emerging.jpg news journal · 2013 nasa space settlement design contest for students in grades 6 -...

MSTA NewsJournal September 2011

http://marsrover.nasa.gov/gallery/artwork/hires/emerging.jpg

NEWS JOURNAL

A publication of the Montana Science Teachers Association

September 2012


Submitting Articles to the MSTA News Journal When submitting articles, please adhere to the following criteria: • Electronic submissions are preferred in Microsoft Word format. These can be attached to your email message. • If in doubt about format, submit your work in .rtf format. • If truly in doubt, paste your submission in the body of the email message. • Lab activities may be mailed. Please cite any references and also state which National Science Standards your activity meets. John Graves, Editor Tentative Submission/Publication Dates 1112 Hunters Way August 15/September Bozeman, Montana 59718 November 15/December [email protected] February 15/March April 15/May

Montana Science Teachers Association Membership Application

Name _______________________________________ Date _______________ Last First Address ________________________________ Phone _(_____)______________ City County State Zip School/Affiliation ____________________________ School Phone(____)______________________

Email___________________________ Grade Level Subject ___K-6 ___All sciences ___Physics ___6-9 MS or JH ___Life Science ___Chem ___9-12 ___Phys Science ___Other ___College/Univ. ___Earth Science ___Sup/Admin. ___Biology

Dues Category 1 year $20.00 ____ MSTA/MCTM $30.00____ MSTA/MEEA $30.00____ 3 years $50.00____ Life $150.00___ Student $5.00_____ Retired $5.00_____ Make checks payable to MSTA Return to LeAnne Yenny 3880 Equestrian Lane Bozeman, MT 59718


In this issue…

From the President MSTA Keynote Speaker MSTA Information Professional Development for Teachers Opportunities for Teachers and Students Lesson Ideas Websites Teacher Award Opportunities Mark Your Calendars

MSTA HAS A FACEBOOK PAGE

Check it out and become a friend


From the President

WELCOME BACK! I hope you are off to a great start in the 2012-2013 school year. I am excited about the upcoming year and serving as MSTA’s president. A big thank-you to Shirley Greene for her leadership, hard work and service to science education in Montana, as she has been MSTA’s president the past two years!

In this message, I would like to elaborate about how MSTA can support you. One of those ways is by keeping you informed about current issues in our state and country. This summer, I had the opportunity to network with leaders from other state associations and share ideas, at the 2012 National Congress on Science Education. Thank you for allowing me to represent you and the science teachers of Montana. “Build the Scaffolding for 21st Century Science Literacy” was the theme and Steven Pruitt (Vice President of Achieve) provided an in-depth overview of the Next Generation Science Standards (NGSS). He reminded us that they are a DRAFT. He stressed the importance of the review process and how critical it is for interested people to review and submit feedback. There is another scheduled public review of the standards this fall, likely in November. The window for the review will only be two weeks and we all need to review the standards and provide feedback as well as encourage our colleagues, administrators, community members/partners and parents to review them! The National Research Council’s Framework describes the vision of what it means to be proficient in science. The Framework is the foundation for which the standards are based. You can read more about the standards, keep up-to-date with the process, and download the Framework using this link: http://www.nextgenscience.org/framework-k–12-science-education There will be emails and announcements informing you of this window for review of the NGSS.

In addition, MSTA has a fabulous website full of information, lesson ideas, and current/former E-blasts and newsletters. Thank you John Graves! On the website, if you click on the “bylaws” link, you will find the proposed bylaws our organization will be voting on at our meeting on October 18th. I would encourage you to take time to review these prior to that meeting.

Another way MSTA can assist you is the plethora of networking opportunities. At MEA in Billings (October 18th and 19th), MSTA alone has almost 100 hours of exceptional professional development being offered in a variety disciplines and levels. Our scheduled keynote speaker is Bob Becker (award winning chemistry teacher, author and presenter) and I guarantee you won’t be disappointed with his keynote address and breakout session on October 19th. MSTA’s annual meeting is scheduled for Thursday, October 18th at 12:00 at Castle Rock Middle School (about 5 blocks from Skyview High School). MSTA is proud to give recognition for people and organizations in Montana


who deserve recognition for their contribution to excellence in science education. The nomination form is available on the MSTA website and can be emailed.

