Daily TAKS Connection: DNA

Safe PracticesObjective 1BIO/IPC(1): The student, for at least 40% of the instructional time, conducts field and laboratory investigations using safe, environmentally appropriate, and ethical practices.(A) Demonstrate safe practices during field and laboratory investigations1You Tell Me

After Sue has completed the laboratory investigation ..Thumbs Up or Thumbs Down?Sue should return any unused chemicals to the original container.

Sue should place any broken glass in the glass receptacle.Clean and properly store the equipment so that the possibility of contamination is minimized. FALSETRUETRUESue should use caution because sulfuric acid is corrosive.TRUE2The safest way to dilute concentrated sulfuric acid is to add the acid to water slowing while stirring constantlyNotes

Circle the process where safety precautions should be planned3Infer

What Information can be gathered from the following Pictograms? 4Safe PracticesObjective 1BIO/IPC(2):The student uses scientific methods during field and laboratory investigations.(B)Collect data and make measurements with precision5You Tell MeHow Much?

ABCD6Discuss with students that Litmus paper turns red in an acid (pH 1-6.9) and blue in a base (pH 7.1-14). In addition demonstrate proper wafting technique.PrecisionWhich Groups Data is the most precise?

Group AGroup B7Graduated cylindar is more precise measurementPrecisionWhich Groups Data is the most precise?

8PrecisionWhich Groups Had the Most Consistent Data??

9Viruses

Objective 3BIO (4):The student knows that cells are the basic structures of all living things and have specialized parts that perform specific functions, and that viruses are different from cells and have different properties and functions. The student is expected to:(C) Compare the structures and functions of viruses to cells and describe the role of viruses in causing diseases and conditions such as acquired immune deficiency syndrome, common colds, small pox, influenza, and warts

10Bacteria

Objective 3BIO (4):The student knows that cells are the basic structures of all living things and have specialized parts that perform specific functions, and that viruses are different from cells and have different properties and functions. The student is expected to:(D) Identify and describe the role of bacteria in maintaining health such as in digestion and in causing diseases such as in streptococcus infections and diphtheria

11Nitrogen Cycle Notes

Nitrogen fixing bacteria transform unusable forms of nitrogen to usable forms for organisms. They are an important part of the nitrogen cycleBacteria FAQsNot all bacteria is harmfulMost bacterial infections can be controlled with antibiotics3. Heat often kills bacteria (fever, cooking food thoroughly)

Plant AdaptationsObjective 3BIO (13): The student knows the significance of plants in the environment. (A): evaluate the significance of structural and physiological adaptations of plants to their environments14Plant Adaptation Notes

Adaptation:Stomata are located on the upper side of the leaf.Possible Purpose:Water Plants (allows for gas exchange)Adaptation:Broad Leaf Surface for more absorption of sunlight

Possible Purpose: Plants in low light environment15Sample AnswersPlant Adaptation NotesAdaption:Spines on Plant

Possible Purpose: Plant Protection

16Sample AnswersPlant Adaptation Notes Adaption:Pneumatophores

Possible Purpose: Mangrove plants or plants which live in waterlogged soils. This structure allows for gas oxygen absorption for cellular respiration in plants

17Sample AnswersPlant Adaptation NotesAdaption:Seed with wing-like structures

Possible Purpose: Wind dispersal of seed

18Sample AnswersPlant Adaptation NotesAdaption:Long tap root

Possible Purpose: Roots can go great distances to reach water

19Sample AnswersPlant Adaptation Notes Adaption:Several small seeds in sweet fruit

Possible Purpose: Greater possibility of dispersal and possibility to be eaten by other organisms

20Sample AnswersCellular ProcessesBIO(4): The student knows that cells are the basic structures of all living things and have specialized parts that perform specific functions, and that viruses are different from cells and have different properties and functions. The student is expected to: (B) Investigate and identify cellular processes including homeostasis, permeability, energy production, transportation of molecules, disposal of wastes, function of cellular parts, and synthesis of new molecules.21Cell NotesCell PartsNucleus- control center of the cellMitochondria- powerhouse produces energy; ATP; numerous in muscle cellsChloroplast- site of photosynthesis contain green pigment called chlorophyll to trap sunlightRibosome- site of protein synthesisCell wall- only in plant cells; structureCell membrane- transport of into/out of cellFlagella & Cilia- movement of the cell22Cell Energy NotesCell Energy

Depletion of oxygen results in production of lactic acid build-up (sore muscles)Photosynthesis:

CO2 + H2O + Energy C6H12O6 + O2 (Reactants) (Products)Respiration:

C6H12O6 + O2 ATP + H20 + CO2 (Reactants) (Products)23Cell Transport NotesCell TransportOsmosis is the diffusion of water across a semi-permeable membrane called the lipid bilayer or cell membrane24Homeostasis NotesHomeostasis

If a cell becomes to large to carry out homeostasis, it divides into 2 identical cells (binary fission)Dynamic Equilibrium is reached when concentrations are equal on both sides of the concentration gradient.25Question 1

Which would most likely cause the liquid in Tube A to rise?

a. Starch concentrations being equal on each side of the membraneb. Water and starch volumes being the samec. Water passing from a region of lower starch concentration to one of higher starch concentrationd. Solute in the tubes changing from a higher temperature to a lower temperature

26Answer: a; solute dissolve more quickly at higher temperatures. Question 2Why are photosynthesis and cellular respiration often considered opposites?

a. Photosynthesis produces twice as many ATP molecules as cellular respiration does.b. Photosynthesis occurs during the day, and cellular respiration occurs at night.c. Water is released during photosynthesis and consumed during cellular respiration.d. Oxygen is produced during photosynthesis and used during cellular respiration.

