neuron, volume 59 supplemental data posttranscriptional
TRANSCRIPT
Neuron, volume 59 Supplemental Data Posttranscriptional Regulation of BK Channel Splice Variant Stability by miR-9 Underlies Neuroadaptation to Alcohol Andrzej Z. Pietrzykowski, Ryan M. Friesen, Gilles E. Martin, Sylvie I. Puig, Cheryl L. Nowak, Patricia M. Wynne, Hava T. Siegelmann, and Steven N. Treistman
Supplementary Materials include:
1. A synopsis of additional mR-9 targets with references.
2. Supplementary Figures with legends.
3. Experimental Procedures with references.
4. A Primer Table.
1. A synopsis of additional miR-9 targets modulated by alcohol.
This synopsis contains a description of physiological roles, relevance to addiction and to BK, of
each miR-9 target.
CLOCK - Clock
CLOCK is an essential part of the mammalian circadian master clockwork. Product of CLOCK
gene works as a transcription activator in tandem with BMAL1 to control circadian oscillations
of certain genes (e.g. Per, Cry, Rev-Erb – which products are transcriptional repressors), thus
establishing cellular daily rhythmicity (Reppert and Weaver, 2002).
Chronic alcohol administration disrupts the internal clock (Chen et al., 2004). Moreover,
biological and behavioral sensitivity to alcohol varies throughout the circadian cycles (Ryabinin
et al., 2003), with important practical ramifications (drinking in the dark (Rhodes et al., 2005)).
In humans, alcohol consumption in shift workers (Trinkoff and Storr, 1998), and in people
suffering from jet lag (Rogers and Reilly, 2002) is increased. Relationship between alcohol and
cellular clock has been established for Per genes. In humans, alcohol alters circadian expression
pattern of Per genes (Spanagel et al., 2005b) while variations of the Per2 gene are associated
with regulation of alcohol consumption (Spanagel et al., 2005a). Alcohol’s effect on CLOCK
gene expression is unknown, however CLOCK gene knock-out mice show an increase in cocaine
reward (McClung et al., 2005).
BK α regulates daily oscillation of the central pacemaker (Meredith et al., 2006). In
return, the intrinsic circadian clock controls expression of BK α (Meredith et al., 2006), which
exhibits daily rhythmicity (Pitts et al., 2006).
Here, we provide evidence that CLOCK gene transcript is substantially and rapidly
downregulated by alcohol, indicating a potential, additional alcohol-relevant mechanism of
regulation of both circadian rhythms, and BK α expression, via miR-9.
NOX4 - NADPH oxidase 4
NOX4 is a catalytic subunit of an enzyme producing reactive oxygen species (ROS) (Bedard and
Krause, 2007), which belongs to a family of enzymatic proteins regulating gene expression,
posttranslational protein modifications, cellular signaling and differentiation. Increased NOX
activity contributes to a large number of pathologies, in particular, cardiovascular diseases and
neurodegeneration (Infanger et al., 2006).
In vascular smooth muscle ROS produced by NOX impair BK channel function (Tang
et al., 2004) by inducing a decrease in BK current caused by both, diminished BK current density
and decreased channel activity (Soto et al., 2002). In the CNS, the effect of increased NADPH
oxidase activity and enhanced production of ROS on the BK channel has not been tested,
however, alcohol ingestion rapidly increases activity of that enzyme and production of ROS
(Wang et al., 2007). Here, we show that, in the CNS, NOX4 gene expression is rapidly
upregulated by alcohol suggesting a novel, miR-9 based mechanism contributing to increased
NADPH oxidase activity, and possible novel regulation of BK α function in neurons.
TGFBR2 - transforming growth factor β2 receptor
TGFBR2 is a receptor binding transforming growth factor. In the CNS TGF functions as a
pleiotropic transcription factor inducing neuroprotective mechanisms (Vivien and Ali, 2006).
Alcohol affects TGF β receptor expression during development (Miller, 2003). We observed that
brief alcohol exposure increased TGFBR2 gene expression in adult rat brain. The specific link
between TGFBR2 and BK remains to be established.
DRD2 - dopamine receptor D2
DRD2 is one of the main receptors binding dopamine (a major neurotransmitter of the reward
system (Kauer and Malenka, 2007)) expressed abundantly in the CNS. Multiple studies indicate
that DRD2 mutations predispose to alcoholism (Bice et al., 2008; Connor et al., 2002).
Reduction in DRD2 expression is linked to higher risk of developing addictive behaviors (Klein
et al., 2007; Noble, 2003) including alcohol abuse (Volkow et al., 1996). Alcohol also alters
alternative splicing of the DRD2 gene product (Oomizu et al., 2003). A specific link between
DRD2 and BK is unknown yet. Our data indicate a possible involvement of miR-9 based
mechanisms in the alcohol regulation of DRD2 splice variants.
HDAC5 - histone deacetylase 5
HDAC5 belongs to class II histone deacetylases (together with Hdac4 and Hdac7). An
epigenetic mechanism of histone acetylation mediated by members of this class allows for
translation of environmental cues into permanent cellular processes, and recently has been
indicated to play a key role in the behavioral response to cocaine (Renthal et al., 2007). Exposure
to cocaine decreases function of Hdac5 in the CNS allowing for increased histone acetylation,
relaxation of chromatin and transcription of Hdac5 target genes.
Expression of the BK channel is also under epigenetic control. Recently, it has been
shown that increased histone acetylation induces BK gene expression and mimics tolerance in
fruit flies (Wang et al., 2007), however a specific link between HDAC4 and BK needs to be
better understood. Here, we show that, in the CNS, HDAC4 gene expression is rapidly
downregulated by alcohol suggesting a possible link between two epigenetic mechanisms:
control of gene transcription by deacetylase-regulated histone modification and control of gene
product stability by miRNA.
SYNJ1 - synaptojanin 1
SYNJ1 is a major, constitutively active phosphatase (Woscholski et al., 1997), predominantly
expressed in the CNS (Nemoto et al., 2001), and concentrated in nerve terminals, where it has
been implicated in regulating synaptic vesicle recycling and actin function. Recently, SYNJ1 has
been identified by array analysis, as a new alcohol target gene (Uddin and Singh, 2007). Our
data indicate that alcohol, possibly via miR-9, regulates SYNJ1 gene expression and thus could
modulate pre-synaptic processes.
GABRB2 - β2 subunit of gamma-aminobutyric acid (GABA) A receptor
GABRB2 is one of two main classes of a multisubunit chloride channel that mediates fast
inhibitory, GABA-based, synaptic transmission in the CNS. Human genetic studies suggest that
the GABRB2 gene has an important role in the development of alcohol dependence (Loh and
Ball, 2000). GABRB2 activity in presynaptic terminals is controlled by alcohol (Zhu and
Lovinger, 2006) and regulates behavioral sensitivity to alcohol (Ariwodola and Weiner, 2004).
Although a specific link between GABRB2 and BK is unknown, interestingly they both inhibit
the release of neurotransmitters from presynaptic terminals. Our data indicate that miR-9 could
play an important role in alcohol regulation of presynaptic neurotransmitter release.
CACNB1 - β1 subunit of voltage-dependent calcium channel
Auxiliary β1 subunit of calcium channel is differentially expressed with the L-type calcium
channel in various tissues, including the CNS (Cens et al., 1999). L-type calcium channels allow
calcium entry into neurons and regulate firing patterns, gene expression, differentiation and
presynaptic release of neurotransmitters (Dunlap et al., 1994;Ghosh and Greenberg, 1995).
Alcohol targets the L-type calcium channels (Knott et al., 2002) and modulates neurotransmitter
release (Knott et al., 2002).
Relationship between L-type calcium channel and BK channel is well established. They
form a functional dyad important in e.g. shaping of action potentials in some neurons (Sun et al.,
2003), and in regulating secretion from neuroendocrine cells (Marcantoni et al., 2007).
Moreover, β1 subunit of calcium channel has been recently shown to bind directly to the BK
channel and to modulate its gating (Zou et al., 2008).
