laterally incident food materials suffer from higher thermal runaway compared to radial incident foods (for Nw > 0.2), while lateral incidence correspond to larger heating rates.

29

Bhalla ‘Brain function across scales’

Brain function across scales

Upinder S. Bhalla National Centre for Biological Sciences Tata Institute of Fundamental Research

Bangalore 560065 Karnataka, India


Keywords: Physiology, encoding, computational neuroscience, olfaction, odor tracking

Abstract The study of the working of the brain, perhaps more than any other of the deep questions in science, is profoundly dependent on interdisciplinary approaches. This is not merely a technical matter, though arguably a broader range of techniques - from molecular biology to psychology to computation - are brought to bear on the brain than any other system. I will instead argue that the core questions of brain function are themselves fundamentally interdisciplinary. We have worked for many years on a small niche of brain function: How do we recognize and find odours? To do this we first delved into the physiology of odour processing. Brain activity is a complex interweaving of chemical and electrical signaling. We monitored activity in the olfactory pathway through electrical and optical recordings. We examined these through the lens of information representation, encoding, and independent components. We then make a leap of levels, to study odour-guided behavior. We related bilateral odour sampling with sophisticated strategies that animals employ to navigate in a complex odour environment. We built computational models, both at the biophysical level to account for encoding, and at the cognitive level to account for odour tracking strategies. Thus our studies spanned disciplinary domains from physiology, information theory, computation, and cognition. While these scientific results illuminate only a small niche of the great challenge of the brain, I believe that the interdisciplinary nature of the results is closely reflective of how the brain itself works.

30

Hariharan ‘Biology and Computing’

Combining Biology and Computing: Challenges and Opportunities

Ramesh Hariharan

Strand Life Sciences Kirloskar Business Park

Bangalore

Email: [email protected] Abstract This talk will describe our journey at Strand Life Sciences, our endeavour to bring computation to problems in biology. The talk will outline challenges we faced in building a multi-disciplinary team and a multi-disciplinary business. The talk will also outline various challenges and problems that need to be solved at the intersection of these two disciplines.

31

Chakrabarti ‘Protein Structure Analysis’

Analysis of protein structures – identification of a new turn, and redefining the buried surface area in complexes

Pinak Chakrabarti Department of Biochemistry and Bioinformatics Centre

Bose Institute, Kolkata 700 054, India


Keywords: Turn conformation, function, structural mimicry, protein-protein interaction

Abstract Protein tertiary structures and complexes have been analyzed to identify two novel features – a new turn conformation (1) and the changes between the bound and the unbound forms of proteins to increase the buried surface area in the interface in the complex (2).

In Asx-turn the hydrogen bond that is typical of a β-turn is mimicked by the side chain of Asn/Asp residue. We find that the N-H part of a β-turn hydrogen bond can also be replaced by a Cγ-H group in the side chain leading to a β-turn mimic, which, because of its shape, is termed as ω-turn stabilized by C-H⋅⋅⋅O interaction (residue i+2 to i). Based on torsion angles there are two types of ω-turns which are found in the active sites (metal-binding, N-linked glycosylation or antigenic determinant). Occurring together with Asx-turns, ω-turns characterize many loop regions in proteins.

The buried surface area (BSA), which measures the size of the interface in a protein-protein complex may differ from the accessible surface area (ASA) lost upon association (termed DSA), if conformation changes take place. DSA was evaluated by measuring the ASA of the interface atoms in the bound and unbound (B/U) states of the components of protein-protein complexes. ASA calculated in the bound state of the components is 3.3% greater than in their unbound state, and the BSA, 7% greater than the DSA. An examination of B/U structures points to a possible origin: local movements optimize contacts with the other component at the cost of internal contacts.

References (1). Dhar, J. et al. (2014) ω-Turn: a novel β-turn mimic in globular proteins stabilized by main-chain to side-chain C-H⋅⋅⋅O interaction. (under submission). (2). Chakravarty, D. et al. (2013). Reassessing buried surface areas in protein-protein complexes. Protein Sci. 22, 1453-1457.

32

Maiti et al. ‘DNA nanotubes’

Microscopic Structure of DNA Nanotubes

Himanshu Joshi, Anjan Dwaraknath and Prabal K. Maiti Department of Physics

Indian Institute of Science Bangalore 560 012, India


Abstract Recently DNA has emerged as unique material for the bottom up synthesis of nano devices and has led to a variety of motifs which are topologically similar to cubes, octahedrons, other polyhedral and nanotubes. DNA Nanotubes are tubular structures created by self-assembling DNA strands whose sequences are designed so that the resulting molecule takes the shape of a nanotube. Here, we study the molecular mechanics involved in the design and characterization of these DNA nanostructure using state of the art all atom molecular dynamics simulation. We report the algorithm to construct variety of DNA nanotube topology like six helix, eight helix bundles as well as triangular nanotubes. We study their thermodynamic stability as a function of sequence and number of DNA helices forming the nanotube. The RMSD and radius analysis averaged over several ns long simulation demonstrate the stability of these tubes. Steered molecular dynamics simulations have been performed to study the elastic response of these nanostructures. The six-helix and eight-helix structures have stretch moduli of the order of 4000 pN which is 4 times larger than the ds-DNA and have persistence length of the order of 6-7 µm.

33

Sampath ‘Electrochemical Energy Systems’

Electrochemical Energy Systems: Materials Challenges

S. Sampath Department of Inorganic and Physical Chemistry

Indian Institute of Science Bangalore 560 012


Abstract Electrochemical energy systems have attracted considerable attention, for conversion as well as storage of various forms of energy. These devices include electrochemical solar cells (DSSC, dye sensitized solar cells), batteries, supercapacitors and fuel cells. Though research on these devices has been carried out for several years now, there are still challenges to be overcome. The present day scenario aided by the search for alternate sources of energy has provided the necessary impetus to this area. The present lecture will give an idea of certain aspects of conversion as well as storage with some emphasis on our research.

34

Lützen ‘Organic nanoaggregates’

Tailored light emitting organic nanoaggregates from π-conjugates oligomers

Arne Lützen

Kekulé-Institute of Organic Chemistry and Biochemistry University of Bonn

Gerhard-Domagk-Str. 1 D-53121 Bonn, Germany


Keywords: π-conjugated oligomers, self-assembly, nanoaggregates, materials, optoelectronic devices

Abstract Functionalized π-conjugated oligomers bearing phenylene, naphthalene, thiophene, or carbazole groups have been synthesized and studied with regard to their ability to form fiber-like light-emitting nanoaggregates upon deposition from the gas phase on suitable template surfaces.[1] Some of these oligomers could also be used to prepare needle-like aggregates via deposition from solution in nanoporous alumina templates.[2] Furthermore, some of the oligomers could also be used to build optoelectronic devices like organic light-emitting field effect transistors or p-type organic phototransistors.[3]

References (1). Schiek, M., Balzer, F., Al-Shamery, K., Brewer, J., Lützen, A. & Rubahn, H.G. (2008). Organic molecular nanotechnology. Small 4, 176-181. (2). Bordo, K., Schiek, M., Ghazal, A., Wallmann, I., Lützen, A., Balzer, F. & Rubahn, H.-G. (2011). Parallelly and Normally Surface-Aligned Organic Nanofiber Arrays. J. Phys. Chem. C 115, 20882-20887. (3). a) Liu, X., Wallmann, I., Boudinov, H., Kjelstrup-Hansen, J., Schiek, M., Lützen, A. & Rubahn, H.-G. (2010). AC-biased organic light-emitting field-effect transistors from naphthyl end-capped oligothiophenes. Org. Electr. 11, 1096-1102. b) Liu, X., Tavares, L., Osadnik, A., Larsen Lausen, J., Kongsted, J., Lützen, A., Rubahn, H.-G. & Kjelstrup-Hansen, J. (2014). Low-voltage organic phototransistors based on naphthyl end-capped oligothiophene nanofibers. Org. Electr. 15, 1273-1281.

35

Dey ‘Water to Hydrogen and Oxygen’

H2O H2 + O2

Abhishek Dey Indian Association for Cultivation of Science (IACS)

Kolkata 700032, West Bengal, India


Abstract We need clean energy and clean water; there is no denying that. H2 and O2 based energy systems are hailed to be clean. To wit; the H2 and O2 when combined will release energy and water as well. A process like that can provide clean energy and water to all (the motto!). There are however several key obstacles to cross before such a system can be realized. The biggest one, undoubtedly, is developing catalysts that are capable of facilitating the two vital half reactions i.e. H+ + e- ½ H2 and H2O - 2e- ½ O2 + 2H+. The catalysts are required to be 1) Cheap, 2) efficient and should work unabated under most daunting circumstances (chemically speaking!). At IACS our group has been heavily invested in electrochemical water splitting in to its elements H2 and O2 adhering to these criteria. Using a combination of synthesis (tireless fun), self assembly (organized fun), spectroscopy (colorful fun) and electronic structure function correlations (quantized fun) our group has been successful in producing some remarkable catalysts for the purpose. These catalyst, designed using the principles laid out in Nature, are derived from cheap materials (mostly) and can produce H2 and O2 from water using electrical energy (socket and solar) at very high rates. While these may not generate trillion dollar business (yet!), the journey so far has been very encouraging and humbling. The talk will highlight the milestones reached along with a healthy serving of chemical details that were necessary to get there. References (1). Dey, S., Rana, A., Crouthers, D., Mondal, B., Das, P. K., Darensbourg, M. Y. & Dey, A. (2014). J. Am. Chem. Soc. 136, 8847–8850. (2). Dey, S., Mondal, B. & Dey, A. (2014). Phys. Chem. Chem. Phys. (Advance Article)

(3). Chatterjee, S., Sengupta, K., Dey, S. & Dey, A. (2013). Inorg. Chem. 52, 14168.

(4). Sengupta, K., Chatterjee, S., Samanta, S. & Dey, A. (2013) Proc. of the Natl. Acad. Sci., USA 110, 8431.

(5). Mondal, B., Sengupta, K., Rana, A., Mahammed, A., Botoshansky, M., Ghosh Dey, S., Gross, Z. & Abhishek Dey (2013). Inorg. Chem. 52, 3381.

(6). Dey, S., Rana, A., Ghosh Dey, S. & Dey, A. (2013). ACS Catalysis 3, 429.

(7). Sengupta, K., Chatterjee, S., Samanta, S., Bandyopadhyay, S. & Dey, A. (2013). Inorg. Chem. 52, 2000.

(8). Pramanik, D., Sengupta, K., Mukherjee, S., Ghosh Dey, S. & Dey A. (2012). J. Am. Chem. Soc. 134, 12180-12189.

(9). Dey, A. (2010). J. Am. Chem. Soc. 132, 13892.

36

George ‘Luminescent Hybrids’

Light Harvesting Soft-Hybrids

Subi J. George Supramolecular Chemistry Laboratory, New Chemistry Unit Jawaharlal Nehru Centre for Advanced Scientific Research

(JNCASR), Jakkur P.O., Bangalore 560064, India

Email: [email protected] Web: www.jncasr.ac.in/george

Keywords: energy transfer, light-harvesting, soft-hybrids, luminescence

Abstract The hybridization of organic chromophores with inorganic systems, either covalently or non-covalently, has emerged recently as an alternative, efficient design for luminescent materials. The structural versatility and nanoscopic periodicity / space present in the inorganic component help to spatially organize the chromophores in these hybrids, which minimizes the inter-chromophoric interactions. As a result, these hybrid assemblies are expected to show a high quantum yield, with added advantages of synthetic simplicity and transparent nature compared with the organic assemblies. Several luminescent hybrid materials of organic chromophores with inorganic scaffolds like zeolites, periodic mesoporous organosilica (PMO), metal–organic frameworks (MOF), and clay materials have been reported, where the emission color has been tuned by the inter-chromophoric energy transfer. However, the substrate transferability of these luminescent hybrids remains elusive because of their limited solution-processability. In this respect, we envisage that the design of soft-hybrids as emissive materials would endow them with both solution processability and finer hybrid properties. We have recently reported a novel supramolecular strategy by the solution-phase self-assembly of donor and acceptor molecules along with a soluble inorganic counterpart to make emissive soft-hybrids, in the form of gels and films. Using this non-covalent approach we have organized various anionic dyes on the surface of cationic aminoclay to result in highly luminescent, light-harvesting hybrid hydrogels. We have further extended this strategy to achieve highly pure white-light-emitting paints. Recent results from our lab further show that these hybrid assemblies can further be exploited to perform photochemical reactions. Details of these works will be presented.