Please consider nominating an individual or group for the following awards: Elementary University Member Distinguished Service Organization or Group Earth Science Middle School Science Physics Chemistry Biology Administrator

Great information and networking opportunities await you so that you can find something that will excite you and in turn your students, either on the web page or in Billings at MEA in October.

Respectfully,

Beth Thomas


MSTA Keynote Speaker

BOB BECKER

Friday, 10/19/2012 12:00PM - 12:50PM SHS Theatre

The Chemistry of Teaching

Bob has developed, written and published several articles and now is a regular writer for ChemMatters Magazine. He has published two books of demonstrations, available together with a videotape through Flinn Scientific. He has also conducted over 140 workshops and presentations across the US and Canada. His awards are numerous, including the Missouri Teacher of the Year in 2011, Missouri Horace Mann Teacher of the Year 2012 and is currently a finalist for the 2012 Presidential Award for Excellence in Mathematics and Science Teaching.


MSTA Information

The URL for the MSTA webpage is

http://montanascience.org

If you have trouble with that address, try http://www.ivymerriot.com/montanascience/index.html

The page has many new listings and links, be sure to visit it often.

Update your Membership Information on

the MSTA webpage

MSTA E-blast Listserv to sign up, visit the website and follow the

E-blast link


Stay informed. Get educated. The Next Generation Science (NGSS) are coming.

Check out the NSTA webpage for the latest information regarding the NGSS.

nsta.org


Professional Development Opportunities for Teachers

INTERNATIONAL EXCHANGE OPPORTUNITIES FOR U.S. CLASSROOM TEACHERS

The U.S. Dept. of State's Bureau of Educational and Cultural Affairs offers grants for U.S. primary and secondary school teachers to participate in international exchanges during 2013-‐2014 academic year through the Fulbright Classroom Teacher Exchange Program (FCTE) and the Distinguished Fulbright Awards in Teaching (DA). Exchanges begin in August 2013 for one semester or an academic year. By living, teaching or conducting research overseas, teachers gain new skills, learn new teaching methodologies and share best practices with international colleagues. They also expand their understanding of national cultures and international education systems that will enrich their schools and communities with new global perspectives. For the Fulbright Classroom Teacher Exchange Program, teachers may apply for direct exchanges of teaching positions with colleagues from one of six countries (Czech Republic, France, Hungary, India, Mexico and United Kingdom). Teachers may apply for the Distinguished Fulbright Awards in Teaching for one of eight countries (Argentina, Finland, India, Israel, Mexico, Morocco, Singapore, South Africa and United Kingdom). Teachers must have at least 5 years of experience, a B.A. degree and be currently employed in a full-‐time teaching position at a U.S. primary or secondary school. Visit the program website at http://fulbrightteacherexchange.org/ for eligibility, application information and country-‐specific requirements. Application deadlines are October 15, 2012 (Fulbright Classroom Teacher Exchange Program), and December 15, 2012 (Distinguished Fulbright Awards in Teaching).


Be a Winner in the 2012 Shell Science Lab Challenge

Are you a science teacher succeeding in science lab instruction with minimal equipment? The Shell Science Lab Challenge offers you a chance to compete to win a school science lab makeover, valued at $20,000, by sharing your exemplary approach. Invited to participate are middle and high school science teachers, grades 6–12, in the United States and Canada, with special attention paid to urban and underrepresented groups. Your task will be to illustrate replicable approaches to science lab instruction utilizing limited school and laboratory resources. Teachers and schools submitting top entries will receive additional laboratory tools, resources, and rich professional development opportunities.

Visit www.nsta.org/shellsciencelab today and begin working on your application. The deadline for entries is November 12, 2012.

