ngo magazine - nr. 2 (december 2011)
DESCRIPTION
"NGO MAGAZINE" is electronic magazine dedicated to the NGOs sector in Macedonia and abroad.TRANSCRIPT
![Page 1: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/1.jpg)
FOUNDERS : EUROPEANCENTERSN7 & CENTER FOREDUCAT IONANDDEVELOPMENT - CED
NGO MAGAZINE
© NGO MAGAZINE - PUBLISHER: EUROPEAN CENTER SN7 & CENTER FOR EDUCATION AND DEVELOPMENT - CED
Editor-in-chief: Daut MEMETI; Editors: Metin MUAREMI, Kaltrina AZIZI, Fatos VELIU, Alma AZIRI, Astrit REXHEPI, Mensure ILJAZI Phone: 00 389 70 523 764; E-mail: [email protected], [email protected]; Web: www.sn7.org.mk/ngomagazine.pdf
A digital edition is an online magazine or online newspaper delivered in electronic form which is formatted identically to the print version.
�A �MAGAZINE�DEDICATED�TO�THE�NGO�SECTOR�–�NR. �2 �/ �DECEMBER�201 1 �
20th - 27th January 2012
MMMMMMMMEEEEEEEETTTTTTTT IIIIIIIINNNNNNNN
MMMMMMMMUUUUUUUUAAAAAAAARRRRRRRREEEEEEEEMMMMMMMM IIIIIIII
PAGE 3PAGE 3PAGE 3PAGE 3
Intercultural learning, ability for the 21st century
FFAATTOOSS VVEELLIIUU
PAGE 2PAGE 2PAGE 2PAGE 2
Human Rights - Role of NGOs
KKAALLTTRRIINNAA AAZZIIZZII
PAGE 2PAGE 2PAGE 2PAGE 2
How to set up your NGO!?
![Page 2: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/2.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 2
FOREWORD
Dear readers, you have the second issue of “NGO MAGAZINE” in front of you, with an objective of facilitating dissemination of knowledge and information. Our magazine is proud of its role in facilitating the communication between NGOs and people actively involved in the non-governmental sector in our country and abroad. As a principle of the right for information, our editorial staff expects to accept more and more papers from different kinds of NGOs, youth activists, volunteers, facilitators to share their knowledge and experience with our readers. That’s the purpose of the magazine. Digital edition of the second issue of the “NGO MAGAZINE” (.pdf version) will be distributed in electronic form completely free of any charge. The second issue of the “NGO MAGAZINE” is due to the efforts of many people. Special acknowledgement is dedicated to all the editors, authors and contributors for their great support for helping this happen and making the second issue of the “NGO MAGAZINE” a really true success. Please don't hesitate to contact any of our editorial staff to discuss further professional aspects of their unforgettable experiences. I would like once again to extend my invitation to all people actively involved in the field of the non-governmental sector to publish their papers, works, analysis, case studies in the “NGO MAGAZINE”. We believe in its future and invite you to work and collaborate with us. Your views are welcomed! We hope you enjoy reading this second issue.
Daut MEMETI Editor-in-chief
HHHHHHHHHHHHOOOOOOOOOOOOWWWWWWWWWWWW TTTTTTTTTTTTOOOOOOOOOOOO SSSSSSSSSSSSEEEEEEEEEEEETTTTTTTTTTTT UUUUUUUUUUUUPPPPPPPPPPPP
YYYYYYYYYYYYOOOOOOOOOOOOUUUUUUUUUUUURRRRRRRRRRRR NNNNNNNNNNNNGGGGGGGGGGGGOOOOOOOOOOOO!!!!!!!!!!!!????????????
By: Kaltrina AZIZI
You decided to start an NGO, the procedure is as follows: You have to arrange a founding assembly of the proposed NGO. In the assembly you should mention and elect: aims, objectives, the president, the secretary general and other bodies, statute, working program, members etc. Thereafter you have to go to the Central Registry of the Republic of Macedonia to apply for registration. List of necessary documents needed: application form; act of establishment; statute; working program; name of the president and of the secretary general.
EUROPEAN CENTER SN7 BEGAN IMPLEMENTING THE CYCLE OF DEBATES
KKKnnnooowwwiiinnnggg EEEUUU ttthhhrrrooouuuggghhh cccooonnnvvveeerrrsssaaatttiiiooonnnsss
European Center SN7 began with the implementation and realization of the project, Cycle of Debates “Knowing EU
through conversations". Fatos Veliu, secretary general of the European Center SN7 and project manager of the Cycle of Debates “Knowing EU through conversations", said that the realization of these debates is intended to inform
participants through debates about the establishment and function of the European Union and to learn more about the different values of EU. The first debate was held in Tetovo and had regional character with participants from Macedonia, Kosovo and Serbia. Otherwise, the implementation of the first phase of this project will continue with realization of two other debates in Gostivar and Skopje.
HHHuuummmaaannn���RRRiiiggghhhtttsss���---���RRRooollleee���ooofff���NNNGGGOOOsss
The Government institutions are responsible
for respecting, protecting and promoting
human rights but they are not the only ones
involved in human rights and sustainable
human development. There are other civil
organizations such as human rights NGO’s
and other law related NGO’s, Socio-
economic NGOs, community organizations,
schools, indigenous people’s organizations,
women’s advocacy groups and the media.
They play a crucial role in Monitoring,
protecting and promoting human rights.
Civil society organizations can monitor
Human rights even under extreme or
authoritarian political conditions. NGOs so
are playing a major role in pushing for
sustainable development not only at
international level and national level. NGOs
can carry on their policies and actions on
continuous while government organizations
depend too much on the policy appraisal
sheet. The NGOs can adjust quickly and are
more flexible in the implementation of their
plans and policies. Government
organizations have long line of command,
and it takes a long time to decide on
appropriate strategies or possible changes of
course in the middle of project for human
rights. The government organizations have
to wait for decision making from “above”
which may take weeks, months, or
sometimes and years. NGOs projects are
usually smaller and go fast when compared
to those of the government organizations
where everything has to be done “nationally”
in state. In this sense, the preparation of
“qualified” personnel is more difficult to
meet all the needs. The NGOs can involve
other “actors”, for example, the private
sector, while the government organizations
are more reluctant to do so. To end, I am of
the view that building a strategy for
development and supporting NGOs, for a
better situation in realty and all instruments
should be used to portray the problems and
encourage people to be a part of this
movement.
Fatos
VELIU
![Page 3: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/3.jpg)
IInntteerrccuullttuurraall lleeaarrnniinngg -- aabbii ll iittyy
ffoorr tthhee 2211sstt cceennttuurryy
OUR UNDERSTANDING
We are living on a world of differences. Each
day we are witnessing different changes in
many fields of every human’s lives and
surroundings. It is more dynamically and
complex in the field of science and
education. These various circumstances
request individuals which are flexible and
compatible for different social and
economical changes in societies. The
process of education in Macedonia is still on
the stage, where many projects are
implemented, but most of them are not long
term determined, and the people involved
doesn’t understand learning as an active
process, where the success of it is therefore
largely in the responsibility of the learner. In
different learning processes the learner must
critically reflect to his attitudes and its
behaviours regarding to some universal
principles and values, then he should
understand concepts, analyse and adapt the
knowledge. The last phase it should be about
implementing the different intercultural
education in the real life through different
actions and activities.
OUR SYSTEM
Our formal education system offers a narrow
frame of the knowledge; it is very
theoretically and doesn’t equip the students
with the skills, the methods and knowledge
needed to take committed actions to
improve lives and conditions in their
communities. In many cases those who learn
aren’t prepared for an uncertain world, where
they might not know what the challenges are
going to be, or how they are unfolding. The
situation becomes even harder due the lack
of human capacities to lead groups which
are culturally mixed. The teachers are very
important in this process, because they play
huge role on choosing the right
methodology, where teaching and learning
even though methods are diverse, they still
complete each other. There are some
initiatives on some schools to use
intercultural as main resources for learning,
but due the lack material capacities, they
failed. So according us, human recourses and
the material capacities are two main reasons
to have a successful intercultural education,
which as every other learning process tends
to create humanity.
