next generation sequencing of soil fungi in fluoride

International Journal of Microbiological Research 9 (3): 98-108, 2018ISSN 2079-2093© IDOSI Publications, 2018DOI: 10.5829/idosi.ijmr.2018.98.108

Corresponding Author: V. Roshni, Research & Development Centre, Bharathiar University, Coimbatore, India.

98

Next Generation Sequencing of Soil Fungi in Fluoride Contaminated Paddy Soil

V. Roshni and V.S. Harikumar1 2

Research & Development Centre, Bharathiar University, Coimbatore, India1

Department of Post Graduate Studies & Research in Botany,2

Sanatana Dharma College (University of Kerala), Alappuzha, Kerala, India

Abstract: Soils, the highly variable microbial habitat on Earth accommodates high taxonomic and functionalfungal diversity. The present work aims to identify the fluoride tolerant microfungi from the paddy fields of theunique tropical wetland, Kuttanad, India, using Next Generation Sequencing. The genomic DNA was amplifiedusing internal transcribed spacers (ITS) 1 and 2 primers specific for the ITS region. The library was sequencedusing paired end (2×250bp) illumina HiSeq 2500. The phylum, class, order, family, genus and speciesdistribution based on Operational Taxonomic Units and reads were identified. The taxonomic compositionanalysis demonstrated that Candida africana was the leading Candida species followed by Alternariaalternata, Edenia gomezpompae, Aspergillus niger and Neolentinus lepideus. Other less representative fungalspecies include Acaulospora colombiana and Candida sake. We also analyzed the microbial diversity withinthe sample by calculating Shannon, Chao1 and observed species metrics. Our study is the first detailed reportof the composition of soil fungal communities in the high fluoride area of Kuttanad. These fluoride tolerantmicrofungi can be used to ameliorate fluoride toxicity in paddy fields which may prove to be effective asmicrobes are native to the contaminated soil thereby alleviating the problem of fluoride contamination.

Key words: Metagenomics Fungi Kuttanad

INTRODUCTION Even though fungi comprise 2.2-3.8 million species,

Soil is one of nature’s most biologically diversified eukaryotes in terms of biodiversity [11]. Fungal diversityhabitats and one of the most convoluted ecosystems with studies have traditionally relied on various phenotypicdiverse living organisms. Among the soil microorganisms, characteristics which was the main norm of fungalfungi are successful inhabitants of soil, due to their ability classification for many years [12]. The development ofto endorse various forms in response to unfavorable metagenomics boosted fungal genomics as it can be usedconditions [1]. The soil fungal communities act as as a powerful tool for more comprehensive assessment ofeffective biosorbant of toxic metals, help to break down soil fungal communities. Next Generation Sequencingorganic matter and decompose soil components [2, 3]. (NGS) has been extensively used in metagenomics in theFungi even act as biological controllers which can past decade because of the low cost, high speed andregulate diseases, pests and the growth of other significant technical advantages [13]. The amplification oforganisms [4]. The mycorrhizal fungi is an example of this internal transcribed spacers (ITS) and the D1D2 domain ofwhich can improve plant growth by increasing the uptake the large ribosomal subunit through polymerase chainof mineral nutrients and water and protect them against reaction (PCR) amplification using universal primers [14]pathogens [4, 5]. Moreover, fungi play an important role coupled with high-throughput sequencing [15] has beenin nitrogen fixation, decomposition of residues, used successfully to study soil fungal communities as astabilization of soil organic matter, biodegradation of culture independent approach [16]. It was found that thepolymers, biological control against root pathogens and ITS1 region with approximately 250 bp average length wasprotection against drought [6- 10]. sufficient to identify fungi at genus and species level [17].

