nucleotide sequence and gene organization of the starfish ... · nucleotide sequence and gene...

Copyright 0 1995 by the Genetics Society of America

Nucleotide Sequence and Gene Organization of the Starfish Asterina pednijkra Mitochondrial Genome

Shuichi Asakawa,*?' Hyouta Himeno,+ Kin-ichiro Miura*9' and Kimitsuna Watanabe"

*Department of Chemist? and Biotechnology, Faculty of Engineering, university of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113 Japan and +Department of Biology, Faculty of Science, Hirosaki University, Hirosaki 036, Japan

Manuscript received November 22, 1994 Accepted for publication March 20, 1995

ABSTRACT The 16,260-bp mitochondrial DNA (mtDNA) from the starfish Asta'napectinqera has been sequenced.

The genes for 13 proteins, two rRNAs and 22 tRNA are organized in an extremely economical fashion, similar to those of other animal mtDNAs, with some of the genes overlapping each other. The gene organization is the same as that for another echinoderm, sea urchin, except for the inversion of a 4 6 kb segment that contains genes for two proteins, 13 tRNA and the 16s rRNA. Judging from the organization of the protein coding genes, mammalian mtDNAs resemble the sea urchin mtDNA more than that of the starfish. The region around the 3' end of the 12s rRNA gene of the starfish shows a high similarity with those for vertebrates. This region encodes a possible stem and loop structure; similar potential structures occur in this region of vertebrate mtDNAs and also in nonmitochondrial small subunit rRNA. A similar stem and loop structure is also found at the 3' end of the 16s rRNA genes in A. pectinijera, in another starfish Pisasterochraceus, in vertebrates and in Drosophila, but not in sea urchins. The full sequence data confirm the presumption that AGA/AGG, AUA and AAA codons, respectively, code for serine, isoleucine, and asparagine in the starfish mitochondria, and that AGA/AGG codons are read by tRNA&, which possesses a truncated dihydrouridine arm, that was previously suggested from a partial mtDNA sequence. The structural characteristics of tRNAs and possible mechanisms for the change in the mitochondrial genetic code are also discussed.

T HE complete nucleotide sequence of animal mitochondrial DNA (mtDNA) has been reported for

human (ANDERSON et al. 1981), cow (ANDERSON et al. 1982), mouse (BIBB et al. 1981), rat (GADALETA et al. 1989), Xenopus (ROE et al. 1985), chicken (DESJARDINS and MORAIS 1990), whale ASON ON et al. 1991; &A- SON and GULLBERG 1993), fish (TZENG et al. 1992) and harbor seal (~LRNASON andJOHNSSON 1992) among vertebrates, and for Drosophila (CLARY and WOLSTEN- HOLME 1985; GARESSE 1988), honeybee (CROZIER and CROZIER 1993), shrimp (VALVERDE et al. 1994) and nematode (OKIMOTO et al. 1992) among invertebrates. While genome size (13-20 kb) and gene constituents (22 tRNA, 2 rRNA and 12 or 13 proteinencoding genes) are well conserved among these animals, the gene organization and the genetic code are fairly diver- gent.

Recently, the sequences of several echinoderms, e.g., the complete nucleotide sequences of two sea urchin species, Strongylocentrotus puquratus (JACOBS et al. 1988) and Paracentrotus liuidus ( CANTATORE et al. 1989), partial

Corresponding author: Kimitsuna Watanabe, Department of Chemis- try and Biotechnology, Faculty of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.

' Present address: Department of Molecular Biology, Keio University School of Medicine, Shinanomachi, Shinjuku-ku, Tokyo 160, Japan.

Present address: Institute for Biomolecular Science, Gakushuin Uni- versity, Mejiro, Toshima-ku, Tokyo 171, Japan.

Genetics 140 1047-1060 (July, 1995)

sequences of several starfishes (HIMENO et al. 1987; JA- COBS et al. 1989a; SMITH et al. 1989, 1990) and a third sea urchin, Arbacia lixula (GIORGI et al. 1991), have been reported. Genome size and gene content in sea urchin mitochondria are almost the same as those in other animal mitochondria. The gene arrangement, however, is distinct from those of other animals, such as vertebrates and Drosophila. Unlike the dispersed type of tRNA gene arrangement in other animal mtDNAs, the tRNA gene arrangement in echinoderm mtDNA is highly clustered, containing 13 tRNA genes (JACOBS et al. 1988, 1989a; CANTATORE et al. 1988, 1989). It was also found that a 4.6-kb region containing the 13-tRNA gene cluster is inverted between starfish and sea urchins (SMITH et al. 1989). The gene inversion observed between the two echinoderm classes led to the finding that a certain constraint operates on the mitochondrial genomes not only of echinoderms but also of various other animal phyla, which results in the accumulation of G and T on one strand and A and C on the other (ASAKAWA et al. 1991; OKIMOTO et al. 1992).

In contrast to the nonmitochondrial universal code, the genetic code in mitochondria is considerably diversified from lower eukaryotes to higher eukaryotes (BAR- RELL et al. 1979; JUKES and OSAWA 1990; OSAWA et al. 1992). Probably as a consequence of this, the primary, secondary and tertiary structures of mitochondrial tRNAs do not resemble their standard nonmitochon-

1048 S . Asakawa et al.

drial counterparts (DE BRUIJN and KLUC 1983; UEDA et al. 1985; KUMAZAWA et al. 1989; SPRINZL et al. 1989; YOKOGAWA et al. 1989, 1991; OKIMOTO and WOLSTEN- HOLME 1990). Based on a partial sequence of the starfish Asterina pectinifera mtDNA, the codons AGA/AGG, AUA, AAA and UGA, respectively, were proposed to code for serine, isoleucine, asparagine and tryptophan in starfish mitochondria (HIMENO et al. 1987). Later sequence accumulations of echinoderm mtDNAs suggest that all of these nonstandard codon assignments are applicable not only to other starfishes but also to sea urchins (JACOBS et al. 1988, 1989a; CANTATORE et al. 1989; SMITH et al. 1989, 1990). The diversity of the genetic code in animal mitochondria is considered to be directly related to the sequence and/or structural characteristics of mitochondrial t R N A s , especially those around the anticodons (OSAWA et al. 1992).

In this study, we present the complete nucleotide sequence of the starfish A. pectinifera mitochondrial genome, which has revealed similarities and differences among mtDNAs of A. pectinifea, other starfishes, sea urchins and other animals.

MATERIALS AND METHODS

Extraction, cloning and sequencing of A. pectinijiia mitochondrial DNA Extraction of A. pectinifea mitochondrial DNA and construction of its restriction map were described previously (HIMENO et al. 1987). Each cloned fragment was further digested with EcoRI and/or Hind111 and subcloned into pUC18 or pUC19. An 11-kb fragment of BamHI-A and a 1-kb fragment of BamHI-C were cloned into plasmid pBR327 as described previously (HIMENO et al. 1987). For sequencing, deletion mutants were constructed essentially based on the methods of HENIKOFF (1987) and YANISCH-PERRON et al. (1985). A 2-kb fragment of BamHI-XbaI and a 1-kb fragment of EcoRI-Sal1 within the BamHI-B region were cloned into pUC18. The remaining 1-kb SalI-BamHI fragment, which was not successfully cloned, was amplified by using the polymerase chain reaction method followed by direct sequencing (SAIKI et al. 1988). The DNA sequence was obtained from both strands using the dideoxy chain termination method (MESSING 1983).

RESULTS AND DISCUSSION

Nucleotide sequence and gene organization: The complete nucleotide sequence of A. pectinifea mtDNA (16,260 bp) was determined and deposited to the GENE Bank (EMBL accession number: D16387). It contains the genes for cytochrome oxidase subunits I, I1 and I11 (COZ, 11 and 114, cytochrome b (Cyt 6 ) , NADH dehydrogenase subunits 1-6 and 4L (A?D1/6 and 4L), ATPase subunits 6 and 8 (ATPase 6 and 8), two rRNAs and 22 WAs. The contents are identical to those for vertebrates, Drosophila and sea urchin. The genome size 16,260 bp is similar to those of other metazoan species (ANDERSON et al. 1981, 1982; BIBB et al. 1981; CLARY and WOLSTENHOLME 1985; ROE et al. 1985; GADA- LETA et al. 1989; GAREY and WOLSTENHOLME 1989; DES JARDINS and MORAIS 1990; CROZIER and CROZIER 1993)

and is slightly larger than its sea urchin counterparts [15,650 bp for S. purpuratus (JACOBS et al. 1988) and 15,697 bp for P. lividus (CANTATORE et al. 1989)I. These size differences among echinoderm species are mainly due to differences in the length of the unassigned non- coding sequence regions, as described below.

The gene organization is summarized in Figure 1. One of the most conspicuous features in A. pectinifera and three other starfish mtDNAs, together with mtDNAs of two sea urchins, S. purpuratus and P, lividus. (JACOBS et al. 1988, 1989a; CANTATORE et al. 1988, 1989), is the presence of a cluster of 13 tRNA genes (JACOBS et al. 1989a). In vertebrate mtDNAs, the tRNA genes, whose secondary structures in the mitochondrial transcripts are thought to serve as signals for RNA processing ( O J ~ et al. 1981), are dispersed either singly or in small clusters between the protein and rRNA genes (Figure 1). This situation is also true for mtDNAs for Drosophila and nematodes (CLARY and WOLSTEN- HOLME 1985; OKIMOTO et al. 1990, 1992). Thirteen is the largest number of tRNA genes comprising a single cluster among various animal mtDNA sequences so far reported. As a result of this tRNA gene clustering, seven (in starfish) and eight (in sea urchin) adjacent protein/ protein or protein/rRNA gene pairs lack an intervening tRNA gene (Figure l ) , possibly implying a different manner of pre-mRNA maturation and/or gene expression in echinoderm mitochondria from those proposed for vertebrate mitochondria (MONTOYA et al. 1981; OJALA et al. 1981).