OUR EXPERIENCE
As leader of an organization that promotes
intercultural learning, where mostly non
formal methods of education are used, we
offer to young women and men from
different regions the opportunity to make a
difference and to contribute to solutions in
their local community. Through our different
projects an individual's cultural and personal
identity depends vitally on his dialogic
relations with others. Intercultural education
plays a vital role in identity formation which
is never an isolated, but always a social-
interactive process. The intercultural ability is
key qualification for each individual in
today’s global world. It helps to realize the
concept of thinking globally and acting
locally. The children who attend in our
activities become very motivated, they
become more responsible, they see learning
as lifelong learning process. Afterward these
individuals become the leader for different
changes within their schools and later in
societies. Through these activities they are
trained to undertake responsibilities for their
self and become more consciousness for the
others, which positively affects their overall
development. Intercultural learning
promotes peace and has to do with
individual development, through cultural
diversity. "Since wars begin in the minds of
men, it is in the minds of men that the
defence of peace must be constructed." This
principle is found in the preamble of the
UNESCO constitution.
Metin
MUAREMI
FUNDS�FOR�NGOs:�GRANTS�AND�RESOURCES�FOR�SUSTAINABILITY�
http://fundsforngos.org is an online initiative, working for the
sustainability of NGOs by increasing their access to donors, resources,
and skills. It uses technology to spread knowledge and increase capacity.
DECEMBER 2011 NGO MAGAZINE PAGE 3
IIMMPPRROOVVEE YYOOUURR
IINNTTEERRCCUULLTTUURRAALL AABBIILLIITTIIEESS
TTHHRROOUUGGHH CCEENNTTEERR FFOORR
EEDDUUCCAATTIIOONN AANNDD
DDEEVVEELLOOPPMMEENNTT -- ((CCEEDD))
Since 2009 Center for Education and Development - (CED) cooperates with Children’s Foundation “Pestalozzi” from Switzerland. Thanks to this cooperation, 20 children from region of Tetovo and Tearce each year, together with “SPPMD” and “MAJKA” can participate on the two weekly exchange children camp in Trogen. During this exchange they attend on different intercultural activities with children from Eastern Europe, learn different social and individual skills and become young leaders in their schools. If you are student between the ages of 22-28 you could apply to the nine monthly programme called empower.
This programme combined by different methods of learning, using non formal education, practical experience aims to strengthen your knowledge, self-awareness and methods of dealing with the diversity. If you are interested to visit the Children’s Village in Trogen, or participate on empower so that you contribute for protecting children rights and become modern warrior of peace, send an email or visit our web site.
![Page 4: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/4.jpg)
BACKGROUND AND DEVELOPMENT:
Mladiinfo-FEJS MK is a NGO organization
from Skopje, which was established in 2003,
as a local office group of European Youth
Press. Its co-founder is Antoaneta Ivanova,
who was familiar with the situation of the
young people in terms of the lack of
information and online access in the field of
the educational and professional
opportunities for advancement worldwide. As
a new generation, facing with
multiculturalism, opened societies and living
in a world where the knowledge of several
languages is almost obligatory and the
intercultural communication becomes a
necessity, the existence of an organisation
and a medium that would enable the
students and young people to become part
of the multicultural world was of huge
importance. Antoaneta was aware of this
problem, especially because of her personal
experience regarding that issue, so she
started the development of the organization,
one of whose major focuses was the
development of the informative web portal
mladiinfo.com (which was founded in 2008),
which would function as an informative
medium in the international experiences,
communication and upgrading field. In 2009
Mladiinfo was chosen in the top five web
portals in the world, providing important
information in the field of the education,
competing among 622 other portals. The
contest World Summit Award was organized
by the UN. Later, in 2010 it was accredited to
function as a hosting organisation for the
EVS-volunteers and so far it performs its
function very successfully, with not less than
three volunteers from Europe, per year. From
2011 onwards, its premises location is in the
National and University Library Sv. Kliment
Ohridski, where various trainings, sessions
and workshops are being held. The same
year it completed a list of 132 projects and
was given the ERSTE foundation award for
social integration.
OBJECTIVES, GOALS AND VISION: The
major function of the organization Mladiinfo
and its web portal is to be a promoter of
projects (played or voluntary), internships,
.
scholarships and fellowships and a mediator
between the young people
researchers and the universities, professors,
university officials the youth NGOs and other
organizations, incorporated in the
educational process of the young people. In
addition it deals with the issues such as
student rights and freedom of
student standards, as well as the issues in the
field of media and communication, as means
of student interaction and gaining
information. That also provided national and
international cooperation of educational
institutions as well as student and
exchange, in addition to international and
national internship and job opportunities.
Since the organization`s portal serves as a
medium, as well, it has also enables additional
communication and exchange of experiences
and ideas. The portal www.mlad
have solved a great deal of the problems the
young people had, regarding the lack of
education information access. That is why
today it has more than 90.000 visits per
month, from all over the world, above 10.000
of which, approximately, subscri
newsletter and on the other side, around 10
universities and organizations per week,
contact the organization for publishing
DECEMBER 2011
AA
The Grant info Center is located in the
new part of the
Kliment Ohridski and it offers direct
information about the content that is
presented on the site. Mladiinfo members
are located here, so they offer help,
regarding the process of applying for a
scholarship, internship, fellowship or
other opportunity presented on the site.
The Grant Info Center it is offers:
promotional materials for the universities
around the world and the possibilities for
education; detailed information about
the scholarships (BA, MA, PhD studies),
fellowships, co
consultation in terms of the process of
application; participating as a sending and
hosting organisation in the volunteering
process; opportunity for various
organizations and the universities to
promote their educational progr
materials for educational events.
contact the organization for p
content. In addition to the info center in
Skopje, Mladiinfo has also its daughter
organizations in Slovakia, Czech Republic and
Montenegro.
spread its network, contacts and its
promotion, as much as possible
encouraging the young people to become a
part of Mladiinfo`s team. At the end,
Mladiinfo`s vision is to participate in the
process of raising awareness and shaping
healthy youth with developed personality and
a greater level of individuality, which would
help to achieve an improvement of the
society.
OTHER ACTIVITIES:
coordinator, mediator and promoter of
novelties in the field of education, Mladiinfo
is involved in other activities, as well. I has
organized a number of workshops
on the improvement of the communication
skills of the young people, their
computerliteracy, their ability to become
successful young leaders and organizers. It
also organizes info
young students to inform themselves
particular scholarship (through presentation
held directly by the representatives of the
organization offering the scholarship). In
addition, there is an article section on the site,
where young people can freely share personal
opinions, something interestin
experienced, or can organize their ideas in a
unique way and creatively express
themselves.
process; moreover, it is actively involved in
this process, participating as a sending and
hosting organization. All in all,
the mentioned activities, Mladiinfo promotes
the ideas of tolerance, preparing the young
people to work in an international
environment, as well as the idea of positive
thinking in an active society, successfully
shaped by the generations to
scholarships and fellowships and a mediator
between the young people, students or
researchers and the universities, professors,
university officials the youth NGOs and other
organizations, incorporated in the
educational process of the young people. In
addition it deals with the issues such as
student rights and freedom of speech,
student standards, as well as the issues in the
field of media and communication, as means
of student interaction and gaining
information. That also provided national and
international cooperation of educational
institutions as well as student and youth
exchange, in addition to international and
national internship and job opportunities.