they are one of the least described groups of multicellular

Intl. J. Microbiol. Res., 9 (3): 98-108, 2018

99

The unique wetland, Kuttanad, India which lies at amplified using the universal primers ITS-1the very heart of Alappuzha district is a part of TCCGTAGGTGAACCTGCGG AND ITS-2Vembanad-Kole wetland, the Ramasar site in Kerala [18]. GCTGCGTTCTTCATCGATGC specific for the ITS region.They are unique in the sense that it lies below the sea The amplification program included initial denaturation atlevel and perhaps the largest below sea level paddy 95°C for 30s, followed by 35 cycles of 95°C for 10s, 56°Ccultivation in the world. It is the well-known granary of for 15s, 68°C for 30s and a final extension at 68°C for 5min.Kerala state and is a globally important agricultural Amplicons below 500bp were gel extracted using Pureheritage system recognized by Food and Agricultural Link PCR Purification kit and proceeded with libraryOrganization. The rice fields in this region are known as preparation using NEB Next Ultra DNA kit. The library‘Puncha vayals’ which contributes nearly 20% of the total was sequenced using paired end (2×250bp) illumine Hirice production of Kerala state [19]. Meanwhile, the Seq 2500.overuse of phosphatic fertilizers in rice production hasgenerated severe challenges regarding soil pollution. NGS Data Processing, Operational Taxonomic UnitsFluoride, the unique and the most reactive electronegative (OTU) and Taxonomic Classification: A propriety wet-labanion in the halide series [20] is one of the major approach was followed to sequence region of fungi.components of phosphatic fertilizer. Many researchers Following steps were performed to extract fungal regionhave investigated a significant relationship between soil from Illumina paired-end sequences. As a first step wefluoride and microbial community activity and diversity removed the adapter region from paired-end reads.[21, 22]. In this study, we used Next Generation After trimming the unwanted sequences from originalSequencing to find out the potential fluoride tolerant paired-end data a consensus region sequence wasmicrofungus which can be used to ameliorate fluoride constructed using FLASH program. While makingtoxicity in paddy fields as they are able to cope with consensus sequence, the passed reads aligned tofluoride polluted soil in croplands. each other with 0 mismatches with an average contig

MATERIALS AND METHODS pre-processing steps before we start the analysis.

Study Area and Sample Collection: The study area removal method UCHIME implemented in the toolselected was the agricultural land of Kuttanad, USEARCH.popularly known as the ‘rice-bowl of Kerala, India. This analysis was performed using the pre-processedThe rice fields, known as ‘Puncha vayals’ comprised of consensus sequences. Preprocessed reads from all55, 000 ha below mean sea level where sowing takes samples were pooled and clustered into Operationalplace in November and where harvesting takes place Taxonomic Units (OTUs) based on their sequencebetween March – April. During the sampling year 2016, similarity using Uclust program (similarity cuto ? = 0.97).the annual precipitation recorded in this region was A total of 128270 OTUs were identified from 467156 reads1839.4 mm.Average annual atmospheric temperature was [23, 24]. From 128270 total OTUs, 114012 singletons were28.91°C and the average relative humidity recorded was removed and 14258 OTUs were selected for further79%. analysis.

Soil samples were collected from Muttar region of QIIME program was used for the entire downstreamKuttanad in Alappuzha district, Kerala, India. A ‘V’ analysis [25]. Representative sequence was identified forshaped cut was made on the surface of the soil to a depth each OTU and aligned against fungal core set ofof approximately 10cm and the samples were collected sequences using muscle program [26, 27]. Further wefrom five distinct places of sampling site by digging aligned this representative sequences against referencevertically.The collected samples were pooled and chimeric data sets. Then, taxonomy classification wastransferred into plastic bags and immediately taken to the performed using RDP classifier against Fungal OTUslaboratory. database. The phylum, class, order, family, genus and

DNA Extraction, PCR Amplification and Library identified. The taxa other than top 10 were categorized asConstruction: DNA was extracted from 0.25g of soil Others. The sequences that do not have any alignmentsample using Qiagen Dneasy power soil kit according to against taxonomic database were categorized asthe manufacturer’s instructions. The genomic DNA was Unknown.