A significant difference between the otherwise highly similar starfish and sea urchin mtDNAs is an inversion of the 4.6-kb region ranging from the tRNAp" gene to the 16s rRNA gene (Figure 1) (SMITH et al. 1989). Sev- eral cases of mitochondrial gene rearrangement between phylogenetically close species have been reported. For example, the tRNAG'" and hD6 gene positions differ between chicken and other vertebrates (DESJARDINS and MORAIS 1990), the position of the AT- rich region differs between the nematodes, Ascaris suum and Caenorhabditzs elegans (OKIMOTO et al. 1990, 1992), and several other cases have been described, most of which involve tRNA gene arrangement (MORITZ and BROWN 1986,1987; YONEYAMA 1987; HAUCKE and GELLI- SEN 1988; P m o et al. 1991). In echinoderm mtDNA, the large sequence inversion between starfish and sea urchins is unaccompanied by any tRNA gene rearrangement, and no other gene rearrangement between these echinoderms is observed in the remaining l l .6kb region. The order of each gene is conserved within the sea urchins, S. purpuratus (JACOBS et al. 1988) and P. lividus (CANTATORE et al. 1989), and within the two starfishes, A. pectinifera and Pisaster ochraceus (SMITH et al. 1990), indicating that this gene inversion occurred after starfish and sea urchin diverged but before the divergence in the lines leading to the two sea urchins or the two starfishes.

Starfish Mitochondrial Genome 1049

FIGURE 1.-Gene organization of A. pectinijiiu mitochondrial genome compared with that of sea urchin mtDNA. Each protein gene is designated between the inner and outer circles with the transcriptional polarity (arrow), using the abbreviations given in the text, except that the ATPase 8 gene is abbreviated as 8. Transfer RNA genes are shown outside the circles by a single- letter designation with the polarity given by hatched arrowheads. The isoacceptors of serine and leucine tRNAs are defined with corresponding anticodons in parentheses. W and 0 in the inner circle of the A. pectinifiiu genome respectively indicate the locations of the 140- and 53bp unassigned sequences. The numbers in parentheses inside the inner circle show the locations of the TTATATATAA sequence with 9-10 matches (Figure 5 ) . The 4.6kb segment inverted between starfish and sea urchin mtDNAs is designated by thick lines. The region without any designation between 16s rRNA and tRNAThe genes in the starfish genome, or between tRNAp'" and tRNAThe genes in the sea urchin genome shows the putative displacement loop region (see text).

On the basis of the high sequence similarity between the two leucine tRNA genes, CANTATORE et al. (1987) hypothesized that in sea urchin the present gene has been generated by a duplication of the tRNAg& gene and that the sequence corresponding to the old gene has lost its original function but remains in its original position as an extension of the 5' end of the ND5 gene. High sequence similarity of the two leucine tRNA genes and the existence of a similar 5' extension of the ND5 gene are also observed in mtDNAs of A. pectinijkra and another starfish, Asterias forbesii (JACOBS et al. 1989a).

Another characteristic of the A. pectinifera mtDNA lies in the different arrangement of the genes for 16s and 12s rRNAs. In contrast to their adjacent location on the same strand in vertebrate and Drosophila mtDNAs, they are located on different strands and separated by the putative displacement loop region and two tRNA genes in A. pectinifera mtDNA (Figure 1). In sea urchin mtDNA, the 16s and 12s rRNA genes are located on the same strand but are separated by the ND1 and ND2 genes as well as the 13 tRNA gene cluster (JACOBS et al. 1988; CANTATORE et al. 1989).

Vertebrate and sea urchin mtDNAs share the common feature that the two rRNA genes and the 12 protein genes, except for the ND6 gene, are encoded on the same strand. In terms of the genes for protein and ribosomal RNAs, transposition of only three genes (the genes for 12s and 16s rRNAs, and ND4L) is sufficient for interconversion of the gene arrangements between

vertebrate and sea urchin mtDNAs (CANTATORE et al. 1987), while an additional gene inversion is required to interconvert the vertebrate and starfish arrangements. Judged from this viewpoint, the gene arrangement of sea urchin is ancestral to that of starfish. Recently, gene arrangements within the 4.6-kb mtDNA region in other echinoderms (brittle star and sea cucumber) were found to be different from that in either starfish or sea urchin (SMITH et al. 1993).

Protein genes: The A. pectinifera mitochondrial genome encodes the same 13 proteins encoded by other animal mtDNAs (Figure 1). The NDl and ND2 genes of A. pectinijma encoded in the inverted 4.6-kb region have significantly lower similarity with those of human than sea urchin (ASAKAWA et al. 1991). In contrast, the other protein and rRNA genes show the reverse ten- dency, which is thought to result from the strand-specific AC(GT) pressure operating on echinoderm and vertebrate mitochondrial genomes. The bias in strand- specific base composition has exerted a powerful influ- ence not only on the first and second codon positions, but on the third codon position as well, and on the resulting amino acid compositions in the proteins (&A- KAWA et al. 1991 ) .

Comparison with many other mtDNA sequences shows that not only ATG but also ATT and GTG appear to be used as initiation codons (Table 1). The A D 1 and ND5 genes start with GTG, and there is no spacer nucleotide between the GTG and the upstream tRNA gene. With a few exceptions such as the COI gene of

1050 S. Asakawa et al.

TABLE 1

Number of amino acids and initiation and termination codons of the 13 proteins encoded in A. pednij i i mtDNA

No. of Initiation Termination Gene amino acids codon codon

m1 326 GTG TAG m2 354 ATG TAA m3 110 ATT TAG m4 460 ATG TAA m 4 L 98 ATT TAA m5 643 GTG TAA ND6 162 ATG TAA cor 51 7 ATG TAA COII 229 ATG T COIII 260 ATG TAA ATPase4 230 ATG TAA ATPase8 54 ATG TAA Cytb 380 ATT T"

"The complete termination codon UAA is considered to be produced by polyadenylation in the mRNA processing.

chicken (DESJARDINS and MORAIS 1990), no extra nucleotide is present between the vertebrate mitochondrial genes that start with GTG, ATT or ATC, such as the A?DI genes of mouse and rat (GADALETA et al. 1989). For GTG, this no-extra-base rule is widely applicable to metazoan mitochondrial genes, such as the ND5 gene of Drosophila (CLARY and WOLSTENHOLME 1985) and ATPase 8gene of sea urchin (JACOBS et al. 1988; CANTA- TORE et al. 1989). In nematode mitochondria, several genes have been recently found to initiate with TTG or GTT, and no spacer nucleotide exists between these aberrant initiation codons and their upstream genes ( OJLIMOTO et al. 1990).

The ATPase 8 and ATPase 6 genes of starfish overlap each other by 16 nucleotides with a -1 frameshift. A similar overlap is found among metazoan mitochondria, although the degree of overlap varies (ANDERSON et al. 1981,1982; BIBB et al. 1981; ROE et al. 1985; DESJAR- DINS and MORAIS 1990; JACOBS et al. 1988; CANTATORE et al. 1989).

Many genes terminate with a TAA codon, and ND1 and ND3 genes terminate with TAG. However, only one T residue intervenes between COII or Cyt b genes and their downstream tRNA genes, and a canonical termination codon is absent. In this case, polyadenylation after the cleavage of the tRNA gene by ribonuclease would produce a complete termination codon, TAA, as was demonstrated in human (Table 1) (ANDERSON et al.

Genetic code: A partial sequence of A. pectinifera mtDNA suggested that an unusual genetic code occurs in starfish mitochondria (HIMENO et al. 1987). Informa- tion from the full sequence facilitates more precise comparisons of codon usage with that of other animals and leads to the conclusion that AGA/AGG, AUA, AAA and UGA in starfish mitochondria code for serine, iso-

1981; OJALA et al. 1981; CLA'rTON 1991).

leucine, asparagine and tryptophan, respectively (Table 2), and the code appears to be identical with that in sea urchin mitochondria (JACOBS et al. 1988; CANTATORE et al. 1989). The use of AGA and AGG codons to specify serine is a characteristic that is widely distributed among metazoan mitochondria, e.g., in nematodes (OKIMOTO et al. 1990), platyhelminths (GAREY and WOLSTEN- HOLME 1989), molluscus (HOFFMANN et al. 1992) and arthropods (DE BRUIJN 1983; CLARY and WOLSTEN- HOLME 1985; CROZIER and CROZIER 1993), although the AGG codon does not occur in Drosophila mtDNA (CLARY and WOLSTENHOLME 1985; GARESSE 1988). In vertebrate mitochondria the AGA and AGG codons are thought to work as stop codons (ANDERSON et al. 1981, 1982; BIBB et al. 1981; ROE et al. 1985; GADALETA et al. 1989; OSAWA et al. 1989a; DESJARDINS and MORAIS 1990). Both AUA and AAA codons specify isoleucine and asparagine, respectively, in platyhelminths, but in other metazoan phyla they specify methionine and lysine, respectively (GAREY and WOLSTENHOLME 1989; OSAWA et al. 1989b, 1992; O m et al. 1990). Like other animal mitochondria (OSAWA et al. 1992), A. pectinifma mitochondria utilize UGA as a tryptophan codon.

