SHORT COMMUNICATION

Naturally Existing Levels of Osmyb4 Gene Expression in RiceCultivars Correlate with their Reaction to Fungal and BacterialPathogensPooja Singh, Ramamoorthy Siva, Kodiveri M. Gothandam & Subramanian Babu

School of Bio Sciences and Technology, VIT University, Vellore, 632014, India

Keywords

India, Osmyb4, resistance, rice bacterial leaf

blight, rice sheath blight, transcription factor

Correspondence

S. Babu, School of Bio Sciences and

Technology, VIT University, Vellore, India.

E-mail: babu.s@vit.ac.in

Received: January 27, 2013; accepted: March

29, 2013.

doi: 10.1111/jph.12114

Abstract

Accumulating functional genomic data in rice are unveiling the role of

regulatory genes and their significance in modulating responses to com-

plex traits like stress tolerance. Rice Osmyb4 is one such gene coding for

transcription factor, and the homologous and heterologous ectopic

expression has proved increased tolerance to several abiotic stress and few

biotic stresses in plants. Nevertheless, the role of this gene in rice plants

for disease resistance has not been studied. We attempted to study the cor-

relation of existing bottom-line expression of this gene in selected rice cul-

tivars and their reaction to artificial challenge with the sheath blight

pathogen (Rhizoctonia solani) and bacterial leaf blight pathogen (Xantho-

monas oryzae pv. oryzae). The study consisted of artificial inoculation of the

pathogens and scoring for disease in selected rice cultivars and amplifica-

tion of Osmyb4 transcripts by a simple reverse transcription PCR. Inocula-

tion studies revealed a higher disease index in cv. IR 50 and lower disease

in cvs TRY 3 and IR 36. Reverse transcription PCR in healthy plants

revealed significantly higher constitutive expression of this gene in cvs

TRY 3 and IR 36 which was not found in IR 50. However, expression of

this gene in cv. IR 50 was found to be cold-inducible. The natural expres-

sion level of Osmyb4 in disease-resistant rice varieties provides molecular

evidences for their possible role in regulating disease resistance.

Introduction

Transcription factors (TFs) regulate genome expres-

sion in response to environmental and physiological

signals. They act as master switch genes for the regu-

latory network in response to biotic and abiotic stres-

ses. TF is encoded by a single gene but regulates the

expression of several other genes leading to the acti-

vation of complex adaptive mechanisms and hence

represents major molecular targets to genetically

improve the tolerance of crop plants against different

stresses (Khong et al. 2008). This review has illus-

trated how the elucidation of the function of these

TFs can be used to set up genetic engineering strate-

gies and to rationalize molecular breeding using

molecular-assisted selection towards enhancement of

rice tolerance to various stresses. Because transcrip-

tion factors modulate the regulatory network in

plants, they are considered the best and safest candi-

date genes for engineering complex traits like stress

tolerance (Zhang 2003; Nakashima et al. 2009; Saibo

et al. 2009).

Over-expression in Arabidopsis thaliana plants of the

rice Osmyb4 gene (GenBank accession no. Y11414),

which codes for a MYB transcription factor, induces a

high level of tolerance to cold and freezing and results

in multiple biochemical changes, commonly observed

in plants during cold acclimation (Vannini et al. 2004;

Mattana et al. 2005). The microarray analysis of

transgenic plants versus the WT showed that the

Myb4 activates genes involved in tolerance to differ-

ent abiotic stresses (such as drought and salt), as well

� 2013 Blackwell Verlag GmbH 1

J Phytopathol

as in pathogen resistance, indicating that this tran-

scription factor is able to integrate the activation of

multiple components of the stress response (Vannini

et al. 2006). Vannini et al. (2007) developed trans-

genic tomato plants over-expressing rice Osmyb4 and

observed the plants acquiring higher tolerance to

drought stress and viral disease. Myb4 protein is

involved in different signal transduction pathways

and regulated responses not only to abiotic but also to

biotic stresses. To verify this hypothesis, the Osmyb4

over-expressing transgenic tomato lines were tested

for disease resistance. A significant reduction in the

symptom severity was observed in tomato plants inoc-

ulated with Tomato mosaic virus (ToMV). Park et al.