Since the organization`s portal serves as a
medium, as well, it has also enables additional
communication and exchange of experiences
and ideas. The portal www.mladiinfo.com
have solved a great deal of the problems the
young people had, regarding the lack of
education information access. That is why
today it has more than 90.000 visits per
month, from all over the world, above 10.000
of which, approximately, subscribe to a
newsletter and on the other side, around 10
universities and organizations per week,
contact the organization for publishing
DECEMBER 2011 NGO MAGAZINE PAGE
VVOOLLUU
WWIITTHH
The young people that are interested to
visit some European country and do a
voluntary work there can have the
opportunity to do that through Mladiinfo
as their sending organization. Ilija
Dimitrovski is the EVS coordinator from
Macedonia, responsible for the
volunteering projects. So, everyone
interested should just contact the
organization and they will be given the
appropriate information for the
application and the participation process.
THE GRANT INFO CENTER
AABBOOUUTT TTHHEE GGRRAANNTT IINNFFOO CCEENNTTEERR
The Grant info Center is located in the
new part of the National Library St.
Kliment Ohridski and it offers direct
information about the content that is
presented on the site. Mladiinfo members
are located here, so they offer help,
regarding the process of applying for a
scholarship, internship, fellowship or
ther opportunity presented on the site.
The Grant Info Center it is offers:
promotional materials for the universities
around the world and the possibilities for
education; detailed information about
the scholarships (BA, MA, PhD studies),
fellowships, conferences, trainings, etc;
consultation in terms of the process of
application; participating as a sending and
hosting organisation in the volunteering
process; opportunity for various
organizations and the universities to
promote their educational programs;
materials for educational events.
contact the organization for publishing
content. In addition to the info center in
Skopje, Mladiinfo has also its daughter
organizations in Slovakia, Czech Republic and
Montenegro. However, its further plans are to
spread its network, contacts and its
promotion, as much as possible, by
encouraging the young people to become a
part of Mladiinfo`s team. At the end,
Mladiinfo`s vision is to participate in the
process of raising awareness and shaping
healthy youth with developed personality and
a greater level of individuality, which would
help to achieve an improvement of the
OTHER ACTIVITIES: Except for the role of
coordinator, mediator and promoter of
novelties in the field of education, Mladiinfo
is involved in other activities, as well. I has
organized a number of workshops working
on the improvement of the communication
skills of the young people, their
computerliteracy, their ability to become
successful young leaders and organizers. It
also organizes info-sessions, helping the
young students to inform themselves about a
rticular scholarship (through presentation
held directly by the representatives of the
organization offering the scholarship). In
addition, there is an article section on the site,
where young people can freely share personal
opinions, something interesting they have
experienced, or can organize their ideas in a
unique way and creatively express
themselves. We support the volunteering
process; moreover, it is actively involved in
this process, participating as a sending and
hosting organization. All in all, by practicing
the mentioned activities, Mladiinfo promotes
the ideas of tolerance, preparing the young
people to work in an international
environment, as well as the idea of positive
thinking in an active society, successfully
shaped by the generations to come.
NGO MAGAZINE PAGE 4
UUNNTTAARRYY SSEERRVVIICCEE
HH MMLLAADDIIIINNFFOO The young people that are interested to
visit some European country and do a
voluntary work there can have the
opportunity to do that through Mladiinfo
as their sending organization. Ilija
Dimitrovski is the EVS coordinator from
Macedonia, responsible for the
volunteering projects. So, everyone that is
interested should just contact the
organization and they will be given the
appropriate information for the
application and the participation process.
![Page 5: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/5.jpg)
ABOUT US: The Youth of the Euro-Atlantic
Council of Macedonia – YATA Macedonia is a
youth organization of EACM. YATA Macedonia
was founded in 1999 by a group of ambitious
students and young politicians who were
interested in the work on the Atlantic values.
In the past years the Youth has been very
active in promoting the euro-atlantic idea and
values in the country as well as developing
cooperation with other YATA national
chapters and other organizations in the
country and abroad. YATA Macedonia is
accomplishing broad cooperation with state
institutions, civil society, media and diplomatic
missions in the country. In wider context YATA
Macedonia through its activities is promoting
democracy, human rights, civil society and rule
of law in the Republic of Macedonia. Long
lasting activities of YATA Macedonia are well
known on national, regional and international
level. One of them is the NATO student
simulation which was organized for the first
time in December 2010. Since many students
showed interest in participating, we decided
to make the NATO Student simulation a
traditional event that will take place each year.
YATA Macedonia is member of YATA – Youth
Atlantic Treaty Association, organization that
has 42 national atlantic associations which act
in Euro – Atlantic region and wider, building
support to civil society for NATO and trans-
atlantic cooperation, sharing the best practices
between their members. The General
Assembly of the YATA is the highest level
within YATA held once a year. In political
terms, it is one of the largest security forums
for the youths in the Atlantic world with
participating global leaders, experts and the
media. YATA Macedonia works in the
premises of the Euro
Macedonia where it has its own office, Statue
and membership. YATA Macedonia has its
own Facebook group and section at the
EACM website, and autonomy to develop its
program of activities which need to be
approved by the Executive Office of the Euro
Atlant
realization, considering the fact that they
need to be in line with the policy of the
organization and the policy of ATA.
PURPOSE:
to attract young people to join the Atlantic
community. Furth
works on developing core of people who are
interested in NATO, security, international
relations and they will be actively involved in
mobilization of the youth for these questions
and on that way will promote public debate
between th
Atlantic topic. The work with young people is
one of the key goals of every organization
knowing the fact that they are the future
leaders and they will have the responsibility
for the processes in the society. In addition,
we
Atlantic network and their informing and
education for euro
is from vital importance.
EXECUTIVE OFFICE:
the members of the YATA who have come
over the age of 26
the ATA membership and the current policy
of the YATA Macedonia is to involve students
from the age of 19 to 26. Due to the transition
TTHHEE YYOOUUTTHH OOFF TTHHEE EEUURROO
Second NATO Student simulation – “Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”
DECEMBER 2011
media. YATA Macedonia works in the
premises of the Euro-Atlantic Council of
Macedonia where it has its own office, Statue
and membership. YATA Macedonia has its
own Facebook group and section at the
EACM website, and autonomy to develop its
program of activities which need to be
approved by the Executive Office of the Euro-
Atlantic Council of Macedonia before
realization, considering the fact that they
need to be in line with the policy of the
organization and the policy of ATA.
PURPOSE: Main goal of YATA Macedonia is
to attract young people to join the Atlantic
community. Furthermore YATA Macedonia
works on developing core of people who are
interested in NATO, security, international
relations and they will be actively involved in
mobilization of the youth for these questions
and on that way will promote public debate
between the youth in the country on the
Atlantic topic. The work with young people is
one of the key goals of every organization
knowing the fact that they are the future
leaders and they will have the responsibility
for the processes in the society. In addition,
believe that the inclusion of youth in the
Atlantic network and their informing and
education for euro – atlantic idea and values
is from vital importance.
EXECUTIVE OFFICE: Throughout the years
the members of the YATA who have come
over the age of 26 have been transferred to
the ATA membership and the current policy
of the YATA Macedonia is to involve students
from the age of 19 to 26. Due to the transition
of the former YATA members into the ATA in
2010 we saw the need for transformation
and reorganiz
Therefore we have decided on the policy of
the age groups involved as well as project
activities that the YATA will work on. In 2010
we set up an Executive Office of the YATA
Macedonia that works on attracting new
members and d
line with the policy and practices of the
Atlantic Treaty Association and the Youth of
the Atlantic Treaty Association. YATA
Macedonia has more than 150 members and
its Executive office consists of four members
Ilija Djugu
Madzoska and
YATA is to promote diversity regarding
gender, ethnic community groups as well as
the wide range of students involved from all
the Universities in the country.