Math Day and Math Circle

They had a great crowd at Math Day last year, almost 200 students attended and they are hoping to continue that success this year. They would like to grow the attendance in our afterschool program, Math Circle -which is also available for remote participation - all that one needs to participate remotely is an internet connection. We'd particularly like to encourage HS teachers in remote locations to "join us" with a group of their students on Thursdays, starting October 11th, from 3:30 - 5:00 at UM.

Math Day is scheduled for FRIDAY, October 5th, 2012 9:00 AM - 2:00 PM. As in the past, Math Day is comprised of a variety of hands-on workshops on topics "beyond the classroom". Some of the popular topics last year were counting to Infinity, fractals and tic tac toe on a torus. This year the panel discussion will feature UM scientists who will discuss the importance of mathematics in their work. They encourage teachers to bring students on a field trip to this MCPS sponsored activity.

Program and Application Information: http://www.math.umt.edu/mathcircle/ Application Deadline: One week prior to the event. Instructors: UM Professors and Graduate Students Information: WEB: http://www.math.umt.edu/mathcircle/ EMAIL: [email protected] Organizers: Professor Jenny McNulty * 243-2473 *[email protected]


Flinn Scientific wants science teachers to be aware that OSHA's Hazard Communication Standard has been revised . . . and science teachers need to receive training to comply with the new requirements. Free, in this edition of Flinn Safety Notes, we begin offering ongoing training to help you meet the new requirements--and improve chemical safety at your school.

To print this month's Flinn Science Department Safety Training Notes please go to: http://www.flinnsci.com/teacher-resources/emails/safety/snsept12/

Make sure to include this information in your next science department meeting. Your support enables us to provide this free training. Thank you!

Very truly yours,

Larry Flinn Chairman Flinn Scientific, Inc. P.O. Box 219 Batavia, IL 60510 1-800-452-1261 www.flinnsci.com


Opportunities for Teachers and Students

The Montana Science Olympiad is November 20. Check out their website for more information. http://www.montana.edu/wwwmtso/

Archaeoastronomy Talk on the Big Horn Medicine Wheel This free talk includes enjoyable background information for Project Archaeology's new professional development curriculum in archaeoastronomy, created for fourth

to sixth grade students.

On Sept. 27th, 6pm, at the Museum of the Rockies, the Extreme History Project will sponsor a free talk, open to the public, titled, Skywatching at Extremely High Altitudes: the Archaeoastronomy of the Big Horn Medicine Wheel, presented by Ivy Merriot, MA, doctoral candidate in American Studies at Montana State University.


2013 NASA Space Settlement Design Contest for Students in Grades 6 - 12

The NASA Space Settlement Design Contest is intended for students in grades 6-12, although younger students may enter. Individual or teams from anywhere in the world propose a design for a space settlement, a permanent community in orbit rather than on another planet or moon. Please visit:

http://settlement.arc.nasa.gov/Contest/

for more information and registration details. Proposals are due March 15, 2013.

Do Some Real Astronomy Research This Year

Want to come do real astronomy research with a mentor astronomer? The application for NITARP for 2012 is now

available! It's available at our website: http://nitarp.ipac.caltech.edu/

Applications are due Sep 21 for a 2013 NITARP experience. The

application website is now open to accept application uploads. Want to know more about NITARP? There is a 3-minute video on our website or on YouTube, featuring real students and

educators talking about their NITARP experience:

http://www.youtube.com/watch?v=EoJqyzCR2fc&feature=youtu.be


Lesson Ideas SNIP SNIP CUT CUT Engage: We know we can cut paper, or string with scissors, but can we cut things we cannot see, like molecules in air, atoms, or DNA? The DNA in our cells is composed of the building blocks called nucleotides. These nucleotides are in a specific sequence in every one of our cells, and each person has a different sequence in their cells. Could we break apart the nucleotides that make up the DNA strands in cells? If we could cut the DNA at a specific sequence or series of nucleotides, how might that be useful? How might we find a particular gene on the long strand of DNA in someone’s cells? Exploration: Enzymes are special proteins that are very specific in what they do. They only work on a specific substance under specific conditions. Some enzymes called restriction enzymes can cut DNA at a specific combination of nitrogen bases. Because each organism’s DNA has differences in the sequence of the nitrogen bases (ATGC’s) we get different cuts in the DNA using restriction enzymes and different lengths of the pieces that result. You will be working with DNA nitrogen base sequences and a pair of scissors which will act like a restriction enzyme we will call “Gee Cuts” that cuts only where the code on the DNA is GGCC and CCGG (see Diagram #1 below). For each patient’s DNA you will start reading through the DNA sequence until you find a GGCC. Cut between the G’s and C’s to produce smaller pieces of DNA. Be sure to keep each patient’s DNA and genetic disease DNA separated as you go so as not to get them mixed up. You will then have DNA fragments of different lengths in piles for each DNA sample. For each of the patient’s DNA run them (make a dark line) on the gel sheet (data sheet #1) according to the number of base pairs in each fragment you cut out according to the base pair ladder on the left. So if the section had 19 base pairs (38 individual nucleotides) make a vertical line just below the 20 location on the patient’s lane. If there are more than one fragment of DNA with the same number of bases make another line right next to your first one to make the line thicker and darker (in a real gel the band will appear darker). Continue doing this for each fragment for that patient. Mark the location of all fragments of each of the patient’s DNA, then “run” the genetic disease DNA in the last lane. Explanation: Compare the genetic disease DNA to the patient’s DNA. Which patient’s DNA matches the bands of the genetic disease DNA? Write a conclusion explaining who’s DNA matched the genetic disease DNA. Answer the following questions. How would it be beneficial to cut the DNA with more enzymes? Do people have the same DNA? Do people have the same combination of nucleotides (ATGC)? Does the presence of a genetic disease gene mean the patient will get the disease? Why would we call this DNA fingerprinting? Elaboration:


A rural hospital experienced a power outage one evening when two babies were born. The babies were mixed up in the nursery before they had received identification bands and the parents and the hospital want to make sure that each set of parents receives their own child. How would you use the techniques in this activity to determine which child belongs to which parents? Would you test work if the mothers were identical twins?

Gel Sheet Data Sheet #1

Lane 1 Lane 2 Lane 3 Lane 4 Lane 5

Base Pair Ladder Patient 1 Patient 2 Patient 3 Patient 4

Genetic Disease DNA

25

20

15

10

5

1

Conclusions:


Diagram #1

GGCCATCCAGGCCTAT GG CCATCCAGG CCTAT CCGGTAGGTCCGGATA CC GGTAGGTCC GGATA PATIENT 1 GGGAATCGCTACATCTTGGGCCGTTCACCTTGGCAACGGCCTGTGGGCCGGGCCCCCTTAGCGATGTAGAACCCGGCAAGTGGAACCGTTGCCGGACACCCGGCCCGG PATIENT 2 GGGAACGTCGGGCCACCGTGGCCGTCGTGGCCATCGTGGCCTGACCACAACCCG CCCTTGCAGCCCGGTGGCACCGGCAGCACCGGTAGCACCGGACTGGTGTTGGGC PATIENT 3 GGGTCGTGGCCCTGACCCTTCGGCCGTCGGGCCTGGCCGGCTTCTTTCGAGGCGCCCAGCACCGGGACTGGGAAGCCGGCAGCCCGGACCGGCCGAAGAAAGCTCCGC PATIENT 4 GGGATCGGGGTTCCCATCGTCCGGGCCGGCCTTTCGGCCGTCTGAGGCCTTTTTCCCTAGCCCCAAGGGTAGCCGGCCCGGCCGGAAAGCCGGCAGACTCCGGAAAAA Genetic Disease DNA AGGTCGTGGCCCTGACCCTTCGGCCGTCGGGCCTGGCCGGCTTCTTTCGAGGCT TCCAGCACCGGGACTGGGAAGCCGGCAGCCCGGACCGGCCGAAGAAAGCTCCGA


