1521-0103/360/3/435–444$25.00 http://dx.doi.org/10.1124/jpet.116.238261THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 360:435–444, March 2017Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics

Niacin Promotes Cardiac Healing after MyocardialInfarction through Activation of the Myeloid Prostaglandin D2Receptor Subtype 1 s

Deping Kong, Juanjuan Li, Yujun Shen, Guizhu Liu, Shengkai Zuo, Bo Tao, Yong Ji,Ankang Lu, Michael Lazarus, Richard M. Breyer, and Ying YuDepartment of Pharmacology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China (D.K., Y.S., Y.Y.); KeyLaboratory of Food Safety Research, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, University ofChinese Academy of Sciences, Shanghai, China (D.K., G.L., S.Z., B.T., Y.Y.); Department of Gastroenterology (J.L.), andDepartment of Cardiology (A.L.); Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, China; The KeyLaboratory of Cardiovascular Disease and Molecular Intervention, Atherosclerosis Research Centre, Nanjing Medical University,Nanjing, Jiangsu, China (Y.J.); International Institute for Integrative, Sleep Medicine, University of Tsukuba, Tsukuba City, Ibaraki,Japan (M.L.); and Department of Veterans Affairs, Tennessee Valley Health Authority, and Department of Medicine, VanderbiltUniversity Medical Center, Nashville, Tennessee (R.M.B.)

Received October 10, 2016; accepted December 30, 2016

ABSTRACTNiacin is a well established drug used to lower cholesterol andprevent cardiovascular disease events. However, niacin also causescutaneous flushing side effects due to release of the proresolutionmediator prostaglandin D2 (PGD2). Recent randomized clinical trialshave demonstrated that addition of niacin with laropiprant [a PGD2receptor subtype 1 (DP1) blocker] to statin-based therapies does notsignificantly decrease the risk of cardiovascular disease events,but increases the risk of serious adverse events. Here, we testedwhether, and how, niacin beneficial effects on myocardial ischemiarequire the activation of the PGD2/DP1 axis. Myocardial infarction(MI) was reproduced by ligation of the left anterior descendingbranchof the coronary artery inmice.We found that niacin increased

PGD2 release in macrophages and shifted macrophages to M2polarization both in vitro and in vivo by activation of DP1 andaccelerated inflammation resolution in zymosan-induced perito-nitis in mice. Moreover, niacin treatment facilitated wound healingand improved cardiac function afterMI throughDP1-mediatedM2bias and timely resolution of inflammation in infarcted hearts. Inaddition, we found that niacin intake also stimulated M2 polari-zation of peripheral monocytes in humans. Collectively, niacinpromoted cardiac functional recovery after ischemic myocardialinfarction through DP1-mediated M2 polarization and timelyresolution of inflammation in hearts. These results indicated thatDP1 inhibitionmay attenuate the cardiovascular benefits of niacin.

IntroductionNiacin, also known as vitamin B3 or nicotinic acid, is a safe,

broad-spectrum lipid-lowering agent used to prevent cardio-vascular events (Dunbar andGoel, 2016). Niacin inhibits free

fatty acid (FFA) release from adipocytes (Carlson, 1963) andreduces plasma FFA levels in humans during fasting (Carlsonand Oro, 1962) through its specific receptor GPR109A (Sogaet al., 2003; Tunaru et al., 2003; Wise et al., 2003). Niacin alsosuppresses hepatic low-density lipoprotein, very-low-densitylipoprotein, and triglyceride synthesis through inhibition ofdiacylglycerol acyltransferase 2 (Ganji et al., 2004) and increasesplasma high-density lipoprotein cholesterol (HDLc) indepen-dent of the GPR109A receptor or FFA suppression (Knouffet al., 2008; Zhang et al., 2012). In addition, niacin displaysmultiple anti-inflammation properties, including regulationof the expression of cell adhesion molecules (Tavintharanet al., 2009), nuclear receptors, and scavenger receptors(Rubic et al., 2004; Knowles et al., 2006), through mecha-nisms that are unrelated to its effects on HDLc (Lukasovaet al., 2011). Moreover, niacin suppresses atherogenesis in

This work was supported by the National Natural Science Foundation ofChina [Grants 81525004, 91439204, 31200860, and 91639302], ShanghaiCommittee of Science and Technology Key Program [Grants 14JC1407400,15140902000], Science and Technology Service Network Initiative [Grant KFJ-EW-STS-099], Postdoctoral Fellowship Program of Shanghai Institutes forBiological Sciences, Chinese Academy of Sciences [Grants 2012KIP514 and2013KIP312], and the National Institutes of Health [Grants GM15431 andDK37097], as well as a Merit Award from the Department of Veterans Affairs,Vanderbilt University [1BX000616]. Y.J. and Y.Y. are Fellows at the JiangsuCollaborative Innovation Center for Cardiovascular Disease TranslationalMedicine.

A recommended section: Cardiovasculardx.doi.org/10.1124/jpet.116.238261.s This article has supplemental material available at jpet.aspetjournals.org.

ABBREVIATIONS: DP1, prostaglandin D2 receptor type 1; DP2, prostaglandin D2 receptor type 2; FFA, free fatty acid; HDLc, high-densitylipoprotein cholesterol; H-PGDS, hematopoietic-type PGDS; IFNg, interferon g; IL, interleukin; KO, knockout; L-PGDS, lipocalin-type PGDS; LPS,lipopolysaccharide; Mac, macrophage; MI, myocardial infarction; MS/MS, tandem mass spectrometry; PCR, polymerase chain reaction; PG,prostaglandin; PGD2, prostaglandin D2; PGDM, prostaglandin D2 metabolite; PGDS, PGD2 synthase; PMN, peripheral monocyte; STAT, signaltransducer and activator of transcription; TNFa, tumor necrosis factor-a; WT, wild-type.

435

http://jpet.aspetjournals.org/content/suppl/2017/01/05/jpet.116.238261.DC1Supplemental material to this article can be found at:

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

hyperlipidemic mice through GPR109A-mediated suppres-sion of immune cells (Lukasova et al., 2011).However, one major limitation of niacin is its induction of

dermal side effects, e.g., facial flushing (Dunbar and Gelfand,2010), resulting from stimulation of the GPR109A receptor inskin immune cells (Benyó et al., 2005). Vasodilatory prosta-glandin (PG) D2 (PGD2), perhaps PGE2 as well, secreted ininflammatory cells, such as Langerhans cells, is thought to beinvolved in niacin-induced flushing through PGD2 receptorsubtype 1 (DP1) (Hanson et al., 2010). PGD2 is an arachidonicacid metabolite derived from sequential reaction of cyclooxyge-nases and PGD2 synthases (PGDSs) (Ricciotti and FitzGerald,2011). Two distinct PGDSs, the hematopoietic PGDS (H-PGDS)and the lipocalin PGDS (L-PGDS), mediate the last regulatorysteps in the biosynthetic pathway of PGD2 production (Uradeand Eguchi, 2002; Aritake et al., 2006). PGD2 interacts mainlywith two G-protein–coupled receptors: the DP1 receptor stim-ulates adenylyl cyclase through Gɑs, whereas DP2 [initiallycalled chemoattractant receptor T helper type 2 (CRTH2)]inhibits adenylyl cyclase through Gɑi and increases intracellu-lar Ca21 (Malki et al., 2005; Spik et al., 2005). DP1 andDP2 arelinked to different signaling pathways and appear to havedistinct functions within the immune system (Kostenis andUlven, 2006). DP1 antagonism suppresses niacin-induced vaso-dilation in both mice and humans (Cheng et al., 2006). Manystudies have shown that cyclooxygenase-2–derived PGD2 pro-motes resolution of inflammation (Rajakariar et al., 2007). DP1is highly expressed in monocytes and macrophages (Rajakariaret al., 2007; Sandig et al., 2007), and PGD2-inducedmacrophageM2 polarization facilitates inflammatory resolution throughDP1-mediated suppression of Janus kinase 2 (JAK2)/signaltransducer and activator of transcription (STAT) 1 signaling(Kong et al., 2016).However,whether niacin shapesmacrophagepolarization and accelerates inflammatory resolution throughPGD2 release remains unclear.In the recent Heart Protection Study 2–Treatment of HDLc

to Reduce the Incidence of Vascular Events (HPS2-THRIVE)trial, niacin therapy, combined with laropiprant (a DP1 antag-onist), did notmarkedly decrease the risk ofmajor cardiovascularevents, but did increase the risk of serious side effects (Landrayet al., 2014). However, it is unclear whether the cardiovascularbenefits of niacin can be confounded byDP1 inhibition (Song andFitzGerald, 2013; Dunbar and Goel, 2016). In this study, weevaluated the effects of niacin on PGD2 secretion and mono-cyte/macrophage M2 polarization through DP1 activation inmice using zymosan-induced peritonitis and myocardial infarc-tion mouse models and analysis of the effects of niacin intake inhumans. Our findings provide important insights into the effectsof niacin on myocardial recovery from ischemic injury throughactivation of theDP1 receptor, suggesting thatDP1blockersmayundermine the cardioprotective effects of niacin.

Materials and MethodsAnimals. DP1F/F mice were maintained on a C57BL/6 genetic

background and crossed with C57BL/6 LysMCre mice to generateDP1F/FLysCre mice; these mice are referred to as macrophage (Mac)-DP1 knockout (KO) mice (Kong et al., 2016). DP1F/F littermates[hereafter referred to as wild-type (WT) mice] were used as exper-imental controls. All animals were maintained and used in accor-dance with the guidelines of the Institutional Animal Care and UseCommittee of the Institute for Nutritional Sciences, University ofChinese Academy of Sciences.

Reagents. Interferon g (IFNg) and interleukin 4 (IL-4) werepurchased from Peprotech (Rocky Hill, NJ). Lipopolysaccharide (LPS),niacin, zymosan, and thioglycolate were purchased from Sigma-Aldrich(St. Louis, MO).

Peritoneal Macrophage Isolation and Treatment. Peritonealmacrophages were induced and prepared by an i.p. injection of 3%Brewer’s thioglycolate as described previously (Yang et al., 2010).Macrophages were allowed to adhere overnight (37°C, 5% CO2) andwashed with fresh medium to remove unattached cells before use.Macrophage polarization was subsequently induced with LPS (1mg/ml)plus IFNg (20 ng/ml) or IL-4 (20 ng/ml) and analyzed by reverse-transcription polymerase chain reaction (PCR) or western blotting, asdescribed later.

Myocardial Infarction Mouse Model. Left anterior descendingartery ligation was used in mice to induce myocardial infarction (MI).In brief, bothmale and femalemice (6–8weeks of age) were anesthetizedwith isoflurane (2%) using an induction chamber, and the left anteriordescending coronary artery was completely ligated to induce leftventricular ischemia (Gao et al., 2010).

Cell Sorting from Post-MI Hearts. Mice were anesthetized andintracardially perfused with 40 ml of ice-cold phosphate-bufferedsaline to exclude blood cells. The heart was dissected, mincedwith finescissors, and enzymatically digested with a cocktail of collagenase I(450 U/ml), collagenase XI (125 U/ml), DNase I (60 U/ml), andhyaluronidase (60 U/ml; Sigma-Aldrich) for 1.5 hours at 37°C withgentle agitation. After digestion, the tissue was triturated and passedthrough a 70-mm cell strainer. Leukocyte-enriched fractions wereisolated by 37–70% Percoll (GE Healthcare, Piscataway, NJ) densitygradient centrifugation, as described elsewhere (Yan et al., 2013).Cells were removed from the interface and washed with RPMI1640 cell culture medium prior to staining with anti-CD45 and anti-CD11b antibodies and sorting into three populations: CD451CD11b1

(myeloid cells), CD451CD11blow (lymphocytes), and CD452CD11blow

(nonleukocytes). The CD451CD11b1 population could be furtherdivided into CD11b1F4/801 macrophages and CD11b1Ly-6G1

neutrophils.Echocardiography. Transthoracic echocardiography was per-

formed at different time points after surgery using an echocardiograph(Vevo2100, VisualSonics, Canada). The investigator was blinded togroup assignment. Mice were anesthetized by isoflurane inhalation.Two-dimensional parasternal long-axis views of the left ventricle wereobtained for guided M-mode measurements of the left ventricleinternal diameter at end diastole and end systole, as well as theinterventricular septal wall thickness and posterior wall thickness.

Flow Cytometry. Isolated peripheral blood cells and leukocytesisolated from the heart were analyzed by flow cytometry. To blocknonspecific binding of antibodies to Fcg receptors, isolated cells werefirst incubated with anti-CD16/32 antibody (BD Biosciences, SanJose, CA) at 4°C for 5 minutes. Subsequently, the cells were stainedwith a mixture of the following antibodies at 4°C for 30 minutes:anti–CD45-fluorescein isothiocyanate (PE), anti–CD11b-fluoresceinisothiocyanate (FITC), anti–Ly6G-PE-Cy7, anti–Ly6C-Allophycocyanin(APC) (eBioscience, San Diego, CA), anti–F4/80-BV421, andanti–CD206-APC (BioLegend, San Diego, CA). Human peripheralblood monocytes were defined as SSClow CD14high cells. Afterstaining with 7-amino-actinomycin D (Sigma-Aldrich) to discrimi-nate dead cells, flow cytometry was performed on a FACSCalibur(BD Biosciences), and the data were analyzed with FlowJo software(version 9, Tree Star, Ashland, OR).