Possible mechanisms by which amino acid assignments of codons may have changed can be reasonably explained by the codon capture hypothesis (OSAWA and JUKES 1989; OSAWA et al., 1992), in which the amino acid assignment of a codon could not change until the codon entirely or nearly disappeared from the genome. It is relatively easy for a codon to disappear from metazoan mtDNA for two major reasons: the small number of genes present and the high substitution rate (BROWN et al. 1982). In addition, the genetic code changes would involve changes of the tRNA structures, especially changes around their anticodons, as discussed in the following sections.

Structures of tRNA genes: Relative to nonmitochondrial systems, animal mtDNAs encode a small number of tRNA species (usually 22), which is supposed to be a result of strong pressure for economization of genome size (ANDERSON et al. 1981, 1982; BIBB et al. 1981; CLARY and WOLSTENHOLME 1985; ROE et al. 1985; W O L ~ TENHOLME et al. 1987; GADALETA et al. 1989; DESJARDINS and MORAIS 1990; OKIMOTO et al. 1992). This is also the case for A. pectin@a mtDNA. The clover leaf structures of 22 tRNAs deduced from the mtDNA sequence of A. pectinifera are shown in Figure 2.

In general, tRNAs have an L-shaped tertiary structure that is maintained by tertiary hydrogen-bonding between conserved nucleotides, such as the GG sequence in the dihydrouridine-loop (DHU-loop) and the TQCRA (T, ribothymidine; Q, psuedouridine; R, pu- rine) sequence in the T-loop (WOO et al. 1980). HOW- ever, these invariant or semi-invariant nucleotides are not conserved among metazoan mitochondrial tRNA (WOLSTENHOLME 1992; KUMAZAWA and NISHIDA 1993). In addition, the number of nucleotides comprising the


TABLE 2

Genetic code and codon usage of the A. pedinifm mitochondrial genome

l"r Phe 203 'ITC Phe 113 TTA Leu 146 TTG Leu 65

C7T Leu 129 CTC Leu 72 CTA Leu 169 CTG Leu 34

A7T Ile 129 ATC Ile 66 ATA Ile 177 ATG Met 78

GTT Val 84 GTC Val 38 GTA Val 81 GTG Val 37

TCT Ser 94 TCC Ser 86 TCA Ser 67 TCG Ser 23

CCT Pro 59 ccc Pro 62 CCA Pro 47 CCG Pro 8

ACT Thr 72 ACC Thr 105 ACA Thr 69 ACG Thr 15

GCT Ala 58 GCC Ala 76 GCA Ala 78 GCG Ala 20

DHU-and T-arms is variable in mitochondria. As extremely unusual examples, the mammalian mitochondrial tRNGu lacks the DHU-arm (ARCARI and BROWNLEE 1980; DE BRUIJN et al. 1980; UEDA et al. 1985), and the nematode mitochondrial tRNAs lack either the DHU- or T-arm (WOLSTENHOLME et al. 1987; OKIMOTO and WOLSTENHOLME 1990). Besides this, many base pairs other than the Watson-Crick base pair exist in the stem regions of animal mitochondrial tRNAs. From these characteristics, it is thought that tRNAs of animal mitochondria have a loosened (less extensively intramo- lecular hydrogen-bonded) tertiary structure, and there is evidence for this from biochemical and biophysical studies (DE BRUIJN and KLUC 1983; UEDA et al. 1985; KUMAZAWA et al. 1989; YOKOCAWA et al. 1989; WAKITA et al. 1994). The only exception is the sea anemone system, in which the tRNA"' gene has the standard invariant nucleotides involved in the tertiary folding (PONT- KINGDON et al. 1994). In A. pectinijima, the DHU-arm of the t R N e u gene is too short to assume a normal stem and loop structure as has been observed for this tRNA species in other animal mitochondria. Other structural anomalies are also inferred from the sequences of several tRNA genes, although they are within the range of variations observed for other mitochondrial tRNA genes.

In mammalian mitochondria, only three tRNA genes possess a set of the consensus GG and TTCRA sequences (ANDERSON et al. 1981, 1982,; BIBB et al. 1991), but these sequences do not exist in any of the Drosoph- ila, Apis and A. mum mitochondrial tRNA genes (CLARY and WOLSTENHOLME 1985; WOUTENHOLME et al. 1987; CROZIER and CROZIER 1993). In A. pectznijma, seven tRNA genes possess both GG and TTCRA sequences (Figure 2). Other nucleotides involved in the tertiary interactions, which are conserved among nonmitochondrial tRNA, are also found in A. pectinifera mito-

TAT TYr 52 TAC TYr 67 TAA Ter 9 TAG Ter 2

CAT His 23 CAC His 61 CAA Gln 64 CAG Gln 19

AAT Asn 41 AAC Asn 58 AAA Asn 112 AAG LYS 48

GAT ASP 21 GAC ASP 48 GAA Glu 65 GAG Glu 22

TGT Cys 14 TGC CYS 21 TGA Trp 78 TGG Trp 24

CGT '4% 8 CGC k g 5 CGA k g 45 CGG k g 14

AGT Ser 23 AGC Ser 23 AGA Ser 54 AGG Ser 19

GGT 38 GGC

112 G1y 32

GGA GlY GGG GlY 50

chondrial tRNA genes, as described below. The invariant nucleotide U at position 8 is usually involved in a tertiary interaction with A14 in standard tRNA molecules. In A. pectinijima mitochondria, T8 exists in no less than 17 tRNA genes, all having A14 in the DHU-loop. A reverse Watson-Crick type of tertiary base pairing, G15-C48 or A15-T48, occurs in 11 tRNA genes. The standard base-triples, A9-T12-A23 and G10-C (T) 24G46, also appear in 10 and 5 of the 22 tRNA genes, respectively. These consensus interactions are also postulated for sea urchin mitochondrial tRNA genes, albeit in a smaller number of tRNA genes (JACOBS et al. 1988; CANTATORE et al. 1989).

Possible decoding mechanism: Most anticodon sequences of A. pectinifera mitochondrial tRNA genes are the same as those of the vertebrate counterparts, while a few, which are probably related to the diversification of genetic codes, are different (Table 3).

The vertebrate mitochondrial tRNALys gene has the anticodon TTT corresponding to the lysine codons AAA and AAG (ANDERSON et al. 1981, 1982; BIBB et al. 1981; ROE et al. 1985; GADALETA et al. 1989; DESJARDINS and MORAIS 1990), whereas the A. pectinijima tRNA1+ gene has the anticodon CTT, which is suitable for specifylng the single lysine codon AAG. On the other hand, tRNAh" gene of both vertebrate and A. pectinijma mitochondria has the anticodon GTT. On the basis of the starfish asparagine codons, AAU, AAC and AAA, the anticodon first letter GS4 would probably be modified. Inosine is a most probable candidate for facilitating such a coding mechanism; however, it is known to be derived usually from an A in nonmitochondrial systems (FOURNIER et al. 1983; SPRINZL et al. 1989). An alterna- tive possibility is that GS4 is modified to 8 - 0 ~ 0 G, as in some DNAs, so that it can pair with C, U, and A (SHIBU- TANI et al. 1991). Insect mitochondrial tRNALp possesses the anticodon CUU, which should recognize not only


G.T T

C- G

0- C T- A

A- T

GOT A

T-A T-A

C -0 T-A

C G T A A

0 A-T A- T A- T 0-C A- T G- C

A A A ~ T G A U TAGTCCCAC C- 0

* A T A A C C t T c T G ~ ~ A c C-GA T C-C A A-T

TA '0

A I I I I I I I I I

G-C tRNAhp

T CA

G.T T

0-C T-A T-A T-A T-A

A A T c T Q A ~ G - C T C C C T ~ T

T A A C A U T GCGGGTA T I l l * * I l l * A

T T A O ;

A- T T-A B

TA - T 0-c tRNAQ'

T A G C A

A

G.T T

C-0

GOT T-A

0-C 0-C

A- T T

G O T T-A A- T A- T

A 0-C A-T TOG T .G GOT 0-C G-C

ATAGACGG' T T T C C T ~ A .I I I I A

B Q G A T G C ~ G I l l GAAGGu

+-:-"A GTA A- T G-C

f-T tRNATv A AA

A C-G C T T T 0-C 0-C

FIGURE 2.-Cloverleaf representations of the 22 tRNA genes of A. pectinijima m i t e chondria. Each GT or T-G pair is shown by a dot. The nucleotides that Dossiblv contrib-

A G-C T-A 0-C

ute to tertiary folding of kNAs are high- lighted in outline (see text). Nucleotide numbering is according to SPRINZL et al.

0-C ( 1989).

AAG but also AAA codons (HSUCHEN et al. 1983; CLARY and WOLSTENHOLME 1985). In this case, Cs4 may be modified so as to pair with A as well as G, as discussed below, or the anticodon may be converted to UUU in the actual tRNALys by RNA editing. Recently, RNA editing has been reported in a tRNA anticodon (GCC to GUC) in marsupial mitochondria, which leads to a change of coding specificity ( JANKE and P ~ o 1993).

