Proc. Natl. Acad. Sci. USAVol. 82, pp. 8349-8353, December 1985Biochemistry

Nonconsensus branch-site sequences in the in vitro splicing oftranscripts of mutant rabbit fJ-globin genes

(RNA analysis/lariat RNAs)

RICHARD A. PADGETT*t, MARIA M. KONARSKA*, MARKUS AEBIt, HORST HORNIGt, CHARLES WEISSMANNt,AND PHILLIP A. SHARP**Center for Cancer Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; and tInstitute of Molecular Biology,University of Zurich, Honggerberg, Zurich, Switzerland

Contributed by Phillip A. Sharp, August 9, 1985

ABSTRACT Mutants of the rabbit P-globin gene lackingthe natural site of branch formation in the second interveningsequence have been analyzed for in vitro splicing activity. RNAstranscribed from these mutants were spliced, via lariat forma-tion, at a reduced rate compared to wild-type RNA. The sitesof branch formation were mapped by direct RNA analysis andprimer-extension analysis. The sequences at the branch sites inthe three mutants examined did not conform to the previouslydetermined consensus sequence, nor were the 5' splice sites andbranch sites complementary.

The splicing of pre-mRNA proceeds through lariat RNAintermediates. In this molecule, the 5' end of the interveningsequence is joined through a 2'-5' phosphodiester bond to aresidue near its 3' end. With the discovery of this pathway,much attention has focused on the role of sequences at thesite of branch formation. Wallace and Edmonds (1) showedthat the residue with both 2'-5' and 3'-5' bonds is usually anadenosine in HeLa cells. In all yeast mRNA introns theinvariant sequence UACUAAC contains the site of branch-ing at the third adenosine residue (2, 3). This conservedsequence in yeast suggested that sequences at branch sites inmammalian mRNA introns might be similar and play a role inthe selection of branch sites or splice sites. A computeranalysis of many intervening sequences performed by Kellerand Noon (4) revealed a weak consensus signal near the 3'splice site. This consensus sequence correctly predicts thelocation of all known natural branch sites. Ruskin et al. (5)deduced a related consensus signal from a smaller set ofmammalian intervening sequences. Both consensus se-quences were highly degenerate, in contrast to the virtuallycomplete sequence conservation in the yeast branch site.The role that branch-site sequences play in mammalian

pre-mRNA splicing is not clear. It is possible that thesequence is recognized by some component in the splicingsystem, perhaps a ribonucleoprotein (RNP). Another sug-gestion is that the complementarity observed between se-quences at the 5' splice site and the branch site may serve tobring the two sites together (6, 7). If either of these ideas iscorrect, deletion of the sequences containing the branch siteshould disrupt splicing. In a study of a large number ofdeletion and substitution mutations ofthe second interveningsequence ofthe rabbit ,3globin gene, Wieringa et al. (8) foundthat all of the intervening sequence was dispensable from 6nucleotides from the 5' splice site to 24 nucleotides from the3' splice site. As shown here and by Zeitlin and Efstratiadis(9), the branch site of this intervening sequence occurs atposition -32 from the 3' splice site. Thus, many of the

mutants of Wieringa et al. (8) lacked the natural branch-sitesequences but were spliced normally in vivo.We have investigated the in vitro activity of three repre-

sentative mutants lacking the natural branch site of the rabbit(3-globin gene. Substrate RNAs from these mutant DNAs wereaccurately spliced in vitro with an 80-90%o reduction in rate.LariatRNA intermediates and products were analyzed and thebranch sites were mapped. The branch sites in all ofthe mutantswere at position -26 in a sequence common to most of themutants in the series. The sequence is derived from a linkerfiagment used in the constructions and does not resemble theconsensus branch-site sequence nor does it have any significantcomplementarity to the 5' splice-site sequence.