References (1). K. V. Rao et al. (2011). Light-Harvesting Hybrid Hydrogels: Energy Transfer Induced Amplified Fluorescence in Non-Covalently Assembled Chromophore-Organoclay Composites. Angew. Chem. Int. Ed. 50, 1179–1184. (2). K. V. Rao et al. (2012). Light-Harvesting Hybrid Assemblies. Chem. Eur. J.18, 2184 - 2194. (3). K. V. Rao et al. (2013). Highly pure Solid-State White-Light Emission from Solution Processable Soft-Hybrids, Adv. Mater. 12, 1713 – 1718. (4). K. V. Rao et al. (2014). Organic-Inorganic Light-Harvesting Scaffolds for Luminescent Hybrids. J. Mater. Chem. C. 2, 3055 - 3064.

37

Philp ‘Waste water management’

Sustainable Wastewater Management: Challenges and Way Forward

Ligy Philip Department of Civil Engineering

Indian Institute of Technology Madras, Chennai-600036 Tamil Nadu, India


Keywords: Wastewater management, challenges, recycle and reuse, centralized and decentralized systems Abstract Wastewater management is a major issue for developing countries. In India, as on 2009, only 41% of the wastewater generated is collected and 48.8% of this is treated before letting the collected water out. Water and wastewater treatments have been viewed as separate issues until recently. However, there has been a paradigm shift in recent years due to the scarcity of fresh water and the stress created by partially treated wastewater on the existing sources. Wastewater treatment systems can be either the conventional centralized systems, decentralized systems or entirely onsite systems. Conventional or centralized wastewater treatment systems collect, treat and discharge large quantities of wastewater whereas decentralized systems collect and treat the wastewater locally. Decentralized wastewater management systems have the potential to contribute to the formation of an infrastructure to sustain watershed integrity. However, each system has its own merits and demerits. This presentation will be discussing about the status of wastewater management in India, performances of centralized, decentralized and onsite treatment systems across India, major challenges faced by such systems, technologies available and commonly employed for wastewater treatment, wastewater recycling and reuse and major quality issues associated with recycling and reuse. This presentation will also be discussing about the possible way forward to address the major issues.

38

Kumar ‘Climate Change Impact’

Climate Change and its Impact on Water Resources of a River Basin

D. Nagesh Kumar Department of Civil Engineering, Centre for Earth Sciences

Indian Institute of Science Bangalore-560 012, India


Keywords: climate change, precipitation, water resources, downscaling, remote sensing Abstract There is growth in scientific evidence about global climate change. Since, hydrological processes are sensitive to climate variability and change, understanding linkages between the climate and the hydrological processes and their feedbacks becomes critical for sustainable management of water resources, environmental quality, economic development and social well-being. Understanding the aforementioned linkages will not only increase the awareness of how the hydrological systems may change over the coming century, but also prepare us for adapting to the impacts of climate change on water resources. So any holistic integrated and environmentally sound sustainable management of the available water resources in climate change scenario is intimately linked to the ability to adequately assess them. Water resources assessment (WRA) involves determination of the sources, extent, dependability and quality of water resources for their proper utilization and control. General Circulation Model (GCM) data obtained at global scale for four different climate change scenarios viz., A1B, A2, B1 and COMMIT are downscaled to river basin scale using Support Vector Machine (SVM). Six Cardinal variables viz., precipitation, maximum temperature, minimum temperature, wind speed, relative humidity and solar radiation are downscaled at monthly time scale from CGCM3 output. Geographical Information System (GIS), remote sensing and Digital Elevation Model (DEM) are used along with GCM downscaled data in assessing the impact of climate change on water resources using ArcView Soil and Water Resources Assessment Tool (AV-SWAT). Malaprabha river basin in Karnataka state, India is chosen for demonstration.

39

POSTER ABSTRACTS CHEMICAL BIOLOGY

40

Pramanik et al. ‘Targeted delivery of metal complex’

Targeted delivery of cytotoxic metal complexes to cancer cells using gold nanoparticles

Anup K. Pramanik1, Siddik Uzzaman2, Kumaravel Somasundaram*2 and Ashoka G. Samuelson*1

1Department of Inorganic and Physical Chemistry, 2Microbiology and Cell Biology Indian Institute of Science, Bangalore - 560012, Karnataka, India


Abstract Cancer is one of the leading causes of death worldwide with limited therapeutic options. Chemotherapeutics used for treatment of cancer have serious side effects because of non-specific delivery to normal and tumour cells. A major challenge for improving anticancer treatments is to direct the therapeutic agent to only the tumour cells. In this regard, nanomedicine provides great opportunities for biomedical applications including diagnosis and therapeutics.1 Because of the ease the of synthesis, functionalization, reduced toxicity and reduced immunogenicity, gold nanoparticles (NPs) are being used widely for delivery of cytotoxic agents.2 Stabilisation of the gold nanoparticles with functionalised polyethylene glycol (PEG) gives the opportunity to link the cytotoxic agent that ensures the delivery of the warhead to the desired site.3 Gold nanoparticles were prepared using the Turkevich method and stabilised with lipoic acid conjugated to amine terminated PEG. Gold NPs were of uniform size and showed good stability and water solubility. Copper bis(thiosemicarbazone) complexes are known to have good antitumor activity.4 Copper bis(thiosemicarbazone) complex with a functionalisable group was synthesized which showed good antitumor activity. This complex was linked to PEG functionalised gold NPs with a cleavable disulfide linker and also linked with a targeting moiety like biotin, to increase the activity of these complexes. Controlled release of copper was observed (60% in 48 h) from the gold conjugates in the presence of GSH. The evaluation of their antitumor activity is in progress.

References (1). Griffith, D., Morgan, M. P. & Celine J. Marmion. (2009). A novel anti-cancer bifunctional platinum drug candidate with dual DNA binding and histone deacetylase inhibitory activity, Chem. Commun. 47, 8530-8532. (2). Kumar, A., Zhang, X. & Liang, X. J. (2013). Gold Nanoparticles: Emerging Paradigm for Targeted Drug Delivery System. Biotechnol. Adv. 31, 593–606. (3). Wu, Y. L. & Li, J. (2009). Synthesis of Supramolecular Nanocapsules Based on Threading of Multiple Cyclodextrins over Polymers on Gold Nanoparticles, Angew. Chem. Int. Ed. 48, 3842 –3845. (4). Duraippandi, P., Shinde, S. V., Somasundaram, K. & Samuelson, A. G. (2013). In Vitro and in Vivo Anticancer Activity of Copper Bis(thiosemicarbazone) Complexes, J. Med. Chem. 56, 722−734.

41

Raja et al. ‘Regioselectivity’

Deiodination of Thyroxine by Deiodinase Mimics: Nature of Chalcogen Atom Alters the Regioselectivity

K. Raja and G. Mugesh

Inorganic and Physical Chemistry Department Indian Institute of Science

Bangalore-560012 Karnataka, India


Keywords: thyroid hormones, iodothyronine deiodinases, selenol, tellurol Abstract Thyroid hormones, thyroxine (T4) and triiodothyronine (T3) are secreted from thyroid gland and play crucial roles in body metabolism. Iodothyronine deiodinases (IDs) are the selenocysteine-containing enzymes which involve in activation and inactivation of thyroid hormones by regioselectively removing iodines from the hormones. ID1 which removes iodine from both outer ring and inner ring of thyroxine to form 3,3’,5-triiodothyronine (T3) and 3,3’,5’-triiodothyronine (rT3) respectively. ID2 and ID3 remove iodine from outer ring and inner ring of thyroxine repectively. Naphthalene-based peri substituted compounds having thiol-selenol and selenol-selenol pair at 1, 8 positions remove selectively iodine from inner ring of thyroxine, showing ID3 like activity. In this work, the deiodination reactions of thyroid hormones with naphthalene-based peri substituted compounds having thiol-tellurol and tellurol-tellurol pair are discussed. It was observed that these compounds mimic the ID1 activity by removing iodines from thyroxine forming rT3, 3, 3’-T2, 3’, 5’-T2, 3-T1, 3’-T1 and T0.

References (1). Bianco, A.C. et al. (2002). Biochemistry, cellular and molecular biology, and physiological role of the iodothyronine selenodeiodinases. Endocr. Rev. 23, 38-89. (2). Manna, D. & Mugesh, G. (2010). A chemical model for the inner-ring deiodination of thyroxine by iodothyronine deiodinase. Angew. Chem. Int. Ed. 49, 9246-9249. (3). Manna, D. & Mugesh, G. (2011). Deiodination of thyroid hormones by iodothyronine deiodinase mimics: Does an increase in reactivity alter the regioselectivity? J. Am. Chem.Soc. 133, 9980-9983. (4). Manna, D. & Mugesh, G. (2012). Regioselective deiodination of thyroxine by iodothyronine deiodinase mimics: An unusual mechanistic pathway involving cooperative chalcogen and halogen bonding. J. Am. Chem.Soc. 134, 4269-4279.

42

Rajasekhar et al. ‘Hybrid Cyclic Peptoids’

Synthesis of Hybrid Cyclic Peptoids and Identification of Autophagy Enhancer

K. Rajasekhar,1 N. Narayanaswamy,1 Piyush Mishra,2 S. N. Suresh,2 Ravi Manjithaya2 and T.

Govindaraju*1 1Bioorganic chemistry laboratory, New Chemistry Unit

2Molecular Biology and Genetics Unit Jawaharlal Nehru Centre for Advanced Scientific Research

Bangalore 560064, Karnataka, India

Email: [email protected] Keywords: differential cyclization, hybrid cyclic peptoid, autophagy, enhancer Abstract Cyclic peptoids are potential candidates for diverse biological activities. However, applications of cyclic peptoids are limited by the synthetic difficulties, conformational flexibility of large cyclic peptoids, and lack of secondary amide in the backbone. Here we have developed an elegant methodology for the synthesis of small and medium-size cyclic hybrid peptoids. αN-Alkyl and αN-acyl substituents in N-(2 aminoethyl)glycine monomers enforce intra- and intermolecular cyclization to form stable six- and twelve-membered cyclic products, respectively. NMR studies show inter- and intramolecular hydrogen bonding in six- and twelve-membered cyclic peptoids, respectively. Screening of a cyclic peptoid library resulted in the identification of a potential candidate that enhanced autophagic degradation of cargo in a live cell model. Such upregulation of autophagy using small molecules is a promising approach for elimination of intracellular pathogens and neurodegenerative protein aggregates. References (1). Wu, Y. D. & Gellman, S. (2008). Peptidomimetics. Acc. Chem. Res. 41, 1231-1242. (2). White, C. J. & Yudin A. K. (2011). Contemporary strategies for peptide macrocyclization. Nat. Chem. 3, 509–524. (3). Liskamp, R. M. J., Rijkers, D. T. S., Kruijtzer, J. A. W. & Kemmink, J. (2011). Peptides and proteins as a continuing exciting source of inspiration for peptidomimetics. ChemBioChem 12, 1626–1653. (4). Rajasekhar, K., Narayanaswamy, N., Piyush, M., Suresh, S. N., Ravi, M. & Govindaraju, T. (2014). Synthesis of hybrid cyclic peptoids and identification of autophagy enhancer. ChemPlusChem. 79, 25-30.