Our data indicate a novel mechanism, possibly involving miR-9, of alcohol regulation of
L-type calcium and BK channels.
PPARA - peroxisome proliferator activated receptor α
PPARA is a nuclear steroid receptor, which heterodimerizes with retinoid-X receptor (RXR),
and functions as a ligand-activated transcription factor. PPARA plays a pivotal role in lipid
metabolism and can be found in hepatocytes, and in the CNS in oligodendrocytes, major lipid-
producing glia cells (Cullingford et al., 1998). PPAR expression level and activity in these and
other cells is regulated by alcohol (Venkata et al., 2008). Impairment of PPARA function during
alcohol consumption contributes to the development of alcoholic fatty liver (Fischer et al., 2003),
which is ameliorated by PPARA activation (Nanji et al., 2004). PPARA is also expressed in
neurons, where it is important for their differentiation (Bento-Abreu et al., 2007;Cimini et al.,
2005). Our data point to a potential new mechanism of alcohol regulation of lipid metabolism in
the CNS via miR-9.
KCNMB2 - β2 subunit of BK channel
KCNMB2 encodes a regulatory β subunit of BK channel expressed in the brain (Brenner et al.,
2000), which regulates several BK channel properties: it increases BK calcium sensitivity (Orio
and Latorre, 2005), rapidly inactivates the channel (Savalli et al., 2007) and decreases its surface
expression (Zarei et al., 2007). Its role in the development of alcohol addiction is unknown.
Our results suggest a novel, miR-9 based mechanism of alcohol regulation of the BK channel by
this subunit.
References list:
1. Ariwodola,O.J. and Weiner,J.L. (2004). Ethanol potentiation of GABAergic synaptic transmission may be self-limiting: role of presynaptic GABA (B) receptors. Journal of Neuroscience 24, 10679-10686.
2. Bedard,K. and Krause,K.H. (2007). The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev. 87, 245-313.
3. Bento-Abreu,A., Tabernero,A., and Medina,J.M. (2007). Peroxisome proliferator-activated receptor-alpha is required for the neurotrophic effect of oleic acid in neurons. J.Neurochem. 103, 871-881.
4. Bice,P.J., Liang,T., Zhang,L., Strother,W.N., and Carr,L.G. (2008). Drd2 expression in the high alcohol-preferring and low alcohol-preferring mice. Mamm.Genome 19, 69-76.
5. Brenner,R., Jegla,T.J., Wickenden,A., Liu,Y., and Aldrich,R.W. (2000). Cloning and functional characterization of novel large conductance calcium-activated potassium channel beta subunits, hKCNMB3 and hKCNMB4. J Biol Chem. 275, 6453-6461.
6. Cens,T., Restituito,S., and Charnet,P. (1999). Regulation of Ca-sensitive inactivation of a 1-type Ca2+ channel by specific domains of beta subunits. FEBS Lett. 450, 17-22.
7. Chen,C.P., Kuhn,P., Advis,J.P., and Sarkar,D.K. (2004). Chronic ethanol consumption impairs the circadian rhythm of pro-opiomelanocortin and period genes mRNA expression in the hypothalamus of the male rat. J.Neurochem. 88, 1547-1554.
8. Cimini,A., Benedetti,E., Cristiano,L., Sebastiani,P., D'Amico,M.A., D'Angelo,B., and Di Loreto,S. (2005). Expression of peroxisome proliferator-activated receptors (PPARs) and retinoic acid receptors (RXRs) in rat cortical neurons. Neuroscience 130, 325-337.
9. Connor,J.P., Young,R.M., Lawford,B.R., Ritchie,T.L., and Noble,E.P. (2002). D (2) dopamine receptor (DRD2) polymorphism is associated with severity of alcohol dependence. Eur.Psychiatry 17, 17-23.
10. Cullingford,T.E., Bhakoo,K., Peuchen,S., Dolphin,C.T., Patel,R., and Clark,J.B. (1998). Distribution of mRNAs encoding the peroxisome proliferator-activated receptor alpha, beta, and gamma and the retinoid X receptor alpha, beta, and gamma in rat central nervous system. J.Neurochem. 70, 1366-1375.
11. Dunlap,K., Luebke,J.I., and Turner,T.J. (1994). Identification of calcium channels that control neurosecretion. Science 266, 828-831.
12. Fischer,M., You,M., Matsumoto,M., and Crabb,D.W. (2003). Peroxisome proliferator-activated receptor alpha (PPARalpha) agonist treatment reverses PPARalpha dysfunction and abnormalities in hepatic lipid metabolism in ethanol-fed mice. Journal of Biological Chemistry 278, 27997-28004.
13. Ghosh,A. and Greenberg,M.E. (1995). Calcium signaling in neurons: molecular mechanisms and cellular consequences. Science 268, 239-247.
14. Infanger,D.W., Sharma,R.V., and Davisson,R.L. (2006). NADPH oxidases of the brain: distribution, regulation, and function. Antioxid.Redox.Signal. 8, 1583-1596.
15. Kauer,J.A. and Malenka,R.C. (2007). Synaptic plasticity and addiction. Nat.Rev.Neurosci. 8, 844-858.
16. Klein,T.A., Neumann,J., Reuter,M., Hennig,J., von Cramon,D.Y., and Ullsperger,M. (2007). Genetically determined differences in learning from errors. Science 318, 1642-1645.
17. Knott,T.K., Dopico,A.M., Dayanithi,G., Lemos,J., and Treistman,S.N. (2002). Integrated channel plasticity contributes to alcohol tolerance in neurohypophysial terminals. Mol.Pharmacol. 62, 135-142.
18. Loh,E.W. and Ball,D. (2000). Role of the GABA (A)beta2, GABA (A)alpha6, GABA (A)alpha1 and GABA (A)gamma2 receptor subunit genes cluster in drug responses and the development of alcohol dependence. Neurochem.Int. 37, 413-423.
19. Marcantoni,A., Baldelli,P., Hernandez-Guijo,J.M., Comunanza,V., Carabelli,V., and Carbone,E. (2007). L-type calcium channels in adrenal chromaffin cells: role in pace-making and secretion. Cell Calcium 42, 397-408.
20. McClung,C.A., Sidiropoulou,K., Vitaterna,M., Takahashi,J.S., White,F.J., Cooper,D.C., and Nestler,E.J. (2005). Regulation of dopaminergic transmission and cocaine reward by the Clock gene. Proc.Natl.Acad.Sci.U.S.A 102, 9377-9381.
21. Meredith,A.L., Wiler,S.W., Miller,B.H., Takahashi,J.S., Fodor,A.A., Ruby,N.F., and Aldrich,R.W. (2006). BK calcium-activated potassium channels regulate circadian behavioral rhythms and pacemaker output. Nat.Neurosci. 9, 1041-1049.
22. Miller,M.W. (2003). Expression of transforming growth factor-beta in developing rat cerebral cortex: effects of prenatal exposure to ethanol. J.Comp Neurol. 460, 410-424.
23. Nanji,A.A., Dannenberg,A.J., Jokelainen,K., and Bass,N.M. (2004). Alcoholic liver injury in the rat is associated with reduced expression of peroxisome proliferator-alpha (PPARalpha)-regulated genes and is ameliorated by PPARalpha activation. J.Pharmacol.Exp.Ther. 310, 417-424.
24. Nemoto,Y., Wenk,M.R., Watanabe,M., Daniell,L., Murakami,T., Ringstad,N., Yamada,H., Takei,K., and De Camilli,P. (2001). Identification and characterization of a synaptojanin 2 splice isoform predominantly expressed in nerve terminals. Journal of Biological Chemistry 276, 41133-41142.
25. Noble,E.P. (2003). D2 dopamine receptor gene in psychiatric and neurologic disorders and its phenotypes. Am.J.Med.Genet.B Neuropsychiatr.Genet. 116, 103-125.
26. Oomizu,S., Boyadjieva,N., and Sarkar,D.K. (2003). Ethanol and estradiol modulate alternative splicing of dopamine D2 receptor messenger RNA and abolish the inhibitory
action of bromocriptine on prolactin release from the pituitary gland. Alcohol Clin.Exp.Res. 27, 975-980.