Cut Cut Restriction Enzyme Analysis of DNA Engage: We learned that DNA could be cut into smaller pieces with restriction enzymes even though we cannot see DNA or the cutting process. These restriction enzymes cleave or cut DNA in a very specific fashion. They cleave the DNA at the recognition sequence and nowhere else. A common use for restriction enzymes is to generate a “fingerprint” of a particular DNA sample. Because restriction enzymes cut DNA at specific locations, they can be used to generate a “DNA fingerprint” and look for a particular gene. If you know the sequence of a gene, and you know the pattern that a restriction enzyme cuts the DNA, how could you use this technique to “search” for a gene? Is it possible to add or remove a person’s DNA? Exploration: A restriction enzyme reaction contains the DNA to be analyzed, a restriction enzyme, and a specific restriction enzyme buffer mix. This buffer mix contains substances that help to maintain constant conditions like ph, salinity, and magnesium concentration. Most commercial restriction enzymes have activities at 10-20 units /ul. A “unit” is usually defined as the optimum amount of enzyme needed to digest (cut) 1 ug of DNA in one hour in a 50 ul reaction. You should use 10-20 units (1 ul) of restriction enzyme per reaction with a total volume of 50 ul. The DNA will be at a concentration of .5 ug/ul and the buffer will be at 10x or ten times the concentration you want for your reaction. The enzyme will be diluted with distilled water to get your final desired volume of 50ul. How much of each substance should you put in your tube to get everything right? Work with your group to come up with the amounts and then raise your hand to have it checked before proceeding. Once your amounts have been ok’d by your teacher, carefully put the DNA, buffer, distilled water, and restriction enzyme into the microtube using a miropipetter (use care not to contaminate stock solutions). Pool the reagents in the bottom of the tube by tapping it on your desk with the lid closed. Your sample is now ready to be incubated. Once you have your restriction digest set up it will need to incubate at 37oC for 1.5 hours. The sample will then be stored in the refrigerator overnight and run on a gel using electrophoresis the next day. You will add loading dye to your sample (to allow you to see how things are moving through the gel) and place your sample in a well on the agarose gel. Pool the sample in the bottom of the tube and add 4ul of 6X loading dye to your reaction tube. Be sure that the loading dye mixes with the DNA sample at the bottom of the tube by gently swirling but not shaking it. Load 10 ul of the sample into a well at the end of the agarose gel near the black electrode being careful to prevent spilling out of the well. Once all the samples are loaded the electrophoresis unit will be connected to the power supply and the DNA sample will migrate through the gel for about 30 minutes or until the loading dye has moved approximately 2/3 of the gel. When complete the power is disconnected and the


gel is carefully removed from the buffer solution. The gel is very fragile so be careful not to break it. The gel now needs to be stained to visualize the DNA fragments. Place the gel in the staining container and let it sit for 5-7 minutes. Place the gel into a zip lock bag or in plastic wrap and destained overnight in the refrigerator in a small amount of water. If a toxic stain is used make sure you dispose of the staining solution and gel properly and use precautions when handling. The destaining will allow you to see the DNA on a light box. Diagram your gel with the sizes of DNA on a blank sheet of paper, and answer the following questions. How will the different pieces of DNA travel through the gel? Why is it important to have the DNA “run to the red” (negative) electrode on the gel (What charge must the DNA have)? Explain how different sizes of DNA travel through the gel? Using the DNA ladder as a guide, determine the sizes of DNA fragments that you have on your gel. How could you get a specific size of DNA fragment by itself for further testing or experimentation? Elaboration: With the Human Genome Project having completed the sequencing of the entire contents of the human chromosomes one can go to the internet and find the genetic sequence for all of the known genes. These genes can then be removed from human DNA and studied or placed into circular bacterial DNA called plasmids. A plasmid is a circular piece of bacterial DNA that has know locations where restriction enzymes cut it. It may also have genes that give it resistance to antibiotics, color changes when genes are inserted, as well as other genes. Use the attached plasmid for pBluescript II SK (+/-) to propose enzymes to cut the plasmid in two places to remove or disrupt (cut a part out so the gene no longer functions) the gene that causes the blue coloration (lacZ gene) of the Bacteria. How large of a piece of DNA will you cut out? How will you be sure that you have cut out the correct piece of DNA? Will cutting the plasmid DNA ring move differently through a gel as a long strand than a ring? How could you separate the DNA that has been cut out from the rest of the plasmid? Evaluation: Suggest a procedure to place a gene from a human into a bacterial plasmid to produce a substance that humans might need for a medical condition. You may develop a procedure to fix a defective gene, remove a section of a gene, or insert a new gene that is missing. Choose a genetic disorder and do some research on its mode of operation and the genetic basis of the disorder or disease. Your group will give a brief description of the disorder and then prescribe a method in detail for correcting the DNA of a person afflicted with the disorder or disease.