MATERIALS AND METHODSDNAs. The rabbit ,/3globin wild-type and mutant construc-

tions were described by Wieringa et al. (8). For this study, thePvu II-Bgl II fragment (10) beginning 10 nucleotides up-stream from the in vivo cap site and ending at the protein-coding terminator was ligated between the HincII andBamHIsites of pSP64 (11).RNA Transcription and Splicing. DNA cleaved with Ava I

was transcribed using SP6 RNA polymerase (DuPont/NewEngland Nuclear) as described (7). The RNA was purified byagarose gel electrophoresis and spliced in a HeLa cell nuclearextract in the presence of 1.5mM ATP and 2.5mM MgCl2 (7).

Analysis of RNA. The various RNA species were analyzedby (i) hybridization to cDNA clones in phage M13 containingdifferent portions ofthe three exons (12); (ii) two-dimensionalanalysis ofRNase T1 and RNase A oligonucleotides followedby secondary digestion with RNase T2 (12); (iii) for lariatRNA species, the RNA branch was cleaved by incubation inHeLa nuclear extract in the presence of 5mM EDTA (13, 23),and the resulting linearRNA was sized by polyacrylamide gelelectrophoresis; and (iv) primer-extension analysis: 8 fmol ofpre-mRNA was spliced in vitro as described above. The totalRNA isolated from the splicing reaction mixture was hybrid-ized to 0.2 pmol of a 5' end-labeled oligonucleotide primercovering positions 1048-1071 of the rabbit f-globin gene (10)in a piperazine-N,N'-bis(2-ethanesulfonate) (Pipes)/NaCl/formamide buffer (14) at 30°C for 16 hr. The reversetranscriptase reaction was carried out as described byWieringa et al. (15).

Analysis of RNA Branches. The excised intervening se-quence lariat RNAs were purified by electrophoresis in a 4%polyacrylamide/8.3 M urea gel followed by electrophoresis ina 10% polyacrylamide/8.3 M urea gel. Then the RNA wasdigested with nuclease P1 and the branched oligonucleotidewas purified by two-dimensional TLC (7). The branchedoligonucleotide was then digested with snake venom

tPresent address: Department of Biochemistry, University of TexasHealth Science Center, 5323 Harry Hines Boulevard, Dallas, TX75235.

8349

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 82 (1985)

1_2i[ 3 RfiG wild type

RPG LIVS 3'ss-24

RfiG mini LIVS 38/129

1 RfiG mini LIVS 38/102

FIG. 1. Structure of rabbit (-globin-gene constructions. Boxes represent the three exons of the rabbit /3-globin gene. Horizontal linesrepresent the two intervening sequences. Hatched bars represent DNA sequences inserted into the second intervening sequence. Allconstructions are described in ref. 8. LIVS, long intervening sequence.

phosphodiesterase and resolved as described (7) or subjectedto periodate-oxidation and ,3-elimination as described (16).

RESULTSThe structures of the wild-type rabbit S-globin second inter-vening sequence and of several mutants prepared byWieringa et al. (8) are shown in Fig. 1. All of theseconstructions, in which various portions of the secondintervening sequence had been removed, produced wild-typelevels of cytoplasmic, spliced mRNA when tested in vivo (8).To examine the behavior of these RNAs in vitro, the genes

were transcribed from an SP6 promoter inserted just up-stream of the first exon. The RNA terminated as a runofftranscript at a site near the end of the third exon. The RNAwas purified and added to a HeLa nuclear extract splicingreaction. Fig. 2 shows an analysis of the precursors andproducts from such reactions using the wild-type RNA andtwo mutant RNAs. In all these cases the expected productswere produced, including fully spliced RNA and interveningsequences excised in the form of lariats as well as a series ofintermediates, showing that the wild-type and mutant RNAswere spliced efficiently in vitro. The various RNA species inFig. 2 were analyzed by hybridization to cDNA probes todetermine which exons they contained (data not shown).Lariat RNA species were identified by altered mobility inhigher-percentage polyacrylamide gels; the linear size of theRNA was determined after incubation in nuclear extractunder "branch-cleavage" conditions (see Materials andMethods; data not shown). Most of the RNAs were alsoanalyzed by RNase T1 oligonucleotide mapping.The rate of splicing of the second intervening sequence in