27Answer: a; solute dissolve more quickly at higher temperatures. Question 3The picture shows a cell model and the solutions associated with it. In this situation the cell model will

a. gain massc. increase in solute contentb. shrinkd. start to vibrate

28Answer: a; solute dissolve more quickly at higher temperatures. DNABIO(6): The student knows that the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: (A) Describe components of deoxyribonucleic acid (DNA), and illustrate how information for specifying the traits of an organism is carried in the DNA.29Notes: What is DNA?

DeoxyriboNucleic AcidFunction: blueprint for life; determines traits of an organismComposition: Double-strandedStrands are made of nucleotides a single unit of DNA. Contain a phosphate group, a sugar, and a nitrogen base.Arranged in a double helixLocation in every cell:nucleus

30Question 1

In all plant and animal cells, the nucleus contains long molecules of DNA. Which of the following best describes the function of DNA?

a.DNA provides the shape and structure of the nucleus.b.DNA packages materials for transport through the nucleus.c.DNA carries materials into and out of the nucleus.d.DNA contains the blueprint for producing the whole organism.

31Answer: DQuestion 2All of the following are found in a DNA molecule except

a.carbon dioxideb.deoxyribosec. nitrogend.phosphate

32Answer: AQuestion 3Which molecule is most responsible for determining an organisms eye color, body structure, and cellular enzyme production?

a.Complex starchb.Fatty acidc.Carbohydrated.Deoxyribonucleic acid

33Answer: DQuestion 4Proteins are produced according to a special code found in the control center of the cell. Which of these molecules carries this code?

a.DNAb. ADPc.Phosphated.Lipid

34Answer: ANotes: DNA Base PairingFour nitrogenous basesAdenineThymineCytosineGuanineBase pairingadenine complements (pairs with) thyminecytosine complements guanineSequence of bases (nucleotides) determines traits

35 Base Pairing PracticeDetermine the complement strand of DNA for each strand shown below:ATACGCCCTTGAG_________________GCCCTATATTGCG_________________GTGTCCCAGGGG_________________36TATGCGGGAACTCCGGGATATAACGCCACAGGGTCCCCQuestion 5In DNA, which of the following determines the traits of an organism?

a.Amount of guanineb.Number of sugarsc.Sequence of nucleotidesd.Strength of hydrogen bonds

37Answer: CQuestion 6Erwin Chargaff studied the DNA of organisms within a single species. Chargaff discovered that the amount of adenine is about equal to the amount of thymine. Which of these explains why the ratio of adenine to thymine is nearly 1:1?

a.Adenine and thymine pair with each other.b.Adenine binds with phosphates, while thymine binds with nitrates.c.Adenine and thymine are identical in chemical composition.d.Adenine bases contain a form of thymine.

38Answer: A; this is the only true statement.Question 7Cytosineguaninethymineguanine describes

a. nucleotides within an RNA strand b.a sequence of bases within a DNA sectionpoints of DNA separation during protein synthesis d.tRNA codons for specific amino acids

39Answer: BNotes: ReplicationReplicationAn exact copy of the DNA is madeTakes place in the nucleus

40

1. DNA unwinds and the two strands separate.2. DNA polymerase (an enzyme) adds the complementary base pairs to each side.3. Result: two identical molecules of DNA, each with one new and one old strand of DNANotes Steps of Replication41Question 8DNA molecules separate into single strands, which are then used to construct two identical strands of DNA. This process ensures that the

a.cytoplasm is in equilibriumb.mitochondria are genetically identical to the chloroplastsc.parent cells use little ATPdaughter cells are genetically identical to the parent cells

42Answer: DReplication, Transcription, TranslationBIO(6): The student knows that the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: (B) Explain replication, transcription, and translation using models of DNA and RNA.43DNA Replication NotesReplication -

DNA synthesisDNA DNAOccurs in the nucleusDNA double helix unwinds; separates at hydrogen bond between base pairsDNA polymerase adds base pairs to both strandsAdenine complements ThymineGuanine complements Cytosine Two New DNA molecules formed one strand original, one strand new

44Question 1

DNA passes information to new DNA during the process of

replication

b.transcriptionc.translationd.osmosis

45Question 2Which of the following must occur before DNA replication can take place?

a.Translation of DNA into amino acidsb.Separation of the DNA molecule intocodons

c.Transformation of DNA into RNAd.Separation of the DNA double helix

46Answer: DQuestion 3Part of a DNA strand is represented in the diagram shown. In order for DNA to replicate, the strand must separate at which of the following locations?

a.Between every phosphate-sugar pairb.Between the eight sugar-base pairsc.Between the four nitrogenous base pairsd.Between any two chemical bonds

47Answer: CQuestion 4If the template of a strand of DNA is 5' TCTACGTAG 3', the complementary strand will be

a.3' TCTACGTAG 5'b.5' CTACGTAGA 3'c.3' AGATGCATC 5'd.5' AGACGTCTA 3'

48Answer: CTranscription Notes

Transcription -

RNA synthesisDNA RNAOccurs in the nucleusAdenine from DNA complements Uracil in RNAThymine from DNA complements Adenine in RNA Guanine from DNA complements Cytosine in RNACytosine from DNA complements Guanine in RNA49Question 5DNA passes information to RNA during the process of

a.replicationb.transcriptionc.translationd.osmosis

50Answer: BQuestion 63' CGGUAU 5'

This is a short section of mRNA. Which DNA code probably produced this section of RNA?

a.3' GCCTUT 5' b.5' GCCAUT 3' c.3' ATTGCC 5' d.5' GCCATA 3'

51Answer: DQuestion 7

Which of these represents the DNA segment from which this section of mRNA was transcribed?

a.ACTAAGb.TCUTTGc.GAAUCUd.UCCTGA

52Answer: AQuestion 8The diagram shows how an mRNA molecule is synthesized. What would be the most likely result if a bacterial infection stopped the production of the RNA polymerase?

a.A protein could not be manufactured.b.A lysosome would digest the cell.c.Osmosis would not occur in the cell.d.Dehydration could be prevented in the cytoplasm.