The letters and numbers around the circular DNA diagram indicate locations where different restriction enzymes cut the plasmid. For instance at location 529 and 977 the enzyme Pvu II cuts the plasmid, and at location 2526 the enzyme Sca I cuts the plasmid. The total size of the vector is 2961 nitrogen base pairs long. MCS is the multiple cloning site where genes can be added into the plasmid vector to disrupt the production of the lacZ blue coloring of the resulting bacteria. Ampr is a gene for an antibiotic resistance that allows the pBluescript bacteria to survive when ampicillin antibiotic is present. This allows scientists to prevent foreign bacteria from growing.


Have you ever used the Science Exploratorium Snacks like the one above? You can find them at http://www.exploratorium.edu/snacks/


Research Experiences for Teachers and Students What does the Research tell us about its Effects?

Tom Cubbage

Programs to engage teachers and students in authentic research experiences have been the mainstay of organizations such as the National Institute of Health (NIH), National Science Foundation (NSF), Pew Science Program, and the Howard Hughes Medical Institute (HHMI) as well as many colleges, universities, and other non-profit organizations. In fact millions of dollars are spent each year to fund and encourage these research opportunities. While most funders, participants, and even the scientific community as a whole extol the virtues of these programs as a method to improve science teaching, recruit and retain STEM (science, technology, engineering and math) students and career seekers, and educate about the nature and culture of scientific research precious little research has gone into the evaluation of such programs. So to the end of find out what is know it is the goal of this article to summarize the research that has been done with these programs for teachers and students to experience research in an authentic setting. A review of the literature as well as unpublished date from programs here in Montana and Washington includes 13 programs for teachers and 22 programs for undergraduate students was summarized to help shed some light on these program’s effects. The areas that are addressed here are how the evaluations were conducted, the reported outcomes of the various programs, and the suggestions for next steps to improve the current programs based on the research. The evaluation methods varied widely and can be seen on the chart below. These evaluations tend to be self reports, interviews, and in rare cases (three in each case) tests of content knowledge prior to the program and upon conclusion of the research experience. A summary of the reported outcomes includes for teachers: Appreciation for the time and persistence that is required to do good research, content knowledge and experience, improved confidence and self-efficacy especially with laboratory activities, collaboration with researchers and post secondary institutions, and changes in Teacher practices. The final one is a common expected outcome of teacher researcher programs, however, several issues plague this change in teaching practice. These problems including but not limited to; budgetary constraints, lack of time to make the change, school curriculum rigidity or breadth, and lack of institutional support. For Students, the list of benefits reported in the literature is also interesting. They include; Appreciation for the time and persistence that is required to do good research, content knowledge and experience, improved confidence and self-efficacy, intellectual development, skill development, satisfaction, and preparation for post secondary education. Research by Silverstein and his colleagues at Columbia University (2006) found many of these beneficial outcomes, but reported an interesting 3-4 year delay for benefits in both students and teachers who are involved in an authentic research experience. Silverstein goes on to discuss the fact that most of the research done on the effects of these types of programs are funded for a short period of time (less than the 3-4 years to see results), or that data are collected for only a year or two after the individuals