43

Mitra ‘Photocytotoxic ferrocenyl-terpyridine’

Photocytotoxic Ferrocenyl-Terpyridine Platinum(II) Complexes

Koushambi Mitra Department of Inorganic and Physical Chemistry

Indian Institute of Science Bangalore-560012 Karnataka, India


Keywords: platinum, ferrocenyl, apoptosis, crystal structure, photocytotoxic Abstract Photodynamic therapy provides a platform where we can selectively activate a photosensitizer with light within the cancer cells thereby leaving normal cells unaffected1. The ability of ferrocenyl terpyridines (Fc-tpy) to act as excellent photosensitizers prompted us to design and explore the PDT activity of a new class of ferrocenyl Pt(II) complexes. Four complexes, viz. [Pt(Fc-tpy)Cl]Cl (1), [Pt(Fctpy)(NPC)]Cl (2, HNPC = N-propargyl carbazole), [Pt(Fc-bpa)Cl]Cl (3) and [Pt(Phtpy)Cl]Cl (4, as a control complex) were synthesized and characterized2. The Pt(II) centre adopted a distorted square-planar geometry as evident from the crystal structures of 1 and 3. The ferrocenyl complexes 1-3 were redox active exhibiting reversible Fc+–Fc redox response near 0.6 V vs. SCE in DMF-0.1 M TBAP. The DNA binding studies indicated that complexes 1-3 were devoid of intercalative properties as seen in 4. Complexes 1 and 2, having an intense charge transfer band at ~590 nm, showed enhanced anti-proliferative effect in HaCaT and MCF-7 cancer cells (IC50: 9.8 - 12.2 μM) in visible light of 400-700 nm with low dark toxicity (IC50>60 μM). Fluorescence microscopic images revealed substantial cytoplasmic and nuclear localizations of complexes 1 and 4. The Annexin V-FITC/PI assay indicated that complexes 1-3 are capable of triggering light-induced apoptosis. Mechanistic aspects showed formation of ferrocenium ion and cytotoxic hydroxyl radicals via a Fenton type mechanism which resulted in a pronounced photocytotoxic effect. Extensive conjugation lowers the HOMO-LUMO energy gap in 1 and 2 making them better photoinitiators. References (1). Celli, J. P., Spring, B. Q., Rizvi, I., Evans, C. L., Samkoe K. S. & Verma S. (2010). Imaging and photodynamic therapy: mechanisms, monitoring, and optimization. Chem. Rev. 110, 2795–2838. (2). Mitra, K., Basu, U., Khan, I., Maity, B., Kondaiah, P. & Chakravarty, A. R. (2014). Remarkable anticancer activity of ferrocenylterpyridine platinum(II) complexes in visible light with low dark toxicity. Dalton Trans. 43, 751-763.

44

Pandeeswar et al. ‘Biomimetic Engineering’

Biomimetic molecular organization of naphthalene diimide in the solid state: tunable (chiro-) optical, viscoelastic and nanoscale properties

M. Pandeeswar,1 H. Khare,2 S. Ramakumar2 and T. Govindaraju*1

1Bioorganic chemistry laboratory, New Chemistry Unit Jawaharlal Nehru Centre for Advanced Scientific Research

2Department of Physics, Indian Institute of Science Bangalore 560 064, Karnataka, India


Keywords: aromatic interactions, chirality, biomimetic, chirooptical, viscoelastic

Abstract The interfacing of organic electronics with biology to design functional molecular materials is a promising area of research. The performance of these materials mainly governed by intermolecular interactions; therefore, precise control over the molecular organization is necessary to improve functional properties. Herein we describe the tunable biomimetic molecular engineering of a promising n-type organic semiconductor, naphthalene diimide (NDI), in the solid state by introducing minute structural mutations in the form of amino acids with variable Cα-functionality. For the first time we could achieve all possible four crystal packing modes, namely cofacial, brickwork, herringbone and slipped stacks of the NDI system. Furthermore, amino acid conjugated NDIs exhibit ultrasonication induced organogels with tunable visco-elastic and temperature responsive emission properties. The amino acid–NDI conjugates self-assemble into 0D nanospheres and 1D nanofibers and 2D nanosheets in their gel state as well as from solution. Photophysical studies indicated the remarkable influence of molecular ordering on the absorption and fluorescence properties of NDIs. Interestingly, the circular dichroism (CD) and X-ray diffraction (XRD) studies revealed the existence of preferential helical bias in both solution and solid state. Consequently, the origin of the preferential handedness in the helical organization is attributed to transcription of chiral information from the amino acid to the NDI core. On account of these unique properties, the materials derived from NDI-conjugates might find a wide range of future interdisciplinary applications from materials to biomedicine. References (1). Aida, T., Meijer, E. W., & Stupp, S. I. (2012). Functional Supramolecular Polymers. Science 335, 813–817. (2). Avinash, M. B., & Govindaraju, T. (2012). Amino Acid Derivatized Arylenediimides: A Versatile Modular Approach for Functional Molecular Materials. Adv. Mater. 24, 3905-3922. (3). Tovar, J. D., (2013). Supramolecular Construction of Optoelectronic Biomaterials. Acc. Chem. Res. 46, 1527-1537. (4). Pandeeswar, M., Khare, H., Ramakumar, S., & Govindaraju, T. (2014). Biomimetic molecular organization of naphthalene diimide in the solid state: tunable (chiro-) optical, viscoelastic and nanoscale properties. RSC Adv. 4, 20154-20163.

45

Narayanaswamy et al. ‘DNA-staining and parasite detection’

Base Pair Specific DNA Probe: Implications in Efficient Parasite Detection in Human Erythrocytes

Nagarjun Narayanaswamy,1 Manoj Kumar,2 Sadhan Das,2 Rahul Sharma,3 Suman K. Dhar,3 Tapas. K. Kundu 2 and T. Govindaraju*1

1Bioorganic Chemistry laboratory, New Chemistry Unit 2Transcription and Disease Laboratory, Molecular Biology and Genetics Unit, JNCASR

Bangalore 560064, Karnataka, India. 3Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi, India.


Keywords: Hemicyanine, Red-fluorescence, DNA-probe, AT-basepair, Malaria parasite

Abstract Sequence-specific recognition of DNA by small switch-on fluorescence probe is a promising tool for bioimaging, bioanalytical and biomedical applications.1,2 Selective targeting of double-stranded (ds) DNA using organic dyes offers powerful strategies to develop i) probes for molecular biology and immunohistochemistry, flow cytometry and DNA quantitation, ii) genome-specific binders of potential theranostic interest in conjugation with predesigned oligonucleotides, and iii) treating gene-related human diseases especially cancer, parasitic and viral infections.3 Here, we report a new red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibits strong fluorescence enhancements in the presence of DNA containing AT-base pairs, but does not fluoresce with DNA containing only GC-base pairs, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK293 cells followed by nuclease enzymes digestion studies show the selective staining of DNA in the nucleus by TC over the cytoplasmic region. Chromosomal centromere and malaria parasite DNA imaging studies further confirm the diagnostic and therapeutic applications of TC in vivo. In general, probe TC may find application in fluorescence spectroscopy, diagnostics, bioimaging, molecular and cell biology. References (1). Armitage, B. A. (2005). Cyanine Dye–DNA Interactions: Intercalation, Groove Binding, and Aggregation. Top. Curr. Chem. 253, 55–76. (2). Ranasinghe, R. T. & Brown, T. (2005). Fluorescence based strategies for genetic analysis. Chem. Commun. 5487–5502. (3). Hurley, L. H. (2002). DNA and its associated processes as targets for cancer therapy. Nat. Rev. Cancer. 2, 188-200. (4). Nararayanaswamy et.al (2014). Base Pair Specific DNA Probe: Implications in Efficient Parasite Detection in Human Erythrocytes. (Communicated).

46

Iyer et al. Racemases in Salmonella

Amino acid racemases: Novel regulators of Salmonella pathogenesis

Namrata Iyer and Dipshikha Chakravortty Department of Microbiology and Cell Biology

Indian Institute of Science Bangalore 560012 Karnataka, India


Keywords: racemases, Salmonella, SPI-1, pathogenesis, D-amino acids

Abstract Salmonella’s success as a pathogen can be attributed primarily to its ability to adapt to its environment, whether it be the intestinal lumen, phago-lysosomal compartment or even the aquatic habitat outside its host. One of the key features of this adaptation, is the sensing of molecules unique to each of these niches via specialized two-component systems that trigger the appropriate downstream response. Our study examines one such class of molecules viz D-amino acids and in particular the enzymes responsible for their production i.e. amino acid racemases, in regulating Salmonella metabolism and pathogenesis. Study of knockouts of putative aspartate racemases in Salmonella typhimurium has revealed them to be novel regulators of Salmonella Pathogenicity Island-1. The knockouts exhibited a drastic defect in their ability to invade non-phagocytic cells, both in vitro as well as in vivo and this regulation was observed to be at the transcriptional level. Microarray analysis has shown that multiple signaling pathways are differentially regulated in the knockouts as compared to the wild type. It is now known that D-amino acids are produced by a wide variety of bacterial species. In this light, our study puts forth the possibility of D-amino acids, (both endogenous as well as exogenously produced) acting as novel signaling molecules in microbe-rich environs such as the host gut lumen.

47

Jathanna et al. ‘Repeated Superovulation on female reproductive system’

Cellular changes in oocytes of Swiss albino mice subjected to repeated

superovulation

Neetha Nirupama Jathanna, Deepthi Dhanya, Ramya Nair, Sujith Raj Salian, Guruprasad Kalthur and Satish Kumar Adiga

Division of Clinical Embryology, Department of Obstetrics and Gynecology Kasturba Medical College, Manipal University

Manipal 576 104, India

Email: [email protected] Key words: Repeated superovulation, oocyte, DNA damage, somatic cells

Abstract Infertility is a major health problem in India. With increase in the infertility rate, the use of fertility drugs is increasing all over the world. However, the possible association between fertility drugs and cancer risk in infertile women have drawn attention of reproductive biologists and increased the anxiety in infertile couple. Due to the low success rate of infertility treatments such as IUI and IVF, infertile women undergo multiple cycles of ovulation induction or superovulation. Under these circumstances, microtrauma caused to the ovarian epithelium by repeated, uninterrupted ovulation and supraphysiological hormonal levels may increase the risk of cancer in hormone responsive organ such as ovary. A study has been undertaken in this direction using the mouse model to investigate the cellular changes in the oocytes and somatic cells after repeated superovulation. Decrease in the number of oocytes, poor quality and altered mitochondrial distribution pattern was observed in mice subjected to repeated superovulation. In addition, the increased incidence of DNA damage was observed in the bone marrow cells of mouse subjected to repeated superovulation.

48

Thyagarajan et al. ‘Production of Amylase’

Microbial production of a solvent, metal ion, detergent and oxidizing agent tolerant amylase using Pongamia pinnata cake meal as substrate

by solid state fermentation

Pankajam Thyagarajan, Amitabha Das and Geetha Bali Department of Biotechnology, Karnataka State Womens’ University

Torvi, Bijapur 586109 Karnataka, India


Key words: Amylase, Deoiled Pongamia seed cake, Thermostability, Solid state fermentation

Abstract Pongamia pinnata oil is a strong candidate for biodiesel production. Large amount of deoiled cake is generated as by-product during biodiesel production from its seeds. Extracellular amylase production by an isolated fungal strain (KSWUAD) cultivated solely on deoiled P. pinnata seed cake (DPSC) as nutrient source was found to be 3500 U/ml after 90 hours of incubation at 30oC. The optimum pH and temperature of protease was 13 and 60oC and the enzyme was thermostable retaining about 70% of maximum at 100ºC. The compatibility of KSWUAD amylase with certain commercial detergents such as Wheel, Ariel and Surfexcel was shown to be excellent. Moreover, it was active in presence of 1% SDS and 3% Tween 80. Increased enzyme activity and thus, stability was exhibited in presence of ethanol, methanol, toluene, ethylacetate, hexane and acetone. All these results indicate the potentiality of the enzyme in various industrial applications.