OO--AATTLLAANNTTIICC CCOOUUNNCCIILL OOFF MMAACCEE
AAAAAAAACCCCCCCCTTTTTTTTIIIIIIIIVVVVVVVV
o Macedonia and NATO in 2020
o Youth delegation visit NATO HQ
o NATO happening
o NATO summit student simulation
o Project about cyber security
o SEE in 2020
o Social platform for security
o BALKAN
Skype conference
o Regional policies in the context of EU
accession
o Debates on the universities
o General assembly of the YATA
o Implementation of the Euro
values in the educational process in
Republic of Macedonia
“Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”
DECEMBER 2011 NGO MAGAZINE PAGE
of the former YATA members into the ATA in
2010 we saw the need for transformation
and reorganization of the YATA Macedonia.
Therefore we have decided on the policy of
the age groups involved as well as project
activities that the YATA will work on. In 2010
we set up an Executive Office of the YATA
Macedonia that works on attracting new
members and developing project activities in
line with the policy and practices of the
Atlantic Treaty Association and the Youth of
the Atlantic Treaty Association. YATA
Macedonia has more than 150 members and
its Executive office consists of four members:
Ilija Djugumanov, Jordan Tasev, Stefanija
Madzoska and Emir Berisha. The policy of the
YATA is to promote diversity regarding
gender, ethnic community groups as well as
the wide range of students involved from all
the Universities in the country.
EEDDOONNIIAA –– YYAATTAA
VVVVVVVVIIIIIIIITTTTTTTTIIIIIIIIEEEEEEEESSSSSSSS FFFFFFFFOOOOOOOORRRRRRRR 22222222000000001111111122222222 Macedonia and NATO in 2020 – essay
Youth delegation visit NATO HQ
NATO happening – 4th April
NATO summit student simulation
Project about cyber security
SEE in 2020 – regional conference
Social platform for security
BALKAN – Mediterranean webcast or
Skype conference
Regional policies in the context of EU
accession
Debates on the universities
General assembly of the YATA
Implementation of the Euro-Atlantic
values in the educational process in
Republic of Macedonia
“Meeting of NATO ministers of foreign affairs: NATO Enlargement and Western Balkans”
NGO MAGAZINE PAGE 5
![Page 6: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/6.jpg)
RRCCCC��ssuuppppoorrttss��rreeggiioonnaall��nneettwwoorrkkiinngg��
aanndd��ccaappaacciittyy��bbuuiillddiinngg��
Regional cooperation and capacity building activities between Project partners were done in twice during this reporting period. In May RCC members from Macedonia as well as our local partners from Rostushe region (bordering region of Gora) together with ATTA from and local partners from Gora and Zupa regions in Kosovo have meet in Dragash. Also Mayors and representatives of both municipalities together with RCC representatives have joint meeting where modalities of future cooperation between two regions were discussed. In Macedonia on May in Rostushe we organize meeting of cultural practitioners, artist, NGO- representatives and municipality representatives (including Mayors) from Rostushe and Vevchani region in order to establish stronger interregional cooperation between this two project regions with similar problems and potentials. In Bosnia and Herzegovina we developed project proposal ''Regional cultural cooperation of youth from rural areas'' and submitted to the BH Ministry of Civil Affairs. Also in Bosnia and Herzegovina during the visit of Serbian partner’s mozaik team members deliver workshop intended to build capacities of Serbian partner organization for providing assistance to rural communities in participatory planning and running cultural initiatives. The workshop was organized in the form of exchange of experiences and discussion about possibilities for transfer of Mozaik methodologies in work of ''Školama na ivici opstanka'', having in mind the nature of this organization, as well as project goals. Members of project partners from Serbia visit Kosovo in order to organize theatre workshop in Rechane. Behind the activities of the theatre workshop this was great chance to develop capacities of ATTA Prizren for performing arts and vice verse to build capacities of Serbian partners in institutional management which is field of expertise of ATTA Prizren. During the last annual planning meeting held in Mavrovo, several international exchanges were planned to be held between NGOs from Macedonia, with those from Kosovo, Serbia, Bosnia and Albania. Activities are planned to contribute for international institutional cooperation between different leaders such as moving theatres, music performances, exhibition, trainings and other similar activities.
DECEMBER 2011 NGO MAGAZINE PAGE 6
The Institute for Democracy “Societas Civilis” Skopje (IDSCS) is a Macedonian based think-tank organisation that is non-governmental, non-partisan and non-profit. It was established in 1999 by a group of intellectuals gathered around the idea for democracy, solidarity and civil society. Long term objectives of the Institute are to work on balanced socio economic development, active citizen engagement and participative political culture. In this direction, we focus our activities on rule of law, good governance and multiethnic and multicultural
coexistence. IDSCS work is primarily based on sociometric research and project-based activities. We believe that human capital is a key precondition for positive social change, hence we eagerly undertake capacity building projects based on skills and knowledge transfer. Finally, ours society improvement is directly linked to availability of resources for self-reflection. In this sense, we advocate policy recommendations and strive to enrich the public discourse through promotion of evidence based policy, publishing and public events.
PERMANENT�FORUM�OF�EUROPEAN�CIVIL�SOCIETY�
TTTOOOWWWAAARRRDDDSSS TTTHHHEEE FFFEEEDDDEEERRRAAATTTIIIOOONNN OOOFFF
EEEUUURRROOOPPPEEE At the initiative of the Permanent Forum of European Civil Society, created in 1995 around a draft Charter of Fundamental Rights of the EU, citizens from several Member States met on 1 October 2011. The themeof the meeting - held in Houjarray (Yvelines) in Jean Monnet House – was to revive the idea of theFederation of Europe mentioned in the Schuman Declaration of May 9, 1950. The coincidence of date placed this meeting in the wake of President Barroso's speech on "the State of the Union" on September 28, and a few days before the presentation by President Van Rompuy of his report on reforming the governance of the euro area, at the European Council of 18 and 19 October. Amidst the current turmoil of the euro area, the participants in this meeting are convinced that only a democratic European federation, based on the interdependence of the peoples of Europe, will be able to maintain their cohesion, promote their social model and ensure that such a federation plays its role in a multipolar world. The participants are also convinced that a European government – of the whole of the Union or of the euro area alone - must be accountable to European citizens. In their opinion, the path to the creation of such a European government must be initiated and laid out by citizens' initiatives of a democracy that is participatory and deliberative. To do this, it is necessary and urgent that the European society summons up all its strength. In concluding their meeting, the participants agreed to continue their work on three themes: defining the ‘Federation of Europe’; stimulating citizen dynamics for the launch of a constituent process; contributing to the creation of a Federal Ministry of Economy and Finance. Time is short. The next European elections will be held in 2014, one hundred years after the start of the First World War. The European government that will be put in place will certainly mark this anniversary, but above all will offer European peoples a new perspective of peace, justice and prosperity.
RCC ACTIVITIES
![Page 7: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/7.jpg)
YYOOUUTTHH AALLLLIIAANNCCEE
OOFF KKRRUUSSEEVVOO
Youth Alliance is an independent, non
governmental, non political and non
profitable organization established in 1999.
Our members (70-80 members) are young
people between 15 and 35, who work,
study or express an interest in processes of
EU integration of our country.
VISION
Active participation of youth in all issues of
social life.
AXES OF PRIORITIES
• Active involvement of young people in
decision-making processes at local,
regional and national level;
• Contribution of youth in the process of
EU integration of the SEE;
• Increasing the contribution of youth in
the economic development of their
local communities.
GOALS
• To promote new ways of expressing
the views of young people from SEE vs.
well-known political and uncooperative
methods;
• Acceptance of the modern European
values of young people from SEE;
• Creation of conditions for faster and
sustainable economic development.
HOW�TO�WRITE��A�PROPOSAL!?�
All proposals must
include certain basic
information. These
basics include:
� Why are you doing this project?