53Answer: ATranslation Notes Translation -Protein synthesisRNA proteinOccurs at the ribosomesCodons (3 base sequence) code for amino acidsUse codon chart to determine amino acidAmino acids link together to form protein

54Question 9RNA is used to code for proteins during the process of

a.replicationb.transcriptionc.translationd.osmosis

55Answer: BQuestion 10Translation (protein synthesis) takes place in a cell at the

nucleusmitochondriaribosomecell membrane

56Answer: CChanges in DNABIO(6): The student knows that the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: (C) Identify and illustrate how changes in DNA cause mutations and evaluate the significance of these changes.57Changes in DNA NotesEnvironmental Factors can Cause MutationsUV rays (does not affect gametes)Carcinogens (radiation, cigarettes, asbestos)

Mutations can be beneficial to an organism because the change can create an advantage over other organismsSex cells (sperm & eggs)58DNA & Nucleotides NotesDNA is made up of a sequence of NUCLEOTIDES.

Any change in the sequence (order) of these nucleotides may result in a mutation3 nucleotides code for an amino acid

Amino acids make up proteins

For example:G G AArginine59Codon Chart NotesA single base change will code for a different amino acid.1) What amino acids are coded for the above?2) What if we change one base? What amino acids are coded for?

UUUU

UUUhistadine-leucine-histadinehistadine-proline-histadineThis Means a Different Protein will be made!!60Karyotypes NotesA karyotype is a picture of a persons 23 chromosomes.From a karyotype you can determine the following

This is a maleThis person has non-disjunction (when chormosomes fail to separate during mitosis (MUTATION)61Question 1

The assembly of a messenger RNA strand that normally begins with UAC has been changed so that the newly assembled messenger RNA strand begins with UAG. Which of the following will most likely occur?

A The protein will be missing the first amino acid.B The amino acids that make up the protein will all be different.C The mRNA will become attached to a ribosome.D The production of the protein will be stopped.62Answer: a; solute dissolve more quickly at higher temperatures. Question 2

The diagram above shows chromosomes in a cell undergoing cell division. If one of the chromosomes breaks during this process, which of the following will most likely happen?A MutationB SelectionC DuplicationD Segregation63Answer: a; solute dissolve more quickly at higher temperatures. Question 3

The diagram shows three generations of cells produced by a single cell through mitosis. In the process, a single mutation occurred at the point indicated. The mutation caused changes within a dominant allele. How many of the 15 cells contain the mutation?

Record and bubble in your answer as you would on a griddable item.

700064Answer: a; solute dissolve more quickly at higher temperatures. Characteristics of Kingdoms

BIO (8): The student knows applications of taxonomy and can identify its limitations. The student is expected:(C) Identify characteristics of kingdoms including monerans, protists, fungi, plants, and animals.

65Archaebacteria NotesArchaebacteria, ProkaryoticNo nucleusNo membrane-bound organelles Most have cell wallsSingle-celledBoth autotrophs and heterotrophs existReproduce by asexual reproductionAlso called extremophiles because they live in extreme environments (extremely hot, salty, or acidic environments)66Eubacteria NotesEubacteriaProkaryoticNo nucleusNo membrane-bound organellesMost have cell wallsSingle-celledBoth autotrophic and heterotrophic existReproduce by asexual reproductionMost abundant kingdom on earth

67Protist NotesProtists

EukaryoticContain a nucleusContain membrane bound organellesUnicellular and multicellular existBoth autotrophs and heterotrophs existExamples: euglena, paramecium, amoeba

68Fungi NotesFungi

EukaryoticMulticellularHave a cell wallLack chloroplastsHeterotrophicDecomposersCan reproduce by both sexual reproduction (produce spores) and asexual reproductionnon-motileExamples: mushrooms and mold69Plant NotesPlantsEukaryoticMulticellularAutotrophic Contain chloroplastsMakes own food by photosynthesisHave a cell wallMost reproduce by sexual reproductionNon-motile70Animal NotesAnimals

EukaryoticMulticellularHeterotrophicNo cell wallReproduce by sexual reproductionMotile

71Question 1

The kingdom Animalia includes all of these except a. jellyfishb. parameciumc. spongesd. roundworms

72Answer: B; paramecium are classified in the kingdom ProtistaQuestion 2

Which is a characteristic of members of the plant kingdom that distinguishes them from members of the animal kingdom?

a. Storage of energy in chemical bondsb. Use of mRNA during protein productionc. Exchange of H2O with the environmentd. Use of chlorophyll for solar-energy transformation

73Answer: B; paramecium are classified in the kingdom ProtistaQuestion 3This organism most likely is a member of which kingdom?

a. Eubacteriab. Animaliac. Protistad. Plantae

74Answer: A; no nucleus present, therefore it is prokaryoticTaxonomy NotesTaxonomic Hierarchy: a scientific classification systemOrganisms are most closely related when the their names contain the same genus.