27. Orio,P. and Latorre,R. (2005). Differential effects of beta 1 and beta 2 subunits on BK channel activity. J.Gen.Physiol 125, 395-411.
28. Pitts,G.R., Ohta,H., and McMahon,D.G. (2006). Daily rhythmicity of large-conductance Ca2+ -activated K+ currents in suprachiasmatic nucleus neurons. Brain Res. 1071, 54-62.
29. Renthal,W., Maze,I., Krishnan,V., Covington,H.E., III, Xiao,G., Kumar,A., Russo,S.J., Graham,A., Tsankova,N., Kippin,T.E., Kerstetter,K.A., Neve,R.L., Haggarty,S.J., McKinsey,T.A., Bassel-Duby,R., Olson,E.N., and Nestler,E.J. (2007). Histone deacetylase 5 epigenetically controls behavioral adaptations to chronic emotional stimuli. Neuron 56, 517-529.
30. Reppert,S.M. and Weaver,D.R. (2002). Coordination of circadian timing in mammals. Nature 418, 935-941.
31. Rhodes,J.S., Best,K., Belknap,J.K., Finn,D.A., and Crabbe,J.C. (2005). Evaluation of a simple model of ethanol drinking to intoxication in C57BL/6J mice. Physiol Behav. 84, 53-63.
32. Rogers,H.L. and Reilly,S.M. (2002). A survey of the health experiences of international business travelers. Part One--Physiological aspects. AAOHN.J. 50, 449-459.
33. Ryabinin,A.E., Galvan-Rosas,A., Bachtell,R.K., and Risinger,F.O. (2003). High alcohol/sucrose consumption during dark circadian phase in C57BL/6J mice: involvement of hippocampus, lateral septum and urocortin-positive cells of the Edinger-Westphal nucleus. Psychopharmacology (Berl) 165, 296-305.
34. Savalli,N., Kondratiev,A., de Quintana,S.B., Toro,L., and Olcese,R. (2007). Modes of operation of the BKCa channel beta2 subunit. J.Gen.Physiol 130, 117-131.
35. Soto,M.A., Gonzalez,C., Lissi,E., Vergara,C., and Latorre,R. (2002). Ca (2+)-activated K+ channel inhibition by reactive oxygen species. Am.J.Physiol Cell Physiol 282, C461-C471.
36. Spanagel,R., Pendyala,G., Abarca,C., Zghoul,T., Sanchis-Segura,C., Magnone,M.C., Lascorz,J., Depner,M., Holzberg,D., Soyka,M., Schreiber,S., Matsuda,F., Lathrop,M., Schumann,G., and Albrecht,U. (2005a). The clock gene Per2 influences the glutamatergic system and modulates alcohol consumption. Nat.Med. 11, 35-42.
37. Spanagel,R., Rosenwasser,A.M., Schumann,G., and Sarkar,D.K. (2005b). Alcohol consumption and the body's biological clock. Alcohol Clin.Exp.Res. 29, 1550-1557.
38. Sun,X., Gu,X.Q., and Haddad,G.G. (2003). Calcium influx via L- and N-type calcium channels activates a transient large-conductance Ca2+-activated K+ current in mouse neocortical pyramidal neurons. Journal of Neuroscience 23, 3639-3648.
39. Tang,X.D., Garcia,M.L., Heinemann,S.H., and Hoshi,T. (2004). Reactive oxygen species impair Slo1 BK channel function by altering cysteine-mediated calcium sensing. Nat.Struct.Mol.Biol. 11, 171-178.
40. Trinkoff,A.M. and Storr,C.L. (1998). Work schedule characteristics and substance use in nurses. Am.J.Ind.Med. 34, 266-271.
41. Uddin,R.K. and Singh,S.M. (2007). Ethanol-responsive genes: identification of transcription factors and their role in metabolomics. Pharmacogenomics.J. 7, 38-47.
42. Venkata,N.G., Aung,C.S., Cabot,P.J., Monteith,G.R., and Roberts-Thomson,S.J. (2008). PPARα and PPARβ Are Differentially Affected by Ethanol and the Ethanol Metabolite Acetaldehyde in the MCF-7 Breast Cancer Cell Line. Toxicol.Sci. 102, 120-128.
43. Vivien,D. and Ali,C. (2006). Transforming growth factor-beta signalling in brain disorders. Cytokine Growth Factor Rev. 17, 121-128.
44. Volkow,N.D., Wang,G.J., Fowler,J.S., Logan,J., Hitzemann,R., Ding,Y.S., Pappas,N., Shea,C., and Piscani,K. (1996). Decreases in dopamine receptors but not in dopamine transporters in alcoholics. Alcohol Clin.Exp.Res. 20, 1594-1598.
45. Wang,Q., Sun,A.Y., Simonyi,A., Kalogeris,T.J., Miller,D.K., Sun,G.Y., and Korthuis,R.J. (2007). Ethanol preconditioning protects against ischemia/reperfusion-induced brain damage: role of NADPH oxidase-derived ROS. Free Radic.Biol.Med. 43, 1048-1060.
46. Wang,Y., Krishnan,H.R., Ghezzi,A., Yin,J.C., and Atkinson,N.S. (2007). Drug-induced epigenetic changes produce drug tolerance. PLoS.Biol. 5, 2342-2353.
47. Woscholski,R., Finan,P.M., Radley,E., Totty,N.F., Sterling,A.E., Hsuan,J.J., Waterfield,M.D., and Parker,P.J. (1997). Synaptojanin is the major constitutively active phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase in rodent brain. Journal of Biological Chemistry 272, 9625-9628.
48. Zarei,M.M., Song,M., Wilson,R.J., Cox,N., Colom,L.V., Knaus,H.G., Stefani,E., and Toro,L. (2007). Endocytic trafficking signals in KCNMB2 regulate surface expression of a large conductance voltage and Ca (2+)-activated K+ channel. Neuroscience 147, 80-89.
49. Zhu,P.J. and Lovinger,D.M. (2006). Ethanol potentiates GABAergic synaptic transmission in a postsynaptic neuron/synaptic bouton preparation from basolateral amygdala. J.Neurophysiol. 96, 433-441.
50. Zou,S., Jha,S., Kim,E.Y., and Dryer,S.E. (2008). The beta 1 subunit of L-type voltage-gated Ca2+ channels independently binds to and inhibits the gating of large-conductance Ca2+-activated K+ channels. Mol.Pharmacol. 73, 369-378.
2. Supplementary Figures with legends
Supplementary Figure S1. BK alternative splicing – individual splice sites. (A) Schematic of
BK constitutive and alternatively spliced exons (numbered sequentially) within the coding
sequence as determined from reference (Beisel et al., 2007) and rat genome. Specific end-point
PCR primers flanking each alternatively spliced site (X1-6) were designed to give a shorter PCR
product (if the alternative exon is spliced out) or a longer product (if the exon is spliced in).
SON from alcohol-naïve HNS explants were isolated, RNA extracted, reverse transcribed and
subjected to PCR. (B) PCR products were run on 2% or 4% agarose gel. Red asterisks indicate
PCR products found. Cloning and sequencing of each band reveals that alternative splicing is
present at only 3 sites: X3 (+/- exon 19), X4 (+/- exon 22 and/or 23) and X6 (+/- exon 29).
Between 8 and 18 clones per individual site were isolated and sequenced.
Supplementary Figure S2. Alcohol downregulation of BK mRNA is post-transcriptional.
Actinomycin D binds to double-stranded DNA and blocks the movement of RNA polymerase,
thereby interfering with DNA-dependent RNA transcription. Actinomycin D (10 µg/µL) has no
effect on BK mRNA levels. In contrast, 20 mM alcohol added during transcriptional blockage
with Actinomycin D (10 µg/µL) downregulates BK mRNA expression similarly to 20 mM
alcohol alone after just 15 min exposure. BK values as in Figure 1. *P < 0.05 (Welch-Aspin t-
test).