Several studies on bacteria have shown that regions other than the anticodon can affect coding specificity (YARUS 1982; YARUS et al. 1986; MURGOLA 1990). These nonmitochondrial examples made it necessary for us to extend our consideration of a possible mechanism of coding divergences in mitochondria to the whole nucleotide sequence of the anticodon loop (Table 3). In nonmitochondrial systems, with a few exceptions described below (SPRINZL. et al. 1989), the position imme-

diately 5' to the anticodon (Nss) is always occupied by U, which provides a hairpin turn of the anticodon loop so as to facilitate a smooth and specific codon-anticodon pairing (KIM and SUSSMAN 1976; SUNDARALINGAM et al. 1976; WOO et al. 1980). tRNASe' corresponding to the CUG codon in some Candida species have Gss (YOKOGAWA et al. 1992; SANTOS et al. 1993; SUZUKI et al. 1993), and the eukaryotic initiator tRNAsMet have Css, the latter of which is supposed to be involved in the initiation step by pairing with the single AUG codon ( S ~ R M A N et al. 1979; WOO et al. 1980). Position 33 in animal mitochondrial tRNA genes is almost always occupied by U (SPRINZL et al. 1989). In A. pectanijiiu, only W A F A and tRNAkn genes have C at this position (Figure 2). In tRNAhn gene, Css appears only in echinoderms, and, instead, Ts3 appears in the other animals reported (Table 3) (SPRINZL et al. 1989). Thus, Cs3 in


T * G A'

A T

C- 0 A

A- T

G-C A

0 0 A I A- T A- T G - C

T A A ~ ~ ~ ~ A T ~ - ~ T T T c c ~ ~ A I I I I I A

A ~ A ~ * ~ ~ A A - T A V c' I l l 1 A A A G G T T ~

0-C A-T A A

C-G ~ R N A P ~ * C A

A C

T A 0 A A

G * T T

A- T 0 - C C-0 T * G T-A

+ - C C T T C C T ~ A GAA?!CCT AAA&LTT,"

"T AGGACA A T-AT 'A

0-0 TG T-A kT tRNA"

CG

T~ AT^

f - r , A-T tRNAAw A-T

T C T O

T C G

A-T A C

A ~ T u T G A # + C ~ ~ ~ ~ ~ C A ~ I I I I I A

A ' 1 I I A C C A G T T ~

T-A A A- T .-r tRNA""

A-T T

T- A T- A T- A T- A

c G-C A- T A- T A-T 0 0

T

'c C A T A G * T G A 0-C

T A C A

C-G tRNA="

G C T

echinoderm mitochondrial tRNAh" is thought to be involved in a special anticodon-loop structure, which may facilitate an unorthodox G,,-A wobble pairing, or it may serve as a signal for modification of GS4 into an inosine-like or 8 oxo-Glike base.

A similar situation is observed for tRNAMet and tRNA"' genes. The AUN codons are largely divided into two groups. In echinoderms, the anticodon CAT of tRNAMet gene corresponds to the AUG codon, and the GAT of tRNA1Ie gene corresponds to AUA, AUC and AUU codons. This seems also to be the case for platyhelminths (GAREY and WOLSTENHOME 1989). On the con- trary, the AUA codon, as well as AUG, appears to be read as methionine by the anticodon CAU of tRNAMet in mitochondria of vertebrates, arthropods (CLARY and WOLSTENHOLME 1985) and nematodes (WOLSTEN-

This categorization based on sequence difference of HOLME et al. 1987).

FIGURE 2.- Continued

AUN codons corresponds well with the whole anticodon loop sequence of tRNA"' gene (Table 3). The loop sequence of echinoderms tRNAILe gene is CTGATAA, and that of vertebrate and arthropod mitochondria, and the nonmitochondrial system is TTGATAG. E hepat- ica tRNAILe gene possesses the GTGATAT sequence ( GAREY and WOLSTENHOLME 1989). It seems likely that the presumed differences in the conformation or base modification (BJORK et al. 1987; BJORK 1992) of the anticodons due to the sequence varieties of the whole anticodon loop (in some cases, including those of the anticodon stem) are closely related to the coding irreg- ularities in mitochondria.

The possibility of base modification should be taken into consideration. A single modification from C to L (lysidine, 2-lysyl cytidine) at the first position of the anticodon of Escherichia coli minor tRNA1Ie can dictate both the acceptor identity of the amino acid and the


TABLE 3

Anticodon loop sequences of tRNA"', tRNAne, tRNAh, tRNALP and tRNA&'GCU genes in metazoan mitochondria

Vertebrate T T m A G *

( A U C / U )

Drosophila T T W A G

( A U C / U )

Mytilus T T m G A

( A U C / U )

Ascaris T T m A A

( A U C / U )

Fasciola G T m A T

( A U C / U / A )

Sea urchin C T E A A * * *

( A U C / U / A )

Starfish C T S A A * * *

( A U C / U / A )

C C E A C

( A U G / A )

T T G A C

* * *

* * *

( A U G / A )

C T G A C C C Z A C

* * *

( A U G / A )

T T G A C * * *

( A U G / A )

-

C T E A C

( AUG )

T T W A C

( A U G )

C T E A A

( A A C / U )

C T m A A

( A A C / U )

C T m A A

( A A C / U )

C T m G A

( A A C / U )

C T m A A

( A A C / U / A )

C C E A A

( A A C / U / A )

C C m A A

( A A C / U / A )

* * *

* * *

* * *

C T m A A * * *

( A A G / A )

C T m A A * * *

( A A G / A )

C T m A A * * *

( A A G / A )

T T m A A

( A A G / A )

T T m A C

( AAG )

C T m A A

( AAG )

C T m A A

( AAG 1

* * *

C T m A A

( A G C / U )

C T m A A * * *

( A G C / U / A )

C T m A A * * *

( AGN

C T m A A

( AGN 1 C T m A A

( AGN

C T a A A

( AGN 1 C T a A A

( A G N )

* * *

* * *

* * *

* * *

Data were obtained from ANDERSON et al. (1981, 1982), BIBB et al. (1981), DUBIN and HSUCHEN (1984), CLARY and WOLSTEN- HOLME (1985), WOLSTENHOLME et al. (1987), JACOBS et al. (1988), CANTATORE et al. (1989), GADALETA et al. (1989), SPlUNZL et al. (1989), DESJARLHNS and MORAIS (1990), GAREY and WOLSTENHOLME (1990), OW et al. (1990) and HOFFMANN et al. (1992). Anticodon triplets are underlined. The anticodons corresponding to the AUA, AAA and A G A / G codons are designated by triple asterisks. The codons corresponding to each anticodon are designated by parentheses. * in chicken mitochondria the sequence is A T K A G (DESJARDINS and MORAIS 199O).--Fasciola tRNAMe' gene has not been sequenced.

coding capacity of the AUA codon (MURAMATSU et al. 1988a,b). Therefore, modification at the anticodon first position of tRNAMet, if any, can explain the decoding mechanism of the AUA codon in the echinoderm mite chondria (OSAWA et al. 1989b). The genome of Mytilus edulis mitochondria, in which AUA codes for methionine, may possibly encode two methionine tRNA genes, one possessing the anticodon loop sequence CTCATAC and the other possessing CCTATAC (HOFFMANN et al. 1992). If the former tRNA acquired the recognition capacity of AUA, the latter would become dispensable and then could be deleted under the pressure of genome-size economization.

The anticodon GCT of tlWsu gene is phylogenetically well conserved among many animal species, although coding of AGN codons in mitochondria has been considerably diversified (OSAWA et al. 1989a; SPRINZL et al. 1989). AGA and AGG codons are used for termination in vertebrate mitochondria, while in starfish mitochondria, they appear to code for serine (HIMENO et al. 1987). The partial sequence of A. pectinijkra mtDNA suggested that these two codons are read by the tRNA%' with the GCT anticodon (HIMENO et al. 1987). The fact

that no tRNA-like cloverleaf sequence possessing a TCT anticodon is found in the entire A. pectinijia mtDNA sequence (Figure 1) strongly supports this view. Thus some unknown mechanisms may be operating in the starfish mitochondrial decoding system, since the anticodon first letter G is usually capable of interacting with only C or U, but not with A or G, at the third position of the codon. The first letter of the anticodon of t12NGu has been shown to be an unmodified G in both mammalian and mosquito mitochondria, in which AGA and AGG are used as termination codons for the former and only AGA is used as a serine codon for the latter (ARCARI and BROWNLEE 1980; DE BRUIJN et al. 1980; DUBIN et al. 1984; UEDA et al. 1985).

Most metazoan mitochondrial t R N G u genes share a common anticodon loop sequence, CTGCTAA, irrespective of their anticodon recognition properties (Ta- ble 3). Failure of modification from G to queuosine (Q at the anticodon first position of plant cytoplasmic tRNATF (anticodon GQA) causes a readthrough of the UAG termination codon (BEIER et al. 1984). This could generalize the notion that the unmodified G at the anticodon first position possesses the potential to form G34-A and/or G,,-G wobble pairings in certain contexts.


S.pu,purahc~ GGAGACAAGTCGTAACACAATAGGCACACCGGA"--CCCGAAAATGCCC-CTATAGTTGAAACA * * * * * ******I.*** ***** * * ******** tt * * . . r- A"

~ N A Q ~ - A A A A A A A 41: 9 *..*.*******..*** *****

P. lividus GGAGAAAAGTCGTAACACAATAGGCACACCGGAAGCCKGAA&+$2CTC-CTATAGTEAACTA ****ttt*.t t .* * *

tRNA - IG- C C- G ." c-c

T 9 G A. pectinifem

human .*.*. *...** *.*** *** GGAGACAAGTCCTAACATGGTAAGT-----GTA---CTGGAAAGTGTGCACTCGAACCAG

+** **.**. * * * * ** * * * * $1 $ tJ3NAQ'+

A-WA~* AAGT. GGCACAAATAT

D.ydub0 TAAGATAAGTCGTAACATAGTAGAT-----GTA---C!EGAAAGTGTAT-CTAGAAlGACAAlT *.* **..*..**** *...* .*t .****. * * * * ***

G A

T-A - IRNAV* G A

D. y a " "

tRNAVv.' i

A

P. lividus

(dl - T c A C c M l r c C A C M ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ C F ~ r ~ ~ A ~ ~ ~ A C F A ~ A ~ A C ~ A C A C ~ A ~ M ~ ~