wild-type RNA is about one-third that of the first interveningsequence in vitro (data not shown). For the mutants exam-ined here, the rate of splicing of the second interveningsequence, as determined by comparing the amount ofproductRNA lacking the first intervening sequence and RNA lackingthe second intervening sequence, was 10-20% the rate forwild type, whereas the rate ofremoval ofthe first interveningsequence appeared to be unaffected (Fig. 2 and data notshown). An additional observation was that either interven-ing sequence could be spliced out of the precursor RNAbefore the other, although more RNA molecules lacking thefirst intervening sequence were produced.The excised intervening sequences were purified and ana-

lyzed to map the branch sites used in the wild-type and two ofthe mutant RNAs. The dinucleotide at the site ofthe branch wasdetermined by digesting uniformly labeled RNA with nucleaseP1 to release the branch trinucleotide of the general structure

(7, 16), where each N represents A, C, G, or U. This was

purified and further digested with snake venom phosphodies-terase to give the component 5' monophosphates (7). As shownin Fig. 3, the wild-type first and second intervening sequences

A B

1-2-3-

45&6

7

C D

*.0i ..-f

- '2&4 I I it4

40 5&6 am 5&6 ~f

7 7

3

E F M

-1057

-770

-612

-495

-_w -392

_ -341

_m 297

_ -210

8

9

8

3&9

8162

9

.--- 79

1 w-Er-w2 ED-Lms3 Q( IVS-2

4 M-K5 -m6 123

71

8 E19 o.. IVS-1

FIG. 2. In vitro splicing reactions of wild-type and mutant3-globin transcripts. RNA transcripts were prepared and spliced asdescribed in Materials and Methods in the presence (lanes A, C, andE) or the absence (lanes B, D, and F) of ATP. The products wereelectrophoresed in a 8% polyacrylamide/8.3 M urea gel. The variousRNA species are numbered 1-9 and diagrammed (compare with Fig.1) below the autoradiographs. The lariat intermediates expected inthe reaction are not seen in this long (3-hr) incubation. Lanes: A andB, R(3G wild-type RNA; C and D, R3G mini LIVS 38/129 RNA; Eand F, R,3G LIVS 3' ss-24 RNA; M, 4X174DNA cleaved with HincHI(fragment sizes in nucleotides at right).

8350 Biochemistry: Padgett et al.

Proc. Natl. Acad. Sci. USA 82 (1985) 8351

A

pA

pG

1B

pApCp0

CIpUpG

*pCOp'U

2_

pA

0PUpG

112

pA

pG

OpCCpU

!120-

E

7 0)10,280_

30940

40%.

50j

2 3 4

FIG. 3. Analysis of branch trinucleotides. (A-D) Nuclease P1-resistant branch trinucleotides from the excised intervening se-quences were cleaved into their component nucleoside 5'-monophosphates with snake venom phosphodiesterase and separat-ed by two-dimensional TLC (directions of migration are indicated inthe lower left corner of each autoradiograph). The amounts ofradioactivity in the released mononucleotides vary from the antici-pated molar ratios due to variability in the specific activity of thenucleoside triphosphates used to synthesize the precursor RNAs.Branch trinucleotides analyzed were from wild-type first interveningsequence (A), wild-type second intervening sequence (B), R/3G miniLIVS 38/129 second intervening sequence (C), and RPG LIVS 3'ss-24 second intervening sequence (D). (E) Cleavage of nucleasePl-resistant trinucleotides by periodate oxidation and P-elimination.The resulting nucleoside 2',3',5'-trisphosphates were separated byone-dimensional TLC in saturated (NH4)2SO4/1 M sodiumacetate/2-propanol (80:18:2, vol/vol). Lanes: 1, wild-type firstintervening sequence; 2, wild-type second intervening sequence; 3,R/3G mini LIVS 38/129 second intervening sequence; 4, R(3G LIVS3' ss-24 second intervening sequence. Markers: 1, Cp2' and Up2'; 2,Cp3' and Up3'; 3, Gp2'; 4, Gp3'; 5, Ap2'; 6, Ap3'; 7, CTP and UTP;8, GTP; 9, ATP; 10, 5'pAp3; 11, 5'pAp2'.