Supplementary Figure S3. Characterization of BK mRNA detection system. (A) Gel
analysis of the real-time PCR (qRT-PCR) products shows single bands of the correct size for
each qRT-PCR amplicon used, thus indicating that each amplicon is specific for its target. NoRT
– No Reverse Transcriptase Control. (B) An example of the amplification plot of the cDNA BK
plasmid used to create a standard curve necessary for the calculations of the relative quantitation.
Initial input - 2.4 pg of the cDNA plasmid (here - STREX) with four 1:10 dilutions. Note that
samples were run in triplicate. (C) The log of the known amounts of cDNA plasmid from (B) is
plotted against Threshold Cycle (Ct).
Supplementary Figure S4. Characterization of miR-9 detection system. (A) Dissociation
curve of qRT-PCR product indicates that PCR primers specific for the mature form of miR-9
(Ambion, Austin, TX) amplify one product only. (B) The log of the known amounts of synthetic
miR-9 (s-miR-9, in molecules) is plotted against Ct value to determine the number of miR-9 in
single neurons. The number of miR-9 molecules (a) was calculated by the formula: a = x * N,
where x = miR-9 amount in moles, N = Avogadro number (6.02 * 1023 molecules). Samples run
in duplicate.
Supplementary Figure S5. Pairwise alignment of BK 3’UTR-2.1 and 3’UTR-2.2. The
alignment indicates that although 3’UTR-2.1 and 3’UTR-2.2 have a common module (light blue
box, 2B), the miR-9 MRE is located only on BK 3’UTR-2.1 module 2A. White arrows depict a
set of primers (see also Table S1) used to determine expression of 3’UTR-2.2.
Supplementary Figure S6. The BK nucleotide sequence of the last three exons (31, 32, 33)
of the coding sequence with the deduced amino-acid sequence and the 3’UTR-2.1 sequence.
The BK coding sequence (CDS) and the 3’ untranslated region (3’UTR) are indicated as is the
position of the 3’RACE BK-specific forward primer (light brown arrow, exon 31), the position
of the 3’UTR-2.1-unique PCR primers (dark brown arrows), the position of 3’UTR-2.1-unique
reverse primer for ALCOREX/3’UTR-2.1 experiment (green arrow), the miR-9 specific miRNA
Recognition Element (miR-9 MRE, orange), and two polyadenylation sites (PAS, red) flanking
miR-9 MRE. Nucleotides encoding the last eight unique amino acid residues are highlighted in
light blue. See also Table S1 for primer sequences.
Supplementary Figure S7. The BK nucleotide sequence of the last three exons (31, 32, 33)
of the coding sequence with the deduced amino-acid sequence and the 3’UTR-1.0 sequence.
Brown arrows depict a set of end-point primers (see also Table S1) used to determine expression
of 3’UTR-1.0. Nucleotides encoding the last eight unique amino acid residues are highlighted in
light blue.
Supplementary Figure S8. The BK nucleotide sequence of the last four exons (31, 32, 34,
35) of the coding sequence with the deduced amino-acid sequence and the 3’UTR-2.2
sequence. Brown arrows depict a set of end-point primers (see also Table S1) used to determine
expression of 3’UTR-2.2. Nucleotides encoding the last eight unique aminoacid residues are
highlighted in light blue.
Supplementary Figure S9. miR-9 MRE is conserved among rodents and humans. Multiple
sequence alignment of the rat (Rattus Norvegicus, AF_135265), the mouse (Mus musculosum,
NM_010610) and the human (Homo sapiens, NM_001014797) BK 3’ UTRs indicate a high
degree of inter-species complementarity. Rat 3’UTR-2.1 was used in the alignment. Both
mRNAs and miR-9 mismatches are irrelevant for mRNA:miR-9 binding. miR-9 nucleotides
which do not pair with mRNA are black. ClustalW program was used for multiple sequence
alignment and GeneDoc program was used for shading: nucleotides of 100% identity are marked
by black background, 66% - gray background, 33% - white background. miR-9 seed sequence is
depicted by the red box.
3. Experimental Procedures
Explant preparation and culture
Male Sprague Dawley adult rats (4–9 weeks old) were obtained from Taconic Farms
(Germantown, NY). All procedures were performed in accordance with the National Institutes of
Health guidelines on the Care and Use of Animals and study protocol approved by the University
of Massachusetts Medical School Animal Care and Use Committee. Explants were prepared as
previously described (Pietrzykowski et al., 2004). Animals were quickly decapitated, the brain
with intact pituitary stalk and the whole pituitary were removed very rapidly from the skull and
chilled in oxygenated dissection buffer (in mM): 120 NaCl, 5 KCl, 1.0 MgCl2, 1.9 CaCl2, 2.0
EGTA, 10 HEPES, 5.0 NaHCO3, 15.0 glucose, 0.5 glutamine (Glutamax; Invitrogen,
Gaithersburg, MD), 100 U/ml to 0.1 mg/ml penicillin–streptomycin (Invitrogen), pH 7.2, 310
mOsm, containing also (1) low levels of free calcium (3 µM), (2) B27 supplement with
antioxidants (1:50; Invitrogen), and (3) 1 mM nitro-arginine and kynurenic acid to increase cell
survival. Next, the anterior pituitary was separated and removed from the posterior pituitary and
a hexagonal block of tissue was carved out (by cutting rostral to the optic chiasm, parallel to the
optic tract, lateral to the median eminence and caudal to the stalk, and undercutting at a depth of
1–2 mm) under a dissection microscope. Subsequently, tissue was trimmed to a final thickness of
550–650 µm to enable nutrient and oxygen penetration in spite of the lack of vascular perfusion.
Explants were cultured individually in a humidified incubator (99% relative humidity), at 37 °C,
in 5% CO2, on Millicell CM inserts (Millipore, Bedford, MA) placed in Petri dishes (60 mm;
Corning, Corning, NY). They were cultured in Neurobasal A medium (310 mOsm) with B27,
glutamine, penicillin–streptomycin (as in dissection buffer), and 10% fetal calf serum (FCS;
Sigma, St. Louis, MO) in the air-medium interface. On the next day after explant preparation,
medium was changed to medium containing 20 mM alcohol (alcohol exposure group). Two
groups were used as a control: 1) fresh - fixed immediately after isolation and 2) naïve – cultured
in alcohol-free medium. There were no differences between the control groups.
In transcription blockage experiments, water-soluble Actinomycin D (10 µg/µL, final
concentration, Sigma) was added to the culture medium for the indicated time.
Primary cultures of striatal neurons
Cultures of dissociated rat striatal neurons were prepared using a modification of a protocol
described by Leveque (Leveque et al., 2003). Postnatal day eight Sprague-Dawley rat pups were
decapitated, pup brains removed and immersed in ice-cold PBS. Next, striata were dissected,
transferred to Hanks Balanced Salt Solution (Gibco, Grand Island, NY) with 10 mM HEPES,
and dissociated using a fire-polished Pasteur pipette. Dissociated cells were transferred to the
plating medium (a 1:1 mix of F12 nutrient mixture (Gibco) and DMEM medium supplemented
with GlutaMAX,; 2.0 mM glutamine final concentration), 2% fetal bovine serum (Hyclone), 2%
B-27 (Gibco), 1% penicillin/streptomycin (Gibco). Cells in the plating medium were seeded out
onto 35 mm Petri dishes (Nunc, Rochester, NY) coated successively with 0.01% (w/v) poly-L-
ornithine (Sigma, St. Louis, MO) and 83 µg/ml mouse laminin (Invitrogen, Carlsbad, CA). 24
hours after plating, the plating medium was replaced with serum-free medium supplemented
with 2% B-27, 2.0 mM glutamine and 1% penicillin/streptomycin. Thereafter, the medium was
replaced weekly. All experiments were performed on neurons that were 14-21 days in culture.