Kingdom (least specific)KingPhylumPhillipClasscame OrderoverFamilyforGenusgoodSpecies (most specific)soup.75Question 4Which of these classifications is least specific?

a.Familyb.Genusc.Phylumd.Order

76Answer: CQuestion 5Which of these classifications is most specific?

a.Familyb.Genusc.Phylumd.Order

77Answer: CQuestion 6The bullfrog, Rana catesbeiana, is most closely related to the

a.spotted chorus frog, Pseudacris clarkib.Asian flying frog, Polypedates leucomystaxc.northern leopard frog, Rana pipiensd.African bullfrog, Pyxicephalus adspersus

78Answer: C; both frogs are of the genus Rana Energy Flow Through Trophic LevelsBIO (9) The student knows metabolic processes and energy transfers that occur in living organisms. The student is expected to:(D) Analyze the flow of matter and energy through different trophic levels and between organisms and the physical environment.79Question 1Energy used by producers in a rainforest food web is provided by

a. sunlightb. photosynthesisc. oxygend. carbon dioxide

80Answer: AQuestion 2The diagram shown is intended to show relationships in an ecosystem. What do the arrows represent?

a.The direction of population migrationb.Differences in dietary habitsc.Progressively smaller organismsd.The direction of energy flowacbd

81Answer: DQuestion 3A food pyramid represents the relative amount of energy in trophic levels. Which of the following correctly shows a food pyramid?

A.C. B. D.

82Answer: BQuestion 5

How many kcal of energy are transferred to the secondary consumer level?3 kcal30 kcal300 kcal3000 kcal

3000 kcal83Answer: 30 kcalQuestion 6

How many kcal of energy are transferred to the tertiary consumer level?3 kcal30 kcal300 kcal3000 kcal

3000 kcal84Answer: 3 kcalQuestion 7About 90% of the energy at one trophic level is not passed to the next level. What usually happens to the energy that is not passed to the next trophic level or used to carry out life processes?

a.It is given off as heat.b.It is stored as vitamins.c.It is used in reproduction.d.It is used in protein synthesis

85Answer: AQuestion 8The diagram represents different levels of a marine food pyramid. Between which two levels is the least amount of energy transferred?

a.R and Qb.S and Rc.T and Sd.U and T

86Answer: AQuestion 9

In this food web, the bacteria probably function as

a.producersb.herbivoresc.decomposersd.carnivores

87Answer: CQuestion 10

In this food web, the grasses function as

a.producersb.herbivoresc.decomposersd.carnivores

88Answer: aQuestion 11

In this food web, the quail function as

a.producersb.herbivoresc.decomposersd.carnivores

89Answer: bQuestion 12The diagram shows several phases of the nitrogen cycle. Which of the following describes the most likely effect of removing some plants from the area by using chemical herbicides?

a.The rate of erosion of rocks on the ground would be slowed.b.The flow of necessary nutrients would be disrupted.c.The ability of plants to complete photosynthesis would be increased.The infiltration of water into the ground would be halted.

90Answer: BFunctions of Systems in OrganismsBIO(10): The student knows that, at all levels of nature, living systems are found within other living systems, each with its own boundary and limits. The student is expected to: (A) Interpret the functions of systems in organisms including circulatory, digestive, nervous, endocrine, reproductive, integumentary, skeletal, respiratory, muscular, excretory, and immune. (B) Compare the interrelationships of organ systems to each other and to the body as a whole.91Urinary System Notes

Urinary SystemRids the body of liquid wastekidneyureterUrinary bladderUrethra92Nervous System NotesNervous SystemResponds to stimuli to maintain homeostasisNeuronAxon

SynapseDendrite93Muscular System NotesMuscle & Skeletal SystemProvides movement and extension of limbsBones have red marrow which produces red blood cellsBicep- flexes the arm (moves arm up)Tricep- extends the arm

94Respiratory System NotesRespiratory SystemIntake of Oxygen (O2) and gets rid of CO2 as the body maintains homeostasis through metabolism

95Endocrine System NotesEndocrine SystemHormonesGlandsFight/Flight Response

96Immune System NotesImmune SystemProtects the body, often with T-cells (White Blood Cells)Helps rid the body of viruses, bacteria, and other pathogens

97Digestive System NotesDigestive SystemContains enzymes which break down foodContains small intestine for absorption of nutrients

98Circulatory System NotesCirculatory SystemDelivers nutrients to all parts of the bodyTransports red blood cells to body which has the protein hemoglobin to carry oxygen (O2)

99Reproductive System NotesReproductive SystemAllows for production of offspring sexual- varied offspring asexual- identical to parent

Star notes organs involved in sexual reproduction100

indicate which interaction of systems are involved in each of the pictured scenarios

Hormones can trigger asthma attacksSystems Activated: Respiratory & EndocrineSystems Activated: muscular, respiratory, endocrineSystems Suppressed: Digestive, urinary, reproductiveExcretory system retains fluidsVasodilatation to release excess heatSystems Activated: excretory, muscular, integumentaryMuscular contraction to chew and push food down GI tract.Systems Activated: Digestion, Excretory, Circulatory101Question 1

According to this information, some organs of the gastrointestinal tract

a.fit in more than one organ systemc.supply the body with plateletsb.perform only one function at a timed.produce soluble vitamins

102Answer: a;Question 2

Pelicans prevent serious wing damage by entering the water in the manner shown above. Which two organ systems in the pelican work together the most to accomplish this maneuver?

a. Circulatory and nervous systemsb. Muscular and digestive systemsc. Nervous and muscular systemsd. Digestive and circulatory systems

CORRECT ANSWER: c. Nervous and muscular systems103Answer: a; solute dissolve more quickly at higher temperatures.