(2010) dissected the Osmyb4 network and determined

that the Osmyb4 controls a hierarchical network com-

prised of several regulatory subclusters associated

with cellular defence and rescue, metabolism and

development. The network activity enhanced cellular

antioxidant capacity through radical scavenging

mechanisms and increased activities of phenylpropa-

noid and isoprenoid metabolic processes involving

various abscisic acid (ABA), jasmonic acid (JA), sali-

cylic acid (SA), ethylene and reactive oxygen species

(ROS) responsive genes. The ectopic expression of

Osmyb4 gene improved the physiological and bio-

chemical adaptation to cold and drought in apple

(Pasquali et al. 2008) and cold in Osteospermum ecklonis

(Laura et al. 2010). Recently, enhanced tolerance to

frost and improved germination of transgenic barley

plants expressing rice Osmyb4 has been observed

(Soltesz et al. 2012).

The results of the effect of ectopic expression of the

rice Osmyb4 in other plant species prompted us to study

the effectiveness in rice, the native plant of this gene.

In the homologous transgenic system, the supra-opti-

mal expression of Osmyb4 was found to up-regulate

4193 genes and down-regulate 5362 genes (Park et al.

2010). However, elucidation of a role of this gene in

rice disease resistance remains unexplored. When

expressed in other plants, rice Osmyb4 is reported to

confer systemic acquired resistance (SAR) against

fungi, bacteria and viruses by inducing expression of

PR proteins and their activators (Vannini et al. 2006).

With this background, our choice of Osmyb4 for devel-

oping transgenic rice resistant to diseases was validated

in this study. Our key questions are as follows: What is

the constitutive/naturally existing level of expression

of Osmyb4 in rice cultivars in India? Can the differential

level be correlated with their differential reaction to

sheath blight and bacterial leaf blight pathogens?

To address our hypothesis, we conducted artificial

inoculation experiments in selected rice cultivars to

score their reaction to the respective fungal and bacte-

rial pathogens. Based on the results, three cultivars

were chosen and the constitutive level of expression

of Osmyb4 was studied by reverse transcription–poly-merization chain reaction (RT-PCR).

Materials and Methods

Rice cultivars

Seeds of selected cultivars of indica rice (Oryza sativa

L.) viz., ADT 36, TRY 3, IR 50, IR 36, Co 43, Co 47,

Pusa Basmati 11, Improved White Ponni were

obtained from the Paddy Breeding Station, Tamil

Nadu Agricultural University, Coimbatore, India.

Seeds were germinated and planted in earthen pots

under greenhouse conditions. The pots contained wet

land soil with organic carbon 0.23%, pH 6.64, EC

0.06 dS/m (non-saline) and available N, P, K 168

kg/ha, 13.0 kg/ha and 188 kg/ha, respectively.

Pathogen challenge and disease scoring

The sheaths of the 4 weeks old plants were used for

artificial inoculation. R. solani (strain RS 7, anastomo-

sis group AG1) and X. oryzae pv. oryzae cultures were

obtained from the Department of Plant Pathology,

Tamil Nadu Agricultural University, Coimbatore,

India and subcultured in PDA and nutrient agar

plates, respectively. For sheath blight pathogen inocu-

lation, pin pricks were made on the sheath and myce-

lial culture disc (7-day-old) was tied on the pricked

spot with the help of parafilm and moistured by sprin-

kling sterile water at the point of inoculation. Sheaths

injured by pin pricking and tied with PDA agar discs

served as control for each variety. For bacterial leaf

blight pathogen inoculation, log phase culture (30 h)

was used by swabbing on pinpricked leaf surfaces. The

plants were covered with polythene bags sprayed with

water 48 h before and after inoculation for necessary

humidity. Disease scoring was carried out using stan-

dard procedures (Kauffman et al. 1973; Nandakumar

et al. 2002) on plants of three replicated pots after

2 weeks of pathogen inoculation, and percent disease

index was calculated.