length of 250 to 360bp. We have performed the following

Chimeras were removed using the de-novo chimera

species distribution based on OTU and reads were


100

Rarefaction Curves, Phylogenetic Analysis and Krona [37]. Other prevalent fungal orders include Pleosporales,Plot: We analyzed the microbial diversity within the Eurotiales, Capnodiales and Polyporales. Pleosporales issample by calculating Shannon, Chao1 and observed the largest order of the class Dothideomycetes comprisingspecies metrics. The chao1 metric estimates the species a quarter of all dothideomycetous species [38]. Species inrichness while Shannon metric is the measure to estimate this order can be epiphytes, endophytes or parasites ofobserved OTU abundances and accounts for both living leaves or stems, lichenized, or are saprobes andrichness and evenness. The observed species metric is occur in various habitats [39, 40]. Majority of Eurotialesthe count of unique OTUs identified in the sample. are saprophytes in soil [41] whereas CapnodialesThe metric calculation was performed using QIIME include epiphytes, plant pathogens and saprobes [42, 43].software. Clustalw 2 was used for the generation of the The Polyporales is a diverse group of Agaricomycetesphylogenetic tree. Krona plot was constructed that allows with more than 1, 800 described species in 216 genera andintuitive exploration of relative abundances and 13 families [38]. They play a key role in the carbon cycle;confidences within the complex hierarchies of Many species within the order are saprotrophic, most ofmetagenomic classifications [28]. them are efficient wood decayers in the biosphere [44, 45].

RESULT AND DISCUSSION application biodegradation [46, 47, 48]. Less represented

Ascomycota was the most prominent phylum in Agaricales, Malasseziales, Hypocreales, Tremellales andthe sample followed by Basidiomycota. Zygomycota Filobasidiales. Root colonization strategies differ amongand Glomeromycota which comprises of exclusively Glomerales, Diversisporales of Glomeromycota phylumobligate symbionts [29] was the next prevalent phylum which includes all those fungi which provide arbuscular(Fig. 1). mycorrhizal symbiosis [49]. For instance, fungi from the

The most represented fungal classes were Glomerales primarily colonize root systems starting fromSaccharomycetes, Eurotiomycetes, Dothideomycetes and a hyphal fragment, while root colonization byAgaricomycetes in the sample. Among these, Diversisporales starts from spores [50]. This indicates thatSaccharomycetes, belonging to the phylum Ascomycota fungi from the Diversisporales are slower colonizers thanwas the most abundant comprising 39.05% of total fungal members of the Glomerales [51]. The relative abundancepopulation. Dothideomycetes comprising 13.61% are of these fungal orders was shown in Fig. 3.highly diverse range of fungi which are mainly saprobes; The families Saccharomycetaceae, Trichocomaceae,they are also endophytes, epiphytes, fungicolous, Nectriaceae, Pleosporaceae, Polyporaceae,lichenized, or lichenicolous fungi; however, some are Trichosporonaceae and Mycosphaerellaceae wereimportant plant pathogens [30, 31, 32]. The detected in the sample with Trichocomaceae being theAgaricomycetes were also highly prevalent in the high most abundant (6.94%) family. Phylogeneticsample (6.82%). They are mostly saprotrophs; some srelationships of many yeast genera are unclear and thesegroups of Agaricomycetes are ectomycorrhizal fungi are placed in Saccharomycetales incertae sedis until family[33, 34]. The Sordariomycetes, Tremellomycetes, relationships become known [37]. Glomeraceae of theMicrobotryomycetes and Glomeromycetes were less class glomeromycetes, Davidiellaceae of the classrepresented fungal classes. Tremellomycetes was the Dothideomycetes, Filobasidiaceae of the classpredominant class of Basidiomycota which encompasses Tremellomycetes were the other fungal families in theyeasts, dimorphic taxa and species that form complex sample which are less represented as shown in Fig. 4.fruiting bodies and hyphae [35]. Sordariomycetes include Of the class Dothideomycetes, the generapathogenic fungal species [36]. Glomeromycetes of the Cladosporium, Septoria, Penidiella, Phoma, Alternariaphylum Glomeromycota accounts for 0.1% of the total and Edenia were detected (Fig. 5). Alternaria, thefungal classes. The relative abundance of these classes efficient phyto-pathogen of the family Pleosporaceaewas shown in Fig. 2. which includes saprophytes and parasites of living plants

Ascomycete yeasts of order Saccharomycetales of [52, 53] was predominant in the sample. In the classphylum Ascomycota was abundant in the sample which Eurotiomycetes of Ascomycota, the generacomprises a monophyletic lineage with a single order of Aspergillus and Penicillium were detected. The genusabout 1000 known species which live as saprobes, often Penicillium of Trichocomaceae family includesin association with plants, animals and their interfaces pathogenic, saprophytic and /or endophytic fungi [54, 55].