gave pA, pG, and pC (Fig. 3 A and B), whereas the secondintervening sequences of mutants R/8G mini LIVS 38/129 andR(3G LIVS 3' ss-24 gave only pA and pG (Fig. 3 C and D). Sinceall ofthe branches have an adenosine residue at their bases (seebelow) and the 2'-5' linked nucleotide is a guanosine as it isderived from the 5' end of the intervening sequence (7), thedinucleotide at the branch site of the wild-type interveningsequences is ApC while for the mutants it is ApG. Thepossibility that the sequence is ApA in the mutants waseliminated by the finding that the RNase T2-resistant branchstructure is not labeled by [a-32P]ATP (data not shown).

The nucleotide at the base ofthe branch was determined byremoving the 2' and 3' nucleosides from the nuclease P1-generated branch trinucleotide by p3-elimination (16). In allcases, this produced a species that comigrated with adeno-sine 2',3',5'-trisphosphate (Fig. 3E).The locations of the branch sites in the intervening se-

quences were determined by analysis of RNase T1- andRNase A-generated oligonucleotides (data not shown). Thebranch site in the first intervening sequence was found in theRNase T1 oligonucleotide ACUUCUCUCCCCUG which is21-34 nucleotides upstream of the 3' splice site. Since thebranch occurs at an adenosine residue, the branch must belocated 34 nucleotides upstream of the 3' splice site, inagreement with Reed and Maniatis (17).The branch site used in vivo in the second intervening

sequence of wild-type rabbit /-globin was located at position-32 by Zeitlin and Efstratiadis (9). The in vitro branch sitewas determined to be in the same position by cleavage withRNase T1 and isolation of the branch-containing oligonucle-otide CUAACCAUG, by gel electrophoresis followed bydigestion with RNase A, two-dimensional separation of theproducts, and identification of the oligonucleotide ApApGpby RNase T2 digestion. In addition, primer extension gave astrong stop at about 30 and 31 nucleotides upstream of the 3'splice site (Fig. 4) consistent with a branch at position -32.The branch sites used in the second intervening sequences

of the mutant RNAs were determined by primer-extensionexperiments (Fig. 4) and analysis of RNase A-resistantoligonucleotides. In the primer-extension analysis, a reversetranscriptase stop site about 26 nucleotides upstream of the3' splice site was observed in all three mutant RNAs. Twolarger, additional species were generated with mutant RB3Gmini LIVS 38/129 RNA. The top band is almost certainly notdue to a branch, since it was frequently found in controlslacking ATP in the splicing reaction. The second band mayrepresent a minor site of branch formation at an adenosineresidue 34 nucleotides upstream of the 3' splice site. Atwo-dimensional separation of the products of RNase Adigestion of the second intervening sequence of mutant RBGmini LIVS 38/129 (Fig. 5A) revealed that the major site ofbranch formation was present in a large oligonucleotide(number 9) with a composition consistent with the sequenceApGpAPGPU. The second ApG dinucleotide rather thanthe first is the branch site, since nuclease P1 digestion of thisoligonucleotide yielded pG, pU, pC, and pApG rather thanpA, pG, pU, pC, and AP (Fig. 5 C and D). The two formsof the branch trinucleotide separate well in the chromatog-raphy system used. A similar analysis of RNase A-generatedoligonucleotides from the excised intervening sequence ofmutant R/3G LIVS 3' ss-24 gave similar results (data notshown). Thus, the branch is located 26 nucleotides from the3' splice site in mutants RP3G mini LIVS 38/129 and R,8GLIVS 3' ss-24. Since the same reverse transcriptase stop sitewas observed for these mutants and for mutant R,3G miniLIVS 38/102, we conclude that all three mutant RNAs use acommon branch site.

DISCUSSIONWe have analyzed the in vitro activity of three mutant formsof the second intervening sequence of the rabbit /3-globingene. These are representative of a large collection ofmutants analyzed in vivo by Wieringa et al. (8). This series ofmutants was notable because many were as capable ofyielding mature mRNA in vivo as the wild-type gene, eventhough the normal site ofbranch formation had been deleted.