A.praini/rO ~ C c M l r c C A C C A C ~ ~ ~ ~ ~ A ~ C F A ~ ~ ~ ~ ~ ~ T ~ ~ ~ ~ r ~ ~ A ~ ~ ~ ~ ~

P. OChrOlXvt C F A C c M l r C C A C C l r C M M o T A o r A C ~ ~ ~ ~ ~ ~ A ~ ~ ~ ~ ~ ~ ~ M ~ ~ ~ ~ A G Q ~

- - S.pu?pnrahu C F A C D A A A G C A C C C F ~ A ~ ~ ~ G M ~ ~ ~ ~ ~ ~ ~ ~

P.liVidvt C F A C ~ c C A C Q c C A T M ~ ~ A r ~ A G A C A ~ C F A ~ ~ ~ ~ ~ ~ C A ~ ~ M ~

FIGURE %-(a) Sequence alignment of the 3' regions of mitochondrial 12s rRNA genes of A . p d n i j i i n , S. purj,ztm/us (JA(:oBs et nl. 1988), P. h i d w (CANTATORE el nl. 1989). human (ANDERSON e& nl. 1981) and D. ynkubn (CIARY and ~TOI.sTI~.NIIOI.ME 198.5). Arrows indicate the 5' terminals of tRNA genes downstream of the 12s rRNA genes and their polarities. Gaps in sequence homology are shown by bars. *, nucleotides that occur in the A. pwtinijiin sequence. Arrowheads indicate the 3' termini of the major 1% rRNA transcripa as determined in human and S. purjlurntzcs mitochondria. (b) Possible stem and loop structures occurring in the 3' terminal region of the 12s rRNA gene in A. p d n i j i i n , P. ochrncacs and human mitochondria and that of the small subunit (16s) rRNA in E. roli. The 5' terminals of the downstream tRNA genes and the transcriptional polarities are indicated by arrows and *, respectively. Watson-Crick and GT (or GU) base pairs are shown by a bar and 0 , respectively. (c) Schematic diagram showing sequence comparisons covering the region of the 3' end of 12s rRNA and the downstream tRNA genes among 11. ynkubn, human, P. orhractw (SMITI-~ t t 01. 1990), A. p d n i j i i n , S. purpurnlrcs and P. lividus. Possible stem and loop structures are shown by arrows facing each other. The human and starfish genomes contain an additional possible stem and loop structure (EPERON pt nl. 1980), shown by broken arrows facing each other. Arrowheads indicate the 3' termini of major 12s rRNA transcript? in human and S. purpurntus mitochondria. The amino acid acceptor stem of the tRNA gene is abbreviated as aa stem. (d) Sequence alignment of the 3' regions of mitochondrial 16s rRNA genes of human (ANIXRSON d nl. 1981). A. pt-ctinijimn, P. ochrncacs ( S M I I I ~ e/ nl. 1989), S. purjlztm/us (JACOBS et nl. 1988) and P. l i v idw (CANTATORE d nl. 1989). The possible stem and loop structure around the 3' terminal region is designated by arrows facing each other. The transcript5 of A . jm-/in@rn (S. ASAKAWA, H. HIMENO, K. MIURA, and K. WATANARE, unpublished results) and S. p r q f m x h u ( E I . I . I o ~ and JKORS 1989) terminate within the regions underlined.

Evolutionaty divergences in the structure o f the DHU-arm o f tRN&?,, may cause the variations in the use o f AGN codons among mitochondria o f various animal species. The truncated DHU-arm is usually considerably larger in mitochondria o f invertebrates than those o f vertebrates. Exceptions are Fasciola mitochondria that use AGA/AGG as serine codons in addition to AGU/AGC and have a small pseudo-DHU-arm on

their tRN&?[. gene (CAREY and WOLSrENHOl.ME, 1989), and a fish (Cypinzls car@) whose tRN$& gene has an intermediate-sized DHU-arm and yet apparently decodes only AGU/AGC codons Cy. S. CHANG and F. L. HUANG, unpublished data). OSAWA et al. (1992) pointed out that the GC pair at the bottom o f the anticodon stem is present in mitochondrial tRNA;?;,. o f invertebrates but not in those o f vertebrates, except for gorilla


G A G G

C c G C G A

G G C A G G C A C-G C-G C A C-G C-G C -G C-G C G A C-G C-G C -G C G C-G C-G C-G C-G C-G C -G C-G C-G C-G A- T

C-G G-C

C-G C-G

C-G C -G

A- T T-A C-G C -G

A. pectinifera A. amurensis A. forbesii P. ochraceus

FIGURE 4.-GGrich stem and loop structure found in the unassigned region between tRNAThr and 16s rRNA genes in four starfish mitochondrial genomes.

(BROWN et al. 1982), hamster (BAER and DUBIN, 1980) and nematodes. The nematode tRNA& gene possesses a TCT anticodon, which can recognize both AGA and AGG codons (WOLSTENHOLME et al. 1987).

rRNA genes: As mentioned above, the echinoderm mitochondrial rRNA genes are located separately from each other, in contrast to theirjuxtaposed arrangement on the same strand in vertebrate and Drosophila mtDNAs. Besides this, the 16s rRNA gene is included in the inverted 4.6kb region, as seen between starfish and sea urchin mitochondrial genomes shown in Fig- ure 1.

Sequences around the 3' end of 12s rRNA gene and the downstream tRNA genes are compared among starfish, sea urchin, human and fruit fly in Figure 3a. The 3' end of the 12s rRNA gene of A. pectinifera is quite similar to those of the above-mentioned species. A distinctive stem and loop structure can be formed in the region from the 3' end of the rRNA gene to the 5' ends of the flanking tRNAva' gene or of the tRNAGln genes in two starfishes A. pectinijkra and P. ochraceus (EPERON et al. 1980; SMITH et al. 1989). This structure is observed not only in mitochondria of vertebrates (ANDERSON et al. 1981, 1982; BIBB et al. 1981; ROE et ul. 1985; GADA- LETA et al. 1989; DESJARDINS and Moms 1990) and Drosophila (CLARY and WOLSTENHOLME 1985), but also in the small subunit rRNA in prokaryotes, eukaryotic cytoplasm and chloroplasts (Figure 3b) (ZWIEB et al. 1981; GRAY et al. 1984; GUTELL et al. 1985). In the small subunit rRNA of E. coli, the 3' terminal region just downstream of this stem sequence contains an anti- Shine-Dargarno sequence (CCUCC) responsible for ef- ficient initiation with the specific AUG codon (Figure 3b) (SHINE and DARCARNO 1974; DAHLBERG 1989). Such an exclusive conservation suggests that this type of structure may play an essential role in the ribosomal function in the animal mitochondrial protein synthetic system, as in the E. coli system. In S. purpuratus, P. lividus (Figures 3a and c) and A. lixula (data not shown), no such characteristic in secondary structure is observed in this region (JACOBS et al. 1988; CANTATORE et al. 1989; GIORCI et al. 1991). To the best of our knowledge,

sea urchin is the only species that does not possess this structure. Sequence comparison between A. pectinifera and sea urchins implies that a 5-bp insertion for S. purpurutus, an additional 3 b p insertion for P. lividus and a 15-bp deletion for both would have occurred to de- stroy a stem and loop formation (Figure 3c). This 15- bp deletion has resulted in the apparent overlapping of the 3' end of the 12s rRNA gene and the 5' end of the tRNAG'" gene (Figure 3c). The acceptor stem sequence of the sea urchin tRNAG'" gene shows a good similarity with the region around the 3' end of the 12s rRNA gene of vertebrates and starfish, and the similarity is much greater than that with the acceptor stem of starfish tRNAG'" (Figures 3a and 3c). The loss of this stem and loop structure might have occurred after starfish and sea urchin diverged in the lines leading to the three sea urchins.

Studies of transcripts have shown that these two genes in sea urchin actually overlap each other (ELLIOTT and JACOBS 1989; CANTATORE et al. 1990). As a result of this overlapping, expression levels of S. purpuratus mitochondrial rRNAs and mRNAs are thought to be regu- lated at the maturation step of the primary transcript by the selection of mutually exclusive synthetic pathways (ELLIOTT and JACOBS 1989; JACOBS 1989). This mechanism contrasts with the human system, in which the 12s rRNA gene and the adjacent tRNAva' gene are butt- jointed (Figure 3a) and a single primary transcript gen- erates both mature 12s rRNA and tRNA""' (DUBIN et al. 1982; CLAWON 1984). Whether this novel regulation mechanism operates only in sea urchin, in association with the 15-bp deletion, or is common to other echinoderm species, irrespective of the deletion or gene inversion, requires clarification.

A possible stem and loop structure is also found in the neighborhood of the 3' end of the 16s rRNA gene (Figure 3d). A similar possible stem and loop structure is found in the corresponding region of another starfish, P. ochraceus (Figure 3d) (SMITH et al. 1989), and in other animals such as vertebrates (Figure 3d) (DUBIN et al. 1982) and insects (HSUCHEN et al. 1984; CLARY and WOLSTENHOLME 1985), in spite of some sequence variations. By contrast, no such potential structure is found around the corresponding regions of either S. purpuratus or P. lividus (JACOBS et al. 1988; CANTATORE et al. 1989). In the human mitochondrial system, since an apparent transcriptional termination at the 3' end of the 16s rRNA causes a differential control of expression of the genes for rRNAs and the other genome region, the stem and loop structure is considered to play a role in transcriptional termination similar to the prokaryotic r-independent termination signal (MON- TOYA et al. 1983). As compared with the 12s rRNA gene, the 3' end sequence of the 16s rRNA gene is variable among different species, and even within starfishes (Fig- ure 3d). In spite of sequence variations, this region can be folded into a stem and loop structure in the

Starfish

Starfish Mitochondrial Genome 105f

Sea urchin

parentheses inside the inner circle in Figure 1.

mitochondria of all metazoans except for sea urchin. The sequence variations in this region suggest that this stem and loop structure in starfish functions in transcriptional regulation, like that for human, rather than in the protein synthetic processes. In sea urchin, the 3' end of 16s rRNA overlaps with the downstream transcript of COZ, as observed in the 3' end of 12s rRNA (ELLIOTT and JACOBS 1989; CANTATORE et al. 1990). By virtue of the absence of a tRNA or mRNA gene downstream of the 16s rRNA gene, the starfish system would not require the transcriptional and/or translational regulation mechanisms for selection of mRNA or rRNA found in sea urchin mitochondria (JACOBS et al. 1989a). The two transcriptional regulation systems would have diverged due to the gene inversion, which probably resulted in extensive mutations within the 4.6- kb region, including the 16s rRNA gene, as a result of strand-specific AC(GT) pressure.