They may also be pathogenic and have potential

fungal orders include Glomerales, Diversisporales,


101

Fig. 1: Phylum Level Classification (OTU) for the sample

Fig. 2: Class Level Classification (OTU) for the sample

Fig. 3: Order Level Classification (OTU) for the sample


102

Fig. 4: Family Level Classification (OTU) for the sample

Fig. 5: Genus Level Classification (OTU) for the sample

Fig. 6: Species Level Classification (OTU) for the sample


103

Fig. 7: The evolutionary relationships of taxa

Fig. 8: Shannon curve obtained for the sample


104

Fig. 9: Chao 1 curve obtained for the sample

Fig. 10: Observed species curve obtained for the sample

Fig. 11: Krona Plot


105

Of the class Saccharomycetes, the genera Candida and 2. if¡cáková, L., T.Vetrovsk , A. Howe and P. Baldrian,Kluyveromyces were detected with Candida being the 2016. Microbial community in forest soil reflects themost abundant genus (34.39%). In the class changes in ecosystem properties between summerGlomeromycetes, the genera Acaulospora of the order and winter. Environmental Microbiology, 18: 288-301.Diversisporales was detected. Neolentinus is the only 3. Frac, M., S.E. Hannula, M. Belka and M. Jedryczka,genera of the family Polyporaceae in the sample. Of the 2018. Fungal biodiversity and their role in soil health.class Tremellomycetes, the genera Cryptococcus and Frontiers in Microbiology, 9: 707.Trichosporon were detected. 4. Bagyaraj, D.J. and R. Ashwin, 2017. Soil biodiversity:

The leading Candida species identified from the role in sustainable horticulture. Biodiversity insample was Candida africana. Alternaria alternata and Horticultural Crops, 5: 1-18.Edenia gomezpompae of the family Pleosporaceae 5. Wang, Y., T. Li, Y. Li, L.O. Björn, S. Rosendahl,comprises of 1.39 % and 0.37% respectively of the total P.A. Olsson, S. Li and X. Fu, 2015. Communityfungal species as shown in Fig. 6. Dynamics of Arbuscular Mycorrhizal Fungi in

Alternaria alternata is a soil borne pathogen that High-Input and Intensively Irrigated Rice Cultivationcauses foliar blight and root rot in rice crops [56]. Systems.Applied and Environmental Microbiology,Edenia gomezpompae has been reported as an endophyte 81: 2958-2965.having symbiotic connections with Poaceae [57]. 6. Jayne, B. and M. Quigley, 2014. Influence ofAspergillus niger of the family Trichocomaceae and arbuscular mycorrhiza on growth and reproductiveNeolentinus lepideus of the family Polyporaceae were response of plants under water deficit: a meta-other fungal species present in the sample. Aspergillus analysis. Mycorrhiza, 24: 109-119.niger is a well-known phosphate solubilizing fungi with 7. Baum, C., W. El-Tohamy and N. Gruda, 2015.high P solubilization activity due to its capacity of medium Increasing the productivity and product quality ofacidification and production of organic acids [58]. vegetable crops using arbuscular mycorrhizal fungi:aOther less representative fungal species include review. Scientia Horticulturae, 187: 131-141.Acaulospora colombiana of the class Glomeromycetes 8. El-Komy, M.H., A.A. Saleh, A. Eranthodi andand Candida sake of class Saccharomycetes. The Y.Y. Molan, 2015. Characterization of novelevolutionary relationships of taxa were shown in Fig. 7. Trichoderma asperellum isolates to select effective

Shannon, Chao1 and observed species metrics biocontrol agents against tomato Fusarium wilt. Thewere shown in Fig. 8, 9 and 10 respectively. Krona plot in Plant Pathology Journal, 31: 50-60.Fig. 10. 9. Treseder, K.K. and J.T. Lennon, 2015. Fungal traits