Biochemistry: Padgett et al.

4

0 to100 Oll

8352 Biochemistry: Padgett et al.

1 2 3 4

a -*

BROG Wild Type

CAGG:GUGAGUUUG...... CUCUGCUAACCAUGUUCAUGCCUUCUUCUUUUUCCUACAG:CUCC -32

RBG/3'ss LIVS-24CAGG:GUGAGUUUG...... AACUUUAGCUCUAGAGCAUGCCUUCUUCUUUUUCCUACAG:CUCC -26

R6G/mini LIVS 38/129CAGG:GUGAGUCUC.....,UUUCUCAUAGCUAGAGCAUGCCUUCUUCUUUUUCCUACAG:CUCC

RBG/mini LIVS 38/102

-26

CAGG:GUGAGUCUC...primer ...UGGGAACCGGAGAGAGCAUGCCUUCUUCUUUUUCCUACAG:CUCC -26

Primer GGAAGAAGAAAAAGGATGTC GAGG

FIG. 4. Primer-extension analysis of wild-type and mutant intervening sequences. (A) Total RNA from splicing reaction with (+) or without(-) ATP was assayed for reverse transcriptase stops due to branch formation. The four left lanes (T-A) represent sequencing reactions usingthe same primer on the wild-type rabbit 3-globin gene inserted into phage M13. Other lanes: 1, wild-type RNA; 2, RNA from RI3G mini LIVS38/102; 3, RNA from R/3G LIVS 38/129; 4, RNA from RI3G LIVS 3' ss-24. (B) Partial sequence of the second intervening sequences of theindicated constructions. The 5' and 3' splice sites are indicated by colons. The underlined residue in each sequence is the site ofbranch formation(position relative to the 3' splice site is given by the number to the right of the sequence). The sequence of the DNA primer used in A is alsoshown.

We wished to determine (i) whether the modified interveningsequences could be spliced in vitro, (ii) whether the inter-vening sequences would form lariat RNAs, and (iii) whatsequences would serve as branch sites.We found that the mutant intervening sequences were

spliced in vitro at 10-20% the rate for wild type and thatsplicing proceeded through a lariat intermediate producingexcised second intervening sequences in lariat form. Thedifference between the observed in vitro and in vivo splicingefficiencies ofthese mutants could indicate that splicing is notthe rate-determining step in the production of cytoplasmicmRNA in vivo. This is indeed the case for at least one RNAin yeast (18).An unexpected result was that the sequences at the branch

site bore almost no resemblance to the consensus branch-site

I

021 12. 3

w5 *6~~.-01,

70. I,_.,

8

.9

sequences proposed by Ruskin et al. (5) and Keller and Noon(4) (Table 1). Moreover, the branch-site sequences were notcomplementary to sequences at the 5' splice site as suggestedby Pikielny et al. (6) and Konarska et al. (7). The onlyresidues in the mutants' branch sites that agree with theconsensus sequences are the R-A sequence (R, purine nucle-oside) where the A residue is the base of the branch. Thissequence is not invariant, since the first intervening sequenceof the adenovirus late leader forms a branch at the sequenceUAU. It is surprising that the splicing of mutant RBG miniLIVS 38/129 RNA uses the branch site at position -26preferentially, because the sequence UUCUCAU at position-34 more closely matches the consensus sequence and is ata distance from the 3' splice site where normal branch sitesare found (17).