Alcohol treatment
Explants - Constant alcohol concentration was obtained by placing an open dish with 20 mM
alcohol 1-2 inches apart from the dish containing the alcohol-exposed explant, in a closed, but
not sealed plastic bag, which allowed exchange of gases. Alcohol levels were measured in both
the media and the tissue, using a GM7Analyser (Analox Instruments Inc., MA) following
manufacturer's instructions. This treatment allowed for maintenance of a constant 20 mM alcohol
concentration for all exposure times tested (0.25, 0.5, 1, 6 and 24 hr).
Striatal cell culture - alcohol-free culturing medium was replaced with culturing medium pre-
mixed with 20 mM ethanol for the time indicated – 30 min. Within this short period of time, we
did not observe any alcohol loss from the medium.
RNA isolation
SON regions of fresh and alcohol-exposed HNS explants, as well as rapidly isolated brain
regions (cerebellum, striatum, hippocampus, prefrontal cortex) were homogenized with Trizol
(Invitrogen, Carlsbad, CA). Total RNA was isolated from homogenates following
manufacturer’s instructions, using Glycol Blue (Ambion, Austin, TX) to aid in visualization of
RNA precipitate. RNA quality (A260/280) and concentration was determined by a ND-1000
Spectrophotometer (NanoDrop, Wilmington, DE). Alternatively, SON regions were stored
appropriately in RNAlater (Ambion) and total RNA was isolated at a later time. Total RNA
aliquots were treated with RQ1 RNase-Free DNase (Promega, Madison, WI). First strand cDNA
was reverse transcribed from DNase-treated aliquots using the iScript cDNA Synthesis Kit
(BioRad, Hercules, CA) following manufacturer’s recommendations and stored at –20°C. To
determine the association of exons located in the protein coding region with 3’UTRs we used the
Iscript Select cDNA Synthesis Kit (BioRad), which allows to use custom-designed gene-specific
RT primers (GSP RT primer). For each 3’UTR, a GSP RT primer specific to this 3’UTR and
GSP RT primer for β-actin was added to a DNase-treated RNA. β-actin was used as an internal
loading control. RT extension time was increased to 120 min to allow for sufficient cDNA
product elongation.
End-point PCR, cloning and sequencing
End point PCR was performed on a 9700 Gene Amp PCR System (Applied Biosystems, Foster
City, CA). Primers were designed using IDT BioTools software (IDT, Coralville, PA). Primer
sequences are shown in Table S1. BLAST searches indicated specificity of all primers. Primers
were also checked for lack of secondary structure formation, ensuring optimal PCR efficiency
(IDT BioTools). PCRs were performed in a 50 µL final volume with a final concentration of 1 U
of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA). PCR conditions were as follows:
94°C, 1 min; 35 cycles of 94°C, 30 sec; 55°C, 30 sec; 72°C 1 min, followed by a final
extension time of 10 min at 72°C. PCR products were visualized on 2 - 4% low-melt
agarose/ethidium bromide gels.
For 3’UTR analysis gel densitometry was performed using a UVP BioImaging System
and the UVP ‘Labworks Image Acquisition and Analysis Software’ (UVP, Upland CA).
Agarose gel images were acquired and total fluorescence was determined in bands of interest.
Fluorescence of bands in distinct treatment groups (Fresh vs. 15’EtOH) were expressed relative
to the fresh group after normalization to ß-actin loading controls.
PCR specific bands underwent gel extraction (QIAquick Gel Extraction Kit, Qiagen,
Balencia, CA), subsequent ligation into the pCR II vector (Invitrogen, Carlsbad, CA), and
cloning with the TOPO® cloning system (Invitrogen). Around 12 clones per individual site were
isolated and sequenced, while total of 54 clones (28 – no alcohol exposure, 26 – 24 hrs 20 mM
alcohol exposure) was isolated and sequenced using primers bracketing X3-6 sites. Cloning
products were sequenced from both directions using T3 and T7 sequencing primers (automated
fluorescent DNA sequencing, Applied Biosystems 3100 sequencer, Nucleic Acid Facility,
University of Massachusetts Medical School, Worcester, MA).
3’RACE
To determine the 3’end of BK mRNA, including the 3’ untranslated region (3’UTR), 3’RACE -
Rapid Amplification of cDNA Ends - was used following manufacturer’s instructions
(GeneRacer™ Kit, Invitrogen). RNA aliquots were reverse transcribed using GeneRacer™ Oligo
dT Primer (Table S1) in the presence of SuperScript™ III RT (10 U/µL final concentration,
Invitrogen) and RNaseOut™ (2 U/µL final concentration, Invitrogen). Reverse transcription
conditions were as follows: incubation at 55°C for 60 min, inactivation at 70°C for 15 min.
Reverse transcription products were treated with RNase H (0.1 U/µL final concentration,
Invitrogen) and stored at – 20°C for further analysis. The PCR reaction was performed using
Platinum® Taq DNA Polymerase High Fidelity (0.05 U/µL final concentration, Invitrogen), BK-
specific 3’RACE primer (Table S1) and GeneRacer™ 3’ primer (Table S1). 3’-RACE PCR
conditions were as follows: 94°C, 2 min; 5 cycles of 94°C, 5 sec; 72°C, 3 min; 5 cycles of 94°C,
5 sec; 70°C, 10 sec; 72°C, 3 min; 25 cycles of 94°C, 5 sec; 68°C, 10 sec, 72°C, 3 min; followed
by 10 min at 72°C of the final extension time. If necessary nested 3’RACE PCR was performed
using Platinum® Taq DNA Polymerase High Fidelity (0.05 U/µL final concentration,
Invitrogen), BK-specific 3’RACE nested primer and GeneRacer™ 3’ nested primer. 3’-RACE
nested PCR conditions were as follows: 94°C, 2 min; 25 cycles of 94°C, 5 sec; 68°C, 10 sec,
72°C, 3 min; followed by 10 min at 72°C. PCR products were run on a 1% agarose/ethidium
bromide gel. Bands were gel extracted, cloned into pCR® 4-TOPO® vector (Invitrogen), and
sequenced as above.
Plasmid preparation
p-VAX vector with rat BK-STREX, but no ALCOREX was a kind gift of Dr. D. McCobb
(Cornell University, Ithaca, NY). pGEMHE-nbc vector with rat BK-27+ exon (=ALCOREX) and
without STREX was a kind gift of Dr. S.C. Park (Kwangju Institute of Science and Technology,
Korea). BK-27+ cDNA was subcloned into p-VAX. The insertless BK variant was prepared by
replacing ALCOREX exon with the “ZERO” fragment cut out from the BK-STREX plasmid,
using SEXA I and Sfi I restriction sites upstream and downstream of the ALCOREX exon,
respectively. Each gene construct was verified by DNA sequencing.
Real-time PCR: BK
TAMRA-based Real-time PCR was used to quantify (Bustin, 2002; Wong and Medrano, 2005)
and to determine the time course of expression of total BK mRNA (regardless of splice variants),
ALCOREX-, and STREX-exon carrying mRNA splice variants, to quantify the amount of each
3’UTR, and to determine the association of exons located within the protein encoding region of
mRNA with each 3’UTR. β-actin mRNA is unaffected by acute and chronic alcohol exposure in
neuronal tissue (Nakahara et al., 2002; Newton et al., 2005) and was used as an endogenous
control to accurately calculate expression of the mRNA of interest. No-reverse transcriptase
(NoRT) and no-template controls were routinely included. All amplicons (the primers and
probes) are described in Table S1. Primers and probes were checked for lack of secondary
structure formation ensuring optimal PCR efficiency (IDT BioTools). Probes were synthesized to
have their 5’ end labeled with the reporter dye FAM and 3’ end with the quencher TAMRA
(IDT). A standard curve for each amplicon was generated from dilution series of known
amounts of plasmids carrying the different BK variants (Insertless, STREX, ALCOREX). Each
dilution point was measured in triplicate, and the average Ct (the threshold cycle) for each point
was plotted on the y axis against the logarithm of input amount of standard material. All
amplicons were checked for validity and specificity - all showed near-perfect PCR amplification
efficiency (Standard Curve Slopes: total-BK –3.228, STREX –2.917, ALCOREX –3.275) and a
single PCR product on gel electrophoresis. For determination of the association between exons
located within protein encoding region and 3’UTRs, exon specific amplicons were used after
3’UTR specific reverse transcription (see above). PCR conditions were as follows: 95 OC for
2min, followed by 40 cycles of 95 OC, 15 sec 56 OC for 15 sec, and 65 OC for 34 sec. Reactions
were performed in a 25 µL final volume, using Real Time Master Mix Probe with ROX
(Eppendorf, Westbury, NY), on an ABI Prism 7500 PCR System (Applied Biosystems). The
Standard Curve method for Relative Quantitation was utilized for all mRNA experiments
because of the unknown efficiency of reverse transcriptase.