Since these fungal species were found in the fluoride that drive ecosystem dynamics on land.Microbiologysoils of Muttar, they are considered as fluoride tolerant. and Molecular Biology Reviews, 79: 243-262.These fluoride tolerant fungi can be used to ameliorate the 10. Thomas, B.T., D.S.K. Olanrewaju-Kehinde,fluoride toxicity in the croplands. O.D. Popoola and E.S. James, 2015. Degradation of

CONCLUSION microorganisms isolated from soil. World Applied

Soil fluoride toxicity is a major problem affecting 11. Hawksworth, D.L. and R. Lücking, 2017. Fungalplants, animals and microbial life.Apart from being used as diversity revisited: 2.2 to 3.8 million species. In Thean indicator of soil toxicity, the microfungi can be used to Fungal Kingdom, Eds., Heitman, J., B. Howlett, P.ameliorate fluoride toxicity in paddy fields if they prove to Crous, E. Stukenbrock, T. James and N. Gow , ASMbe fluoride tolerant. Press, Washington, DC, pp: 79-95.

12. Bartnicki-Garcia, S., 1987. The cell wall in fungalREFERENCES evolution. In Evolutionary biology of the fungi, Eds.,

1. Sun, J.M., W. Irzykowski, M. Jedryczka and F.X. Han, University Press, New York, NY, USA.2005. Analysis of the genetic structure of Sclerotinia 13. Edwards, R.A., B. Rodriguez-Brito, L. Wegley,sclerotiorum (Lib.) de Bary populations from difierent M. Haynes, M. Breitbart, D.M. Peterson, M.O. Saar,regions and host plants by Random Amplified S. Alexander, E.C. Alexander Jr and F. Rohwer, 2006.Polymorphic DNAmarkers. Journal of Integrative Using pyrosequencing to shed light on deep minePlant Biology, 47: 385-395. microbial ecology. BMC Genomics, 7: 57.

plastic and polythene materials by some selected

Sciences Journal, 33: 1888-1891.

Rayner, A.D.M., C.M. Brasier, D. Moore, Cambridge


106

14. Kurtzman, C. P. and C.J. Robnett, 1998. Identification gut microbiome composition using two di?erentand phylogeny of ascomycetous yeasts from bioinformatic pipelines. BioMed Researchanalysis of nuclear large subunit (26S) ribosomal International, pp: 325-340. DNA partial sequences. Antonie Van Leeuwenhoek, 25. Caporaso, J.G., J. Kuczynski, J. Stombaugh,73: 331-371. K. Bittinger, F.D. Bushman, E.K. Costello, N. Fierer,

15. Lindahl, B.D., R.H. Nilsson, L. Tedersoo, A.G. PeÃœa, J.K. Goodrich, J.I. Gordon, G.A. Huttley,K. Abarenkov, T. Carlsen, R. Kjøller, U. Koljalg, S.T. Kelley, D. Knights, J.E. Koenig, R.E. Ley,T. Pennanen, S. Rosendahl, J. Stenlid and C.A. Lozupone, D. McDonald, B.D. Muegge,H. Kauserud, 2013. Fungal community analysis by M. Pirrung, J. Reeder, J.R. Sevinsky, P.J. Turnbaugh,high-throughput sequencing of amplified markers-a W.A. Walters, J. Widmann, T.Yatsunenko, J.user’s guide. New Phytologist, 199: 288-299. Zaneveld and R. Knight, 2010. QIIME allows analysis

16. Baeza, M., S. Barahona, J. Alcaino and V. Cifuentes, of high-throughput community sequencing data.2017. Amplicon-Metagenomic Analysis of Fungi from Nature Methods, 7: 335-336.Antarctic Terrestrial Habitats. Frontiers in 26. DeSantis, T.Z., P. Hugenholtz, N. Larsen, M. Rojas,Microbiology, 8: 2235. E.L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu and