Interactions Among Organisms

Objective 3BIO (12): The student knows that interdependence and interactions occur within an ecosystem. The student is expected to:(B) interpret interactions among organisms exhibiting predation, parasitism, commensalism, and mutualism

104NotesMutualism: A relationship in which both organisms benefit from the relationship.Example: Clown Fish & Sea Anemone the fish receives protection from enemies and the anemone receives scraps of leftover food from the fish Commensalism: A relationship in which one organism benefits, and the other is neither helped nor harmedExample: Egret & Rhino the bird receives protection from predators by its proximity to the rhino and the rhino is neither helped nor harmed

105NotesParasitism: A relationship in which one organism, who lives on another, benefits, and the other organism is harmed.Example: Fleas & Dog the fleas gain nourishment from the dog and the dog itches from the bitePredation: A relationship in which one organism benefits (the predator) and the other organism is killed/consumed (the prey)Example: Lion & Zebra/Rabbit & Lettuce the lion eats the zebra; the rabbit eats the lettuce106Be sure to highlight the difference between parasitism (although the organism is harmed, it does not meet imminent death) and predation (results in consumption of the prey). Also, The words "predator" and "prey" are almost always used to mean only animals that eat animals, but the same concept also applies to plants: Bear and berry, rabbit and lettuce, grasshopper and leaf. Question 1Which situation best represents a parasitic relationship?a. A tapeworm absorbing nutrients from the intestine of a dogb. An orchid being pollinated by a nectar collecting waspc. A bear eating a berryd. An armadillo rooting in the soil at the base of an oak tree

107Question 2Which situation best represents a commensalistic relationship?a. A tapeworm absorbing nutrients from the intestine of a dogb. An orchid being pollinated by a nectar collecting waspc. A bear eating a berryd. A bird builds a nest in a tree.108Answer: D; The tree helps protect the birds home, no benefit for the tree.Question 3Which situation best represents a predator/prey relationship?a. A tapeworm absorbing nutrients from the intestine of a dogb. An orchid being pollinated by a nectar collecting waspc. A bear eating a berryd. An armadillo rooting in the soil at the base of an oak tree

109Answer: C; the bear consumes the berryQuestion 4Which situation best represents a mutualistic relationship?a. A tapeworm absorbing nutrients from the intestine of a dogb. An orchid being pollinated by a nectar collecting waspc. A bear eating a berryd. A student eating a hamburger

110Answer: B; the orchid is pollinated and can reproduce and the wasp gains nutrition by consuming nectarFood Chains, Food Webs, and Food Pyramids

BIO (12): The student knows that interdependence and interactions occur within an ecosystem. The student is expected to:(E) Investigate and explain the interactions in an ecosystem including food chains, food webs, and food pyramids.111Question 1In a typical forest community, plants are producers, rabbits are primary consumers, and wolves are secondary consumers. Which diagram correctly represents these relationships?acbd

112Answer: bQuestion 2

The difference in the size of each layer of this food pyramid is primarily the result of the difference in

a. food choices of individual nichesb. the amount of food energy at each trophic levelc. oceanic zones of habitatd. the relative heights of the organisms113Answer: bQuestion 3

Which of these groups of organisms would most likely have accumulated the largest concentration of a long-lasting chemical pollutant in their bodies?

a. Phytoplanktonb. Lake troutc. Zooplanktond. Gulls114Answer: dQuestion 4

According to this food web, which of these is an omnivore?

a. Caterpillarb. Antc. Deerd. Bird115Answer: b; Ant eats both grass and corn (producers) and the caterpillar (primary consumer)Question 5 The picture shows a piece of rotting wood. Which of these does the picture demonstrate?

a. Photosynthesis occurringb. Decomposers growingc. Wood regeneratingd. Genes transforming

116Answer: b; fungi are decomposers growing on the logQuestion 6

The table lists four groups of factors found in a particular ecosystem. Which group consists of only abiotic factors?

a. Group 1b. Group 2c. Group 3d. Group 4

117Answer: cNewtons Laws Motion, Work and Power

IPC(4): The student knows concepts of force and motion evident in everyday life. The student is expected to:. The student is expected to:

(A) calculate speed, momentum, acceleration, work, and power in systems such as in the human body, moving toys, and machines.(B) investigate and describe applications of Newtons Laws such as in vehicle restraints, sports activities, geological processes, and satellite orbits.118Question 1Safety restraints in cars help prevent passenger injuries that would otherwise occur as a result of passengers remaining in motion during a cars abrupt stop. Which of these laws predicts that an unrestrained moving body will continue to move?A. Law of inertiaB. Law of reflectionC. Law of universal gravitationD. Law of conservation of momentum

Law of inertia119Question 2A wet bar of soap slides 1 meter across a wettile floor without appearing to slow down.Which of these statements explains why thebar of soap fails to slow down?A. A constant force on an object produces aconstant positive acceleration.B. An object in motion tends to remain inmotion in the absence of an external force.C. A moving object having constant velocitycontains kinetic energy.D. An objects weight is proportional to itsmass.

B120Question 3 Which of these would cause the gravitationalforce between Earth and the sun to increase?A. An increase in the length of a day onEarthB. A decrease in the distance between Earthand the sunC. An increase in the number of planetsorbiting the sunD. An increase in the masses of Earth andthe sun

B121Question 4How many newtons of force does a 75.0 kg student exert on their chair because of gravity? 735 N122Question 5After shooting a cannonball, a cannon recoils with a much lower velocity than the cannonball. This is primarily because, compared to the cannonball, the cannon has a -A. much greater massC. greater kinetic energyB. smaller amount of momentumD. smaller force applied to it

A123Question 6A leaf from an apple tree falls to the ground more slowly than an apple falls. As an explanation of this observation, the ancient Greeks theory of natural place has been replaced by a more recent theory involving gravitational force and A. atomic weightB. inertial massC. air resistanceD. kinetic energy

C124Question 7Which of the these is the best description of the action-reaction force pair when the space shuttle lifts off from the launchpad?A. The ground pushes the rocket up while exhaust gases push down on the ground.B. Exhaust gases push down on air while the air pushes up on the rocket.C. The rocket pushes exhaust gases down while the exhaust gases push the rocket up.D. Gravity pulls the exhaust gases down while friction pushes up against the atmosphere.