� What will you do?
� How will you be doing it?
� Who will be doing it?
� Where will it be done?
� How long will it take?
� How much will it cost?
Macedonia. The events took place in
Tetovo and Krusevo. In Krusevo a round
table that put together the concepts of
lifelong learning and community
development took place on November 4th
2011. In Tetovo similar round table took
place on November 8th 2011. Apart from
educational professionals, the director of
the Center for Adult Education in the
Republic of Macedonia, Lindita Qazimi
addressed the present participants.
LIFELONG LEARNING STREET
FESTIVAL
On November 8th a Lifelong Learning
Street Festival took place in front of the
Center for Culture in Tetovo. The visitors
were distributed with useful information on
lifelong learning and adult education and
the benefits they bring to the community.
Moreover, there was a presentation of
various guilds such as woodcarving,
knitting and crochet, traditional clothes
making, silversmithing and shoe-cleaning.
PARTNERSHIPS AND
COLLABORATIONS
So far ADAE has partnered and
collaborated with dvv-International - office
Skopje. Furthermore, ADAE is in process of
establishing collaboration and partnerships
with the Center for Adult Education in the
Republic of Macedonia, the Federation of
Adult Education Associations in Spain and
the European Basic Skills Network.
CONTACT INFO
St. Ljubo Bozinovski - Pish 82
1200 Tetovo, Rep. of Macedonia
Phone: 044 340 677
Email: [email protected]
Web: www.srov.mk
DECEMBER 2011 NGO MAGAZINE PAGE 7
The Alliance for Lifelong Learning and
Adult Education (ADAE) is a membership-
based program established within the
frames of the Community Development
Institute (CDI).
AIMS OF ADAE
Development and promotion of adult
education; reducing the unemployment in
the Republic of Macedonia; support for
structures, organizations and institutions
for sustainable adult education
MEMBERS OF ADAE
• Community Development
Institute - Tetovo
• Workers University - Prilep
• Youth Cultural Center - Bitola
• AGTIS - Prilep
• ADORA - Tetovo
• People Technique - Tetovo
• OMU - Open Multicultural
University - Prilep
• Center for Education and
Development (CED) - Tearce
HOW TO BECOME A MEMBER OF
ADAE?
Every legal and physical entity who wants
to contribute toward adult education
development can become member of
ADAE. One can become a member by
filling out a registration form that can be
found at www.srov.mk. The legal entities
that want to become members, in addition
to the registration form should submit
decision for accession.
ACTIVITIES
ADAE with support of dvv-International -
office Skopje organized events in the
frames of the Days of Lifelong Learning in
The days of lifelong learning in Tetovo
![Page 8: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/8.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 8
For the first time in our historywehave been given the honor to hostthe65-thIAESTEAnnualConference.In January 2012, the whole worldcomes toMacedonia.Ononeof themost significant events thatconnects IAESTE leaders from allover theworld,over400delegates,guests and members from over 87countrieswill attend theconferencewheretheywilldiscussthefutureofIAESTE,exchangeoffers forenablingtechnical experience for as manystudents as possible, develop globalstrategy and build long-termorganizational vision and shareexperienceandskills.
MACEDONIANCOMMITTEEFORTHEINTERNATIONALEXCHANGEOFSTUDENTSFORTECHNICALEXPERIENCE
ABOUT IAESTE MACEDONIA
IAESTE Macedonia (Macedonian Committee
for the International Exchange of Students for
Technical Experience) is an independent, non-
profit and non-political student exchange
association, who is a full member of IAESTE
a.s.b.l. IAESTE Macedonia, provides students of
science, engineering, technology and the
applied arts with paid, course-related,
technical training abroad.
A BIT OF HISTORY
The international IAESTE was founded in
January 1948 after the initiative of the Royal
College in London. Starting with just 10
European member countries, IAESTE soon
began to spread quickly now counting around
90 members with IAESTE Macedonia being
one of them. We have joined the “big family”
in 1992 and we are proud to celebrate our 19-
th birthday this year.
OUR MISSION AND GOALS
o Providing students a chance to gain
technical experience in their field of
studies which would be significant in their
overall education and professional growth
o Promoting mutual understanding and
good will among students, the academic
community and employers
o Providing employers with highly qualified
and motivated trainees
NETWORK AND STRUCTURE
IAESTE Macedonia has 4 Local Committees at
the state universities in Skopje, Bitola, Shtip
and Ohrid. It is run by the national committee
which is the executive body of IAESTE
Macedonia, consisted of 9 members: National
Secretary, Representative of LC Skopje,
Representative of LC Bitola, Representative of
LC Shtip, Representative of LC Ohrid, Finance
responsible, Marketing responsible, Incoming
responsible and Outgoing responsible. These
are all elected by the National Assembly which
is the most powerful body in IAESTE
Macedonia and is an assembly of all full
members of IAESTE Macedonia. It holds
meetings according to the needs, but at least
once per year in the third Saturday of every
December.
WHO CAN BE A MEMBER?
Our members can be any students at the
following faculties: Faculty of Agricultural
Sciences and Food, Faculty of architecture,
Faculty of Civil Engineering, E-business from
Faculty of Economics, Faculty of Electrical
Engineering and Information Technologies,
Faculty of Forestry, Faculty of Mathematics
and Natural Sciences, Faculty of mechanical
engineering, Faculty of Pharmacy, Faculty of
Technology and Metallurgy, all from “Ss Cyril
and Methodius” University. If you want to join
us, all you have to do is come to one of our
regular meetings which are being held every
Monday at 8pm. at the amphitheatre at FEIT
and MFS.
EVENTS
Throughout the year, IAESTE Macedonia
organizes many events such as the Seminar
for training and motivation, IAESTE Day,
International Evenings, TWIN Seminar and
many, many more.
TheUnitedNationsVolunteers(UNV)The United Nations Volunteers (UNV) programme is the UN organization that contributes to peace and development through volunteerism worldwide. Volunteerism is a powerful means of engaging people in tackling development challenges, and it can transform the pace and nature of development. Volunteerism benefits both society at large and the individual volunteer by strengthening trust, solidarity and reciprocity among citizens, and by purposefully creating opportunities for participation. UNV contributes to peace and development by advocating for recognition of volunteers, working with partners to integrate volunteerism into development programming, and mobilizing an increasing number and diversity of volunteers, including experienced UN Volunteers, throughout the world. UNV embraces volunteerism as universal and inclusive, and recognizes volunteerism in its diversity as well as the values that sustain it: free will, commitment, engagement and solidarity. Based in Bonn, Germany, UNV is active in around 130 countries every year. Source: unv.org
IAESTE Macedonia
![Page 9: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/9.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 9
TThhee��LLaaww��oonn��YYoouutthh��aanndd��tthhee��IInniittiiaattiivvee��
““IInn��ddeeffeennssee��ooff��ppaarrttiicciippaattiioonn””��During the summer month of August, while
looking into the National Assembly’s working
agenda something unexpected and curious
caught our eye. The Commission on
Education, Youth and Sport had scheduled a
meeting for a first reading of the Law on
Youth, a law which until that day we had only
heard that was going to be created, but there
was no other information on it. Immediately
we contacted other youth organizations to
inquire whether anyone had the slightest idea
about the Law on Youth being brought into
parliament. What came as a total shock was
the fact that no one we contacted was at any
point asked or included in the creation of the
draft law. When we raised the question about
how the law was created, a further shocker
came through the announcement that the
proposed law not only included the opinions
of youth organizations, but it was also created
according to EU standards. Hearing notions
like this, that resembled nothing to the real
situation, meant that there was an urgent
need for action. Youth Educational Forum
immediately issued a call to other youth
organization who were willing to join us and
create a united front that will raise their voices
and speak about the necessary changes of a
law on youth that should be envisioned as a
protector of youth rights but somehow
forgets to include youth in the actual process
of creation of the law. Within a week of
placing the call, 35 civil society organizations
joined. With that the initiative “In defense of
participation” was born. Today there are 45
member organizations and non-formal groups
directly participating in the initiative. From the
very beginning the Initiative decided to
present its opinions both to the wider public
and directly to members of parliament. A
website for the initiative was launched and a
policy brief was created which was
immediately sent to all members of
parliament. The policy brief showed effective
as its data was used both by parliamentarians
from both the opposition and coalition
partners in the governments were
commenting on the many shortfalls of the text
of the draft law. Thanks to the initiative a
public call was placed for recommendations to
be submitted in order for the draft law on
youth to be improved. In the open call for
comments on the Law, the members of the
initiative prepared comments and submitted
them to the MPs as well as the Assembly’s
Commission of Education, Science and Sport.