PGD2 Extraction and Analysis. Cell supernatants or peritonealexudates (500 ml) were used for PG extraction after protein quantifi-cation, as previously reported (Lu et al., 2015). An internal standard(2 ml) was added to the sample in 40 ml of citric acid (1 M) and 5 ml of10% butylated hydroxytoluene, and the sample was then vigorouslyshaken with 1 ml of solvent (normal hexane:ethyl acetate, 1:1) for1 minute. The organic phase supernatant was collected after centri-fugation (6000� g) for 10minutes. The eluatewas dried under nitrogenand analyzed by electrospray triple/quadruple liquid chromatography

436 Kong et al.

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

tandem mass spectrometry (MS/MS) (4000Q Trap; AB Sciex, Concord,Ontario, Canada). Chromatographic separation was performed on aZORBAX SB-Aq high-performance liquid chromatography column(3.0 � 250 mm, 5 mm; Agilent, Santa Clara, CA) using 0.1% acetic acidin water (mobile phase A) and acetonitrile (mobile phase B) as themobile phase for binary gradient elution. The column flow rate was0.4 ml/min; the column temperature was 25°C, and the autosamplerwas kept at 4°C. The binary elution gradient was 30% B to 53% B in15 minutes, and then to 90% B in 1 minute, maintained at 90% B for3 minutes. The column was equilibrated for 10 minutes with the initialsolvent composition between injections. PGD2 was detected andquantified in negative ion mode, and the electrospray potential wasmaintained at 24.5 kV and heated to 500°C. For MS/MS analysis,PGD2/internal standards were subjected to collision-induced fragmen-tation. PG production was normalized to total protein.

PGD2 Metabolite Analysis. Urinary PGD2 metabolite (PGDM)was extracted and quantitated as previously reported (Song et al.,2008). In brief, mouse urine was collected for 24 hours in metaboliccages with fasting treatment after niacin or carboxymethylcellulosetreatment from the third day post-MI. Samples (100 ml) were spikedwith internal standard (10 ml [2H6]tetranor PGDM) contained inacetonitrile. Two times the urine volume of an aqueous solution ofmethoxy-amine HCl (1 g/ml) was added and allowed to stand for30minutes at room temperature and then diluted to 1ml using water.The solid-phase extraction cartridge was conditioned with 1 ml ofacetonitrile and equilibrated with 1 ml of water. The sample wasapplied to the cartridge, which was then washed with 1 ml of 5%

acetonitrile in water and dried with vacuum for 15 minutes. Theanalyte and internal standard were eluted from the cartridge using1 ml of 5% acetonitrile in ethylacetate. The eluate was collected anddried under a gentle stream of nitrogen. The resulting residue wasthen dissolved in 100 ml of 10% acetonitrile in water and passedthrough small centrifugal filters with a 0.2-mm nylon membrane priorto analysis by mass spectrometry. The urinary creatinine was used tonormalize the prostaglandin metabolites.

Collection of Human Plasma and Urine. Sixteen healthyvolunteers (20–30 years old) who did not take any nonsteroidal anti-inflammatory drugswithin 1weekwere administered niacin (500mg/day,orally) for 3 days. Peripheral blood samples were collected 12 hoursbefore and after niacin intake. Urine samples were collected at theindicated time point [before (time 0) and after (time 1, 2, 3, 4, 6, and12 hours)] after niacin intake. Urinary PGDMs were quantified byliquid chromatography MS/MS, and peripheral monocytes weresorted for gene-expression analyses. The experiment was approvedby the Human Ethics Committee of Shanghai Ruijin Hospital, andall volunteers provided informed consent before the start of theexperiment.

RNA Extraction and Quantitative Real-Time PCR. TotalRNA samples from sorted cells or adherent macrophages wereprepared using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands) orTRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufac-turer’s instructions. Total RNA (1 mg) was reverse transcribed tocDNAwith a Reverse Transcription Reagent kit (TAKARA, Shanghai,China), according to the manufacturer’s instructions. The resulting

TABLE 1Primers for real-time PCR analysis in mice

Gene Sense Antisense

H–PGDS GGAAGAGCCGAAATTATTCGCT ACCACTGCATCAGCTTGACATL–PGDS TGCAGCCCAACTTTCAACAAG TGGTCTCACACTGGTTTTTCCTDP1 AACCTCTATGACATGCACAGGCG AAGGCTTGGAGGTCTTCTGAGTCDP2 TCTCAACCAATCAGCACACCCGA GATGTAGCGGAGGCTAGAGTTGCIL-1b AGCTCTCCACCTCAATGGAC GACAGGCTTGTGCTCTGCTTIL-12b TGGTTTGCCATCGTTTTGCTG ACAGGTGAGGTTCACTGTTTCTTNFa ACGGCATGGATCTCAAAGAC CGGACTCCGCAAAGTCTAAGMCP1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGTNOS2 ACATCGACCCGTCCACAGTAT CAGAGGGGTAGGCTTGTCTCYM1 CAGGTCTGGCAATTCTTCTGAA GTCTTGCTCATGTGTGTAAGTGAMRC1 CTCTGTTCAGCTATTGGACGC CGGAATTTCTGGGATTCAGCTTCIL-10 TCAAGGATGCACATCAAAAGGC AGGCAGCAACTTCCTCCCTDectin GACTTCAGCACTCAAGACATCC TTGTGTCGCCAAAATGCTAGGL32 TTAAGCGAAACTGGCGGAAAC TTGTTGCTCCCATAACCGATGGAPDH CCCTTATTGACCTCAACTACATGGT GAGGGGCCATCCACAGTCTTCTG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

TABLE 2.Primers for real-time PCR analysis in human samples.

Gene Sense Anti–sense

COX-1 CGCCAGTGAATCCCTGTTGTT AAGGTGGCATTGACAAACTCCCOX-2 CTGGCGCTCAGCCATACAG CGCACTTATACTGGTCAAATCCCH–PGDS ACCAGAGCCTAGCAATAGCAA AGAGTGTCCACAATAGCATCAACL–PGDS GGCGTTGTCCATGTGCAAG GGACTCCGGTAGCTGTAGGADP1 CTGGGCAAGTGCCTCCTAAG CAACGAGTTGTCCAATGCGGDP2 AAAAGGCTCGGGAAGGTTAAATG ACCGGGGAACCAAGAGAGAGIL-1b ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGAIL–12b ACCCTGACCATCCAAGTCAAA TTGGCCTCGCATCTTAGAAAGTNFa CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAGNOS2 TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCCArg1 GTGGAAACTTGCATGGACAAC AATCCTGGCACATCGGGAATCMRC1 TCCGGGTGCTGTTCTCCTA CCAGTCTGTTTTTGATGGCACTDectin GGAAGCAACACATTGGAGAATGG CTTTGGTAGGAGTCACACTGTCFizz1 CCGTCCTCTTGCCTCCTTC CTTTTGACACTAGCACACGAGAGAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Macrophage DP1 Mediates Resolution Effect of Niacin 437

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

cDNAwas amplified for 40 cycles. L32 and glyceraldehyde 3-phosphatedehydrogenase (GAPDH) mRNA were amplified as internal controls.Each sample was analyzed in triplicate and normalized to a referenceRNA. PCR products were confirmed by a single band of expected size ona 2% agarose gel. The primer sequences for PCR are summarized inTables 1 and 2.