B7 1 4 2

(GU)/GAGU/C/U/C/C/U/C/C/C/U/C/GU/GC/GC/U/C/U/C/C/U/GU/

5 7U/C/C/GAC/C/C/U/GC/C/GC/U/U/AC/C/GGAU/AC/C/U/GU/C/C/GC/

8 6C/U/U/U/C/U/C/C/C/U/U/C/GGGAAGC/GU/GGC/GC/U/U/U/C/U/C/3 5 9 10AU/AGC/U/AGAGC/AU/GC/C/U/U/C/U/U/C/U/U/U/U/U/C/C/U/AC/AGOH

C iAp

.I<p ,0pA-U*lp PC P

pG!

ti2 EpApG

FIG. 5. Analysis of branch site in R,3G mini LIVS 38/129. The excised second intervening sequence from a splicing reaction using uniformlylabeled RNA was purified by two cycles of polyacrylamide gel electrophoresis. (A) The branch site was mapped by digestion of the RNA withRNase A, followed by two-dimensional oligonucleotide mapping (12). The numbered spots are from the sequence shown in B. The weaker spotsare due to contamination from the nearly identically sized first intervening sequence, which separates poorly from the second interveningsequence. Each of the numbered spots was excised and digested with RNase T2 or nuclease P1 and analyzed by two-dimensional TLC (16).The only branch-containing oligonucleotide was number 9. (B) Sequence of the second intervening sequence of Rj3G mini LIVS 38/129. Thesequence is divided into the nucleotides and oligonucleotides produced by digestion with RNase A. Only the first occurrences of the commonoligonucleotides are numbered. The products C and AC are not seen in the analysis in A. The 5' oligonucleotide, GU, is found in the branchedoligonucleotide 9. (C) Two-dimensional TLC of an RNase T2 digestion of oligonucleotide 9. (D) Two-dimensional TLC ofa nuclease P1 digestion

of oligonucleotide 9. The arrow marks the position of ApG as determined in a parallel experiment.

AT C G A

A

TaT 4B

AAG t,

Proc. Natl. Acad. Sci. USA 82 (1985)

Proc. Natl. Acad. Sci. USA 82 (1985) 8353

Table 1. Branch-site sequences

Intron Branch site

Rf3G wild-type IVS-1 UGCUGACR,3G wild-type IVS-2 UGCUAACR(3G LIVS 3' ss-24 UCUAGAGR,8G mini LIVS 38/129 GCUAGAGRPG mini LIVS 38/102 GAGAGAGConsensus from ref. 4 CUGACConsensus from ref. 5 YNYRAY

Y, pyrimidine nucleoside; R, purine nucleoside; N, pyrimidine orpurine nucleoside.

The role of sequence specificity at branch sites in mam-malian introns is difficult to interpret. Tabulation of knownbranch sites reveals a consensus sequence that has a com-plementary relationship to the consensus sequence at 5'splice sites. Changes in sequences at the branch site typicallyresult in a modest reduction in the efficiency of splicing (19).For example, for the three mutants analyzed here, deletionsof the natural branch site reduced the efficiency by a factorof 5 to 10. This suggests that a consensus sequence at thebranch site can facilitate the reaction but is not essential. Thissituation is in striking contrast to that in yeast, where changesin the highly conserved branch-site sequence effectivelyblock splicing (20). The lack of a strong dependence on aparticular sequence at the site of branch formation in mam-mals suggests two ideas. First, direct recognition of se-quences at the branch site by a factor(s) is probably notcritical in the splicing mechanism. This implies that the siteof branch formation is probably specified in large part by thestructure of the multicomponent complex that forms on theprecursor RNA (21, 22). Second, that the role of the branchsite is to supply a reactant, the 2' hydroxyl group, in thecleavage reaction at the 5' splice site, while other sequencesprovide the specificity.An additional consequence of this work is to strengthen the

results of the study of the second intervening sequence of therabbit ,-globin gene, carried out by Wieringa et al. (8). Theseauthors found that correct splicing in vivo was abolished byreduction of the intervening sequence length to less than 30nucleotides and was restored by insertion of a variety ofsequences into such "mini-introns." Because this work wasdone before the role of branch formation in splicing had beenrecognized, the possibility that the observed changes insplicing efficiency could have been due to the elimination andsubsequent restoration of branch sites was not appreciated.However, it is now apparent, from these results, that all oftheconstructions contained a potentially active branch site in theform of an Xba I linker or a remnant thereof. Thus, theconclusion of Wieringa et al. (8) that a minimal intron lengthis required is strengthened by the finding that all the mutantspossessed a potentially active sequence at the 5' splice site,branch site, and 3' splice site.Another conclusion can be drawn from the work of