Unassigned sequence: There are two fairly long sequences not attributable to any gene in the A. pectinifera mtDNA, one (-450 nucleotides) containing a putative replication origin located between the genes for 16s rRNA and tRNAThr, the other (-140 nucleotides) is found between the genes for ND4 and tRNA'"' (Fig- ure 1).

In sea urchin, the former sequence is speculated to function as a replication origin on the basis of partial sequence similarity with that of vertebrates (JACOBS et al. 1988; CANTATORE et al. 1989). In fact, this region in the S . purpurntus mtDNA forms a 70-80-nucleotide displacement loop as a replication intermediate, as in vertebrate mtDNAs (JACOBS et al. 1989b). This unassigned region in starfish is considerably longer than the sea urchin counterpart (JACOBS et al. 1988; CANTATORE P t nl. 1989). Besides, only a slight sequence similarity

between A. pectinifera and sea urchins exists in this region, and even among several starfishes (details of a sequence comparison among 4 starfishes are described in JACOBS et nl. 1989a). In A. pectinifera, a GGrich stem and loop structure is found -40 nucleotides downstream of the tRNAT'lr gene (Figure 4). A similar stem and loop structure is also found in other starfishes ( JA- COBS et al. 1989a). Such a stem and loop structure is often observed in the light-strand replication origin, as in mammalian and amphibian mtDNAs (ANDERSON et al. 1981, 1982; BIBB et nl. 1981; ROE ei nl. 1985; GADA- LETA et al. 1989). Because of the ubiquitous distribution of the stem and loop structure among starfishes in spite of only a low sequence similarity around this region, it is considered to play a role in the DNA replication. A considerably larger stem and loop structure is found in the corresponding unassigned region of the sea urchin mtDNA (JACOBS et al. 1988; CANTATORE et al. 1989), in which the stem region of this structure contains a C (pyrimidine)-rich sequence and a oligo G tract that are supposed to be involved in the displacement-loop formation at the initiation for replication of S . purpurntus mtDNA (JACOBS et al. 198913).

In S. purpurutus, a putative promoter-like sequence (TTATATATAA) has been found upstream of the G rich sequence, and their dual functions in the primer synthesis for replication as well as in the transcription of the heavy-strand has been postulated (JACOBS et al. 1989b). In A. pectinijia, however, no sequence with >SO% match to TTATATATAA is found in this region. Among the four starfish mtDNks, only the A. jorbesii mtDNA possesses this sequence around this region ( JA- COBS et al. 1989a). This unassigned region seems to have undergone the most extensive mutations, probably having facilitated long-range gene inversion (SMITH et al. 1989).

Another unassigned sequence of 140 nucleotides contains a run of 19 consecutive A residues and a poten-


tial stem and loop structure (Figure 1) (HIMENO et al. 1987). This region shows a sequence similarity with that for P. ochraceus and is thus considered as a second replication control region of starfish mtDNA (SMITH et al. 1990). A second putative replication origin is thought to occur upstream of the Cyt b gene in sea urchin mtDNA (ROBERTI et al. 1990). This evokes a possibility that the process of mtDNA replication is considerably different between starfish and sea urchin in association with the gene inversion.

A. pectinijkra mtDNA contains an additional unassigned sequence of 53 nucleotides between ND5 and ND6 genes (Figure l), whose role is not understood.

Sequence motifs possibly involved in the regulation of transcription or DNA replication: Several TTATA- TATAA sequences are dispersed in the intergenic regions of the echinoderm mitochondrial genome. Based on its location and self complementarity, this decamer sequence was suggested as a possible bidirectional promoter ( JACOBS et al. 1989a). A. pectinijiia mtDNA contains five sequences with at least 9-10 matches to TTA- TATATAA. These are located between the genes for 16s rRNA and ND2, Cyt b and ND6, ND3 and

tRNAp‘” and COI, and tRNAGLy and tRNA:& (Figure 5). Sea urchin mtDNA also contains five sequences in which 9- 10 positions match TTATATATAA. Four of these are at the same locations in the two echinoderms. The fifth is located between tRNACly and tRNAf& in starfish and in the middle of the 13 tRNA gene cluster in sea urchin, where it is upstream of the tRNAva’ gene and overlaps the first two bases at the 5’ end of the tRNAMe‘ gene.

The sequence-specific binding of a mitochondrial protein to an AGCCT(N7)AGCAT sequence in the 3‘ terminal region of the ATPase 6 gene in S. purpuratus is considered to have caused a pause in DNA replication in certain developmental stages (QURESHI and JACOBS 1993a,b). In A. pectinijma, a similar sequence, AGCCT (N7)AGCCT, is found at essentially the same location (Figure 1).

We thank Dr. YOSHINORI KUMAZAWA of the Nagoya University and Dr. TAKASHI YOKOGAWA of the Tokyo Institute of Technology (at present, University of Bayreuth, Germany) for stimulating discussions and for many helpful comments on the manuscript. We also thank TAKA~HI YOKOGAWA for generous help with graphics. The study was supported by Grants-in-Aid for Specially Promoted Research (60060004) and for Scientific Research on Priority Areas (01656003) from the Ministry of Education, Science, and Culture of Japan.

LITERATURE CITED

ANDERSON, S., A. T. BANKIER, B. G. BARRELL, M. H. L. DE BRUIJN, A. R. COULSON et al., 1981 Sequence and organization of the human mitochondrial genome. Nature 290 457-465.

ANDERSON, S., M. H. L. DE BRUIJN, A. R. COULSON, I. C. EPERON, F. SANGER et al., 1982 The complete sequence of bovine m i t e chondrial DNA conserved features of the mammalian mitochondrial genomes. J. Mol. Biol. 156: 683-717.

A R C A R I , P., and G. G. BROWNLEE, 1980 The nucleotide sequence

of a small (3s) seryl-tRNA (anticodon GCU) from beef heart mitochpndria. Nucleic Acids Res. 8: 5207-5212.

ASO ON, U., and A. GULLBERG, 1993 Comparison between the complete mtDNA sequences of the blue and the fin whale, two species that can hybridize in nature. J. Mol. Evol. 37: 312-322.

AS ON, U., and E. JOHNSSON, 1992 The complete mitochondrial DNA sequence of the harbor seal, Phoca vitulina. J. Mol. Evol.

B AS ON, U., A. GULLBERG and B. WIDEGREN, 1991 The complete nucleotide sequence of the mitochondrial DNA of the fin whale, Balaenoptera, physalus. J. Mol. Evol. 33: 556-568.

ASAKAWA, S.,Y. KUMAZAWA, T. A R A K I , H. HIMENO, K. MIURA et al., 1991 Strand-specific nucleotide composition bias in echinoderm and vertebrate mitochondrial genomes. J. Mol. Evol. 32: 51 1-520.

BAER, R. J., and D. T. DUBIN, 1980 The sequence of a possible 5 s RNA-equivalent in hamster mitochondria. Nucleic Acids Res. 8: 3603-3610.

BARRELL, B. G., A. T. BANNER and J. DROUIN, 1979 A different genetic code in human mitochondria. Nature 282 189-194.

BEIER, H., M. BARCISZEWSKA and H. D. SICKINGER, 1984 The molecular basis for the differential translation of TMV RNA in tobacco protoplasts and wheat germ extracts. EMBO J. 3 1091-1096.

BIBB, M. J., R. A. VAN ETTEN, C. T. WRIGHT, M. W. WALBERG and D.A. CIAWON, 1981 Sequence and gene organization of mouse mitochondrial DNA. Cell 26: 167-180.

BJORK, G. R., 1992 The role of modified nucleotides in tRNA interactions, pp. 23-85 in Transfer RNA in Protein Synthesis, edited by D. L. HATFIELD, B. J. LEE and R. M. PIRTI.E. CRC Press, Boca Raton, FL.

BJORK, G. R., J. U. ERICSON, C. E. D. GUSTAFSSON, T. G. HAGERVALI., Y. H. JONSSON et al., 1987 Transfer RNA modification. Annu. Rev. Biochem. 56: 263-287.

BROWN, W. M., E. M. PRAGER, A. WANC and A. C. WILSON, 1982 Mitochondrial DNA sequence of primates: tempo and mode of evolution. J. Mol. Evol. 18: 225-239.

CANTATORE, P., M. N. GADALETA, M. ROBERTI, C. SACCONE and A. C. WILSON, 1987 Duplication and remoulding of tRNA genes during the evolutionary rearrangement of mitochondrial genomes. Nature 329: 853-855.

CANTATORE, P., M. ROBERTI, G. RAINARDI, C. SACCONE and M. N. GADALETA, 1988 Clustering of tRNA genes in Paracentrotus lividus mitochondrial DNA. Curr. Genet. 13: 91-96.