Western Blotting. The protein concentrations of adherent orsorted macrophage lysates were determined using a BCA ProteinAssay Kit (Pierce, Rockford, IL). Equal quantities of proteins weredenatured and resolved by sodium dodecyl sulfate polyacrylamide gelelectrophoresis on 10% gels, transferred to nitrocellulose membranes,incubated with 5% skimmed milk for 1–1.5 hours, and then incubatedwith primary antibodies overnight at 4°C. Primary antibodies werediluted as follows: anti–phospho-STAT1 (58D6) (1:1000; Cell SignalingTechnology, Danvers, MA), anti-STAT1 (1:1000; ABclonal Technology,Woburn, MA), anti–phospho-STAT6 (pY641) (1:1000; BD Biosciences),and anti-STAT6 (1:1000; ABclonal Technology). Antiactin antibodies (1:2000; Sigma-Aldrich) were used as a loading control. The membraneswere then incubated in horseradish peroxidase–labeled secondary anti-bodies in blocking buffer for 2 hours. Blots were developed using anenhanced chemiluminescence reagent (ThermoScientific,Waltham,MA).

Statistical Analysis. All data are expressed as themeans6S.E.M.Data were analyzed in GraphPad Prism 5 (GraphPad Software,

Inc., San Diego, CA). Two-tailed Student’s t test and analysis ofvariance were used for comparisons between different groups.P values ,0.05 were considered statistically significant.

ResultsNiacin Promotes M2 Macrophage Polarization via

Activation of the PGD2/DP1 Axis. We previously foundthat PGD2 triggers macrophage M2 polarization (Konget al., 2016). To explore whether niacin alters macrophagepolarization through PGD2, we first tested PGD2 generationin niacin-treated macrophages. As shown in Fig. 1A, niacin(3mM, 30minutes) (Meyers et al., 2007) markedly enhancedPGD2 secretion in both LPS/IFNg- and IL-4–challengedmacrophages in vitro for induction of M1 and M2 polariza-tion, respectively. Interestingly, niacin (3 mM) effectivelysuppressed LPS/IFNg-induced proinflammatory gene ex-pression and enhanced IL-4–induced anti-inflammatoryexpression in WT macrophages (DP1F/F), but not in theirDP1-deficient counterparts (DP1F/FLysCre, Mac-DP1 KO;Fig. 1, B and C). It has been proposed that STAT1 activation

Fig. 1. Niacin stimulates M2 macrophage polariza-tion in vitro. (A) Cultured primary peritoneal mousemacrophages were treated with LPS/IFNg or IL-4 for24 hours after washing, then the cells were exposed toniacin (3 mM) for 30 minutes, the supernatants werecollected, and PGD2 was analyzed by mass spectrom-etry. *P , 0.05; **P , 0.01 versus vehicle (n = 6). (Band C) Effects of niacin pretreatment (3 mM, 30 min-utes) on proinflammatory (B) and anti-inflammatory(C) gene expression. (D and E) Effects of niacinpretreatment (0.5–3 mM, 30 minutes) on phosphor-ylation of STAT1 (D) and STAT6 (E) in peritonealmacrophages. (F and G) Effects of niacin pretreat-ment (3 mM, 30 minutes) on phosphorylation ofSTAT1 (F) and STAT6 (G) in WT and DP1-deficientperitoneal macrophages. *P , 0.05 versus vehicle;#P , 0.05 versus WT (n = 6). Data are expressed asthe mean 6 S.E.M. All western blots were repeatedthree times, and other results were verified in twoindependent experiments. Statistical significancewas determined using unpaired Student’s t tests.

438 Kong et al.

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

is indispensable for M1 macrophage polarization, whereasM2 macrophage differentiation requires STAT6 activity(Sica and Mantovani, 2012). We have also reported thatDP1 mediates M2 polarization through suppression of theSTAT1 pathway and activation of the STAT6 pathway(Kong et al., 2016). Similarly, here we found that niacinpretreatment depressed LPS/IFNg-induced STAT1 activa-tion (Fig. 1D) and enhanced IL-4–induced STAT6 activation(Fig. 1E) in macrophages in a dose-dependent manner, in-dicating niacin promotes macrophage polarization towardM2 status. Notably, these effects were disrupted by DP1 dele-tion (Fig. 1, F and G). Therefore, our findings indicate thatniacin modulated macrophage polarization via activation of thePGD2/DP1 axis.Niacin Accelerates Resolution through DP1 in a

Zymosan-Induced Mouse Model of Peritonitis. Next,we examined the effect of niacin on zymosan-inducedperitonitis in mice. Niacin (600 mg/kg) (Wang et al.,1990; Nagai et al., 1994; Godin et al., 2012) was adminis-tered to mice 24 hours after zymosan challenge (Fig. 2A),and peritoneal macrophages were isolated for gene-expression analysis. H-PGDS and DP1 expression levels

were increased in peritoneal macrophages from zymosan-treated mice (Fig. 2B). Notably, niacin reduced both totalinfiltrated inflammation cells and macrophages at thelater stages of zymosan-induced peritonitis in WT mice(Fig. 2, C and D), thereby accelerating resolution. Additionally,niacin markedly increased the CD11b1F4/801CD2061 macro-phage ratio (M2-like) at the resolution phase (both 48 and72 hours) in zymosan-treated mice (Fig. 2E). Moreover, consis-tent with our observations in vitro, niacin also suppressedproinflammatory gene expression [i.e., tumor necrosisfactor-a (TNFa)] and induced anti-inflammatory gene ex-pression [i.e., arginase 1 (Arg1); chitinase 3-like 3 (YM1); andCD206, mannose receptor, C type 1 (MRC1)] in peritonealmacrophages from WT mice (Fig. 2, F–I). None of thesealterations were observed in Mac-DP1 KOmice (Fig. 2, C–G).Thus, niacin facilitated inflammatory resolution by pro-moting DP1-mediated macrophage polarization toward anM2-like state.Niacin Improves post-MI Recovery by Promoting

DP1-Mediated Inflammatory Resolution. We have con-firmed that there was an increase of PGD2 in ischemic heartpost-MI (Fig. 3A). Again, niacin increased total body PGD2

Fig. 2. Niacin accelerates resolution in zymo-san-induced peritonitis through DP1 activa-tion. (A–I) Effects of niacin on zymosan-inducedperitonitis in mice. Niacin (600 mg/kg, every12 hours) was administered 24 hours afterzymosan challenge (A), and peritoneal cellswere harvested as indicated. PGDS and DP1expression levels (B) were examined in macro-phages, and the influence of niacin on totalinfiltrated inflammatory cells (C), total macro-phages (D), M2 polarization ratio (E), andTNFa (F) andM2 (G–I) expression was assayedin macrophages isolated at the resolution stageof zymosan-induced peritonitis. *P , 0.05,**P , 0.01 versus carboxymethylcellulose (B)or as indicated (C–I); n = 4–6. All data areexpressed as the mean 6 S.E.M. P values werecalculated using two-way analysis of variancefollowed by Bonferroni post-hoc tests (C–I) orunpaired Student’s t tests (B). CMC, carboxy-methylcellulose; GAPDH, glyceraldehyde3-phosphate dehydrogenase; ns, not significant.