C125Speed

Km, minQ: 1.2 km/minR: 1.5 km/minS: 1.7 km/minT: 0.73 km/min126Speed

Motionless; standing still127Acceleration

O m/s21 m/s2128Momentum

129Force

First, acceleration must be calculated. Then, use F = ma to determine force.

Larger skater: 100 NSmaller skater: 100 N

Newtons 3rd law!130Work

N, m, s384 J131Power

It performs work faster.It did not move.60 W132Kinetic Energy

10 m/sKg, J133Wave Types, Characteristics, and Interactions

IPC(5): The student knows the effects of waves on everyday life. The student is expected to: (A) demonstrate wave types and their characteristics through a variety of activities such as modeling with ropes and coils, activating tunings forks, and interpreting data on seismic waves..(B) demonstrate wave interactions including interference, polarization, reflection, refraction, and resonance within various materials.

134Compression Wavesrarefaction-the less dense region of a compression wavecompression-the more dense region of a compression wavewavelength-measured from the start of one compression to the start of the next compressionTASK: Match the letter with the corresponding wave characteristic under the compression wave door.

wavelengthTransverse Waveshas crests and troughscrest high point of the wavetrough low point of the wavewavelength from crest to crest or trough to troughAmplitude is distance from crest or trough to the resting position of the wave larger the amplitude, the greater the energy

Velocity of a WaveFrequency - number of waves that pass a fixed point per secondmeasured in hertz (Hz); waves/second (1/s)for sound waves, determines the pitch of the sound (how high or how low a note sounds)Velocity speed and direction of a wavemeasured in meters per second (m/s)WavelengthMeasured in meters (m)

Lets review InteractionsConstructive Interferencewaves add up

Destructive Interferencewaves cancel each other

ReflectionReflectionincident beamnormalreflected beamthe law of reflection states that the angle of incidence equals the angle of reflection

RefractionRefractionbending of light when changing mediumsdepends on speed of light in each mediumlight bends toward normal when slowing down and away from normal when speeding up.

ResonanceResonancethe ability of an object to vibrate at natural frequency when it absorbs energystanding waves vibrate at natural frequenciesexample: rim of glass, strings on a violin, bells

PolarizationPolarizationwhen light vibrates in one directionEx. Polarizing sunglasses

QuestionThe image on the screen is inverted because light rays A. condense as they pass through the pinholeB. travel through the opening in straight linesC. refract as they strike the screenD. are polarized by the materials of the screen

B143Convection, Conduction, and Radiation

IPC(6): The student knows the impact of energy transformations in everyday life. The student is expected to: (B) Investigate and demonstrate the movement of heat through solids, liquids, and gases by convection, conduction, and radiation.144Question 1The primary way liquids and gases (fluids) transmit heat is by the process of

A. reflectionB. conductionC. radiationD. convection

Question 2Heat convection occurs in gases and liquids. Heat convection does not occur in solids because solids are unable to

A. absorb heat by vibratingB. transfer heat by fluid motionC. emit radiation by reflecting lightD. exchange heat by direct contact

Insulators and Conductors Notes

conductorsallow heat to transfer readilyBlack improves absorption of infrared radiation (heat)Ex: metals are good conductors of heat; painted black are even betterinsulatorsdo not readily allow the transfer of heatEx: glass and plastic are good insulators of heatNow Apply Your Knowledgedetermine whether a substance is a good conductor or insulator based on data providedFYIgood insulators dont allow heat loss/gain; therefore little or no temperature changegood conductors do allow heat loss/gain; therefore a large temperature change will take placeQuestion 5Which container is a better insulator? A better conductor? Why?

Container P is a better insulator than container Q. (T = 7C)Container Q is a better conductor than container P. (T = 14C)

149Periodic TableIPC(7): The student knows relationships exist between properties of matter and its components. The student is expected to:(D) relate the chemical behavior of an element. including bonding, to its placement on the periodic table.150Importance of Atomic #

number of protons is the same as the atomic number; used to ID an element

ID this element151The element modeled is Beryllium; has 4 protons.Question An element has 24 protons. What element is it?

Magnesium MolybdenumChromiumIron152Answer: C; Chromiums atomic number is 24.Question A certain atom has a nucleus containing nine protons and ten neutrons and has nine electrons orbiting the nucleus. This atom is a form of the element

a.potassiumb.fluorinec. neond.calcium

153Answer: B; Fluorine is atomic number 9 (9 protons)Question Alpha particles are one type of radioactivity. These particles have a nucleus of two protons and two neutrons but have no orbital electrons. Based on this information, it can be inferred that alpha particles are positive ions of the element

a.actiniumb.curiumc.radiumd.helium

154Answer: D; Helium is atomic number 2 (2 protons)All in the Familygroups or families are the columns on the Periodic Tableelements in the same group have similar physical and chemical properties

155QuestionWhich of the following groups contains members with similar chemical reactivity?

a.Li, Na, Kb.Be, Mg, Nac.K, Ca, Scd.P, S, Cl

156Answer: A; Li, Na, and K are all in the same group on the periodic table.QuestionThe bonding characteristics of nitrogen are most similar to the bonding characteristics of

a.hydrogenb.siliconc.heliumd.phosphorus

157Answer: D; Phosphorus is in the same group as nitrogen on the periodic table..Noble GasesGroup 18 are called noble gases8 valence electrons (stable octet)noble gases are resistant to forming compounds158QuestionThe elements of which of these groups on the periodic table are least likely to form compounds?

a.Group 1b.Group 9c.Group 14d.Group 18

159Question

Elements found in which shaded area of this periodic table undergo the fewest chemical reactions?