React

Keywor

AbstracS

many oC−H bX)Cl(COcomplexreactionH2)Cl(Cby measD coupcomplexrespectivCH3−H)

TMe3Si+

reflected

tivity of [Rwith E

rds: Sigma c

ct Sigma compf the metal ond activatO)(PNP)][Ox with varion of comCO)(PNP)][Osuring the valing constanx (1) with Mvely, similar)(Cl)(CO)(PNThe space felectrophile

d in the abse

Fig

RuHCl(COElectrophi

R Departm

complexes, e

plexes involvcatalyzed r

tion reactioTf] {X = H

ous electropmplex (1) OTf] (2). Thariable tempent in the co

MeOTf and Mr to an SN

2 NP)][OTf] (filled modeles onto the ence of form

gure 1: Spac

O)(PNP)] (ilic Reagen

Ramaraj A ament of Inor

Indian InBangalo

Email: jagir

electrophile,

ving H−H, Sreactions likns. In an

H (2), Me (3)philic reagen

with HOhe presence oerature (VT)

orrespondingMe3SiOTf re

reaction wi(3) and [Ru( of complexRu-H bond

mation of the

ce filled mod

Ayy

(PNP = Phnts X-OTf

and Balaji Rrganic and Phnstitute of Sore-560012,

[email protected]

dihydrogen

Si−H and C−ke hydrogen

attempt to ), Me3Si (4)nts XOTf (XOTf gives of dihydroge) 1H NMR sp

g H-D isotopesulted in thethout the in(�2-Me3Si−Hx (1) is shod experienccorrespondi

del of [RuHC

yappan et al. ‘At

hCH2N(CHf (X = H, M

. Jagirdar* hysical Chemcience India

sc.ernet.in

n

−H bonds arenation, hydro

prepare s}, we treate

X = H, Me,the dihy

en moiety inpin-lattice repomer. One direct elim

ntermediacy H)(Cl)(CO)(own in fig 1ces severe sng sigma co

Cl(CO)(PNP

ttempts to Obser

H2CH2PPhMe3Si and

mistry

e found to bogenolysis, igma comp

ed the [RuHC, Me3Si; OTydrogen con complex (2elaxation timn the other

mination of Mof sigma co

(PNP)][OTf]1. The apprsteric encumomplexes in t

P] complex 1

rve Sigma Comp

h2)2) CompMe)

be intermediahydrosilatio

plexes [Ru(Cl(CO)(PNPTf: CF3SO3)omplex [R2) was estabme (T1, ms) a

hand, reactiMeCl and Meomplexes [Rf] (4), respectroach of Membrance whthese two ca

.

plexes’

plex

ates in on and �2-H-P)] (1) ). The

Ru(�2-blished and H-ion of e3SiCl

Ru(�2-tively. e+ and hich is ases.

50

Banerjee ‘ER-targeted photochemothrapeutics’

ER-targeted photochemotherapeutics: remarkable photocytotoxicity in visible light of oxovanadium(IV) vitamin-B6 complex

Samya Banerjee Department of Inorganic and Physical chemistry

Indian Institute of Science Bangalore 560 012 Karnataka, India


Keywords: Oxovanadium(IV), Vitamin-B6, ER targeting, Cellular imaging, Apoptotic photocytotoxicity

Abstract Oxovanadium(IV) vitamin-B6 Schiff base complexes [VO(HL)(bpy)]Cl (1) and [VO(HL)(acdppz)]Cl (2) with the (acridinyl)dipyridophenazine (acdppz) complex as cellular imaging and PDT agent shows remarkable photo-induced cytotoxicity in cancer cells in visible light of 400-700 nm while being non-toxic in dark and for MCF-10A normal cells.1 The crystal structure of the control complex 1 (bpy = 2,2′-bipyridine) shows VO2+ group in VN3O3 distorted octahedral coordination geometry. The V=O bond distance is ~1.598(2)Å. The complexes show a d-d band near 750 nm in 10% aqueous DMF and exhibit an irreversible V(IV)-V(III) redox response near −0.9 V vs. S.C.E. in 20% DMF-H2O with 0.1 M TBAP. Vitamin-B6 transporting membrane carrier (VTC) mediated entry of the complex into the tumor cells in preference to the normal ones is responsible for higher cellular uptake of complex 2 to the cancer cells over normal cells. Complex 2 exhibits remarkable photocytotoxicity in HeLa and MCF-7 cancer cells giving IC50 values of 0.24±0.02 and 0.53±0.03 μM, respectively, showing much higher activity to that of the clinically used drug Photofrin®. DNA laddering experiment shows ladder like pattern on light exposure indicating apoptotic damage of DNA. The Annexin-V/PI binding assay further confirmed apoptotic cell death. DCFDA assay in HeLa cells indicates visible light induced ROS generation by 2. Fluorescence microscopy reveals specific localization of the complex to endoplasmic reticulum (ER). The localization of 2 in ER and generation of ROS may be responsible for induction of apoptosis in visible light through the trigger of ER stress response. References (1). Banerjee, S., Dixit, A., Shridharan, R. N., Karande, A. A. & Chakravarty, A. R. (2014). Endoplasmic reticulum targeted chemotherapeutics: the remarkable photo-cytotoxicity of an oxovanadium(IV) vitamin-B6 complex in visible light. Chem. Comm. 50, 5590-5592.

51

Antony et al. ‘Enoyl ACP reductase inhibitor’

Identification of a potent inhibitor of enoyl ACP reductase FabI from Burkholderia pseudomallei - Crystal structure, Mode of Action and Biological

Activity

Sarah Joseph a, Anirudha Lakshminarasimhan a , Narasimha Rao, K a., Swathi U Lekshmi a, Lau Xiang a, Mohammed Takhi a, K Sreenivas a, Shiela Nathan b, Rohana Yusof b, Noorsaadah A.

Rehmanc, Thomas Antony a and Subramanya H. a

a) Aurigene Discovery Technologies Ltd, 9-40, KIADB Industrial area, Phase II, Electronic City, Hosur Road, Bangalore 560 100, India

b) Department of Molecular Medicine, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia

c) Department of Chemistry, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia


Abstract Melioidosis is a tropical bacterial infection caused by the Gram negative organism Burkholderia pseudomallei (Bpm). Sustained infection of Bpm can be life threatening, leading to illness and death in humans and animals. Growth of this bacterium can be inhibited by targeting enoyl-ACP reducatase (FabI), a key enzyme in the fatty acid biosynthesis. We evaluated an antibacterial agent known to be very active against the Gram positive organism Staphylococci, for its ability to inhibit Bpm. This compound strongly inhibited BpmFabI activity and inhibited the growth of Burkholderia pseudomallei R15 strain with an MIC of 2.35 mg/L. Inhibitor binding resulted in the stabilization of BpmFabI with an increase in melting temperature (ΔTm) by 12 °C without any additive stabilization in the presence of the cofactor NADH. Kinetic studies showed that binding of the compound to BpmFabI is uncompetitive with the substrate Crotonyl CoA and competitive with cofactor NADH. Elucidation of the binding mode of compound to BpmFabI through crystal structure studies reiterated these findings. This information may be useful in the design and development of potent inhibitors of BpmFabI for the treatment of Melioidosis.

52

Basu ‘Tumor targeting and photocytotoxicity’

Carbohydrate Appended Iron Complexes for Tumor Targeting and Photocytotoxicity in Red Light

Uttara Basu

Department of Inorganic and Physical Chemistry Indian Institute of Science

Bangalore 560 012 Karnataka, India


Key words: Iron, Carbohydrate, Schiff base, Crystal structure, Photocytotoxicity, Apoptosis Abstract An important aspect in designing PDT agent is to have selective accumulation of the photosensitizer in the cancerous cells leaving the normal and healthy cells unaffected. The higher rate of glucose metabolism is a general property of tumor cells.1,2 Thus we explored the effect of

glucose appended photocytotoxic iron(III) complexes of a tridentate Schiff base phenolate ligand [Fe(bpyag)(L)](NO3) (1-3), where bpyag is N,N-bis(2-pyridylmethyl)-2-aminoethyl-β-D-glucopyranoside and H2L is (3-(2-hydroxyphenylimino)-1-phenylbutan-1-one (H2phap) in 1, [(3-(2-hydroxyphenylimino)-9-anthrylbutan-1-one (H2anap) in 2 and [(3-(2-hydroxyphenylimino)-1-pyrenylbutan-1-one (H2pyap) in 3 in different cell lines. [Fe(dpma)(anap)](NO3) (4) with bis-(2-pyridylmethyl)-benzylamine (dpma) in which the glucose moiety of bpyag is substituted by a phenyl group was used as a control and [Fe(dpma)(anap)](PF6) was structurally characterized by X-ray crystallography. The structure showed a distorted octahedral geometry at FeN4O2 core. The absorption spectra showed low energy phenolate to Fe(III) charge transfer (CT) band as a shoulder near 500 nm with a tail extending to 700 nm. The complexes were five spin paramagnetic and redox active with irreversible Fe(III)-Fe(II) response near -0.6 V vs. SCE. Complexes 2 and 3 displayed significant photocytotoxicity in red light (600-720 nm) giving IC50 values near 20 μM in HeLa and HaCaT cells upon photo-excitation at the low energy charge transfer band. The cell death via apoptotic pathway involved the generation of reactive oxygen species. Carbohydrate appended complexes 2 and 3 showed five-fold increase in the cellular uptake in HeLa cells as compared to 4. References (1). Macheda, M. L., Rogers, S. & Best, J. D. (2005). Molecular and cellular regulation of glucose transporter (GLUT) proteins in cancer. J. Cell Physiol. 202, 654-62. (2). Basu, U., Khan, I., Hussain, A., Gole, B., Kondaiah, P. & Chakravarty, A. R. (2014). Carbohydrate appended iron (III) complexes for tumor targeting and photocytotoxicity in red light. Inorg. Chem. 53, 2152-2162.

53

Sadashivappa et al. ‘Fortified Maize’

Potential Economic Impact of Biofortified Maize in Indian Poultry Sector

Vijesh V. Krishna1*, Olaf Erenstein2, Prakash Sadashivappa3 and B. S. Vivek4

1*Department of Agricultural Economics and Rural Development, Georg-August, University of Goettingen, Platz der Goettinger Sieben 5, D-37073 Goettingen, Germany

2International Maize and Wheat Improvement Center (CIMMYT), C/o International Livestock Research Institute (ILRI), Post Box 5689, Addis Ababa, Ethiopia

3Tata Consultancy Services, 254, “ANUGRAHA”, LIG, First „C‟ Main, Kengeri Satellite Town, Bangalore 560060, India

4International Maize and Wheat Improvement Center (CIMMYT), C/o ICRISAT, Patancheru 502 324, Hyderabad, India

E-mail: [email protected]

Keywords: Biofortification, Feed cost, Optimization, Quality protein

Abstract The study examines the current feed use in the rapidly-growing Indian poultry sector and evaluates the potential economic impact of using biofortified maize with higher levels of amino acids as feed. Data collected from 185 poultry firms of South India form the empirical base. A large proportion of these firms were found to be using amino acids in quantities above the dosage recommended for profit maximization but with negligible yield impact, demonstrating a clear dearth of managerial information. A linear programming model for estimating the least-cost feed formulation showed that the potential economic impact of biofortified maize is critically limited by the availability of low-cost protein from alternative sources, and that the potential cost savings from the technology would only be marginal. Similar findings were obtained from additional estimation done by relaxing the assumption that firms have the perfect information on feed formulation. Also, lack of knowledge with the small-scale firm management on poultry nutrition could pose additional challenges in development of novel maize-poultry value chains for diffusion of this innovation.