The amount of comments and amendments
that we created were so large, that there
came a need to produce a clean text version
of the draft law in order to ensure that a clear
picture is shown of the necessary changes in
the draft law on youth. During the whole
period, the Initiative always stayed active and
within the radar of the media as the topic
seemed interesting to the wider public. Two
public debates were organized one by YEF
and the other by supporters of the initiative -
Progress Institute. YEF’s debate had members
of parliament, Political Party Youths and
NGOs. However the public debates were not
the only extent of work the initiative did. YEF
organized meetings with representatives from
political parties’ youths in order to try to find
a common ground for all youth
representatives and send a clear picture to the
parliament that by joining efforts and working
towards a common goal can be done, and
political interests can be cast aside. During
the meetings with various representatives
from the largest political party youths, we had
the chance to hear their stance on the matter,
discuss common ground and gain their
support with their MPs. The interest by the
European Youth Forum was another
encouragement for us in the process, as the
report that was sent to the Commission of
Education, Science and Sport reflected many
of the flaws we also noticed in the draft
version of the law. When the second reading
of the Draft-Law was scheduled in the
Assembly’s Commission on Education, Science
and Sport, the problem arising was that the
Commissions’ session was scheduled before
there was a report published about the
outcomes of the public discussion on the
draft version of the law. Not ready to give up,
the initiative organized a conference for the
press in front of the national Assembly. The
key message delivered was that the MPs
should rise above the party interests and
focus their attention on the comments by the
organizations which thoroughly approached
this matter and dedicated a lot of time and
effort in improving the proposed law. With
the continuous public pressure created, on
October 30th the Government of Macedonia
decided to retract the Draft-Law on youth in
order to conduct a wider consultation with
the youth NGOs. This does not mean that the
battle is over, but that it has yet to start. The
non-formal coalition will continue to follow
the development of the matter in the future
and organize meetings and focus groups
with its members to locate the optimal
solution for youth organizing in the country
and the future steps for action.
TThhee��WWoorrlldd��
AAssssoocciiaattiioonn��ooff��NNoonn--
GGoovveerrnnmmeennttaall��
OOrrggaanniizzaattiioonnss��--��
((WWAANNGGOO))����
WANGO is an international organization uniting NGOs worldwide in the cause of advancing peace and global well being. WANGO helps to provide the mechanism and support needed for NGOs to connect, partner, share, inspire, and multiply their contributions to solve humanity’s basic problems. Initiated in 2000 by a handful of international NGOs and prominent visionaries, WANGO has quickly become one of the premier international bodies for non-governmental organizations that are committed to the ideals of universal peace, justice, and well being for all humanity. Concerned with universal values shared across the barriers of politics, culture, religion, race and ethnicity, the founding organizations and individuals envisioned an organization that would enable NGOs to work in partnership across those barriers, thereby weaving a selfless social fabric essential to establishing a worldwide culture of peace. By optimizing resources and sharing vital information, WANGO provides a means for NGOs to become more effective in completing their vital tasks. With its global network of NGOs, as well as affiliates drawn from the ranks of governmental and intergovernmental bodies, business, and universities, WANGO has become an international leader in tackling issues of serious global concern. Source: wango.org
![Page 10: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/10.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 10
The Coalition of youth organizations SEGA is a national platform of youth organizations active in the field of lobbying for the needed legislative changes in youth policies, as well as committed to support youth activism, youth participation and access to information, by implementing activities for improving the overall state of youth. The Coalition SEGA addresses its activities towards initiation and implementation of legislation aiming to improve the young people’s life in Macedonia. The Coalition SEGA gave significant contribution towards creation of the National Youth Strategy of the Republic of Macedonia and the Action Plan for Implementation of the National Youth Strategy of the Republic of Macedonia. In 2009 the Coalition of youth organizations SEGA prepared the Alternative Report for the implementation of the Convention on the rights of the child in Macedonia. The report was presented in 2010 in front of the UN Committee on the Rights of the Child in Geneva. The recommendations of the Alternative Report were presented to the Commission for labor and social policy of the National Assembly of the Republic of Macedonia. In 2010, the Coalition of youth organizations SEGA conducted national research on the Youth trends and youth organizing in Macedonia. In its seven year working experience SEGA produced numerous publications, toolkits and manuals, and have organized a number of seminars and trainings for raising the awareness for the need of youth participation and as well advocacy and lobbying for the youth needs. Aiming to increase the youth participation in decision and policy making processes, SEGA supported the process of establishment of Councils of Youth within 6 municipalities of Macedonia. Regarding to the increasing the youth information the first Youth Information and Counseling Center INFO SEGA was opened. Beginning from 2010 the Coalition of youth organizations SEGA started to implement activities advocating for adoption of Law which will support the youth organizing and youth participation in the Republic of Macedonia.
The strengths part of a Youth Worker is that when we work in the community with youths some job we have very big responsibility, consecration, and they take the job very seriously then you are doing your job honestly and you enjoy working with youth, in the most of the case the Youths they works for the youths in the Community.
THE MAIN TASKS OF THE YOUTH
WORKER ARE:
1. Treat young people with respect: The youth worker is necessary to treat all the youth of equally and work with them no meter if they are different from ages, nationality, religions, race, gander, ability.
2. Respect and promote young people’s
rights to make their own decisions and
choices: Help them and create an atmosphere where everyone to have opportunity to discus in group or in peers and I will respect their choices and decisions.
3. Promote and ensure the welfare and
safety of young people: It’s necessary to be prepared in any situations and confront with it. Even there he has to take risk because in some situations is necessarybut also the Youth worker to take responsibility for my action in that case I will safe and ensure young people who are involved too. They have to be careful to avoid unnecessary rick and to be aware for the job I did in this way I will encourage young people of my practical placement group to participate in every activity without been afraid.
4. Contribute towards the promotion of
social justice for young people and in
society generally: The Youth Worker needs to encourage the members in group to respect all the peoples and to value the differences, multicultural society and they will encourages all of them to participate and to work together in activities that they will have in the project.
5. Recognize the boundaries between
personal and professional life: They need to have one line in which level they will have the relationships with the youth on their work, not to be so closer with them but and not to be so close person but to have one gold mess and both sides to be satisfied with the relationships that we will have during the projects.
6. “Recognize the need to be accountable
to young people, their parents or
guardians, employers, funders, wider
society and other people with a relevant
interest in the work”: They need to be open and very honest with the youth on their work, and be sure that every actions that they will make need to be in accordance with the low, is necessary to make discussion in case when we work with youth if we have some conflict in our project. They will take opportunity to collages of other agency to collaborate with youth activities.
7. Develop and maintain the skills and
competence required to do the job: They need to give and receive feedback with their collages for having quality work and skills and knowledge’s and recognizes and use new skills for educations and training.
8. Foster and engage in ethical debate in
youth work: They need to develop like a youth worker and they need to l relate their own personal values with the ethical principles of youth work.