Macrophage DP1 Mediates Resolution Effect of Niacin 439

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

production in mice, and upregulated both H-PGDS and DP1expression inmacrophages recruited to infarcted hearts at day14 after experimental MI (Fig. 3, B and C). Interestingly,niacin alleviated the inflammatory response to ischemia andaccelerated resolution by reducing the infiltration of CD451

leukocytes and CD11b1F4/801 macrophages to the infarctedhearts in WT mice on days 7 and 14 after MI (Fig. 3, D and E;Supplemental Fig. 1). Moreover, niacin also reduced theCD11b1F4/801CD2062macrophage ratio (M1-like) but increasedthe CD11b1F4/801CD2061 macrophage ratio (M2-like) in WT

Fig. 3. Niacin treatment improves recovery in post-MI mice by promoting DP1 activation–dependent M2 polarization and timely resolution. (A)PGD2 production in ischemic hearts after MI. Mice underwent left anterior descending ligation for 2 weeks, and then heart tissues were collected forPG extraction and examined by liquid chromatography MS/MS. **P , 0.01, n = 6. (B and C) Effects of niacin (600 mg/kg, twice daily) on urinaryPGDM (B) and PGDS, DP1 and DP2 expression in peripheral monocytes (C) in mice. *P , 0.05, **P , 0.01 versus carboxymethylcellulose (CMC);(n = 6). (D–G) Effects of niacin on inflammatory resolution and macrophage polarization in Mac-DP1 KO mice. Inflammatory cells were harvestedfrom infarcted hearts, and total CD45+ leukocytes (D), macrophages (E), and M1/M2 cell ratios (F and G) were analyzed. *P , 0.05, **P , 0.01 asindicated (n = 4–6). (H and I) Macrophages sorted at day 14 were used to examine proinflammatory (H) and anti-inflammatory (I) gene expression.*P, 0.05 versus carboxymethylcellulose; #P, 0.05 versus WT (n = 6). (J) Representative echocardiography images with M-mode views of infarctedhearts after niacin treatment on day 14 post-MI. Arrows and lines mark left ventricular inner diameters in systole (dashed, white) and diastole(solid, blue). (K) Effects of niacin (600 mg/kg, twice daily) on heart functions post-MI in Mac-DP1 KO and WT mice. Niacin was administered fromdays 3 to 14 after MI. *P, 0.05; n = 8–10 per group. Data are presented as means6 S.E.M. and are representative of two independent experiments.Statistical analysis was performed using two-way analysis of variance followed by Bonferroni post-hoc tests (D–G and K) or unpaired Student’st tests (A, B, C, H, and I). GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LVEF, left ventricular ejection fraction; ns, not significant; Ucr,Urinary Creatinine.

440 Kong et al.

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

mice on days 7 and 14 after MI (Fig. 3, F and G), suppressed theexpression of proinflammatorygenes (i.e., IL-1b,TNFa, andnitricoxide synthase 2 [NOS2]), and increased the expression of anti-inflammatory genes (i.e., YM1, Arg1, and MRC1) in infiltratedmacrophages fromWTmice but not Mac-DP1 KOmice (Fig. 3, Hand I), indicating that niacin promoted M2 polarization ininfarcted hearts through DP1. Accordingly, niacin dramaticallyrestored cardiac function and tissue damage in WT mice but

not in Mac-DP1 KO mice after MI (Fig. 3, J and K; Table 3;Supplemental Fig. 2). Since DP1 activation may have genderdifferential responses in vasculature in mice (Song et al.,2012), we also compared the effect of Mac-DP1 deletion incardiac recovery after MI between male and female mice.Again, Mac-DP1 deficiency markedly impaired cardiac re-covery after MI in mice (Supplemental Table 1), but we failedto observe significant differences of heart functions between

Fig. 4. Niacin stimulates peripheral monocyte M2 polarization via DP1 activation in LPS-challenged mice. (A) Experimental design for niacin(600 mg/kg) treatment in LPS-challenged (8 mg/kg) mice. (B–F) Peripheral monocytes were sorted (B) to examine the mRNA levels of PGDS (C) andDP1(D), proinflammatory (E), and anti-inflammatory (F) gene expression in the presence and absence of niacin. *P , 0.05, **P , 0.01 versuscarboxymethylcellulose (CMC); #P , 0.05 versus WT (n = 5–6). All graphs are shown as the mean 6 S.E.M. Data are representative of two independentexperiments. Statistical significance was determined using unpaired Student’s t tests. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

TABLE 3Effect of niacin treatment on recovery of Mac-DP1 KO mice 14 days post-MIAll mice were female. Data are presented as means 6 S.E.M. and are representative of two independent experiments.Statistical analysis was performed using a two-way analysis of variance followed by a Bonferroni post-hoc test.

Vehicle Niacin

WT (n = 8) Mac-DP1 KO (n = 8) WT (n = 9) Mac-DP1 KO (n = 10)

LVEF (%) 35.74 6 1.992 18.32 6 2.144** 49.85 6 1.707# 20.75 6 0.6724**LVFS (%) 17.26 6 1.146 8.376 6 1.006** 25.23 6 1.014# 8.47 6 0.2887**LVIDd (mm) 4.710 6 0.1769 5.233 6 0.2329* 4.206 6 0.1893 5.110 6 0.2400*LVIDs (mm) 3.920 6 0.1516 4.798 6 0.2289** 3.030 6 0.1223# 4.643 6 0.2118**BNP (pg/ml) 125.1 6 2.545 133.624 6 1.557* 98.2 6 2.131## 130.5 6 1.002**CKMB (pg/ml) 19.82 6 0.211 21.581 6 0.231* 17.75 6 0.212# 21.54 6 0.289**LVM/HW 0.691 6 0.016 0.593 6 0.152* 0.729 6 0.127 0.605 6 0.017*HW/BW 0.007 6 0.0003 0.009 6 0.0003** 0.007 6 0.0001 0.009 6 0.0002

BNP, brain natriuretic peptide; BW, body weight; CKMB, creatine kinase; HW, heart weight; LVEF, left ventricularejection fraction; LVFS, left ventricular fractional shortening; LVIDd, left ventricular internal diameter at diastole;LVIDs, left ventricular internal diameter at systole; LVM, left ventricular mass.