Each sample was normalized by using an appropriate standard curve to calculate both, β-
actin and target amount, then attaining a target/β-actin ratio. Error bars in each treatment group
were generated by calculating the SEM of normalized data. Next, SEM values were applied to
the Relative Quantification data by calculating the percentage of the average normalized value
they consisted.
Real-time PCR: additional targets
Additional miR-9 targets were selected using TargetScan (Grimson et al., 2007). In this program
targets of particular miRNA are scored to reflect a probability of their regulation by this miRNA.
A more negative score indicates higher probability of regulation. From the total list of 826 miR-9
targets (score ranging from -0.78 to 0.03) we focused on the upper half of targets, which have
higher regulation probability (413 targets, score up to -0.17), and compiled a list of targets
(totaling twelve) with documented relevance to alcohol and brain expression in a biomedical
literature (PubMed). Next, SYBR-GREEN-based Real-Time PCR was used to quantify the
alcohol regulation of the expression level of these twelve miR-9 targets. An example of an
alcohol-relevant target of lower regulation probability (PRKCA, score -0.04) and a gene with no
miR-9 MRE (KCNMB1) were used as “no effect” controls. No-reverse transcriptase and no-
template controls were included. Primers were designed to span introns to avoid false positive
results from genomic DNA, to ensure optimal PCR efficiency (lack of secondary structure
formation, IDT BioTools), and their specificity (IDT BioTools, single pick of the melting curve).
All primers are described in Table S1. PCR conditions were as follows: 95 OC, 10 min, followed
by 40 cycles of 95 OC, 15 sec; 56 OC for 15sec, 60 OC for 34 sec. Reactions were performed in a
25 µL final volume, using SYBR Green PCR Master Mix (Real Time Master Mix Probe with
ROX (Eppendorf, Westbury, NY), on an ABI Prism 7500 PCR System (Applied Biosystems).
Each gene product was normalized to β-actin, and expressed as a ratio to the basal (= before
alcohol exposure) expression level of that product. Alcohol effect on the expression of each gene
product was categorized into seven groups based on the change of the expression level: +/- 25%
(no effect), 26-50% upregulation (+), 51-75% upregulation (+ +), 76-100% upregulation (+ + +),
26-50% downregulation (-), 51-75% downregulation (- -), 76-100% downregulation (- - -)
(Table 1).
Real-time PCR: miRNA
Small RNA species (including miRNAs) are effectively isolated along with the total RNA in the
Trizol isolation procedure. Relative expression levels of individual, mature miRNAs were
determined using miRNA specific primers (#17100, Ambion, Austin, TX) with Ambion’s
mirVana qRT-PCR miRNA Detection Kit, following manufacturer’s instructions. A dilution of
total RNA was created to reach a 25ng/µl final concentration and 1µl was used as a template.
mirVana specific reverse transcription and PCR were performed on the Applied Biosystems
9700 Gene Amp PCR System, and ABI Prism 7500 PCR System (Applied Biosystems)
respectively. PCR cycling conditions were as follows: 40 cycles of 95°C, 3 min; 95°C, 15 sec,
60°C, 34 sec. Dissociation analysis (a melting curve) was always included to ensure the
amplification of a single product. To determine the expression of miR-9 we used the known
amounts of synthetic miR-9 (s-miR-9, in molecules) creating standard dilutions (Figure S4).
These amounts were plotted against Ct value to determine the number of miR-9 in single
neurons. Because, in this method both samples and standards are RNA species, data can be
accurately expressed as absolute values. The number of miR-9 molecules (a) was calculated by
the formula: a = x * N, where x = miR-9 amount in moles, N = Avogadro number (6.02 * 1023
molecules). All miRNA levels were normalized to the endogenous control - 5S rRNA.
Single-cell, real-time PCR
Single-cell PCR determination of miRNA and BK exons was performed in RNase-free
conditions on SON magnocellular neurons dissociated from coronal SON slices and striatal
medium spiny neurons (see primary striatal neuronal culture) and as described elsewhere
(Martin, 2004). Briefly, after decapitation, the brains were rapidly transferred into a cold (4oC)
oxygenated, low-calcium HEPES-buffered salt solution (in mM): 234 sucrose, 2.5 KCl, 2
NaH2PO4, 11 glucose, 4 MgSO4, 2 CaCl2, 1.5 HEPES and cut into coronal slices on a vibratome
(World Precision Instruments, Sarasota, FL). The SON was punched out from the slices under
the dissecting microscope in a gassed (95% O2 and 5% CO2) NaHCO3-buffered saline solution
(mM): 116.4 NaCl, 1.8 CaCl2, 0.4 MgSO4, 5.36 KCl, 0.89 NaH2PO4, 5.5 glucose, 24.0 NaHCO3,
100.0 glutathione, 1.0 nitro-arginine, 1.0 kynurenic acid, pH 7.35, 300-305 mOsm/l. The SON
punches underwent brief enzymatic digestion with protease XIV (1 mg/ml, Sigma) in an
oxygenated (100% O2 with constant stirring) HEPES-buffered solution in the inner chamber of a
Cell-Stirr flask (Wheaton, Millville, NJ USA) containing (in mM): 136 NaCl, 0.44 KH2PO4, 2.2
KCl, 0.35 NaH2PO4, 5.5 Glucose, 10 HEPES, 100 glutathione, 1 nitro-arginine and 1 kynurenic
acid (pH = 7.35 with NaOH, 300-305 mOsm). SON neurons were next isolated by mechanical
trituration with fire-polished Pasteur pipettes of successively smaller tip diameters. Neurons were
plated into a 35 mm Petri dish, and allowed to attach to the dish for 10 min before replacing the
Na+-isethionate solution with normal external solution (in mM): 142 NaCl, 2 KCl, 1 CaCl2, 23
glucose, 15 HEPES, 10 glucose (pH = 7.35 with NaOH, osmolarity 300 mOsm/l). Cells (n = 1, 3,
5) were harvested based on their characteristic SON magnocellular neuron morphology (large
cell bodies, thin, long, tempering out processes, Figure 4B), or in case of striatal culture, medium
spiny neurons morphology (small cell bodies, multiple thin processes, Figure 4C). Neurons were
aspirated into the recording pipettes prepared from pre-baked glass capillaries, cleaned further
with the DEPC-treated water to ensure the absence of RNAases. The pipette content was
expelled into a centrifuge tube containing 5µl of DEPC water, Rnasin (40,000 U/ml, Promega),
and DTT (0.1M, Invitrogen, 10µl final volume), and used immediately for RT-PCR experiments.
HEK cell transfection
Cells from the Human Embryonic Kidney cell line (HEK293 cells) were cultured in DMEM
medium supplemented with 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin G,
100 µg/mL streptomycin sulfate, and 25 mM HEPES (all supplies from Invitrogen), and plated
onto 25 cm2 flasks. The cells were maintained in a 5% CO2, humidified incubator (99% relative
humidity) at 37ºC. HEK293 cells to be transfected were split from confluent cultures and were
plated on 60 mm Petri dishes. In both, miRNA experiments and in functional,
electrophysiological experiments determining alcohol effects on BK variants activity, 50-70%
confluent cells were transfected using PolyFect transfection reagent (Qiagen,Balencia, CA)
complexed with BK variants (BK-Insertless, BK-ALCOREX, BK-STREX) in pVAX vector
(Invitrogen) cDNAs.