Wieringa et al. (8), in view of the recently established

mechanism of splicing. Mutants with intron lengths shorterthan 60 nucleotides were found to utilize preferentially acryptic 5' splice site upstream of the natural 5' splice site.Since cleavage at the 5' splice site is the first covalentmodification of the RNA, this utilization of upstream cryptic5' splice sites strongly suggests that, before cleavage, acomplex forms on the intervening sequence which recognizesboth the 5' and 3' splice sites and specifies the branch site.This is consistent with recent results showing that mutationsin the pyrimidine tract of the 3' splice site block cleavage atthe 5' splice site and branch formation (17).

R.A.P. has been the recipient ofa postdoctoral fellowship from theMyron Bantrell Foundation, and M.M.K. acknowledges postdoc-toral fellowship support from the Jane Coffin Childs Memorial Fund.This work was supported by National Institutes of Health GrantsR01-GM32467 and P01-CA26717, by National Science FoundationGrant PCM-8200309 (to P.A.S.), and by grants from theSchweizerische Nationalfonds and the Kanton of Zurich (to C.W.).

1. Wallace, J. C. & Edmonds, M. (1983) Proc. Natl. Acad. Sci.USA 80, 950-954.

2. Domdey, H., Apostol, B., Lin, R.-J., Newman, A., Brody, E.& Abelson, J. (1984) Cell 39, 611-621.

3. Rodriguez, J. R., Pikielny, C. W. & Rosbash, M. (1984) Cell39, 603-610.

4. Keller, E. B. & Noon, W. A. (1984) Proc. Natl. Acad. Sci.USA 81, 7417-7420.

5. Ruskin, B., Krainer, A. R., Maniatis, T. & Green, M. R.(1984) Cell 38, 317-331.

6. Pikielny, C. W., Teem, J. L. & Rosbash, M. (1983) Cell 34,395-403.

7. Konarska, M. M., Grabowski, P. J., Padgett, R. A. & Sharp,P. A. (1985) Nature (London) 313, 552-557.

8. Wieringa, B., Hofer, E. & Weissmann, C. (1984) Cell 37,915-925.

9. Zeitlin, S. & Efstratiadis, A. (1984) Cell 39, 589-602.10. van Ooyen, A., van den Berg, J., Mantei, N. & Weissmann, C.

(1979) Science 206, 337-344.11. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T.,

Zinn, K. & Green, M. R. (1984) Nucleic Acids Res. 12,7035-7056.

12. Padgett, R. A., Hardy, S. F. & Sharp, P. A. (1983) Proc. Natl.Acad. Sci. USA 80, 5230-5234.

13. Ruskin, B. & Green, M. R. (1985) Science 229, 135-140.14. Dierks, P., van Ooyen, A., Mantei, N. & Weissmann, C.

(1981) Proc. Natl. Acad. Sci. USA 78, 1411-1415.15. Wieringa, B., Meyer, F., Reiser, J. & Weissmann, C. (1983)

Nature (London) 301, 38-43.16. Padgett, R. A., Konarska, M. M., Grabowski, P. J., Hardy,

S. F. & Sharp, P. A. (1984) Science 225, 898-903.17. Reed, R. & Maniatis, T. (1985) Cell 41, 95-105.18. Pikielny, C. W. & Rosbash, M. (1985) Cell 41, 119-126.19. Rautmann, G. & Breathnach, R. (1985) Nature (London) 315,

430-432.20. Langford, C. J., Klinz, F.-J., Donath, C. & Gallwitz, D. (1984)

Cell 36, 645-653.21. Grabowski, P. J., Seiler, S. R. & Sharp, P. A. (1985) Cell 42,

345-353.22. Brody, E. & Abelson, J. (1985) Science 228, 963-967.23. Konarska, M. M., Padgett, R. A. & Sharp, P. A. (1985) Cell

42, 165-171.

Biochemistry: Padgett et al.