*P , 0.05; **P , 0.01 versus WT; #P , 0.05; ##P , 0.01 versus vehicle.

Macrophage DP1 Mediates Resolution Effect of Niacin 441

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

male and female Mac-DP1 KO mice before and after MI(Supplemental Table 1).Niacin Modulates Peripheral Monocyte Polarization

in Both Mice and Humans. We also examined the effects ofniacin (600 mg/kg) on polarization of peripheral monocytes inLPS-challenged mice (Fig. 4A). Expression of L-PGDS and DP2was relatively low in mouse peripheral monocytes (Fig. 4, B–D).Interestingly, niacin enhanced H-PGDS and DP1 expression inperipheral blood monocytes (CD451CD11b1Ly6G2Ly6C1; Fig.4, B–D), but did not affect L-PGDS or DP2 expression (Fig. 4,B–D). As anticipated, LPS challenge induced proinflammatoryM1 gene expression, which was blunted by niacin pretreatmentin WT peripheral monocytes (PMNs) but not in Mac-DP1 KOPMNs (Fig. 4E). Moreover, niacin was only able to augmentanti-inflammatory M2 gene expression in WT monocytes,whereas DP1-deficient cells were unaffected (Fig. 4F).Next, to determine whether niacin had the same effects in

humans, blood and urine samples were collected from healthyvolunteers before and after a 3-day administration of niacin(Fig. 5A). As previously described (Song et al., 2008), niacintreatment resulted in substantial PGD2 production (Fig. 5B).Interestingly, H-PGDS and L-PGDS expression levels weresignificantly increased in human CD141 PMNs, but no signif-icant effects were observed with respect to DP1 expression (Fig.5, C andD). Accordingly, niacin induced the downregulation andupregulation of M1 and M2 markers, respectively, in humanPMNs (Fig. 5, E and F), indicating that niacin also promotedhuman monocyte M2 polarization.

DiscussionNiacin has been used in the treatment of dyslipidemia

(Carlson and Oro, 1962; Carlson, 1963); however, adverseeffects, including facial flushing, limit its use in part by enhancingPGD2 synthesis (Dunbar and Gelfand, 2010; Hanson et al.,2010). Here, we found that niacin facilitated post-MI healingthrough PGD2 receptor DP1-induced M2 polarization andresolution of inflammation.PGD2 is involved in the resolution of inflammation (Gilroy

et al., 1999). Consistent with this, H-PGDS deficiency resultsin impaired inflammatory resolution in mice (Rajakariaret al., 2007), and the proresolution effects of PGD2 are believedto contribute to balancing the secretion of pro- versus anti-inflammatory cytokines through the DP1 receptor (Rajakariaret al., 2007). We found that PGD2 promotes M2 polarizationand resolution of acute inflammation, including MI, throughDP1-mediated suppression of JAK2-STAT1 signaling (Konget al., 2016). Interestingly, in vascular inflammation animalmodels, DP1 activation restrains aneurysm formation inmales and atherogenesis in females (Song et al., 2012). Weand others found DP1 mediates cardioprotection in bothgenders (Tokudome et al., 2009; Kong et al., 2016). Niacinstimulates PGD2 biosynthesis in inflammatory cells throughtheGPR109A receptor (Benyó et al., 2005;Maciejewski-Lenoiret al., 2006). Accordingly, in this study, we showed that niacinpromoted the resolution of inflammation and cardiac recoveryfrom ischemia by activating DP1. In accordance with these

Fig. 5. Niacin intake promotes M2-like bias in human peripheral monocytes. (A) Diagram of niacin intake and blood-sample collection. (B) UrinaryPGDMs were measured at different time points after niacin intake (n = 4). (C–F) CD14+ human peripheral monocytes (C) were monitored for PGDS,DP1(D), proinflammatory (E), and anti-inflammatory (F) gene expression. *P , 0.05, **P , 0.01 versus before niacin (n = 15). All graphs are shown as themean 6 S.E.M. Statistical significance was determined using unpaired Student’s t tests. Cre, Creatinine; FSC, Forward Scatter; hGAPDH, humanglyceraldehyde 3-phosphate dehydrogenase.

442 Kong et al.

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

observations, niacin inhibits various inflammatory reactionsin different disease models (Godin et al., 2012).Immediate-release niacin has been shown to ameliorate lipid

profiles and improve outcomes in patients with acute myocar-dial infarction (Canner et al., 1986; Carlson and Rosenhamer,1988). However, in two recent clinical trials [AtherothrombosisIntervention in Metabolic Syndrome with Low HDL/HighTriglycerides: Impact on Global Health Outcomes (AIM-HIGH)(Boden et al., 2011) and HPS2-THRIVE (Landray et al., 2014)],an extended-release alternative failed to recapitulate thebenefits of the established cardioprotective regimen of nia-cin, despite significant increases in HDLc and reduction oftriglyceride levels in patients. These contradictory findingsmay be related to clinical design and outcomes, such as un-balanced use of statins and ezetimibe (Song and FitzGerald,2013) and possibly the dosage of the extended-release niacinalternative (Dunbar andGoel, 2016). In theHPS2-THRIVE trial,combinational use of the DP1 antagonist laropiprant may alsohave been an important factor (Song and FitzGerald, 2013). Inexperimental animals, pharmacological inhibition or geneticdeletion of DP1 augments abdominal aneurysm formation,enhances angiotensin II–induced hypertensive responses, andincreaseshigh-fat diet–inducedatherosclerosis (Song et al., 2012;Strack et al., 2013). Moreover, the PGD2-DP1 axis mediates thecardioprotective effects of glucocorticoids against ischemia-reperfusion injury (Tokudome et al., 2009; Katsumata et al.,2014), and we found that DP1 expression in macrophagesfacilitates cardiac healing after MI by accelerating resolution(Kong et al., 2016). Thus, it is possible that DP1 inhibition bylaropiprant could block the beneficial effects of niacin in micewith myocardial infarction. Indeed, in the HPS2-THRIVEtrial, laropiprant was found to contribute to some seriousadverse events, such as excessive bleeding and infection,given that laropiprant has high affinity for the thromboxaneA2 receptor (Dallob et al., 2011) and that PGD2 has multipleanti-inflammatory properties.In summary, our findings show that niacin promoted cardiac

recovery after MI through DP1-mediated M2 polarization andtimely resolution of inflammation, suggesting activation of DP1receptor may represent a novel strategy for management ofcardiovascular disease.

Acknowledgments

The authors thank Maohua Shi and Kai Cao for technicalassistance.