CANTATORE, P., M. ROBERTI, G. RAINARDI, M. N. GADALETA and C. SACCONE, 1989 The complete nucleotide sequence, gene organization, and genetic code of the mitochondrial genome of Para- centrotus lividus. J. Biol. Chem. 264 10965-10975.

CANTATORE, P., M. ROBERTI, P. L. POLOSA, A. MUSTICH and M. N. GADAI.ETA, 1990 Mapping and characterization of Paracentrotus liuidus mitochondrial transcripts: multiple and overlapping transcription units. Curr. Genet. 17: 235-245.

C I ~ Y , D. O., and D. R. WOLSTENHOLME, 1985 The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 2 2 252-271.

CIAWON, D. A,, 1984 Transcription of the mammalian mitochondrial genome. Annu. Rev. Biochem. 53: 573-594.

CLAWON, D. A,, 1991 Replication and transcription of vertebrate mitochondrial DNA. Annu. Rev. Cell. Biol. 7: 453-478.

CROZIER, R. H., andY. C. CROZIER, 1993 The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization. Genetics 133: 97-117.

DAHLBERG, A. E., 1989 The functional role of ribosomal RNA in protein synthesis. Cell 57: 525-529.

DE BRUIJN, M. H. L., 1983 Drosophila melanogastermitochondrial DNA a novel organization and genetic code. Nature 304 234-241.

DE BRUIJN, M. H. L., and A. MNG, 1983 A model for the tertiary structure of mammalian mitochondrial transfer RNAs lacking the entire ‘dihydrouridine’ loop and stem. EMBO J. 2 1309-1321.

DE BRUIJN, M. H. L., P. SCHREIER, I. C. EPERON, B. G. BARRELL, E. Y. CHEN et al., 1980 A mammalian mitochondrial serine transfer RNA lacking the “dihydrouridine” loop and stem. Nucleic Acids Res. 8: 5213-5222.

DESJARDINS, P., and R MORAIS, 1990 Sequence and gene organization of chicken mitochondrial genome. J. Mol. Biol. 212 599-634.

DUBIN, D. T., and C. C. HSUCHEN, 1984 Sequence and structure o f a methionine transfer RNA from mosquito mitochondria. Nucleic Acids Res. 12: 4185-4189.

3 4 493-505.


DUBIN, D. T., J. MONTOYA, K. D. TIMKO and G. ATTARDI, 1982 Se- quence analysis and precise mapping of the 3' ends of hela cell mitochondrial ribosomal R N A s . J. Mol. Biol. 157: 1-19.

DUBIN, D. T., C. C. HSUCHEN, C. R. CLEAVES and K. D. TIMKO, 1984 Sequence and structure of a serine transfer RNA with GCU anticodon from mosquito mitochondria. J. Mol. Biol. 176 251-260.

ELLIOTT, D. J., and H. T. JACOBS, 1989 Mutually exclusive synthetic pathways for sea urchin mitochondrial rRNA and mRNA. Mol. Cell Biol. 9: 1069-1082.

EPERON, I. C., S. ANDERSON and D. P. NIERLICH, 1980 Distinctive sequence of human mitochondrial ribosomal RNA genes. Nature

FOURNIER, M., E. HAUMOUNT, S. DE HENAU, J. GANGLOFF and H. GROSJEAN, 1983 Post-transcriptional modification of the w o b ble nucleotide in anticodon-substituted yeast tRNAgg after mi- croinjection into Xenopus h i s oocytes. Nucleic Acids Res. ll:

GADALETA, G., G. PEPE, G. DE CANDIA, C. QUAGLIARIELLO, E. SBISA et al., 1989 The complete nucleotide sequence of the Rattus nmegzcw mitochondrial genome: cryptic signals revealed by comparative analysis between vertebrates. J. Mol. Evol. 28 497-516.

GARESSE, R., 1988 Drosophila melanogastermitochondrial DNA gene organization and evolutionary considerations. Genetics 118:

CAREY, J. R., and D. R. WOLSTENHOLME, 1989 Platyhelminth mitochondrial DNA Evidence for early evolutional origin of a tRNAserAGN that contains a dihydrouridine arm replacement loop, and of serine specifylng AGA and AGG codons. J. Mol.

GIORGI, C. D., C. LANAVE, M. D. MUSKI and C. SACCONE, 1991 Mito- chondrial DNA in the sea urchin Arbacia Lixula: evolutionary interferences from nucleotide sequence analysis. Mol. Biol. Evol.

GRAY, M. W., D. SANKOFF and R. J. CEDEGREN, 1984 On the evolutionary descent of organisms and organelles: a global phylogeny based on a highly conserved structural core in small subunit ribosomal RNA Nucleic Acids Res. 12: 5837-5852.

GUTELL, B. R., B. WEISER, C. R. WOESE and H. F. NOLLER, 1985 Comparative anatomy of 16Slike ribosomal RNA. Prog. Nucleic Acid Res. 32: 155-216.

HAUCKE, H.-R., and G. GELLISEN, 1988 Different mitochondrial gene orders among insects: exchanged tRNA gene positions in the COII/COIII region between orthopteran and a dipteran species. Curr. Genet. 14: 471-476.

HENIKOFF, S., 1987 Unidirectional digestion with exonuclease 111 in DNA sequence analysis. Methods Enzymol. 155 156-165.

HIMENO, H., H. MASAKI, T. KAWAI, T. OHTA, I. KUMAGAI et aZ., 1987 Unusual genetic codes and a novel gene structure for tRNA:& in starfish mitochondrial DNA. Gene 56: 219-230.

HOFFMANN, R. J., J. L. BOORE and W. M. BROWN, 1992 A novel mitochondrial genome organization for the blue mussel, Mytilus edulis. Genetics 131: 397-412.

HSUCHEN, C. C., G. R. CLEAVES and D. T. DUBIN, 1983 A major lysine tRNA with a CUU anticodon in insect mitochondria. Nu- cleic Acids Res. ll: 8659-8662.

HSUCHEN, C. C., R. M. KOTIN and D. T. DUBIN, 1984 Sequences of the coding and flanking regions of the large ribosomal subunit RNA gene of mosquito mitochondria. Nucleic Acids Res. 12:

JACOBS, H. T., 1989 Do ribosomes regulate mitochondrial RNA synthesis? Bioessays 11: 27-34.

JACOBS, H. T., D. J. ELLIOTT, V. B. MATH and A. FARQUHARSON, 1988 Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J. Mol. Biol. 202: 185-217.

JACOBS, H. T., S. A S m W . 4 , T. A R A K I , K. MIURA, M. SMITH et aZ., 1989a Conserved tRNA gene cluster in starfish mitochondrial DNA. Curr. Genet. 15: 193-206.

JACOBS, H. T., E. R. HERBERT and J. RANKINE, 1989b Sea urchin egg mitochondrial DNA contains a short displacement-loop (D- loop) in the replication origin region. Nucleic Acids Res. 17:

JANKE, A., and S. PAABo, 1993 Editing of a tRNAanticodon in marsupial mitochondria changes its codon recognition. Nucleic Acids Res. 21: 1523-1525.

JUKES, T. H., and S. ONWA,1990 The genetic code in mitochondria and chloroplasts. Experientia 46: 1117-1126.

286 460-467.

707-718.

649-663.

EvoI. 28: 374-387.

8: 515-529.

7771-7785.

8949-8965.

KIM S. H., and J. L. SUSSMAN, 1976 .rr-turn is a conformational pattern in RNA loops and bends. Nature 260: 645-646.

KUMAZAWA, Y., and M. NISHIDA, 1993 Sequence evolution of mitochondrial tRNA genes and deepbranch animal phylogenetics. J.

KUMAZAWA, Y., T. YOKOGAWA, E. HASEGAWA, K. MIURA and K. WATA- NABE, 1989 The aminoacylation of structurally variant phenylal- anine tRNAs from mitochondria and various nonmitochondrial sources by bovine mitochondrial phenylalanyl-tRNA synthetase. J. Biol. Chem. 264: 13005-13011.

MESSING, J. (1983). New M13 vectors for cloning. Methods Enzymol. 101: 20-78.

MONTOYA, J., D. OJALA and G. ATTARDI, 1981 Distinctive features of the 5"terminal sequences of the human mitochondrial mRNA. Nature 290: 465-470.

MONTOYA, J., G. L. GAINES and G. ATTARDI, 1983 The pattern of transcription of the human mitochondrial rRNA genes reveals two overlapping transcription units. Cell 34: 151 - 159.

MORITZ, C., and W. M. BROWN, 1986 Tandem duplications of D- loop and ribosomal RNA sequences in lizard mitochondrial DNA. Science 233: 1425-1427.

MORITZ, C., and W. M. BROWN, 1987 Tandem duplications in animal mitochondrial DNAs: variation in incidence and gene content among lizards. Proc. Natl. Acad. Sci. USA 84: 7183-7187.

MURAMATSU, T., K. NISHIKAWA, F. NEMOTO, Y. KUCHINO, S. NISHI- MURA, et aZ., 1988a Codon and amino acid specifications of a tRNA are both converted by a single post-transcriptional modification. Nature 335 179-181.

MURAMATSU, T., S. YOKOYAMA, N. HIROSE, A. MATSUDA, T. UEDA et al., 1988b Novel lysine substituted nucleotide in the first position of the anticodon of minor isoleucine tRNA from Escherichia coli. J. Biol. Chem. 263: 9261-9267.

MURGOLA, E. J., 1990 Suppression and the code: beyond codons and anticodons. Experientia 46: 1134-1141.

OHAMA, T., S. OSAWA and K. WATANABE, 1990 Evolution of the mitochondrial genetic code IV. AAA as an asparagine codon in some animal mitochondria. J. Mol. Evol. 30: 329-332.