9. Work for conditions in employing
agencies where these principles are
discussed, evaluated and upheld: The Youth Worker will be aware of the statements of principles like a Youth Worker when I will work with the students of my practical placement group and I will be prepare always to talk and discus with the collages for difficulties ethical issues.
TTThhheee jjjooobbb ooofff ttthhheee YYYooouuuttthhh WWWooorrrkkkeeerrr
Pranvera
IMERI
![Page 11: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/11.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 11
Skopje thus it’s office is located in the Faculty of Law “Iustinianus Primus”. In its work, AEGEE – Skopje, has organized numerous international and local events, as: Summer Universities, Winter Universities, student exchanges, conferences and other youth events. As an antenna of the AEGEE network it was pronounced as one of the ten antennas from the whole network which are the guiding force for the period of 1995 to 1999. To prove the hard work involved AEGEE - Skopje became organizer of the annual statutory event called “AUTUMN AGORA 2004” and again in 2011. It’s very rear for one antenna to organize the AGORA two times, but the legacy of AEGEE Skopje is strong and willing to promote unity and youth activism. In the current year, AEGEE Skopje has worked out some ambitious projects which core is the most noble ideas for human understanding, positive and transparent thoughts, love and tolerance. Despite having one of the toughest projects on their hands by organizing the statutory event they managed to organize one Local Training course for their members, a Youth in Action project and a Summer University. For all of those who want to be informed more about the ideas and work of AEGEE – Skopje can visit our official web site www.aegee-skopje.org.mk and can find us on Facebook. Our motto is: “Some call it Europe, we call it home”
AEGEE – Skopje is a non- government student organization (NGO), apolitical, and nonprofit secular organization which is a local antenna of the AEGEE network. AEGEE is an abbreviation for European Students Forum and is one of the biggest interdisciplinary organizations in Europe. It is present in 256 Universities in 40 European countries and it includes 17 000 members. The name is an acronym for Association des Etats Généraux des Etudiants de l’Europe and despite its student body it promotes united Europe forging towards international cooperation, communication and integration among students and creating an open and tolerant society. As well as the general network AEGEE - Skopje is European and does not function on a separate national level; this structure aims to wipe out the existing mental borders among students of whole Europe. THERE ARE FOUR MAIN ACTIVITIES: 1. University education 2. Exchange of culture 3. Peace and Stability 4. Active citizenship AEGEE enjoys the support of the European Commission. It has a consulting status in the Council of Europe and the United Nations also is a member of the European Youth Forum and cooperates with UNESCO. The members of AEGEE believe in their work. In return they gain personal current events. Needles to say they are all volunteering for a better tomorrow. AEGEE – Skopje is formed in 1993 as one of the first student NGOs registered in the independent Republic of Macedonia. Throughout its 18 years of existence it has a great cooperation with the University of Cyril and Methodius in
HOW TO WORK
WITH DEADLINES!?
The word "deadline" may bring up a spike of adrenaline in many people. So many of us are natural procrastinators, but by using deadlines, you can improve every aspect of your business even the relationship with your clients. Of course you will need some time to break old habits, but by instituting the right systems, you can start embracing the use of deadlines and reaping the benefits. Here are some ways to make deadlines work for your business!
INSTRUCTIONS
1. Accept deadlines. It's smart to come to an acceptance that you need to work with deadlines. Simply stated, they're essential to your productivity. Once you set up a system, it won't feel like such a chore. In the meantime, start reading up on business productivity.
2. Set up your system. How will you best stay updated on deadlines? Will you use the organizer in your Blackberry, or use a traditional day planner? Write or post your deadlines somewhere that you can frequently see them and that you'll actually use. There's no point in writing down deadlines in an old planner that stays under your desk. If your goals and deadlines are so long term that you almost forget them, make sure to mark baby steps or milestones into your planner.
3. Set a timeline. Start with something small. Say you want to create next year's budget and need it done in the next two months. Give yourself a deadline six weeks from now. It's best to start with things that won't have a huge impact if you miss them.
4. Start using deadlines. If you have a project due to a client in two weeks, mark it in your planner and use the baby steps necessary to get it done. Sometimes a final deadline doesn't work, so those in-between milestones are necessary. Let people know when you set a deadline for yourself, that'll motivate you more to keep it.
By: Kristen Fischer, eHow Contributor
�
NEWS�AND�RESOURCES�FOR��������THE�NONPROFIT�SECTOR
Caleidoscop.org is your definitive
source of daily news aimed at the
nonprofit sector. This project is
managed exclusively through
voluntary work and it's been running in
similar formats since 2003.
![Page 12: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/12.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 12
YYYYYYYYoooooooouuuuuuuutttttttthhhhhhhh wwwwwwwwoooooooorrrrrrrrkkkkkkkk
Life in front of youth is like a pace of hammer
in front of one painter, and as long as one
painter collects enough colors to depict his
best picture, we, as youth, want to create and
have our possibilities in order to live a colored
life. Our reality is built as a result of our human
invention and it is harmful. People need the
true reality which is supposed to be built
according to the essential sources of life. Now
I want us to stop in our Balkan countries, and
figure out what is the problem with our society
by looking at the first important guiding
foundations- for example: what strategies are
used to guide youth? Where is the teacher to
be listened, and which is the global influence
over the Balkan society? Our Balkan countries
are not more important than we are, but the
problem is the people, who believe that our
countries are more important than our lives.
That’s why passes a year, a decade, a century,
and there is still lack of freedom, peace or a
normal life. So, this is the evident reality, but
you, try to think what kind of reality would be
important if it has no freedom or peace? And
this is what our Balkan countries have to deal
with. We have different religions, different
nations, and different ways of disrespecting
our invented integrity which is a result of our
political aspects, also our human identity
which is an endowment from our Creator. In
this point can be connected youth, therefore,
can be found ‘the misleading teacher of the
society’ which is made of politics who play the
restrictor, depriver, corruptor etc.
When there is mentioned religion than
there is present also its fellow whose name
is the faithful human, and a faithful human
must be called the one who appreciates
his/her life by appreciating others’ lives, or
his/ her own God Creature. This means that
there is no religion advice which leads us
towards to depriving each-other as long as
faithfulness is realized based on appreciation.
If there is any convincing advice from the re-
presenters of religion or patriotism than we
have to be sure that they are also the miss-
interpreters of their beautiful invented lie that
supports our false reality, in the Balkan
countries and all over the world, because the
Balkan reality is also a result of the global
.
Sadudin
BAJRAMI
society. Furthermore, our politics consider
their alternatives to be more important than
our lives; because they are separating us by
putting barriers between our communities, not
to let us exchange, thinking that we are
different from one another even when we
know how short our life to spend for these silly
things is. Our Balkan countries have millions of
people, and in us are endowed the same
abilities that are endowed in any other
generation around the world. Our problem
isn’t any lack of ideas, but it is lack of courage
to follow our instincts to change. If we stop
and look our Balkan image today we can notice
nothing unusual except our politics that stand
as a barricade in the middle of us and our
chance to change. There is always said that
avoid politics, be who you are supposed to be,
work yourselves etc. But how can we go
through these paths when the random worker
and the student are obliged by the politics to
have their partial membership certificates
which corrupt us way before we start our work
and educational research as individuals. This is
the kind of reality that we as youngsters don’t
belong to, and this what we must consider as a
wrong reality for our human society. The
meaning of this life is to live it and we can have
differences as many as we want but when it
comes to society than there in no difference.