17. Nilsson, R.H., M. Ryberg, K. Abarenkov, E. Sjökvist G.L. Andersen, 2006. Greengenes, a Chimera-Checkedand E. Kristiansson, 2009. The ITS region as a target 16S rRNA Gene Database and Workbenchfor characterization of fungal communities using Compatible with ARB. Applied and Environmentalemerging sequencing technologies. FEMS Microbiology, 72: 5069-72.Microbiology Letters, 296: 97-101. 27. De Santis, T.Z., P. Hugenholtz, K. Keller, E.L. Brodie,

18. Mohan, M., M.S.S. Chandran, K.K. Jayasooryan and N. Larsen, Y.M. Piceno, R. Phan and G.L. Andersen,E.V. Ramasamy, 2014. Mercury in the sediments of 2006. NAST: a multiple sequence alignment server forVembanad Lake, western coast of India. comparative analysis of 16S rRNA genes. NucleicEnvironmental Monitoring and Assessment, Acids Research, 34: 394-9.186: 3321-3336. 28. Ondov, B.D., N.H. Bergman and A.M. Phillippy, 2011.

19. Ray, J.G., V. Dhanya and T. Binoy, 2014. Globally Interactive metagenomic visualization in a Webunique Kuttanadu wetland paddy soil of South India: browser. BMC Bioinformatics, 12: 385.Soil fertility in relation to seasons and different 29. Redecker, D., A. Schüßler, H. Stockinger,stages of the crop. International Journal of S.L. Stürmer, J.B. Morton and C. Walker, 2013. AnAgriculture, 125: 296-304. evidence-based consensus for the classification of

20. Kumar, K., A. Giri, P. Vivek, T. Kalaiyarasan and arbuscular mycorrhizal fungi (Glomeromycota)B. Kumar, 2017. Effects of fluoride on respiration and .Mycorrhiza, 23: 515-531.photosynthesis in plants: An overview. Peertechz 30. Schoch, C.L., P.W. Crous, J.Z. Groenewald,Journal of Environmental Science and Toxicology, E.W.A. Boehm, T.I. Burgess, J. de Gruyter, G.S. de2: 043-047. Hoog, L.J. Dixon, M. Grube, C. Gueidan, Y. Harada,

21. Szostek, R., Z. Ciecko, M. Walczak, M. Swiontek- S. Hatakeyama, K. Hirayama, T. Hosoya,Brzezinska, 2015. Microbiological and enzymatic S.M. Huhndorf, K.D. Hyde, E.B.G. Jones,activity of soil after pollution with fluorine. Polish J. Kohlmeyer, Å. Kruys, Y.M. Li, R. Lücking,Journal of Environmental Studies, 24: 2641-2646. H.T. Lumbsch, L. Marvanová, J.S. Mbatchou,

22. Mondal, N.K., K.C. Pal, M. Dey, S. Ghosh, C. Das, A.H. McVay, A.N. Miller, G.K. Mugambi, L. Muggia,J.K. Datta, 2015. Seasonal variation of soil enzymes in M.P. Nelsen, P. Nelson, C.A. Owensby,areas of fluoride stress in Birbhum District, West A.J.L. Phillips, S. Phongpaichit, S.B. Pointing,Bengal, India. Journal of Taibah University for V. Pujade-Renaud, H.A. Raja, E. Rivas Plata,Science, 9: 133-142 B. Robbertse, C. Ruibal, J. Sakayaroj, T. Sano,

23. Lozupone, C.A., J. Stombaugh, A. Gonzalez, L. Selbmann, C.A. Shearer, T. Shirouzu,G. Ackermann, D. Wendel, Y. VÃ¹zquez-Baeza, B. Slippers, S. Suetrong, K. Tanaka, B. VolkmannJ.K. Jansson, J.I. Gordon and R. Knight, 2013. Kohlmeyer, M.J. Wingfield, A.R. Wood,Meta-analysesofstudiesofthehumanmicrobiota. J.H.C. Woudenberg, H. Yonezawa, Y. Zhang andGenome Research, 23: 1704-14. J.W. Spatafora, 2009. A class-wide phylogenetic

24. D’Argenio, V., G. Casaburi, V. Precone, F. Salvatore, assessment of Dothideomycetes. Studies in2014. Comparative metagenomic analysis of human Mycology, 64: 1-15.