a.Qb.Rc.Sd.T

160Bond. Ionic Bond.MetalsNonmetalsLeft of bold line (staircase)Right of bold line (staircase)Lose electrons when bondingGain electrons when bondingForm ca+ionsForm anionsPositive ions (positive oxidation numbers)Negative ions (negative oxidation numbers)Ionic Bonds: when metals form bonds with nonmetals Halogens, group 17 elements, form ionic compounds (salts) called halides161QuestionElements in Group 2 of the periodic table usually

a.form large moleculesb.lose electrons when bondingc.act like nonmetalsd.liquefy at room temperature

162QuestionSodium fluoride is a type of halide used in toothpaste to help strengthen teeth. Elements from which group in the periodic table are necessary to form halide compounds?

a.Group 4b.Group 5c.Group 10d.Group 17

163QuestionThe elements from which of the following groups are most likely to react with potassium (K)?

a.Group 2b.Group 7c.Group 13d.Group 17

164Oxidation NumbersHow to determine oxidation numbersFind the group number (roman numeral) for the element (located at the top of the group).Determine if the element is a metal or a nonmetal.If it is a metal, the roman numeral value from the group number is the positive value of the oxidation number. Example: Hydrogen is in group IA; therefore the oxidation number is +1 and the cation is written H1+.

OR

If it is a nonmetal, subtract the roman numeral value from eight. Assign a negative sign to the oxidation number. Example: F is in group VIIA; 8 7 = 1; therefore the oxidation number is -1 and the anion is written F1-. 165QuestionWhat is the oxidation number of Mg?

1+1-2+2-166Answer: C; Mg is a metal in group IIA, therefore the oxidation number is 2+.QuestionAccording to the periodic table, which of these elements will form an ion with a 3 charge?

a.Nb.Lac.Lid.Rb

167Answer: A; Nitrogen is a nonmetal in group VA; 8 5 = 3; therefore the oxidation number is -3.QuestionWhich shaded area of the periodic table shown shows the location of elements that require the least energy to lose two electrons?QRST

168Criss-Cross ShortcutCa2+Cl1- Ca1Cl2 CaCl2 Criss-Cross Method for writing ionic compound formulas Rule: Value of oxidation # of cation becomes the subscript of the anion Rule: Value of oxidation # of anion becomes the subscript of the cation169QuestionAccording to this information, what is the chemical formula for sodium oxide?

NaONaO2Na2ONa2O2

Na1+O2-170QuestionAccording to this information, what is the chemical formula for magnesium fluoride?

MgFMgF2Mg2FMg2F2

Mg2+F1-171QuestionAccording to this information, what is the chemical formula for potassium sulfate?

K2SO4K4(SO4)2K2(SO4)2KSO4

K1+SO42-172Answer: A; Use criss-cross method.QuestionThe ionic compounds that result from combining Group 1 and Group 17 elements have a 1:1 ratio because a.Group 1 elements are electrically neutralb.Group 1 elements have one valence electronc.Group 1 elements contain neutrons in the nucleusd.Group 1 contains more elements than other groups

173We Like to Share!Covalent BondsNon-metals form bonds with non-metalsElements share electronsExamples: CO2, CH4 Carbon, Oxygen, and Hydrogen are all nonmetals174QuestionNitrogen forms covalent bonds with which of the following elements?

SodiumIronCarbonNeon175AnswerC; Carbon is a nonmetal.QuestionThe model above shows how an unidentified element, X, forms covalent bonds with oxygen. In which group on the periodic table does Element X most likely belong?Group 2Group 7Group 15Group 18

176Answer: C; Group 15 contains nonmetals which can form covalent bonds.Physical and Chemical Changes

Objective 4IPC(8) The student knows that changes in matter affect everyday life. The student is expected to:(A) Distinguish between physical and chemical changes in matter such as oxidation, digestion, changes in states, and stages in the rock cycle.177QuestionIn the rock cycle, which of these is a physical change involved with the formation of igneous rocks?

a. Compression of sedimentsb. Subduction of platesc. Heat loss from lavad. All of the above

178Answer: DQuestionSheets of ice containing mostly pure water can be formed by decreasing the temperature of saltwater. Which of these best describes this change?

Chemical change Nuclear changePhysical changeAtomic change

179Answer: CQuestionCompounds with the same chemical composition may have different densities because they

a. have differences in reactivityb. vary in solubility c. are able to bond with oxygend. exist in different phases

180Answer: D; solids most dense, gases least dense (exception: Water less dense as a solid; thats why ice floats). This is a very important concept when evaluating aquatic and marine ecosystems. What would happen to aquatic or marine life if ice sank rather than floated?Clues of a Chemical ChangeIdentity of material DOES change Ex: oxygen combines with iron to form iron oxide (rust)Includes all chemical changesWords to look for: Souring, rotting, decomposing, burning, changing, forming, producing, acid weathering, rusting, oxidizingMore words to look for: 181Words to Look For

A silver bracelet tarnishes. A bicycle is left out in the rain and begins to rust. Leaves on an oak tree turn red as winter approaches . Starches and sugars being broken down during energy production

Water and carbon dioxide being converted to glucoseIron in rock combining with oxygen to form hematiteAcid rain damaging marble182TarnishesRustTurn red (color change)Broken downConvertedCombining, to form (something new)Acid rain damaging (hint: if acid is involved, its a chemical change)

QuestionWhich of the following is an example of a chemical change?

a. Ice crackingb. Sugar dissolvingc. Milk souringd. Lead melting

183Answer: CQuestionWhich of these describes a pollution-producing process that involves a chemical change?

a.Coal with a high sulfur content is burned, producing gases that cause acid rain.b.Chlorofluorocarbons are released, changing ozone in the upper atmosphere into oxygen.c. Nitrogen oxide emissions combine with water vapor, producing nitric acid.d. All of the above

184QuestionWhich of these changes in rocks is NOT a chemical change?

a.Acid rain damaging marbleb.Carbonic acid weathering limestonec. Iron in rock combining with oxygen to form hematited. An ice wedge shattering a slab of shale

185Answer: DWater as the Universal SolventFactors Influencing Solubility

IPC(9): The student knows how solution chemistry is a part of everyday life. The student is expected to: (A) relate the structure of water to its function [as the universal solvent].(D) demonstrate how various factors influence solubility including temperature, pressure, and nature of the solute and solvent.