do their research, and thus potentially missing the benefits if the research at Columbia is applicable to the other programs. Finally what are the suggestions to improve programs that provide research experiences for teachers and students? The research has a few interesting and helpful suggestions for these programs and their funders. Longer experiences show more correlation to benefits reported by participants and their evaluators. Providing explicit attention to desired learning outcomes, and even do training and workshops for participant to ensure that they are progressing toward these goals are all hallmarks fo the most successful programs. Finally, engage participants in higher order thinking and full immersion in the research process. Students and teachers need to be involved in many steps in the process and need to feel like they are being researchers or at least are contributing valuable data or information to inform the research process.


Some Websites Wind: http://hint.fm/wind/ Lab Safety Video http://www.youtube.com/watch?v=xJG0ir9nDtc Higgs-‐Boson Cartoon http://www.cbsnews.com/8301-205_162-57465895/higgs-boson-explained-by-cartoon/ Teachers Network: http://www.teachnet.org/ NASA: http://www.jpl.nasa.gov/education/index.cfm?page=16 Climate Change: http://epa.gov/climatechange/kids/index.html Oceans and Currents: http://oceanexplorer.noaa.gov/welcome.html National Parks Climate Challenge: http://parksclimatechallenge.org/


MSTA LUNCHEON NOON Thursday at the Billings

Conference

A vote will be taken on the proposed MSTA By-law changes. Be sure to review the changes by

downloading the document from the MSTA homepage.


Teacher Award Opportunities

For information on awards, visit nsta.org


The MEA-MFT Conference Schedule is NOW

available online

Check all the MSTA Sectionals:

http://mea-mft.org/educators_conference.aspx


Nomination for MSTA Recognition Awards If you know of a science teacher, university person, administrator or organization in Montana who deserves recognition for contributing to science education in Montana and beyond, please consider nominating them for an MSTA Award in one of the following areas: Elementary Earth Science Chemistry University member Middle School Science Biology Distinguished Service Physics Administrator Organization or Group Criteria for selection is based in part, but not limited to, the following: longevity or service, contribution to topic area, participation in MSTA and/or NSTA, presentation of workshops, improvement of fellow teachers and community service.

Nomination Form Name________________________________________ Award Area______________ Address_______________________________________________________________ Current Position ________________________________________________________ Name and address of the person making the nomination: Email address: ___________________________________________________________ Attach a 500 word or less statement of why you are making the nomination. This statement may include the nominee’s resume, educational background, teaching positions, awards and honors, leadership positions and professional activities. Nominations may be emailed. Send to Beth Thomas 601 Carol Drive

Great Falls, MT 59405 [email protected]


Mark Your Calendars

October 18-19, 2012: Billings MSTA Conference in conjunction with MEA-MFT November 1-3, 2012: Atlanta Regional Conference, NSTA December 6-8, 2012: Phoenix Regional Conference, NSTA


MSTA Officers Board of Directors President Beth Thomas Great Falls [email protected] President Elect Secretary Shannon Walden Ft. Benton [email protected] Treasurer Carol Pleninger Havre [email protected] Region 1 Karen Hutchison Kalispell [email protected] Region 2 Cynde Jacobsen Great Falls [email protected] Region 3 Diana Hedegaard Glasgow [email protected] Region 4 Kim Popham Belgrade [email protected] Region 5 Mariann Prewett Roundup [email protected] Region 6 David MacDonald Sidney [email protected] Advisory Board CheMST Steve Eversoll Kalispell [email protected] Biology Rep Tom Cubbage Great Falls [email protected] Earth Sci Rep Patrick McNelly Billings [email protected] Physics Daniel Baker Rosebud [email protected] Elementary Lucy Jensen Joliet [email protected] Middle School Rolland Karlin Big Timber [email protected] Post Secondary Mary Leonard Bozeman [email protected] Past President Shirley Greene Billings [email protected] BaP Walt Woolbaugh Manhattan [email protected]

emerging.jpg news journal · 2013 nasa space settlement design contest for students in grades 6 -...

Documents