54

MEDICINE AND TECHNOLOGY

55

Prabhu et al. ‘Testicular toxicity’

Effect of Streptomycin on testicular function in adult Swiss albino mice

Amratha D. Prabhu, Ramya Nair, Sandhya Kumari, Guruprasad Kalthur and Satish Kumar Adiga

Division of Clinical Embryology Department of Obstetrics and Gynaecology

Kasturba Medical College, Manipal University Manipal 576 104, India


Keywords: Tuberculosis, Streptomycin, testicular function, sperm DNA Abstract Tuberculosis is the most common infectious disease and is the second cause of death due to a single infectious agent, coming only after HIV/AIDS. Globally, more men than women are diagnosed with TB and die from it. India ranks first among the 22 high burden countries with respect to TB incidence with about 2,200,000 new cases in 2012. First line anti-tuberculosis drugs have been used as per WHO recommendation for nearly 2 decades for treating tuberculosis successfully. Streptomycin is one of the drugs used in treating TB. The mode of action of the antibiotic Streptomycin involves binding to the 30S subunit of ribosomes thereby inhibiting translation in tubercle bacilli. Along with effective eradication of the bacilli, streptomycin is known to induce normal tissue toxicity, especially ototoxicity. However, the effect of the drug on the testicular function is virtually unknown. Hence, the present investigation was aimed at understanding the effects of Streptomycin on testicular function. Adult male Swiss albino mice were injected intraperitoneally with 25, 50 and 100 mg/ kg body weight of streptomycin for 4 weeks. After a gap of 2 weeks, the animals were sacrificed and spermatozoa from cauda epididymis were analyzed for density, motility, morphological changes and DNA integrity. It was observed that incidence of DNA damage and head morphology changes were increased. A marginal reduction in count and motility were observed in mice treated with streptomycin. The results of the study suggest that Streptomycin has adverse effect on the testicular function.

56

D’Souza et al. ‘Preimplantation embryos’

Modulation of preimplantation embryo metabolism in response to genotoxic stress: An NMR based non invasive approach

Fiona D’Souzaa, Shivanand M. Pudakalakattib, Shubhashree Uppangalaa, Sujit Raj Saliana, Guruprasad Kalthura, Hanudatta S. Atreyab and Satish Kumar Adigaa

aDivision of Clinical Embryology, Department of Obstetrics and Gynecology, Kasturba Medical College, Manipal University, Manipal 576104, Karnataka, India

bNMR Research Centre, Indian Institute of Science, Bangalore 560012, Karnataka, India


Keywords: Preimplantation embryo, DNA Damage, non invasive, biomarkers, NMR

Abstract Non invasive detection of DNA damage still remains one among the most critical limitations during embryo selection procedures in assisted reproduction. Preimplantation embryos modulate their immediate environment in accordance to their intrinsic state. This study was designed to ascertain the application of NMR spectroscopy in the non invasive detection of DNA damage in preimplantation embryos. DNA damage in mouse embryos was induced by exposure to Cisplatin for a period of 2 hours. Cisplatin is an antineoplastic agent, which primarily acts by the induction of inter and intra strand DNA crosslinks. The embryos were cultured for 48 hours in ISM1 and embryo culture medium was frozen for NMR analysis. The embryos were further cultured for 24 hours and evaluated for DNA damage by the TUNEL assay. The blastocysts derived from embryos treated with Cisplatin and control groups were morphologically indistinguishable. However, they harbored DNA damage as evidenced by a 3 fold increase in the incidence of apoptosis and 7 fold increase in genomic instability when compared to the untreated control embryos. NMR profile of the spent medium revealed a characteristically altered amino acid metabolism and changes in energy requirement in cisplatin treated embryos when compared to the control group. In addition, embryos that arrested at the morula stage had distinctly different metabolic pattern than the embryos that developed to blastocyst stage. Thus this study validates the applicability of NMR based profiling of spent embryo culture medium in non invasively predicting DNA damage in mouse preimplantation embryos.

57

Nayak et al. ‘Cyclophosphamide induced toxicity’

Alcoholic extract of Moringa oleifera leaves ameliorates cyclophosphamide induced testicular toxicity and tragenerational

changes in mice

Guruprasad Nayak, Aarti Vadinkar, Guruprasad Kalthur and Satish Kumar Adiga

Division of Clinical Embryology, Department of Obstetrics and Gynecology, Kasturba Medical College, Manipal University, Manipal 576 104, Karnataka, India


Key words: Moringa oleifera, cyclophosphamide, chemoprotection, DNA integrity

Abstract Moringa oleifera L. commonly called as drumstick tree, is cultivated in India for dietary pupose. All parts of the plant have been used in preparation of traditional medicine to treat various diseases. The present study is carried out to explore the chemoprotective property of alcoholic extract of Moringa oleifera (MOE) on cyclophosphamide (CP) induced testicular toxicity in mice. Healthy pre-pubertal Swiss albino male mice (2 week) were intraperitoneally (i.p.) injected with phosphate buffered saline (control), 50 mg/kg of cyclophosphamide, 25 mg/kg of MOE or CP with MOE (24h prior, 24h prior and post CP injection and 24h post CP injection for 5 consecutive days). Six week post CP injection, the mice were sacrificed to study the epidiymal sperm count, motility, sperm head morphology and sperm DNA integrity. Administration of cyclophosphamide (50 mg/kg, i.p) significantly decreased quantity and quality of spermatozoa compared to the control. Administration of MOE at 24h before CP injection, 24h pre- and post CP injection as well in 5 fractionated doses post CP injection exhibited significant improvement in epididydmal sperm chararcteristics. The embryo derived from spermatozoa of treated animals did not show any significant difference in blastocyst rate but there was significant increase in DNA damage in CP treated groups. Administration of MOE at 24h prior to CP injection resulted in reduction in DNA damage indicating its chemoprotective property. This property of MOE may have potential benefit in male fertility preservation for prepubertal boys in future.

58

Nair et al. ‘Development of parthenotes’

Sperm derived factors enhances the developmental potential of

mouse parthenotes

Ramya Nair1, Shahin Aboobacker1, Pallavi K Shetty2, Srinivas Mutalik2, Guruprasad Kalthur1 and Satish Kumar Adiga1

1Division of Clinical Embryology, Department of Obstetrics and Gynecology, Kasturba Medical

College, Manipal University, Manipal 576 104, Karnataka, India 2Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, Manipal

University, Manipal 576 104, Karnataka, India

Email: [email protected] Keywords: Oocyte activation, sperm derived factors, developmental potential, Mass spectrometry Abstract Embryonic development without the intervention of spermatozoa is known as parthenogenesis. Development of parthenotes in vitro is characterized by increased fragmentation rate, high 2 cell arrest, delayed development and decreased blastocyst rate and quality. Cytosolic factors from spermatozoa are known to initiate the complex process of oocyte activation and determine cleavage axis in porcine oocytes suggesting its role in early embryo development. In the present study we investigated the influence of sperm derived factors in the development of mouse parthenotes in vitro. The oocytes were activated using different activating agents such as strontium chloride (10mM) and alcohol (7%) in presence or absence of various concentrations of sperm derived factors. Activated oocytes were further cultured by supplementing sperm derived factors in the culture medium. These embryos were studied for developmental potential and embryo quality. Increased blastocyst rate was observed in parthenotes cultured in medium supplemented with sperm derived factors (2.5μg/ml). However no difference in blastocyst rate was observed when the sperm derived factors were supplemented in culture medium post activation. Mass spectrophotometric analysis indicated the presence of phosphatidyl serine, phosphatidyl ethanol amine, phosphatidyl choline, sphingomyelin and caveolin in sperm derived factors which can have possible role in oocyte activation. The results indicate that the presence of sperm derived factors during oocyte activation have beneficial effects on the development of parthenotes in vitro.

59

Honguntikar et al. ‘Embryonic DNA integrity’

Laser assisted hatching of cleavage stage embryos impairs developmental potential and increases genetic instability in blastocysts

Sachin D. Honguntikar, Shubhashree Uppangala, Sujith R Salian, Guruprasad Kalthur and Satish K Adiga

Division of Clinical Embryology, Department of Obstetrics and Gynecology, Kasturba Medical College, Manipal University, Manipal 576104, India


Key words: Laser assisted hatching, apoptosis, genetic integrity, blastocyst

Abstract Assisted hatching is routinely used in fertility clinics on patients with poor prognosis such as repeated implantation failures, advanced maternal age, poor quality embryos, and frozen thawed embryos. In clinical situation, assisted hatching is usually performed either on day 2 or 3 of development. The temperature generated during zona pellucida ablation by diode laser beam is known to generate excess heat in situ. Since preimplantation embryos are quite sensitive to thermal changes and, DNA damage response in preimplantation embryos is stage specific, this study was undertaken to look into the influence of day 2 and day 3 laser assisted hatching on the developmental potential and genetic integrity of the mouse embryos. Parallely, development of human embryos subjected to day 2 laser hatching was also assessed. Though mouse embryo laser hatching resulted in a significant enhancement of blastocyst hatching on day 4.5, the total cell numbers in blastocysts were not significantly different on day 2 but a marginal decline was observed in day 3 hatching group. There was no significant difference in day 3 total cell numbers of human embryos subjected to day 2 laser hatching. Attempt to understand the genetic integrity in laser hatched mouse blastocysts revealed significantly higher apoptotic index in both day 2 (P<0.01) and day 3 (P<0.05) hatched embryos. Our results suggest that laser assisted hatching impairs the embryonic developmental potential and also induces genetic instability in blastocysts which may have serious impact on the reproductive outcome.

60

Uppangala et al. ‘Embryo metabolism’

Influence of sperm DNA fragmentation on human preimplantation embryo metabolism

Shubhashree Uppangala1, Shivananda Pudakalakatti2,3, Fiona D’Souza1, Sujith Raj Salian1, Guruprasad Kalthur1, Pratap Kumar4, Hanudatta Atreya2,3 and Satish Kumar

Adiga1

1Division of Clinical Embryology, Kasturba Medical College, Manipal University, Manipal 576104, 2NMR Research Centre and 3Solid State and Structural Chemistry Unit, Indian Institute

of Science, Bangalore 560012, 4Department of Obstetrics & Gynecology, Kasturba Medical College, Manipal University, Manipal 576 104, India.


Key words: sperm DNA damage, non-invasive marker, NMR, pyruvate/alanine ratio

Abstract Non-invasive testing of human spent embryo culture media is considered as a promising tool for the selection of healthy embryos. Given the varied effects of abnormal sperm characteristics on the reproductive outcome, understanding the influence of specific sperm abnormalities on the ICSI derived embryo metabolism could help in developing the differential metabolic markers to prevent the transfer of embryos carrying sperm mediated defects. Therefore the main objective of this study was to investigate whether there is any influence of sperm characteristics especially sperm DNA fragmentation on the ICSI derived human embryo metabolism? This prospective study comprised 34 infertile couple undergoing ICSI cycles. Processed ejaculates from men undergoing ICSI were tested for DNA fragmentation using the neutral comet assay. A total of 97 spent media samples were subjected to 1H NMR profiling for the evaluation of metabolites and metabolite intensities were compared between male and tubal factor (control) groups. Of the metabolites analyzed, glutamine intensity was significantly lower in male factor group. On the other hand, glutamine, pyruvate and alanine intensities were significantly different between the embryos derived from sperm population having OTM < 1.0 and > 1.0. At the same time, pyruvate to alanine ratio was significantly perturbed between the two DNA fragmentation (based on OTM) groups tested. The present study, for the first time, indicates that abnormal sperm characteristics also affect ICSI derived embryo metabolism which could be related to embryonic genetic integrity. These observations provide a potential insight into the sperm mediated pathophysiological changes in human embryo metabolism.