In miRNA experiments, BK 3’UTR+/- plasmids (0.0442 fmol/well) were transfected
alone, or with one of two miRNA precursors: miR-9 and miR-135b (200 pmol/well). BK mRNA
was isolated for quantitation 24 hours after transfection.
In functional experiments cells were co-transfected with a BK variant (BK-ALCOREX,
BK-STREX or BK-Insertless in pVAX) together with the expression plasmid (πH3-CD-8) for
the α subunit of the human CD-8 lymphocyte surface antigen (GeneBank M12824). To identify
transfected cells, CD-8 antibody-coated beads were used (Dynal/Invitrogen). Prior to
electrophysiological recordings, the medium was replaced with Locke’s buffer containing the
beads (1 µL/mL) and incubating for 1 hr. Unattached beads were washed out and recordings
were made from clearly identified cells with attached beads.
Electrophysiological recordings
Electrodes were pulled from borosilicate thin-wall capillary glass on a horizontal puller (Sutter
Instruments, CA), coated with Sylgard (Dow Coring Co., Broomall, PA), and fire-polished to a
final resistance of 3-4 MΩ. HEK cells were bathed in alcohol-free Locke’s solution (in mM: 142
NaCl, 2.0 KCl, 2.0 CaCl2, 2.0 MgCl2, 13.0 Glucose, and 15.0 HEPES, pH 7.35, 300 mOsm). The
recording pipette solution was (in mM): 135 Potassium Gluconate, 1 MgCl2, 2.2 CaCl2, 15
HEPES, 4 EGTA, 4 HEDTA, pH 7.35, 300 mOsm. The electrodes were first filled through the
tip and then backfilled with the recording solution. Potassium currents were recorded using an
EPC10-single amplifier (HEKA Elektronik, Germany). Traces were recorded at a sampling rate
of 5 kHz and 10 kHz for whole cell and single channel recordings respectively, and low-pass
filtered at 3 and 2 kHz, respectively. In whole-cell mode, leak current was subtracted on line
using a conventional P/n (4) protocol, and series resistance, that never exceeded 15 MΩ, was
60% compensated. Data were acquired with Patchmaster 2.05 (HEKA Elektronik, Germany),
and analyzed with Fitmaster 2.05 (HEKA Elektronik, Germany) on a G4 Apple computer.
Whole-cell recordings - current density
We used the standard whole-cell patch clamp recording method (Hamill et al., 1981). From a
holding potential of -60 mV, the membrane potential was depolarized to +100 mV for 500 ms.
Mean BK current amplitude was measured at BK current steady state, 400-470 ms after the
beginning of the voltage step. To obtain current density, the membrane surface was determined
from the cell capacitance and divided by the measured current.
Single-channel recordings - sensitivity to alcohol
BK channel activity was recorded in inside-out patch clamp mode in symmetrical (135 mM K+)
conditions, in the presence of a 5 µM-free calcium solution (140 mM K-Gluconate, 5 mM Na-
Gluconate. 1.0 mM MgCl2, 0.86 mM CaCl2, 15 mM HEPES and 1.5 mM HEDTA) from
HEK293 cells transfected with one of the BK variants. The control (no alcohol) and 50 mM
alcohol-containing solutions were enclosed in 50 ml syringes and expelled from hematocrite
tubes. Pipette tips were positioned in the “mouth” of the hematocrite tubes to prevent
contamination from solution potentially leaking from nearby tubes. Each cell was its own
control. To determine baseline activity (defined here as an open probability – NPo) before
alcohol application, BK channel activity was recorded 3 times, 30 sec each, with 30 sec intervals.
Then, 50 mM alcohol was applied and BK channel activity was recorded further in successive
blocks of 30 sec at 30 sec intervals for up to 10 min. NPo values were calculated from all-points-
amplitude histograms by fitting the histograms with a sum of Gaussian functions using a
Levenberg-Marquardt algorithm.
The integrated measurements of magnitude and duration of alcohol potentiation were
determined by measuring the area under the curve equaling the cumulative area of trapezoids.
The area of each trapezoid was calculated using the formula: a(b+c)/2, where a is an interval
between two adjacent time points measured, and b and c describe the magnitude of potentiation
of these time points.
Computational modeling of the miR-9 regulation of BK transcripts
The modeling was performed in five consecutive steps: 1) creating a matrix of all possible
combinations of BK monomers assembled into tetramers, 2) computing the probability of each
tetrameric assembly of monomers in seven different conditions (see below), 3) grouping of
similarly assembled tetramers: homomers, heteromers of two types of monomers only,
heteromers of all three monomers, 4) assigning alcohol sensitivity level to each group, 5)
calculating the overall effect of the alcohol-mediated shift in BK alpha gene expression on BK
alcohol responsiveness.
We made the following assumptions in our model:
Asmp1. BK mRNA and protein are in a steady state.
In our culture system viability of cells was unchanged compared to in vivo (Pietrzykowski at al.,
2004), and we used widely accepted methods of tissue processing, which ensure minimal
deterioration of the tissue, thus this very common assumption of mathematical modeling of
biological systems (R.D. Phair, Integrative Bioinformatics
http://www.bioinformaticsservices.com/bis/resources/cybertext/chapter4.html, ) is valid.
Asmp2. Stoichiometry of BK mRNA variants is preserved at the protein level.
We assumed that BK mRNA levels correlate with BK protein levels in the CNS, similarly to
published results (Song et al., 1999).
Asmp3. All monomers have the same affinity to assemble throughout the assembly process, thus
the resulting combinations are based on the relative available ratio of monomers.
Assembly of BK channels into tetramers depends on a tetramerization domain (BK-T1) (Quirk et
al., 2001). This domain does not undergo alternative splicing and is constitutively expressed in
all splice variants studied here (Figure 1), therefore it is reasonable to assume that the chief
determinant of the assembly of monomers into tetramers is their relative abundance.
The same set of assumptions was applied in modeling of all seven conditions studied:
1) naive SON neurons before alcohol exposure; 2) SON neurons after 15 min exposure to 20 mM
alcohol; 3) SON neurons after 30 min exposure to 20 mM alcohol; 4) SON neurons after 6 hrs
exposure to 20 mM alcohol; 5) SON neurons after 24 hrs exposure to 20 mM alcohol; 6) naive
striatal neurons; 7) striatal neurons after 15 min exposure to 20 mM alcohol.
The probability of assembly of each possible BK protein tetramer configuration, including both
homo- and heterotetramers was calculated based on an equation 1 (Eq. 1), in which the
abundance of each of the monomers was determined using real-time PCR data (Figure 2D and
2F).
Eq. 1 P(M1, M2, M3, M4) = A(M1) x A(M2) x A(M3) x A(M4),
where:
P(M1, M2, M3, M4) - probability of assembly of four different monomers into a tetramer,
A(M i) - abundance of a monomer Mi, where i= 1...4,
Mi - for each of the three monomers i contained in set ALCOREX, STREX,
INSERTLESS.
All possible 81 assembly configurations and their individual probabilities corresponding to their
relative amounts are listed in Table S2.
To determine alcohol effect on the different tetramers, they were categorized according to their
monomeric assembly (Figure 7A, B): i.e. homotetramers (a combination of four, same type
monomers), heterotetramers of any combination of two different monomers (e.g. A+A+S+S,
A+A+I+I, S+S+I+I), and heterotetramers of any combination of three different monomers (e.g.
A+S+I+A, A+S+I+S, A+S+I+I). For the complete list see Table S2.
Our electrophysiological data indicated that assemblies fall into four alcohol sensitivity categories:
I) resistant - assemblies with at least one STREX (i.e. both, homo- and heteromers), II) high
potentiation - ALCOREX homomers, III) low potentiation - INSERTLESS homomers, IV)
potentiation level unknown -ALCOREX/INSERTLESS heteromers.