Authorship Contributions

Participated in research design: Kong, Li, Shen, Yu.Conducted experiments: Kong, Li, Shen, Liu, Zuo, Tao.Contributed new reagents or analytic tools: Tao, Ji, Lu, Lazarus,

Breyer.Performed data analysis: Kong, Li, Shen.Wrote or contributed to the writing of the manuscript: Kong,

Shen, Yu.

References

Aritake K, Kado Y, Inoue T, Miyano M, and Urade Y (2006) Structural and functionalcharacterization of HQL-79, an orally selective inhibitor of human hematopoieticprostaglandin D synthase. J Biol Chem 281:15277–15286.

Benyó Z, Gille A, Kero J, Csiky M, Suchánková MC, Nüsing RM, Moers A, Pfeffer K,and Offermanns S (2005) GPR109A (PUMA-G/HM74A) mediates nicotinic acid-induced flushing. J Clin Invest 115:3634–3640.

Boden WE, Probstfield JL, Anderson T, Chaitman BR, Desvignes-Nickens P,Koprowicz K, McBride R, Teo K, and Weintraub W; AIM-HIGH Investigators(2011) Niacin in patients with low HDL cholesterol levels receiving intensive statintherapy. N Engl J Med 365:2255–2267.

Canner PL, Berge KG, Wenger NK, Stamler J, Friedman L, Prineas RJ,and Friedewald W (1986) Fifteen year mortality in Coronary Drug Project patients:long-term benefit with niacin. J Am Coll Cardiol 8:1245–1255.

Carlson LA (1963) Studies on the effect of nicotinic acid on catecholaminestimulated lipolysis in adipose tissue in vitro. Acta Med Scand 173:719–722.

Carlson LA and Oro L (1962) The effect of nicotinic acid on the plasma free fatty acid;demonstration of a metabolic type of sympathicolysis. Acta Med Scand 172:641–645.

Carlson LA and Rosenhamer G (1988) Reduction of mortality in the StockholmIschaemic Heart Disease Secondary Prevention Study by combined treatment withclofibrate and nicotinic acid. Acta Med Scand 223:405–418.

Cheng K, Wu TJ, Wu KK, Sturino C, Metters K, Gottesdiener K, Wright SD, Wang Z,O’Neill G, Lai E, et al. (2006) Antagonism of the prostaglandin D2 receptor1 suppresses nicotinic acid-induced vasodilation in mice and humans. Proc NatlAcad Sci USA 103:6682–6687.

Dallob A, Luo WL, Luk JM, Ratcliffe L, Johnson-Levonas AO, Schwartz JI, Dishy V,Kraft WK, De Hoon JN, Van Hecken A, et al. (2011) The effects of laropiprant, aselective prostaglandin D2 receptor 1 antagonist, on the antiplatelet activity ofclopidogrel or aspirin. Platelets 22:495–503.

Dunbar RL and Gelfand JM (2010) Seeing red: flushing out instigators of niacin-associated skin toxicity. J Clin Invest 120:2651–2655.

Dunbar RL and Goel H (2016) Niacin Alternatives for Dyslipidemia: Fool’sGold or Gold Mine? Part I: Alternative Niacin Regimens. Curr AtherosclerRep 18:11.

Ganji SH, Tavintharan S, Zhu D, Xing Y, Kamanna VS, and Kashyap ML (2004)Niacin noncompetitively inhibits DGAT2 but not DGAT1 activity in HepG2 cells. JLipid Res 45:1835–1845.

Gao E, Lei YH, Shang X, Huang ZM, Zuo L, Boucher M, Fan Q, Chuprun JK, Ma XL,and Koch WJ (2010) A novel and efficient model of coronary artery ligation andmyocardial infarction in the mouse. Circ Res 107:1445–1453.

Gilroy DW, Colville-Nash PR, Willis D, Chivers J, Paul-Clark MJ, and WilloughbyDA (1999) Inducible cyclooxygenase may have anti-inflammatory properties. NatMed 5:698–701.

Godin AM, Ferreira WC, Rocha LT, Ferreira RG, Paiva AL, Merlo LA, NascimentoEB, Jr, Bastos LF, and Coelho MM (2012) Nicotinic acid induces antinociceptiveand anti-inflammatory effects in different experimental models. Pharmacol Bio-chem Behav 101:493–498.

Hanson J, Gille A, Zwykiel S, Lukasova M, Clausen BE, Ahmed K, Tunaru S, WirthA, and Offermanns S (2010) Nicotinic acid- and monomethyl fumarate-inducedflushing involves GPR109A expressed by keratinocytes and COX-2-dependentprostanoid formation in mice. J Clin Invest 120:2910–2919.

Katsumata Y, Shinmura K, Sugiura Y, Tohyama S, Matsuhashi T, Ito H, Yan X, ItoK, Yuasa S, Ieda M, et al. (2014) Endogenous prostaglandin D2 and its metabo-lites protect the heart against ischemia-reperfusion injury by activating Nrf2.Hypertension 63:80–87.

Knouff CW, Lim N, Song K, Yuan X, Walker MC, Townsend R, Waeber G, MatthewsPM, Vollenweider P, Waterworth DM, et al. (2008) Pharmacological effects oflipid-lowering drugs recapitulate with a larger amplitude the phenotypic effects ofcommon variants within their target genes. Pharmacogenet Genomics 18:1051–1057.

Knowles HJ, te Poele RH, Workman P, and Harris AL (2006) Niacin inducesPPARgamma expression and transcriptional activation in macrophages via HM74and HM74a-mediated induction of prostaglandin synthesis pathways. BiochemPharmacol 71:646–656.

Kong D, Shen Y, Liu G, Zuo S, Ji Y, Lu A, Nakamura M, Lazarus M, Stratakis CA,Breyer RM, et al. (2016) PKA regulatory IIa subunit is essential for PGD2-mediated resolution of inflammation. J Exp Med 213:2209–2226.

Kostenis E and Ulven T (2006) Emerging roles of DP and CRTH2 in allergic in-flammation. Trends Mol Med 12:148–158.

Landray MJ, Haynes R, Hopewell JC, Parish S, Aung T, Tomson J, Wallendszus K,Craig M, Jiang L, Collins R, et al.; HPS2-THRIVE Collaborative Group (2014)Effects of extended-release niacin with laropiprant in high-risk patients. N Engl JMed 371:203–212.

Lu A, Zuo C, He Y, Chen G, Piao L, Zhang J, Xiao B, Shen Y, Tang J, Kong D, et al.(2015) EP3 receptor deficiency attenuates pulmonary hypertension through sup-pression of Rho/TGF-b1 signaling. J Clin Invest 125:1228–1242.

Lukasova M, Malaval C, Gille A, Kero J, and Offermanns S (2011) Nicotinic acidinhibits progression of atherosclerosis in mice through its receptor GPR109Aexpressed by immune cells. J Clin Invest 121:1163–1173.