107

31. Lawrey, J.D., P. Diederich, M.P. Nelsen, C. Freebury, 43. Zhou, L.W., Z.Q. Hao, Z. Wang, B. Wang andD.V.D. Broeck, M. Sikaroodi and D. Ertz, 2012. Y.C. Dai, 2011. Comparison of ecological patterns ofPhylogenetic placement of lichenicolous Phoma polypores in three forest zones in China. Mycology,species in the Phaeosphaeriaceae (Pleosporales, 2: 260-275.Dothideomycetes). Fungal Divers, 55: 195-213. 44. Floudas, D., M. Binder, R. Riley, K. Barry,

32. Liu, Y.X., K.D. Hyde, H.A. Ariyawansa, W.J. Li, R.A. Blanchette, B. Henrissat, A.T. Martínez,D.Q. Zhou, Y.L.Yang, Y.M. Chen, Z.Y. Liu, 2013. R. Otillar, J.W. Spatafora, J.S. Yadav, A. Aerts,Shiraiaceae, new family of Pleosporales I. Benoit, A. Boyd, A. Carlson, A. Copeland,(Dothideomycetes, Ascomycota). Phytotaxa, P.M. Coutinho, R.P. De Vries, P. Ferreira, K. Findley,103: 51-60. B. Foster, J. Gaske, D. Glotzer, P.Górecki, J.Heitman,

33. Hibbett, D.S., 2006. A phylogenetic overview of the C. Hesse, C. Hori, K. Igarashi, J.A. Jurgens, N. Kallen,Agaricomycotina. Mycologia, 98: 917-925. P. Kersten, A. Kohler, U. Kües, T.K. Kumar, A. Kuo,

34. Tibbett, M. and F. Sanders, 2002. Ectomycorrhizal K. LaButti, L.F. Larrondo, E. Lindquist, A. Ling,Symbiosis can Enhance Plant Nutrition through V. Lombard, S. Lucas, T. Lundell, R. Martin,Improved Access to Discrete Organic Nutrient D.J. McLaughlin, I. Morgenstern, E. Morin, C. Murat,Patches of High Resource Quality. Annals of Botany, L.G. Nagy, M. Nolan, R.A. Ohm, A. Patyshakuliyeva,89: 783-789. A. Rokas, F.J. Ruiz Dueñas, G. Sabat, A. Salamov,

35. Liu, X.Z., Q.M. Wang, M. Goker, M. Groenewald, M. Samejima, J. Schmutz, J.C. Slot, F. St John,A.V. Kachalkin, H.T. Lumbsch, A.M. Millanes, J. Stenlid, H. Sun, S. Sun, K. Syed, A. Tsang,M. Wedin, A.M. Yurkov, T. Boekhout and F.Y. Bai, A. Wiebenga, D. Young, A. Pisabarro,2015. Towards an integrated phylogenetic D.C. Eastwood, F. Martin, D. Cullen, I.V. Grigorievclassification of the Tremellomycetes. Studies in and D.S. Hibbett, 2012. The Paleozoic origin ofMycology, 81: 85-147. enzymatic lignin decomposition reconstructed from

36. Hedeler, C., H.M. Wong, M.J. Cornell, I. Alam, 31 fungal genomes.Science, 336: 1715-1719.D.M. Soanes, M. Rattray, S.J. Hubbard, N.J. Talbot, 45. Younes, S.B., T. Mechichi and S. Sayadi, 2007.S.G. Oliver and N.W. Paton, 2007. e-Fungi: a data Purification and characterization of the laccaseresource for comparative analysis of fungal genomes. secreted by the white rot fungus PerenniporiaBMC Genomics, 8: 426. tephropora and its role in the decolourization of

37. Suh, S.O., M. Blackwell, C.P. Kurtzman and synthetic dyes. J. Appl. Microbiol., 102: 1033-1042.M.A. Lachance, 2006. Phylogenetics of 46. Wang, W., T.Q. Yuan, K. Wang, B.K. Cui andSaccharomycetales, the ascomycete yeasts. Y.C. Dai, 2012.Combination of biological pretreatmentMycologia, 98: 1006-1017. with liquid hot water pretreatment to enhance