61

Salian et al. ‘Biotin as a sperm motility enhancer’

Biotin enhances sperm motility in human semen samples and developmental potential of mouse embryos

Sujith Raj Salian, Sandesh Patel, Shruthi Gowda, Yashashwini Shenoy, Sandhya Patil,

Guruprasad Kalthur and Satish Kumar Adiga

Division of Clinical Embryology, Department of Obstetrics and Gynecology, Kasturba Medical College, Manipal University, Manipal, India


Key words: Biotin, sperm motility, DNA damage, fertilizing ability Abstract Motility is a characteristic function of the male gamete, which is required for the sperm to reach and penetrate the oocyte. Reduction in the number of progressively motile spermatozoa limits the possibility of applying various assisted reproductive techniques (ART). Pentoxifylline is widely used as a sperm motility enhancer under in vitro conditions. However, its deleterious effect on the embryo development has raised concerns about its clinical application. A recent study conducted in our laboratory has demonstrated that biotin, a water soluble B-complex vitamin, enhances the motility and longevity in fresh and frozen-thawed normozoospermic semen samples. However, its effect on poor quality of semen samples and its influence on the developmental potential of the embryos is not yet elucidated. In the present study, we assessed the effect of biotin on the motility, kinematics and fertilizing ability of spermatozoa of asthenozoospermic semen samples. Both biotin (10 nM) and pentoxifylline (1 mM) enhanced the sperm motility. In addition, when the 2 cell stage mouse embryos were cultured in KSOM medium supplemented with various concentration of biotin, significant effect on cleavage was observed. The data suggests that biotin is a safe alternative to pentoxifylline as a sperm motility enhancer.

62

COMPUTATIONAL SCIENCE

63

Samad ‘Optimal Design’

Optimal Design of Wave Energy Conversion System

Abdus Samad and Rameez Badhurshah Department of Ocean Engineering

Indian Institute of Technology Madras Chennai 600036, India


Keywords: Design optimization, Surrogate modeling, wave energy, impulse turbine

Abstract Wave energy conversion systems are being developed by several private and government efforts and the systems are still facing challenges to produce significant amount of energy. Hence, a systematic optimization effort is required to get reliable and efficient system. There are ample inventions available to harness some portion of energy from huge oceans containing huge energy. Oscillating water column (OWC) is such a system which uses a bidirectional turbine to extract wave energy. The turbine may be reaction or impulse type. In the present discussion, optimization of an impulse turbine with guide vane will be explained.

The turbine performance defined as efficiency which is to be maximized. The design variables were number of rotor blade, number of guide vanes, guide vane angle and length of the guide vane straight section. A commercial solver of Reynolds Navier Stokes equations was used to analyze the flow and to get efficiency of the turbine. A surrogate model based approximation strategy was used to reduce the computational time and the turbine performance was optimized. Through the optimization it was found that the efficiency enhancement was significant. The reason behind the efficiency enhancement was to flow pattern changes in the turbine. The approach of optimization can be extended to redesign the other parts of the wave energy system.

64

COMPUTATIONAL BIOLOGY

65

Garai et al. ‘DNA Nano-elasticity’

DNA elasticity from short DNA to nucleosomal DNA

Ashok Garai, Suman Saurabh and Prabal K. Maiti Department of Physics

Indian Institute of Science Bangalore 560012 Karnataka, India


Keywords: Structure, elasticity, DNA, nucleosome

Abstract Active biological processes like transcription, replication, recombination, DNA repair and DNA packaging, encounter bend DNA. These processes occur at short length (<100 base pair) scale. Thus the study of elasticity of DNA at such length scale is very important. We use fully atomistic simulation along with various theoretical methods [1,2,3] to determine elastic properties of DNA of different length and sequence. We also study DNA elasticity in nucleosome core particle (NCP) both in presence and absence of salt. At room temperature and in equilibrium with different salt concentrations for our different systems we calculate contour length distribution, end-to-end length distribution and bend angle distribution, which are nearly Gaussian. We determine stretch modulus and persistence length of such short DNA and nucleosomal DNA from contour length distribution and bend angle distribution, respectively. The stretch modulus increases with ionic strength while persistence length decreases with salt concentration. Calculated stretch modulus and persistence length for DNA is in quantitative agreement with available experimental data. In contrast our study for the first time reports the elastic properties for the DNA when it is wrapped around the histone core in NCP. We further show that WLC model is inadequate to describe the DNA elasticity at shorter length scale. Our results not only provide a deeper understanding of DNA mechanics but also are applicable to most protein-DNA complexes.

References (1). Mazur, A. K. (2007). Wormlike chain theory and bending of short DNA. Phys. Rev. Lett. 98, 218102-218105. (2). Mathew-Fenn, R. S., Das, R. & Harbury, P. A. B. (2008). Remeasuring the double helix. Science 322, 446-449. (3). Mogurampelly, S. et al. (2013). Elasticity of DNA and the effect of dendrimer binding. Eur. Phys. J. E. 36, 68-76.

66

Gupta et al. ‘Transport of tRNA’

Molecular basis for nucleocytoplasmic transport of tRNA by Exportin-t

Asmita Gupta, Senthilkumar Kailasam and Manju Bansal

Molecular Biophysics Unit

Indian Institute of Science

Bangalore 560012, Karnataka, India


Keywords: tRNA, Exportin-t, Karyopherins, Molecular dynamics simulation

Abstract Export of mature, fully processed tRNA molecules from nucleus to cytoplasm is carried out by Exportin-t (Xpot) protein in mammals (Los1p homologue in S.cerevisiae). It belongs to a family of nuclear import/export proteins called Karyopherins, which are formed of a repeating motif of 35-40 amino acids called HEAT repeats. The export and subsequent release of tRNA cargo by Xpot involves Ran protein and GTP hydrolysis in the cytoplasm which is associated with Ran. Despite the availability of crystal structures of nuclear and cytosolic forms of Xpot, the molecular details regarding the sequential events leading to tRNA release and conformational change by Xpot remains unclear. We studied a range of molecular complexes including free Xpot protein and intermediate state complexes bound either to Ran or tRNA, to illustrate gross structural motions in Xpot after cargo release and identified various molecular determinants responsible for cargo binding. We employed classical all atom molecular dynamics simulation methods to study all the molecular complexes involving Xpot. The overall conformational change in Xpot due to cargo release was attributed to a highly fluctuating C-terminal region. The identity of residues in GTP and GDP bound states of transporter protein was also established, besides analyzing the change in the molecular electrostatic surface potential of Xpot during conformational change after tRNA release. The energetics of complete and intermediate complexes was also studied in order to illustrate differential binding affinities of Xpot in presence or absence of its specific cargo and directionality of the overall transport process.

67

Kumar et al. ‘Effect of mutations in the spacer region’

Intrinsic variations in the structure of spacer regions can critically influence transcription

Arvind Marathe, Prasun Kumar and Manju Bansal

Molecular Biophysics Unit Indian Institute of Science


Email: [email protected] Keywords: TraR, molecular dynamics, mutation, structural variations Abstract TraR of Agrobacterium tumefaciens is a member of the LuxR family of transcriptional regulators, which regulates genes that control vegetative replication and conjugal transfer of the tumour-inducing (Ti) plasmid. It exists as a dimer in the solution with each monomer comprising of 234 residues. TraR is activated only when the N-terminal domain of each monomer binds to an autoinducer molecule and C-terminal domain binds to specific DNA sequences (traboxes) of the target promoters. In this study, we have carried out extensive (60ns) molecular dynamics simulations of a free wild-type trabox d(GATGTGCAGATCTGCACATC), the same sequence with double mutation (G9→C and C12→G) in the spacer region, which eliminates transcription, a TraR-trabox complex (PDB ID: 1L3L) and unbound TraR. Structural variations in the dinucleotide step parameters, primarily slide and roll, dictate the binding of traR protein to the trabox. Mutations affect the groove width and the overall conformation of the trabox by introducing kinks in the spacer region, possibly making it unfavourable for binding to traR monomer/dimer. Principal component analysis of motion of each monomer of bound and unbound TraR shows that each monomer tends to have different conformations. Our analysis shows that TraR selects a suitably positioned trabox, and that the wild-type trabox is far more likely to assume such a suitable conformation as compared to the mutated trabox. This study highlights the influence on protein binding, of the intrinsic structural variations in regions of DNA that do not directly hydrogen bond to the protein.

68

Wagh et al. ‘NGS alignment accuracy’

Comparison of Accuracy for Exact and Heuristic Alignment of Next Generation Sequencing Data for Clinical SNP Detection of Complex

Diseases

Baban Wagh1 and Debnath Pal2

1Department of Physics, 2Supercomputer Education Research Centre Indian Institute of Science, Bangalore, India


Abstract Single Nucleotide Polymorphism (SNP) detection for disease association has gained a special significance with the advent of Next Generation Sequencing data. Speed and accuracy have become the twin cornerstones of clinical SNP detection. Our analysis for SNP detection casted as one mismatch alignment of query sequences against NCBI human reference genome, suggest significant errors for heuristic methods compared to exact alignment. Our analysis reveals significant errors for popular methods like BWA, BFAST for trials of 1500-2000 cases. The likelihood of error can be correlated to the composition of the reads aligned, in contrast to the exact alignment using Smith-Watermann algorithm. Specific tests on NGS data for cardiovascular diseases show error rates of as high as 1-2% if the read sequence has a specific base type exceeding 30% of the total read content. Also, if the percentages of either of the two base types in the read are equal, a higher error rate is found even for small trials. A simple metric of percentage base-type content in the NGS read, is correlated with alignment and SNP identification accuracy. Detailed statistics of errors and implication thereof in clinical settings will be made in the final presentation.

69

Raychaudhury et al. ‘Graph theory and T cell epitope’

A Graph-Theoretical Approach to the Identification of T cell Epitopes

Chandan Raychaudhury and Debnath Pal Supercomputer Education and Research Centre

Indian Institute of Science Bangalore 560012, Karnataka, India


Keywords: Graph Theory, Topological Shape and Size, T cell epitope

Abstract Graph theory has found important applications in addressing important problems of biology. One of many such applications is to predict pharmacological / biological activities of molecules using quantitative descriptors of chemical structures. Application ranges from small organic compounds which have potentiality of becoming drug candidates to macromolecular structures for which biological functions are sought for. A particular interest in this regard has been to identify T cell epitopes which would have adequate structural characteristics to activate T cells in producing T cell responses. This in turn would help design peptide vaccines which are believed to be safer than those developed from killed or, attenuated viruses particularly for deadly diseases. While the common trend of looking into chemical structures is the 3D structures, graph models (referred to as 2D structures) representing connectivity of the atoms by chemical bonds provides useful information. The flexibility embedded into such models is believed to help understand the structural requirements of a molecule to be biologically active. In the case of identification of T epitopes a large number of peptides bind with MHC molecules to trigger T cell response with varying capacity. Therefore, identification of suitable peptides with adequate structural characteristics is important to get useful vaccine candidates. In this work, we will discuss the application of topological shape and size descriptors of amino acid side chains, obtained from graph models, in the identification of allele specific helper T cell antigenic sites.

70

Maity ‘Study of Protein Kinetics’

Study of Protein Kinetics

Dibyajyoti Maity Institute Mathematics Initiative

DST Centre for Mathematical Biology Indian Institute of Science



Keywords: Protein, structure, kinetics, normal mode analysis Abstract Proteins are present in every cell of every living organism. They are essential for the almost all functions in an organism. The kinetic data for most of these proteins is not measured, or measureable. Moreover, biological reactions have very small number of reacting molecules, a regime in which the mass action formalism is not applicable (Metri 2013). So predicting their kinetics would provide insights into biological reactions taking place inside an organism. With further advancement, it will help in understanding metabolic networks accurately and even provide quantitative data for regulating drug doses. Our approach aims to utilize the available kinetic and structural data, to extract molecular motions in proteins responsible for the reaction under consideration. We have chosen a data set of proteins which are common to the databases BRENDA and PDB, from which we have extracted the sets of orthologous proteins. Due to high computational time requirements in molecular dynamics simulations, we have begun the work with a set with set of shorter sequence lengths. Subsequently we will perform optimised torsion-angle normal mode analysis (Bray, Weiss et al. 2011) or auto-correlation vector analysis (Bhadra and Pal 2014) to determine the parts of the proteins which are actively responsible for the execution of the reaction. A comparison of the energy landscape of these parts across orthologs will be performed to obtain relative estimates on rate constants. References (1). Bhadra, P. & D. Pal (2014). De novo inference of protein function from coarse grained dynamics. Protein: Structure, Function and Bioinformatics (in press). (2). Bray, J. K., Weiss, D. R. & Levitt, M. (2011). Optimized Torsion-Angle Normal Modes Reproduce Conformational Changes More Accurately Than Cartesian Modes. Biophysical Journal 101: 2966-2969. (3). Metri, V. (2013). Stochastic Chemical Kinetics: A study on hTREK1 potassium channel. Master of Science (Engineering), Indian Institute of Science.