OJALA, D., J. MONTOYA and G. ATTARDI, 1981 tRNA punctuation model of RNA processing in human mitochondria. Nature 290:

OKIMOTO, R., and D. R. WOLSTENHOLME, 1990 A set of tRNAs that lack either the TYC arm or the dihydrouridine arm: towards a minimal tRNA adaptor. EMBO J. 9: 3405-3411.

OKIMOTO, R., J. L. MACFARLANE and D. R. WOLSTENHOLME, 1990 Evidence for the frequent use of TTG as the translation initiation codon of mitochondrial protein genes in the nematodes, Ascaris m u m and Caenorhabditis elegans. Nucleic Acids Res. 18: 6113-6118.

OKIMOTO, R., J. L. MACFARLANE, D. 0. CLARY and D.R. WOLSTEN- HOLME, 1992 The mitochondrial genomes of two nematodes, Caenmhabditis elegans and Ascaris mum. Genetics 130 471-498.

OSAWA, S., and T. H. JUKES, 1989 Codon reassignment (codon capu- ture) in evolution. J. Mol. Evol. 28: 271-278.

OSAWA, S., T. OHAMA, T. H. JUKES and K. WATANABE, 1989a Evolu- tion of the mitochondrial genetic code I. Origin of AGR serine and stop codons in metazoan mitochondria. J. Mol. Evol. 29:

OSAWA, S., T. OHAMA, T. H. JUKES, K. WATANABE and S. YOKOYAMA, 1989b Evolution of the mitochondrial genetic code 11. Reas- signment of codon AUA from isoleucine to methionine. J. Mol.

O N W A , S., T. H. JUKES, K. WATANABE and A. MUTO, 1992 Recent evidence for evolution of the genetic code. Microbiol. Rev. 56:

PAABO, S., W. K. THOMAS, K. M. WHITFIELD, Y. KUMAZAWA and A. C. WIISON, 1991 Rearrangements of mitochondrial transfer RNA genes in marsupials. J. Mol. Evol. 33: 426-430.

PONT-KINGDON, G. A., C. T. BEAGLEY, R. OKIMOTO and D. R. W01.s TENHOLME, 1994 Mitochondrial DNA of the sea anemone, Me- tridium senile (Cnidaria): prokaryote-like genes for tRNAf-Met and small-subunit ribosomal RNA, and standard genetic code specificities for AGR and ATA codons. J. Mol. Evol. 39: 387-399.

QURESHI, S. A., and H. T. JACOBS, 1993a Characterization of a high- affinity binding site for a DNA-binding protein from sea urchin embryo mitochondria. Nucleic Acids Res. 21: 811-816.

QURESHI, S. A., and H. T. JACOBS, 1993b Two distinct, sequence-

Mol. Evo~. 37: 380-398.

470-474.

202-207.

EvoI. 29 373-380.

229-264.


specific DNA-binding proteins interact independently with the

Acids Res. 21: 2801-2808. major replication pause region of sea urchin mtDNA. Nucleic

ROBERTI, M., A. MUSTICH, M. N. GADALETA and P. CANTATORE, 1990 Identification of two homologous mitochondrial DNA sequences, which bind strongly and specifically to a mitochondrial protein of Parmentrotus lividus. Nucleic Acids Res. 19: 6249-6254.

ROE, B.A., D.P. MA, R. R WILSON and J. F. H. WONG, 1985 The complete nucleotide sequence of the Xenopus his mitochondrial genome. J. Biol. Chem. 260 9759-9774.

SAIKI, R. K., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, R. HICUCHI et al., 1988 Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 487-491.

SANTOS, M. A. S., G. KEITH and M. F. TUITE, 1993 Non-standard translational events in Candida albicans mediated by an unusual seryl-tRNA with a 5‘-CAG3’ (leucine) anticodon. EMBO J. 12:

SHIBUTANI, S., M. TAKESHITA and A. P. GROLLMAN, 1991 Insertion of specific bases during DNA synthesis past the oxidationdam- aged base &oxoG. Nature 349 431-434.

SHINE, J., and L. DARGARNO, 1974 The 3’-terminal sequence of Esche richia coli 16s ribosomal RNA Complimentarity to nonesense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA

SIVERMAN, S., J. HECKMAN, G. J. COWLING, A. D. DELANEY, R. J. DUNN et al., 1979 The nucleotide sequence of the initiator tRNA from Drosophila melanogaster. Nucleic Acids Res. 6: 421-433.

SMITH, M. J., D. K. BANFIELD, K. DOTEVAL, S. GORSKI and D. J. KOWBEL, 1989 Gene arrangement in sea star mitochondrial DNA dem- onstrates a major inversion event during echinoderm evolution. Gene 76: 181-185.

SMITH, M. J.. D. K. BANFIELD, K DOTEVAL, S. GORSKI and D. J. KOWBEL, 1990 Nucleotide sequence of nine proteinsoding genes and 22 tRNAs in the mitochondrial DNA of the sea star Pisaster ochra-

SMITH, M. J., A. ARNDT, S. GORSKI and E. FAJBER, 1993 The phylogeny of echinoderm classes based on mitochondrial gene arrangements. J. Mol. Evol. 3 6 545-554.

SPRINZI., M., T. H A R T M A N N , J. WEBER, J. BLANK and R. ZEIDLER, 1989 Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 17: rl-rl71.

SUNDARALINGAM, M., H. MIZUNO, C. D. STOUT, S. T. RAO, M. LIEBMAN et al., 1976 Mechanism of chain folding in nucleic acids. The (w’, w) plot and its correlation to the nucleotide geometry in yeast tRNAPh‘. Nucleic Acids Res. 3: 2471-2484.

SUZUKI, T., T. UEDA, T. OHAMA, S. OSAWA and K. WATANABE, 1993 The gene for serine tRNA having anticodon sequence CAG in a pathogenic yeast, Candida albicans. Nucleic Acids Res. 21: 356.

607-616.

71: 1342-1346.

C ~ U S . J. Mol. Evo~. 31: 195-204.

TZENG, C.-H., C.-F. HUI, S.-C. SHEN and P. C. HUANG, 1992 The complete nucleotide sequence of the Crossostoma lacustre mitochondrial genome: conservation and variations among vertebrates. Nucleic Acids Res. 2 0 4853-4858.

UEDA, T., T. OHTA and K. WATANABE, 1985 Large scale isolation and some properties of AGY-specific serine tRNA from bovine heart mitochondria. J. Biochem. 98: 1275-1284.

VALWRDE, J. R., B. BATUEW, C. MORATILLA, R. MARCO and R. GA- RESSE, 1994 The complete mitochondrial DNA sequence of the Crustacean Artemiafiunciscana. J. Mol. Evol. 39: 400-408.

WAKITA, K., Y. WATANABE, T. YOKOGAWA, Y. KUMAZAWA, S. NAKAMURA et al., 1994 Higher-order structure of bovine mitochondrial tRNAphe lacking the ‘conserved’ GG and TYCG sequences as inferred by enzymatic and chemical probing. Nucleic Acids Res. 22: 347-353.

WOLSTENHOLME, D. R., 1992 Animal mitochondrial DNA structure and evolution. Int. Rev. Cyt. 141: 173-216.

WOLSTENHOLME, D. R., J. L. MACFARLANE, R. OKIMOTO, D. 0. CIARY and J. A. WAHLEITHNER, 1987 Bizarre tRNAs inferred from DNA sequences of mitochondrial genomes of nematode worms. Proc. Natl. Acad. Sci. USA 84: 1324-1328.

WOO, N. C., B. A. ROE and A. RICH, 1980 Three-dimensional structure of Escherichia coli initiator W A F . Nature 286 346-351.

YANISCH-PERRON, C., J. VIEIRA and J. MESSING, 1985 Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13 mp8 and pUC19 vectors. Gene 33: 103-119.

YARUS, M., 1982 Translational efficiency of transfer RNAs: uses of an extended anticodon. Science 218: 646-652.

YARUS, M., S. W. CLINE, P. WIER, L. BREEDEN and R. C. THOMPSON, 1986 Actions of the anticodon arm in translation on the pheno- types of RNA mutants. J. Mol. Biol. 192: 235-255.

YOKOGAWA, T.,Y. KUMAZAWA, K. M I U R A ~ ~ ~ K. WATANABE, 1989 Puri- fication and characterization of two serine isoacceptor tRNAs from bovine mitochondria by using a hybridization assay method. Nucleic Acids Res. 17: 2623-2638.

YOKOCAWA, T., Y. WATANABE, Y. KUMAZAWA, T. UEDA, I. HIRAO et al.,

chondrial tRNA*‘(UCN). Nucleic Acids Res. 19: 6101-6105. 1991 A novel cloverleaf structure found in mammalian mi t e

YOKOCAWA, T., T. SUZUKI, T. UEDA, M. MORI, T. OHAMA et al., 1992 Serine tRNA complementary to the nonuniversal serine codon CUG in Candida qlindraceu: Evolutionary implications. Proc. Natl. Acad. Sci. USA 89: 7408-7411.

YONEYAMA, Y. 1987 The nucleotide sequences of the heavy and light strand replication origins of the Rana catesbeiana mitochondrial genome. Nippon Ika Daigaku Zasshi 54: 429-440.

ZWIEB, C., C. GLOTZ and R. BRIMACOMBE, 1981 Secondary structure comparisons between small subunit ribosomal RNA molecules from six different species. Nucleic Acids Res. 15: 3621-3640.

Communicating editor: N. TAKAHATA

nucleotide sequence and gene organization of the starfish ... · nucleotide sequence and gene...

Documents