38. Kruys, A., O.E. Eriksson and M. Wedin, 2006. enzymatic hydrolysis of Populus tomentosa.Phylogenetic relationships of coprophilous Bioresour Technol., 107: 282-286.Pleosporales (Dothideomycetes, Ascomycota) and 47. Si, J., F. Peng and B.K. Cui, 2013. Purification,the classification of some bitunicate taxa of unknown biochemical characterization and dye decolorizationposition. Mycol. Res., 110: 527-536. capacity of an alkali-resistant and metaltolerant

39. Ramesh, C.H., 2003. Loculoascomycetes from India. laccase from Trametes pubescens. BioresourIn: Frontiers of fungal diversity in India, Eds., Rao, Technol., 128: 49-57.G.P., C. Manoharachari, D.J. Bhat, R.C. Rajak and 48. Schußler, A., D. Schwarzott and W. Christopher,T.N. Lakhanpal. International Book Distributing 2001. A new fungal phylum, the Glomeromycota:Company, Lucknow, pp: 457-479. phylogeny and evolution. Mycological Research,

40. Manoharachary, C., K.V.B.R. Tilak, K.V. Mallaiah 105: 1413-1421.and I.K. Kunwar, 2016. Mycology and Microbiology 49. Hart, M.M. and R. Reader, 2002a. Does percent root(A Text Book for UG & PG Student), Scientific length colonization and soil hyphal length reflectPublisher, pp: 607. the extent of colonization for all AMF? Mycorrhiza,

41. Hughes, S.J., 1976. Sooty molds. Mycologia, 12: 297-301.68: 693-820. 50. Hart, M.M. and R.J. Reader, 2002b. Taxonomic

42. Crous, P.W., 2009. Taxonomy and phylogeny of the basis for variation in the colonization strategy ofgenus Mycosphaerella and its anamorphs. Fungal arbuscular mycorrhizal fungi. New Phytol.,Diversity, 38: 1-24. 153: 335-344.


108

51. Tsuge, T., Y. Harimoto, K. Akimitsu, K. Ohtani, 55. Valdez, J.G., M.A. Makuch, A.F. Ordovini,M. Kodama, Y. Akagi, M. Egusa, M. Yamamoto and R.W Masuelli, D.P. Overy and R.J. Piccolo, 2006. FirstH. Otani, 2013. Host-selective toxins produced by the report of Penicillium allii as a field pathogen of garlicplant pathogenic fungus Alternaria alternata. FEMS (Allium sativum). Plant Pathology, 55: 583.Microbiol. Rev., 37: 44-66. 56. Iram, S. and I. Ahmad, 2005. Analysis of variation in

52. Nam, Y.J., H. Kim, J.H. Lee, H. Yoon and J.G. Kim, Alternaria alternata by pathogenicity and RAPD2015. Metagenomic analysis of soil fungal study. Polish Journal of Microbiology, 54: 13-19.communities on Ulleungdo and Dokdo Islands. The 57. Eo, J.K., M.S. Choi and A.H. Eom, 2014. Diversity ofJournal of General and Applied Microbiology, Endophytic Fungi Isolated from Korean Ginseng61: 67-74. Leaves. Mycobiology, 42: 147-151.

53. Sharma, I. and A. Sharma, 2014. Use of Alternaria Spp 58. Mendes, G.O, A.L.M. Freitas, O.L. Pereira, I.R. Silva,as a Pest Control Agent: A Review. World Applied N.B. Vassilev and M.D. Costa, 2014. Mechanisms ofSciences Journal, 31: 1869-1872. phosphate solubilization by fungal isolates when

54. Khan, S.A., M. Hamayun, H. Yoon, H.Y. Kim, exposed to different P sources. Annals ofS.J. Suh, S.K. Hwang, J.M. Kim, I.J. Lee, Y.S. Choo, Microbiology, 64: 239-249.U.H. Yoon, W.S. Kong, B.M. Lee and J.G. Kim, 2008.Plant growth promotion and Penicillium citrinum.BMC Microbiol., 8: 231.

next generation sequencing of soil fungi in fluoride

Documents