71

Kumar et al. ‘Do not Call Me α, I am π-helix’

Do not Call Me α, I am π-helix

Prasun Kumar and Manju Bansal Molecular Biophysics Unit Indian Institute of Science

Bangalore 560 012 Karnataka, India


Keywords: π-helix, sequence, structure, database, amino acid, secondary structure Abstract Existing secondary structure identification methods identify very few π-helices in the structures available in Protein Data Bank (PDB). The path traversed by Cα atoms is used to devise a new method for the identification of secondary structure elements (SSEs) in proteins and is designated as ASSP (Assignment of Secondary Structure in Proteins). Using ASSP to search a non-redundant subset of high-resolution and well-refined protein structures comprising of 3582 protein chains, we found total of 574 π-helices with average unit twist and rise being 85.2 � and 1.2 Å, respectively. A total of 391 (68%) π-helices were found at the termini of α helices with a majority (312) of them being present at the C-termini. The size of the dataset allowed us to analyze the position wise preference for the commonly occurring 20 amino acids within and around π-helices. They show certain positional amino acid preferences and these are different from those of α-helices. Amino acid propensities in π-helices were found to be context dependent, viz. occurring independently, or at N-terminus, C-terminus or middle of α helices. They also influence the preference of amino acids in the flanking α-helices. Majority of interspersed π-helices were found to be conserved across a large number of structures within a family and introduce a kink or distortion in the neighbouring α-helices. In addition to hydrogen bonds, several other non-bonded interactions contributing to the stability of the π-helices have also been identified and studied in detail. Finally, functional and structural role of π-helices have been analyzed. Our analysis indicates that the conformation of the π-helix has evolved to provide unique structural and functional features within a variety of proteins.

72

Bhadra et al. ‘Dynamics-function’

Protein dynamics and function correlation using a new knowledge based coarse grained force field

Pratiti Bhadra1 and Debnath Pal2

1IISc Mathematics Initiative, Indian Institute of Science, Bangalore 560012, India 2 Supercomputer Education Research Centre, Indian Institute of Science, Bangalore

560012, India


Keywords: coarse-grained, force-field, protein dynamics and function, molecular dynamics, auto correlation vector Abstract Coarse grained molecular dynamics (CGMD) simulation offers a way to easily obtain long timescale and compact dynamics information compared to all-atom simulations. However, CGMD requires coarse-grained force fields (CGFF); but most are currently produced in-house and none are benchmarked against experimental dynamics data. Therefore, an accurate CGFF is essential for realistic execution of the protein dynamics. We have developed a new knowledge based coarse grained molecular mechanics (CGMM) force field for monomeric single subunit protein with the aim to reproduce native state dynamics, benchmarked against experimental data and based on Cα atomic position. The CGMM is based on statistical distribution of properties like bonded and nondonded distance, virtual angle and dihedral, parameterized against an unbiased database by Boltzmann inversion approach and modeled by regression method. Our rigorous benchmarking shows that CGMM can produce simulation results that match closely (overall correlation-coefficient: 0.74(±0.2)) with the root- mean-square fluctuation graphs calculated from the 315 unique NMR ensemble structures. The biomolecular function of a protein resides mainly in the flexible parts, whose characteristic dynamics information can be interpreted to link it to its molecular function. We have developed a novel method using 3D auto correlation vectors to compare the dynamics information of the flexible segments across two proteins to infer a match-based association for molecular function1. When benchmarked for correspondence of dynamics-signature of protein segments and function on a dataset of 60 experimentally validated proteins, we obtained a true-positive rate of 87% and 93.5% true negative rate.

References (1). Bhadra, P. & Pal, D. (2014). De novo inference of protein function from coarse-grained dynamics. Proteins: Structure, Function and Bioinformatics, In press.

73

MATERIALS AND ENERGY

74

Gole ‘Metal nanoparticle’

Metal nanoparticle immobilized on metal-organic frameworks (MOFs) for heterogeneous catalysis

Bappaditya Gole

Department of Inorganic and Physical Chemistry Indian Institute of Science Bangalore-560012, India


Abstract Recently heterogeneous catalysts have been emerged as extremely valuable materials for industrial purpose over homogeneous catalysts due to their high thermal stability, easy separation and efficient reusability. Among several heterogeneous catalysts known, metal nanoparticles based catalysts have played a leading role in hydrogenation, reduction of nitro-compounds, oxidation of alcohol, hydroformylation, in C-C bond formation etc. Metal nanoparticles (MNPs) provide a large number of active sites for selective and enhanced catalytic performances. However, due to their high surface energy and large surface area, these MNPs are thermodynamically unstable and often needed a capping agent to stabilize them in nano-region. Among the several possible capping agents, MOFs are particularly promising as supports for MNP immobilization because of their rationally designed framework structures with desired pore sizes, shapes, and functionalities. Since the catalytic process is highly dependent on size and loading of MNPs onto MOF, it is always challenging to increase loading without aggregation of MNPs. Thus, we have functionalized MOFs interior with proper functional group to increase loading of Au and Pd NPs by many folds. Also it has been established that the size of the metal nanoparticles can be controlled by varying the interior space available of the MOFs. Finally the Pd NPs immobilized in MOFs showed excellent heterogeneous catalytic activity of Heck-coupling reaction.

75

Roy et al. ‘Self-Assembled Metallamacrocycles’

Self-Assembly of [2 + 2] Metallamacrocycles using Semi-rigid Diplatinum (II) Acceptor and Their Fluorescence Sensing of Nitroaromatic Explosives

Bijan Roy, Sankarasekaran Shanmugaraju, Rupak Saha and Partha Sarathi Mukherjee* Department of Inorganic & Physical Chemistry

Indian Institute of Science, Bangalore 560 012, Karnataka, India


Keywords: Self-assembly, macrocycle, fluorescence, sensing

Abstract Coordination driven self-assembled molecular architectures have created an enormous interests in the scientific community associated with materials, catalysis, sensing and ‘chemistry in confined space’. The rapid development of the field demands to design and synthesize molecular architectures beyond the molecular library, which is based on the association of metal acceptors of fixed coordination angle with rigid donors to yield thermodynamically stable architectures of allowed geometry. Though a large number of rigid/semi-rigid donors have been used extensively, the use of flexible metal-acceptors is very rare. In the present study, a benzil based diplatinum (II) acceptor is synthesized employing Sonagashira-coupling reactions. This acceptor possesses inherent rotational flexibility with an angle of 116o between two platinum coordination sites. An equimolar combination of this acceptor as nitrate salt, with four different flexible/rigid donors in acetone-chloroform mixture at 60oC yielded [2 + 2] self-assembled metallamacrocycles in quantitative yield. The formation of the single product in each case was confirmed by the presence of only single peak in 31P NMR spectra and they were characterised by 1H NMR spectroscopy and ESI-MS spectrometry.

76

All the macrocycles show good to moderate fluorescence emission and have been utilized to study their ability to recognize highly energised nitroaromatic compounds (NACs). The macrocycles were found to be selectively recognizing phenolic NACs in accordance with their electron deficiency, being most sensitive for picric acid and least for the nitrophenol. Stern-Volmer plot for the MC-I obtained by titrating with PA showed efficient binding with Ksv = 2.5 x 10-4 at lower concentration of analyte. References (1). Chakrabarty, R., Mukherjee, P. S. & Stang P. J. (2011). Supramolecular Coordination: Self-Assembly of Finite Two- and Three-Dimensional Ensembles. Chem. Rev. 111, 6810. (2). Shanmugaraju, S., Jadhav, H., Patil, Y. & P. S. Mukherjee (2012). Self-assembly of an octanuclear Pt(II) tetragonal prism from a new Pt4 organometallic building unit and its nitroaromatic explosives sensing. Inorg. Chem. 51, 13072. (3). Roy, B., Bar, A. K., Gole B. & Mukherjee P. S. (2013). Fluorescent tris-imidazolium sensors for picric acid explosive. J. Org. Chem. 78, 1306.

77

Mala et al. ‘Elongation of H-H bond’

Influence of nucleophilicity of the N-heterocyclic carbene ligands on the elongation of H-H bond in ruthenium(II) complexes

Deep Mala and Balaji R. Jagirdar* Department of Inorganic and Physical Chemistry

Indian Institute of Science, Bangalore 560 012, Karnataka, India

Email: [email protected] Keywords: N-heterocyclic carbene, dihydrogen complexes Abstract Transition metal dihydrogen complexes are of immense significance in catalytic processes such as hydrogenation, hydroformylation, and hydrogenolysis. In these processes, the bound H2 ligand undergoes oxidative addition on the metal center. To facilitate oxidative addition of H2, strong nucleophilic co-ligands are required within the metal complex. In this regard, N-heterocyclic Carbene (NHC) ligands would be extremely useful in promoting the oxidative addition of H2 due to their strong donor ability. Transition metal dihydrogen complexes bearing NHC co-ligand have been studied to a very small extent1-3.

In continuation of our research pursuits to address the question of, as to what point in the reaction coordinate the H–H bond could be considered to be broken, we synthesized and characterized certain ruthenium complexes bearing NHC co-ligand, of the type [RuCl(η2–H2)(L)(CO)(IMes)(PPh3)]OTf (L = MeCN, Me3CCN, and pyridine). The chemistry of these complexes will be presented.

(L = MeCN, Me3CCN, and pyridine)

References (1). Giunta, D., Hölscher, M., Lehmann, C. W., Mynott, R., Wirtz, C. & Leitner, W. (2003). Room temperature activation of aromatic C–H bond by non-classical ruthenium hydride complexes containing carbene ligands. Adv. Synth. Catal. 345, 1139-1145. (2). Beach, N. J., Blacquiere, J. M., Drouin, S. D. & Fogg, D. E. (2009). Carbonyl-amplified catalyst performance: Balancing stability against activity for five-coordinate ruthenium hydride and hydridocarbonyl catalysts. Organometallics 28, 441-447. (3). Burling, S., Häller, L. J. L., Mas-Marza, E., Moreno, A., Macgregor, S. A., Mohan, M. F., Pregosin, P.S. & Whittlesey, M. K. (2009). The influence of N-heterocyclic carbenes (NHC) on the reactivity of [Ru(NHC)4H]+ with H2, N2, CO and O2. Chem. Eur. J. 15, 10912-10923. with H2, N2, CO and O2. Chem. Eur. J. 15, 10912-10923.