To estimate the impact of reorganization of BK mRNA transcript landscape on the development
of alcohol tolerance, we used equation 2 (Eq. 2). This equation calculates the overall BK channel
responsiveness to alcohol in a cell as a ratio between responsiveness in alcohol exposed neurons
to naïve controls. In this equation we used information on the amount of BK channels,
probability of each BK assembly, and their level of alcohol sensitivity. Decreased alcohol
responsiveness = increased alcohol tolerance. Since there is no direct evidence of alcohol
sensitivity of the ALCOREX/INSERTLESS heteromer, we calculated two variations of equation
2 for both the SON and striatal neurons:
1. Variation 1: the alcohol potentiation level of ALCOREX/INSERTLESS heteromer is as
the INSERTLESS homomer – AIV = AIII
2. Variation 2: the alcohol potentiation level of ALCOREX/INSERTLESS heteromer is as
the ALCOREX homomer – AIV = AII
No/N* x [(PI* x AI) + (PII* x AII) + (PIII* x AIII) + (PIV* x AIV)] Eq. 2 C = -------------------------------------------------------------------------
No x [(PIo x AI) + (PIIo x AII) + (PIIIo x AIII) + (PIVo x AIV)] where:
C - overall change in the alcohol responsiveness of all BK channels in a cell,
No - amount of BK channels in naive neurons,
N*/No - change in the amount of BK channels due to alcohol exposure,
P - probability of forming assembles belonging to a specific alcohol sensitivity
category,
A - integrated channel activity (Figure 6C),
I-IV - one of the four alcohol sensitivity categories described above,
O - naïve neurons,
* - one of four alcohol exposure conditions (15 min, 30 min, 6 hrs, 24 hrs).
Statistical Analysis
For all experiments, the distribution characteristics of the data were evaluated by observing the
frequency histogram of model residuals. A Kolmogrov-Smirnov (K-S) Goodness-Of-Fit Test
was done on residual data to determine if data were normally distributed. If raw data were not
normally distributed, the natural logarithm of residuals was calculated to approximate the normal
distribution and stabilize the variances (confirmed by repeating the K-S test and observing the
new frequency histogram). Unless otherwise stated, Analysis Of Variance (ANOVA) was
utilized to test for a difference in treatment means, followed by Tukey’s HSD for pair-wise
comparisons between each treatment and control. P < 0.05 was defined as statistically
significant. n = number of independent biological preparations. Error bars represent standard
error of the mean (SEM). Statistical analysis was performed using SPSS.
Additional references (for other references see the main article):
Hamill,O.P., Marty,A., Neher,E., Sakmann,B., and Sigworth,F.J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391, 85-100.
Nakahara,T., Hirano,M., Uchimura,H., Shirali,S., Martin,C.R., Bonner,A.B., and Preedy,V.R. (2002). Chronic alcohol feeding and its influence on c-Fos and heat shock protein-70 gene expression in different brain regions of male and female rats. Metabolism 51, 1562-1568.
Newton,P.M., Tully,K., McMahon,T., Connolly,J., Dadgar,J., Treistman,S.N., Messing,R.,O. (2005). Chronic ethanol exposure induces an N-type calcium channel splice variant with altered channel kinetics. FEBS Lett. 579, 671-6.
Song,M., Zhu,N., Olcese,R., Barila,B., Toro,L., Stefani, E. (1999). Hormonal control of protein expression and mRNA levels of the MaxiK channel alpha subunit in myometrium. FEBS Lett. 460, 427-32.
Wong,M.L. and Medrano,J.F. (2005). Real-time PCR for mRNA quantitation. Biotechniques 39, 75-85.
4. A Primer Table
Table S1. The end-point PCR primers and RT-PCR amplicons used in this study.
End-Point Primer Set
Forward Primer (5’-3’)
Reverse Primer (5’-3’)
X1 CCAGACACTGACTGGCAGAGTCC AAGAACACGTTGAAAGCCATGTCG
X2 TGGCCATGTTTGCCAGCTACGTCC ATGTGCCCACAGACTACAATGTGC
X3 TAAGCTCCTGATGATAGCCATTGAG
CACTTGCGATGAAAAATCCTAAAGTA
X4 GTCATGATGACGTCACAGATCC CTCATGCCCCCATTACGTTGT
X5 GAAGATGAGCAACCGCCAACAC CATGTTGTCAATCTGATCGTTGC
X6 CTCCTGGAATGGACAGATCATC AGGGCTGTGTGAGGTACAGC
3’RACE TAGCCAACAGGGACCGCTGCCGAGT
GCTGTCAACGATACGCTACGTAACG
3’UTR Variant-2.1
TGAGTACCCACATGGCTAACCAGA
AGAGGAAGAGAAGTCACGTCACCA
3’UTR Variant-2.2
GTATGATAGTGTGCATGTGGTTGTC
GGTCCGTCTGCTTATTTGCTGTTG
3’UTR Variant-1.0
CTTCCCATATATCACAGCAATGCAA
GTGGTGACCATCATTCTCCTCGAA
ALCOREX/ 3’UTR-2.1
GTCATGATGACGTCACAGATCC AGGGATCAGGCTGCTTGTGGATTT
Real-Time PCR TaqMan Amplicons (5’-3’)
FP: TCCACACGATCTTGCCAGAGTCAA RP: ATCCGGGTCAGCGCAGTACTTATT
pan-BK
Probe: CAGCAGATGCATGTTTGATCCTTGCC FP: AGGCGGCCCCAAGATGT RP: ATGCACGAGCAGTCACGCTCA
STREX
Probe: TGAGCCGAGCATGTTGTTTTGATTGCGGACG ALCOREX
FP: ACTCGCTAAGCCGGGCAA RP: TCAGGGTCATCATCATCATCTTGGTC Probe: CAGTGGGACGCACATTCTAATGATAACGGAGTT FP: TCTGTGTGGATTGGTGGCTCTA RP: CTGCTTGCTGATCCACATCTG
β-actin
Probe: CCTGGCCTCACTGTCCACCTTCC FP: CCAATGGCTTTGGGAATGGCAAGA RP: CGTTGCAATGCCCGTCTTTCTTCA
KIR-2.1
Probe: ATACCCGACAACAGTGCAGGAGCCGCTTT
Real-Time PCR SYBR-GREEN Primers
FP: CCAATGGCTTTGGGAATGGCAAGA KCNJ2 RP: CGTTGCAATGCCCGTCTTTCTTCA
FP: CAGGTTCTTATCCCAGATTGTCCC GABRB2 RP: CCGGAGATGGGTATTGATTGTGGT
FP: AGGCGGCCCCAAGATGT KCNMB2 RP: ATGCACGAGCAGTCACGCTCA
FP: AGGCGGCCCCAAGATGT CLOCK RP: ATGCACGAGCAGTCACGCTCA
FP: TAGAGGCGAGCCAAGACTGAAGTT PPARA RP: AGGGACTTTCCAGGTCATCTGCTT
FP: AGGTGCAGAGGCAGATGAGAATCA NPY2R RP: TGAGTACTCCCGGAAGATGGCAA
FP: TTCCGGTCCATGTGGTCTGTGAAT SYNJ1 RP: TTGTCGGCTAAGTCGCTGTTCAGA
FP: CCCGGAAGTTCTAGAATCCAGGATGA TGFBR2 RP: TCGGTCTCTCAGCACGTTGTCTTT
FP: TCTGAGTACCACACCCTGCTCTAT HDAC5 RP: ATTCTTGAGCTCTCCTGCAGCCA
FP: AGGCGGCCCCAAGATGT CACNB1 RP: ATGCACGAGCAGTCACGCTCA
FP: AGAAGGTCCCTAGCAGGAGAACAA NOX4 RP: GCTTTCTGGGATCCTCATTCTGGT
FP: AGGCGGCCCCAAGATGT DRD2 RP: ATGCACGAGCAGTCACGCTCA
FP: AGGCGGCCCCAAGATGT PRKCA RP: ATGCACGAGCAGTCACGCTCA
FP: AGGCGGCCCCAAGATGT KCNMB1 RP: ATGCACGAGCAGTCACGCTCA