Maciejewski-Lenoir D, Richman JG, Hakak Y, Gaidarov I, Behan DP, and ConnollyDT (2006) Langerhans cells release prostaglandin D2 in response to nicotinic acid.J Invest Dermatol 126:2637–2646.

Malki S, Nef S, Notarnicola C, Thevenet L, Gasca S, Méjean C, Berta P, Poulat F,and Boizet-Bonhoure B (2005) Prostaglandin D2 induces nuclear import of the sex-determining factor SOX9 via its cAMP-PKA phosphorylation. EMBO J 24:1798–1809.

Meyers CD, Liu P, Kamanna VS, and Kashyap ML (2007) Nicotinic acid inducessecretion of prostaglandin D2 in human macrophages: an in vitro model of theniacin flush. Atherosclerosis 192:253–258.

Nagai A, Matsumiya H, Hayashi M, Yasui S, Okamoto H, and Konno K (1994) Effectsof nicotinamide and niacin on bleomycin-induced acute injury and subsequent fi-brosis in hamster lungs. Exp Lung Res 20:263–281.

Rajakariar R, Hilliard M, Lawrence T, Trivedi S, Colville-Nash P, Bellingan G,Fitzgerald D, Yaqoob MM, and Gilroy DW (2007) Hematopoietic prosta-glandin D2 synthase controls the onset and resolution of acute inflammationthrough PGD2 and 15-deoxyDelta12 14 PGJ2. Proc Natl Acad Sci USA 104:20979–20984.

Ricciotti E and FitzGerald GA (2011) Prostaglandins and inflammation. ArteriosclerThromb Vasc Biol 31:986–1000.

Macrophage DP1 Mediates Resolution Effect of Niacin 443

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from

Rubic T, Trottmann M, and Lorenz RL (2004) Stimulation of CD36 and the keyeffector of reverse cholesterol transport ATP-binding cassette A1 in monocytoidcells by niacin. Biochem Pharmacol 67:411–419.

Sandig H, Pease JE, and Sabroe I (2007) Contrary prostaglandins: the opposing rolesof PGD2 and its metabolites in leukocyte function. J Leukoc Biol 81:372–382.

Sica A and Mantovani A (2012) Macrophage plasticity and polarization: in vivoveritas. J Clin Invest 122:787–795.

Soga T, Kamohara M, Takasaki J, Matsumoto S, Saito T, Ohishi T, Hiyama H,Matsuo A, Matsushime H, and Furuichi K (2003) Molecular identification of nic-otinic acid receptor. Biochem Biophys Res Commun 303:364–369.

Song WL and FitzGerald GA (2013) Niacin, an old drug with a new twist. J Lipid Res54:2586–2594.

Song WL, Stubbe J, Ricciotti E, Alamuddin N, Ibrahim S, Crichton I, Prempeh M,Lawson JA, Wilensky RL, Rasmussen LM, et al. (2012) Niacin and biosynthesis ofPGD2by platelet COX-1 in mice and humans. J Clin Invest 122:1459–1468.

Song WL, Wang M, Ricciotti E, Fries S, Yu Y, Grosser T, Reilly M, Lawson JA,and FitzGerald GA (2008) Tetranor PGDM, an abundant urinary metabolite re-flects biosynthesis of prostaglandin D2 in mice and humans. J Biol Chem 283:1179–1188.

Spik I, Brénuchon C, Angéli V, Staumont D, Fleury S, Capron M, Trottein F,and Dombrowicz D (2005) Activation of the prostaglandin D2 receptor DP2/CRTH2increases allergic inflammation in mouse. J Immunol 174:3703–3708.

Strack AM, Carballo-Jane E, Wang SP, Xue J, Ping X, McNamara LA, ThankappanA, Price O, Wolff M, Wu TJ, et al. (2013) Nicotinic acid and DP1 blockade: studiesin mouse models of atherosclerosis. J Lipid Res 54:177–188.

Tavintharan S, Lim SC, and Sum CF (2009) Effects of niacin on cell adhesion andearly atherogenesis: biochemical and functional findings in endothelial cells. BasicClin Pharmacol Toxicol 104:206–210.

Tokudome S, Sano M, Shinmura K, Matsuhashi T, Morizane S, Moriyama H, TamakiK, Hayashida K, Nakanishi H, Yoshikawa N, et al. (2009) Glucocorticoid protects

rodent hearts from ischemia/reperfusion injury by activating lipocalin-type pros-taglandin D synthase-derived PGD2 biosynthesis. J Clin Invest 119:1477–1488.

Tunaru S, Kero J, Schaub A, Wufka C, Blaukat A, Pfeffer K, and Offermanns S (2003)PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolyticeffect. Nat Med 9:352–355.

Urade Y and Eguchi N (2002) Lipocalin-type and hematopoietic prostaglandin Dsynthases as a novel example of functional convergence. Prostaglandins OtherLipid Mediat 68-69:375–382.

Wang QJ, Giri SN, Hyde DM, Nakashima JM, and Javadi I (1990) Niacin attenuatesbleomycin-induced lung fibrosis in the hamster. J Biochem Toxicol 5:13–22.

Wise A, Foord SM, Fraser NJ, Barnes AA, Elshourbagy N, Eilert M, Ignar DM,Murdock PR, Steplewski K, Green A, et al. (2003) Molecular identification of highand low affinity receptors for nicotinic acid. J Biol Chem 278:9869–9874.

Yan X, Anzai A, Katsumata Y, Matsuhashi T, Ito K, Endo J, Yamamoto T, TakeshimaA, Shinmura K, Shen W, et al. (2013) Temporal dynamics of cardiac immune cellaccumulation following acute myocardial infarction. J Mol Cell Cardiol 62:24–35.

Yang P, An H, Liu X, Wen M, Zheng Y, Rui Y, and Cao X (2010) The cytosolic nucleicacid sensor LRRFIP1 mediates the production of type I interferon via a beta-catenin-dependent pathway. Nat Immunol 11:487–494.

Zhang LH, Kamanna VS, Ganji SH, Xiong XM, and Kashyap ML (2012) Niacinincreases HDL biogenesis by enhancing DR4-dependent transcription of ABCA1and lipidation of apolipoprotein A-I in HepG2 cells. J Lipid Res 53:941–950.

Address correspondence to: Dr. Ying Yu, Department of Pharmacology,School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070,China; or Institute for Nutritional Sciences, Shanghai Institutes for BiologicalSciences, University of Chinese Academy of Sciences, 294 Taiyuan Road,Shanghai 200031, China. E-mail: yuying@sibs.ac.cn; yuying@tmu.edu.cn

444 Kong et al.

at ASPE

T Journals on D

ecember 14, 2021

jpet.aspetjournals.orgD

ownloaded from