We have to agree with the way we have come
up, having our differences, but why those
differences have to stop us share our cultures,
maintain our education, be conscious towards
to living life peacefully? We as youngsters need
to be invested our ideas, our educational
systems must be recuperated, and our politics
must be responsible for the structures of our
nations in Balkan as long as they dare to
present our will. In this way any change can
happen, because we, as youth, are the future of
our countries and our society, and if we don’t
have a valuable start than we will have a
terrible ending together with our society. So
our politics should work in their business and
we as youngsters should go on educating
ourselves. The founding of the Balkan society is
us, and our global influence is to integrate our
cultures overseas, but our teacher is our
politician and he prevents us to complete our
dream. You as a reader may consider these
facts as problems that appear all over the
world, but you should also think about our life
standards? Imagine that If in some countries
around the world have economical crisis than
we in Balkan have insurance crisis which is way
too worse than the first. I, as a citizen of
Macedonia see that we go through many
difficulties: employment and education are too
low, our investments which are supposed to
.
be in education are contrary being in
materialization. If we don’t have a ministry
of education that does its job well than we
as students will not have values in our
professions, even if we all become
academics, as long as our society is a ‘Black
Pearl’ than we all are ‘white idiots’. Our
intention is to be part of Europe, but we still
have problems with the language which is
the base of one country. There are certain
places in Macedonia where our ethnical
groups (either majorities or minorities)
grow distantly, because we as youngsters
attend our educational courses separately.
In some places where live only Albanians,
the official Macedonian language is
practiced but not learned, and that is as a
result of our Ministry of Education, also it is
because of the non-official Albanian
language who want it as an ethnic right.
The lack of the official language separates
Albanians from the Administrative
information, medical information, taxation
information etc. And we are waiting Europe
to come and solve these problems! What
we have to do is make up our minds to help
ourselves and stop being perseverant
people. Our national decisions shouldn’t be
that strong, and turn into pressure against
our lives. These notes might not look well
to your opinion, but this is the pain of
youth, and I as a part of it, present that
these are the difficulties which don’t let us
play an important role in our society and
maintain it in best way we can. So, every
disadvantage of these cases is or becomes
a disadvantage for the civilization of our
nations, and also our civilization as
humankind.
55 DDeecceemmbbeerr,, IInntteerrnnaattiioonnaall VVoolluunntteeeerr DDaayy ((IIVVDD))
International Volunteer Day (IVD) is a chance for volunteer-involving organizations and individual volunteers to promote their contributions to development at local, national and international levels. By merging UN support with a grassroots mandate, IVD is a unique opportunity for volunteer-involving organizations to work with government agencies, non-profit organizations, community groups and the private sector. Source: unv.org
![Page 13: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/13.jpg)
DECEMBER 2011 NGO MAGAZINE PAGE 13
The European Law Students’ Association in
Republic of Macedonia (ELSA Republic of
Macedonia) is an independent, non-political
and non-governmental organization
completely oriented towards its members-
the law students. The organization was
founded on September the 5th 1997 in
Skopje, by a group of young and enthusiastic
law students, as part of the network of the
European Law Student Association. The
founders imagined ELSA Republic of
Macedonia as a certain type of service for
the students of the Law School and a window
to Europe and it`s opportunities. ELSA
Republic of Macedonia was recognized as a
full member of ELSA Internationa аt the
International Council Meeting, held in
Opatia, Croatia in 1998. We are very proud to
say that our organization is recognized under
the constitutional name of the country which
reflects our status and reputation in ELSA
International. This is unique organization that
gives law students an opportunity to gain
knowledge and experience both on national
or international lever through its activities
and events. ELSA represents the starting
point in the process of building the carrier of
a future lawyer and allows its members to
finish the Law Faculty with maximal
knowledge and practical information for their
future profession. On international level ELSA
was found 30 years ago and the motto that
played a great role in the making and
developing the organization is “A just world
where there is a respect for human dignity
and cultural diversity”. This vision is leading
us in our mission to make law students
prepared to be great lawyers after they finish
their formal education. There are ELSA
National and Local groups in more than 200
universities throughout 40 Countries in
Europe. ELSA functions through four areas:
Seminar and Conferences, STEP (Student
Training Exchange Program), Academic
Activities and Marketing. The Seminar and
Conference area beside these two types of
events includes also international and
national institutional or regular study visits.
Until now we have organized one study visit
with the students and members of ELSA
Albania and one International Institutional
Study Visit of the European Court of Human
Rights in Strasbourg, France. We also had
several institutional visits of institutions in
Macedonia. In the STEP sector our members
have the chance to apply for an internship
that is organized by some other ELSA
National groups (for example Spain, Italy,
Germany, Poland etc.). In the same time our
members, together with the Vice President
for STEP are doing job hunting so foreign
students of law can come and do internship
here in Macedonia. Until now we have had
several foreign students on internships in
Macedonia (from Finland, Czech Republic
and Slovakia). More important our students
have gained internships in another country
(Turkey, Montenegro, Germany and The
Council of Europe). The area of Academic
Activities includes legal writing, legal
research and Moot court competitions. As a
part from ELSA Republic of Macedonia there
is a Moot Court Club that every year does
recruitment of new members that practice
law related to the topic of human rights and
its protection. The best members of the
Moot Court Club are representing our Law
Faculty Iustinianus Primus and our ELSA
group on the Regional Moot Court
Competition that is organized by Young
Lawyers of Serbia and Human Right
Defenders. Every year we have great results
on this competition. Our best year was in
2010 when our team won the first place. The
Marketing area is helping all the other
sectors with promotional materials and
maintenance of our website: www.elsa-
rm.org.mk. There are seven people that are
responsible for the functioning of the
organization: President, Treasurer, Secretary
General and four Vice Presidents for each of
the above mentioned areas. For each area we
have organized a lot of events throughout
the years and we still are. Every year we
adopt One year operational plan that is
guideline for our work. Until now we
cooperated with OSCE Mission in Skopje,
Council of Europe, MYLA, Akademika, MOF,
IHR, with a lot of our Alumni members etc.
Our organization has its office on the Law
Faculty Iustinianus Primus in Skopje. Current
president of ELSA Republic of Macedonia is
Svetlana Kjoseva - (president@elsa-
rm.org.mk).
NNEEWW LLIITTEERRAATTUURREE
SSEECCTTIIOONN BBYY
""IIZZLLEEZZ"",, WWHHYY AARRTT
MMAATTTTEERRSS??
The NGO "Izlez" decided to raise the awareness of the importance of literature by dedicating 10 new pages on the poetry and prose of uprising Macedonian talents and new birds. The first issue has now been completed and it is to be released soon. The content ranges from professional literature translations of famous world-wide poets to literary criticism. Moreover, this issue will promote the best literature pieces from the first Literature contest and some of the current cultural and artistic events. The team believes that this small step forward in the field of arts will motivate young artists to voice themselves. Why? The answer would be because art matters. By leaving out art, we unbalance science, negate social sciences and diminish the quality of education. How so? If there wasn't for creativity triggered by artistic practices we would lack the ability to tolerate the lack of scientific knowledge and ultimate facts and "thrust" because creativity makes us tolerate inconsistencies. If there wasn't for Malamud to tell us that people's spirit is colorless maybe social sciences would have to write more chapters on racism without using metaphors. Finally, can we make good education without the harmony of all the aspects mentioned above? Let art be what it is, aesthetic pleasure, but don't leave it out altogether for society will need a good satire or a reminder of humanity. It will need an aesthetic reminder and of course not always of the beautiful. At the end, I would like to reveal some of the details of the upcoming Literature contest the team is working on. The selections of the literature pieces will be made by renowned Macedonian writers, the poetry by Eftim Kletnikov, while the prose by Venko Andonovski. Everyone interested should check out the official website: www.izlez.mk
By: Afrodita Nikolova
![Page 14: NGO MAGAZINE - Nr. 2 (December 2011)](https://reader034.vdocuments.mx/reader034/viewer/2022052605/568c4c851a28ab4916a07941/html5/thumbnails/14.jpg)
�
STAY TUNED!
SEE YOU NEXT ISSUE!