78

Ghosh et al. ‘Metal nanosponge formation’

Synthesis and Mechanistic study of metal nanosponge formation

Sourav Ghosh and Balaji R. Jagirdar* Department of Inorganic and Physical Chemistry



Keywords: Metal nanosponge, ammonia borane, porous material Abstract Materials with porous morphology and high surface area are very important in the field of catalysis, gas sensors, and electrodes.1 More importantly if the materials are made of metals they have additional advantages due to their stability, chemical resistivity, medium cost, and high permeability. Several methods have been developed for such materials, of which the template based approach was thoroughly investigated.2 All these methods were found to be very good for metal oxides but not for noble metals like Ag, Au, Pt, Pd. Recently, a template free synthesis approach has been reported.3a In this context we have also developed a template free synthetic route for porous materials made of metals. Recently our group had shown that ammonia borane can act as a reducing agent for the synthesis of noble metal nanoparticles from their salts.3b Herein we used ammonia borane as a reducing agent to form porous metal frameworks. We tuned the porous structure morphology by changing the substrate to reducing agent ratio, by using different reducing agents (trimethylamine borane, dimethylamine borane etc.), also by changing the concentration of substrate and reducing agent, solvents and temperature. All the materials were characterized by Powder X-ray diffraction, solid state UV-visible spectroscopy, SEM, EDS, TEM, BET and XPS techniques. References (1). Rolison, D. R. (2003). Catalytic Nanoarchitectures--the Importance of Nothing and the Unimportance of Periodicity. Science 299, 1698-1701. (2). a) Walsh, D., Arcelli, L., Ikoma, T., Tanaka, J. & Mann, S. (2003). Dextran templating for the synthesis of metallic and metal oxide sponges. Nat. Mater. 2, 386. b) He, J., Kunitake, T. & Watanabe, T. (2005). Porous and nonporous Ag nanostructures fabricated using cellulose fiber as a template Chem. Commun. 795-796. (3). a) Krisna, K.S., Sandeep, C. S. S., Philip, R. & Eswaramoorthy, M. (2010). Mixing Does the Magic: A Rapid Synthesis of High Surface Area Noble Metal Nanosponges Showing Broadband Nonlinear Optical Response. ACS Nano. 4, 2681-2688. b) Kalidindi, S. B., Sanyal, U. & Jagirdar, B. R. (2010). Metal Nanoparticles via the Atom-Economy Green Approach. Inorg. Chem. 49, 3965-3967.

79

Dasgupta et al. ‘Pillararene-Materials’

Pillar[n]arene in Host-Guest Chemistry

Suvankar Dasgupta, and Partha Sarathi Mukherjee* Department of Inorganic and Physical Chemistry



Keywords: Pillararene, molecular recognition, host-guest chemistry, supramolecular materials Abstract Macrocyclic host molecules such as cyclodextrin, calixarene, crown ether, and cucurbituril have made significant contributions in supramolecular chemistry because of their nanoscale size and molecular recognition ability. These host molecules have been extensively used for various analytical applications such as separation, electroanalysis, spectroscopy and chemometrics1

.They are also used as biomedical supramolecular materials2

, topological gels3 and stationary phase in

chromatography4. In 2008, a new class of macrocycle known by the name of pillar[n]arenes was

reported for the first time along with its interesting host-guest properties5. Pillar[n]arenes have

repeating units connected by methylene bridges at the para position of benzene moieties, and thus they have a unique symmetric pillar architecture differing from the basket-shaped structure of calixarenes bridged at the meta-position of benzene moieties. Pillar[n]arenes show high functionality similar to cyclodextrins and can capture electron-accepting guest molecules within their cavity similarly to cucurbiturils. Pillar[n]arenes are the least explored macrocycles till date and has enormous potential application. We are interested in molecular recognition by pillar[n]arenes in aqueous medium as most biological processes occur in aqueous solution. To achieve that, we have synthesized water-soluble pillar[n]arenes (n= 5, 6) derivatives which show interesting host-guest complex formation with secondary ammonium salts. Taking a step further, self-sorting of guests in aqueous medium could be achieved by using the differing cavity sizes of pillar[5]arene and pillar[6]arene derivatives. In addition, our broad research interest utilizes pillar[n]arene based materials for sensing, gas adsorption and catalysis. References (1). Mokhtari et al. (2011). Analytical applications of calixarenes from 2005 up-to-date. J. Incl. Phenom. Macrocycl. Chem. 69, 1-55. (2). Uekama et al. (1998). Cyclodextrin Drug Carrier Systems. Chem. Rev. 98, 2045-2076. (3). Okumura et al. (2001). The Polyrotaxane Gel: A Topological Gel by Figure-of-Eight Cross-links. Adv. Mater. 13, 485-487. (4). Kakhki, R. M. (2013). Application of crown ethers as stationary phase in the chromatographic methods. J. Incl. Phenom. Macrocycl. Chem. 75, 11-22. (5). Ogoshi et al. (2008). para-Bridged Symmetrical Pillar[5]arenes: Their Lewis Acid Catalyzed Synthesis and Host–Guest Property. J. Am. Chem. Soc. 130, 5022-5023.

80

‘Cultural Program’

Tabla Recital Sagar Bharathraj, Ph.D Scholar

Department of Chemical Engineering Indian Institute of Science, Bangalore 560 012


Brief Résumé Sagar was born to Sri. V. Bharathraj and Smt. Shoba Bharathraj on 19th February 1989. Born and brought up at Calicut, Sagar started learning tabla at a very young age and has been performing since the age of 10. His father, being a very senior disciple of tabla maestro Pt. Omkar Gulwady, Sagar got his initial lessons from him and has been learning ever since. After shifting to Bangalore for his post graduation in engineering, Sagar has been continuing his taalim under the tutelage of tabla wizard Pt. Ravindra Yavagal. A state champion in tabla solo for two consecutive years in the Kerala state school

youth festivals, Sagar started developing interest in vocal accompaniment after coming to Bangalore and has been fortunate to be under the guidance of Pta. Aditi Kaikini Upadhya. His style of accompaniment is very much motivated by stalwarts like Pt. Omkar Gulwady, Pt. Gourang Kodical and his guruji himself. Sagar has performed at various prestigious venues and has accompanied renowned artistes like Pta. Aditi Kaikini Upadhya, Pt.Upendra Bhat, Ustad Rafique Khan and many more. A state rank holder in secondary and higher secondary schools, a double gold medalist for

B. Tech from National Institute of Technology, Calicut, M. Tech from the Indian Institute of Science, Bangalore and also a national award winner for the best M. Tech thesis, Sagar is currently pursuing his Ph.D in Chemical Engineering under Prof. V Kumaran, at IISc., Bangalore. Tabla Rhythm is one of the most beautiful and inevitable aspects of nature. Every process has a unique time cycle attached to it and it is true with day to day activities as well. Any musical piece can be crudely dissected into two parts, the melody part and the rhythm associated with the melody part. Percussion instruments, which are used to provide the rhythm, are many, ranging from drums to bongos to pakhawaj. Indian classical music has been blessed to have so many percussion instruments, one of which is the Tabla. Said to have been brought to the Indian tradition from Persia, the instrument has evolved over a century, to the stage of being the most versatile percussion instrument. Tabla, as such, is a language, the language of music through rhythm. I will be presenting, a traditional Tabla solo, exploring the various aspects of the instrument, its evolution, styles of playing and some traditional compositions in the sections of Peshkar, Kaida, Gat, Chakradhars and Rela.

81

‘Cultural Program’

Yakshagana By

Sri K Krishnamurthy Thunga and Group Yakshakala Academy Mobile: 9448510581

Yakshagana is a typical complete Indian traditional art. It is a musical dance drama very popular in coastal and Malenadu regions of Indian southern state, Karnataka. It is believed to have evolved from pre-classical music and theatre. Yakshagana is a traditional theatre form combining dance, music, actor-created dialogues, costume-makeup, and stage technique with a distinct style. Being a theatre form, unlike a dance form, it is more plural and dynamic. It has its own style of integrating stories in the form of Kannada lyrics, synchronizing dance, music and conversations. Actors wear costumes and enact various roles. One essential element of representation consists of MUSIC and the other, DANCE. The dance elements have good support from percussion instruments like Chande, Maddale and Cymbals. The essence of the drama is conveyed to the audience in prose which is dependent on the textual content of the songs. The themes for the play are normally based on Indian Hindu epics - Ramayana, Mahabharatha, Bhagavatha and the Puranas. The creative art form Yakshagana with its rich costumes, dance and music has great potential but the people are yet to realize its greatness. Yaksha-Kala Academy Yaksha-Kala Academy is an establishment in Bangalore, India, formed for the welfare of the great Indian traditional art Yakshagana, its training and learning. It has been active since past 8-9 years, with countless number of programs in various parts of the city. It comprises of highly experienced teachers, enthusiastic artists and young learners. Yaksha-Kala Academy is regularly conducting Yakshagana classes - 3 days a week and more than 30 aspirants are participating in the training. The Academy conducts classes in schools and many other places of the city (Bangalore, India) too. Academy has a famous and special team of small children under age 16, who are trained separately for different shows of Yakshagana. The team has given many successful programs in, around the city and at many other places of the country. It is considered to be a great success in the activities of the Academy. Mr.Krishmamurthy Thunga – one of the best teachers in the history of Yakshagana, having more than 25 years of hands on experience in Yakshagana, is the founder of the Academy and the inspiring personality leading the different activities of the academy. Yakshakala Academy gives beautiful stage performances for any allotted/specified time duration. Storyline: Abhimanyu Kalaga Abhimanyu is a tragic hero in the Hindu epic, the Mahabharata. He was the son of Arjuna and Subhadra, who is the half-sister of Lord Krishna. He was killed in the 13th day of Mahabharata war. After twelve days of war, of which Abhimanyu was most recognized for destroying the banner and checking the advance of Bhishma on the first day of the war,

82

Abhimanyu's short but eventful life gains the most prominence on the 13th day of the war when he is made to enter the powerful 'Chakravyuha' battle formation of the Kaurava army. Drona had made this contraption in order to capture Yudhishtira. On the side of the Pandavas, only Pradyumna, Krishna, and Arjuna were aware of the secret technique to break this seven-tier defensive spiral formation used by Dronacharya. As they were elsewhere on the battlefield, it fell on Arjuna's son to invade the Chakravyuha with his partial knowledge of entry (but not exit). Abhimanyu himself took the permission from Yudhishtira to destroy Chakravyuha. He enters into the living room of his mother Subhadra to take her blessings. Mother curiously asks her child what he was prepared to do. But after hearing the truth, Subhadra never agrees to send Abhimanyu to the battle as he is very young and inexperienced. But enthusiastic Abhimanyu tries to convince her, he walks out by taking best wishes from her and he went to the battle with a small army. Being the grandson of Lord Indra, god of mystical weapons and wars, Abhimanyu was a courageous and dashing warrior. Considered an equal to his father owing his prodigious feats, Abhimanyu was able to hold at bay great heroes like Drona, Karna, Duryodhana and Dushasana. Determined to exit the Chakravyooha by shattering it from within, Abhimanyu goes on rampage, reaching the heart of the trap. Fighting with such ferocity, none from the Kaurava side can beat him in a one on one combat (dwandva yudha), Bhishma being the only Kaurava warrior who could have done so. Proceeding, Abhimanyu defeats all the Maharathis on a one on one battle, highlights including Abhimanyu piercing the armor of Karna, injuring Salya, the king of Madra so badly he cannot sit, and killing Brihadbala, the king of Kosala of the Ikshwaku dynasty. Abhimanyu really proves very expensive for the Kaurava army, destroying 3/4 of an Akshouhini army single-handedly. Incensed at the admiration those like Kripa and Drona express for Abhimanyu, Duryodhana attacks the boy. Sparing him so that his uncle Bhima can fulfill his oath, Abhimanyu leaves Duryodhana chariot less and weaponless, bleeding all over. He also kills Duryodana's son Lakshamana, who had come to defend his father. Enraged, Duryodhana orders all the Kaurava Maharathis to attack Abhimanyu, who with disgust counters all their attacks. Stung by Duryodhana's doubts in his abilities, Drona suggests that Abhimanyu could only be killed through illicit means. His comments are not met with disagreement, and Karna snaps Abhimanyu's bow from behind while Drona kills Abhimanyu's horses and charioteer from the front. Abhimanyu draws a sword and shield and continues to wreak havoc on the Kaurava army, only to be disarmed from afar once again. The Kaurava forces team up and kill a defenseless Abhimanyu, who famously uses the wheel of a broken chariot to fend of attackers in lieu of his weapons. The final blow was struck by the son of Dushasana, Durmashana. The 16-year-old obliges to keep the honour of his kinsmen, but is killed before he can get out. This was the only way by which Abhimanyu could attain Moksha.

on interdisciplinary science: catalyst for...

Documents