186Polarity is the Key!Water is the Universal Solvent Water is a polar moleculeSlightly negative at the oxygen atomSlightly positive at the hydrogen atomsLike dissolves likePolar molecules dissolve polar moleculesMost substances in nature are polar; therefore water dissolves most substances

187QuestionWhich factor makes water an effective solvent?

a. The presence of molecular oxygenb. Its lack of covalent bondsc. The polar nature of its moleculesd. Its abundance on Earths surface

188Answer: CQuestionThe structure of pure water makes it a good

a.solventb.catalystc.conductord.nutrient

189Answer: A; Water is polar and most substances in nature are polarQuestionWhich characteristic of water best explains its ability to dissolve a great variety of materials?

a.Its transparency in lightb.Its electrical conductivityc.Its physical state of matterd.Its molecular arrangement

190Answer: D; it is a polar arrangementQuestionThe graph shows the concentration of ions found in the water of the Dead Sea. Which property of water is responsible for the dissociation of salts that produces the ion concentrations shown in the graph?

a.Chemical stabilityb.High polarityc.Low melting pointd.High freezing point

191Answer: BQuestion

The diagram above shows water molecules and ions from an NaCl crystal. What is the most likely reason that each water molecule is arranged so that the oxygen part of the molecule faces a sodium ion?

a.The oxygen in a water molecule contains a partial negative charge. b.Gravity rotates the oxygen atoms to face the more-massive sodium ions.c.Hydrogen atoms create repulsive forces with chloride ions. d.Oxygen atoms form covalent bonds with sodium ions.

192Answer: AStructure and Unique PropertiesProperties of Water that Never Change Water always contains two hydrogen atoms bonded to one oxygen atom2:1 ratioFormula: H20Water expands when frozenBecomes less denseIce floats!! Very important to aquatic life!!

193QuestionIf the properties of water were to change so that the solid form was denser than the liquid form, organisms living in a cold pond environment would be less likely to survive because water would no longer

a.dissolve enough oxygen from the airb.produce solutions containing vital nutrientsc.remain neutral, instead becoming highly acidicd.produce a floating insulating layer of ice

194Answer: DQuestionFish survive through severe winters because of the property of water that allows water to

a.form chemical bonds as it freezes, raising the water temperature below the iceb.increase in density while it freezes, dissolving more oxygen from the airc.expand when it freezes, creating a floating and insulating layer of iced. precipitate vital nutrients when it freezes, increasing the food supply

195

Answer: CFactors of Solids Dissolved in LiquidsRecord the following notes under the flap label Solids Dissolved in Liquids -3 factors:temperatureExample: heat water to dissolve sugar when making iced teastirring/shakingExample: mixing Kool-Aid with a spoonsurface area of solid (particle size)Example: granulated sugar dissolves more quickly than sugar cubes

196QuestionA 0.2 g crystal of gypsum dissolves very slowly in 100 mL of water while the water is stirred. Which of these would cause the gypsum to dissolve faster? a. Increasing the water temperatureb. Raising the air pressurec. Stopping the stirringd. Use larger crystals

197Answer: a; solute dissolve more quickly at higher temperatures. QuestionThe table shows temperature and pressure in four containers holding the same amount of water. According to the table, in which container will the least sodium chloride be dissolved in the water?

a.Qb.Rc. Sd.T

198Answer: a; least solute will dissolve at the lowest temperatureQuestion 3A pharmaceutical company makes the claim that their caplet formulation of a pain reliever is fast acting. It is probable that this formulation

a. is a solid capletb. consists of a gel cap containing finely ground crystals of the pain medicationc. reduces fever in the user, aiding digestiond. reduces the gas pressure in the users stomach199Answer: b; density determines whether an object sinks or floats.Factors of Gases Dissolved in LiquidsGases Dissolved in Liquids 2 factors:temperature Example: a soda on ice will not go flat as quickly as a soda without ice.pressureExample: When soda is opened, carbon dioxide gas begins coming out of solution (bubbles rising)

200QuestionOver time an open soft drink will lose carbonation (dissolved CO2). Which of these allows the CO2 to remain in solution the longest?

a. Reduced air pressureb. Increased air currentsc. Exposure to direct sunlightd. Refrigerate the soda

201Answer: b; the cooler temperature reduces the rate at which the carbon dioxide is liberated.QuestionAbnormally hot summers can have a negative effect on aquatic life. This is because the higher temperatures

a. increases the pressure of rivers, ponds and lakesb.decreases sediment solubility in rivers, ponds and lakesc.increases the pH value of rivers, ponds and lakesd.decreases the dissolved oxygen in rivers, ponds and lakes

202Answer: b; density determines whether an object sinks or floats.QuestionMTBE is a gasoline additive that has entered some groundwater supplies. According to the table shown, which of the following water temperatures would allow 35 grams of MTBE to dissolve in 1 liter of water?a. 15Cb. 35Cc. 40Cd. 50C

203Answer: a; temperatures greater than 29.6C will dissolve 31 grams or less of MTBE