Semi-quantitative reverse transcription PCR analysis

Based on our disease scoring experiment, cvs IR 36,

IR 50 and TRY 3 were chosen for the molecular analy-

sis of Osmyb4 expression. To study the natural level of

expression of this gene, total RNA was extracted from

4 weeks old healthy plant sheath tissue using Raflex

� 2013 Blackwell Verlag GmbH2

Rice Osmyb4 transcription factor and disease resistance P. Singh et al.

total RNA isolation kit (Genei, Bangalore, India) as

per the manufacturer’s protocol. One set of pots was

transferred to cold room (4°C) 48 h before RNA isola-

tion. Because the gene is reported to be cold-inducible

(Vannini et al. 2004), we wanted to study any change

in level of expression upon cold treatment. First

strand cDNA was synthesized using AMV reverse

transcriptase and oligo d(T) primer using the cDNA

synthesis kit (Genei, Bangalore, India). The reaction

mixture consisted of 20 ng RNA template for all the

cultivars. The reaction mixture was incubated at 42°Cfor 1 h and terminated at 70°C for 10 min followed

by chilling on ice. PCR was carried out using 5 ll ofthe cDNA (synthesized from 20 ng of RNA), 2 U Taq

polymerase, 200 lM each dNTP and 1.5 mM MgCl2.

Primers for Osmyb4 gene were designed using the

sequences obtained from NCBI and Primer3 software.

About 0.4 lM primer concentration was found to be

optimum for amplification. Similarly, rice actin gene

primer was designed and used as internal control.

Actin gene primers were used at 0.2 lM concentra-

tion. The primers used are given in Table 1. Amplifi-

cation for Osmyb4 gene was carried out with initial

denaturation at 95°C for 2 min and 30 cycles of dena-

turation at 95°C for 1 min, 57°C annealing for 1 min

and 72°C extension for 1 min. This was followed by a

final extension at 72°C for 7 min. The annealing

temperature for actin gene was 54°C.

Results and Discussion

Reaction of the rice cultivars to R. solani and Xoo chal-

lenge is given in Fig. 1. In both experiments, all types

of reactions (highly susceptible, moderately suscepti-

ble and resistant) were observed among the eight

selected varieties. Cv. IR 50 had the highest level of

disease, whereas cvs TRY 3 and IR 36 recorded >30and >20 PDI, respectively, in both experiments. The

results of reverse transcription PCR are shown in

Fig. 2. Constitutive expression of Osmyb4 was

observed in cvs TRY 3 and IR 36 which is not evident

in cv. IR 50.

The cultivars that are recorded as resistant/tolerant

in our artificial inoculation study (TRY 3 and IR 36)

have a distinguishable higher level of expression of

Osmyb4 in healthy normal plants when compared to

the susceptible cv. IR 50. However, the cold treatment

of seedlings resulted in more induced expression of

the gene in cv. IR 36 compared with TRY 3. In addi-

tion, the highly susceptible IR 50 also showed expres-

sion of the gene although the level of expression is

less compared with TRY3 and IR 36 (Fig. 2b).

The well-known susceptible cv. IR 50 (Sriram et al.

1997; Nandakumar et al. 2001, 2002) showed the

maximum disease. Cv. IR 36 is known for its multiple

pest and disease-resistant characteristics (IRRI 2007).

This cultivar has been used as male sterile parent in

classical breeding, and attempts have been made to

develop sheath blight resistance in Venezuela (Del-

gado and Rodriguez 2005). Cv. TRY 3 is a rice variety

released by Tamil Nadu Agricultural University,

Coimbatore, in 2010 (TNAU 2010) with multiple

disease resistance, including sheath blight.

The reaction of the cultivars (susceptible and resis-

tance) to pathogen inoculation correlates with Osmyb4

expression in all the three cultivars tested. The results

validate the role of this transcription factor to the

overall contribution towards sheath blight and bacte-

rial leaf blight resistance in rice. It can be inferred that

cv. IR 50 requires cold temperature for the expression

of Osmyb4. The cultivars used in the study are grown

mostly in tropical countries like India. The tempera-

ture under field conditions in most of the rice culti-

vated areas falls down too cold only during some

extreme winter spells. Hence, under normal condi-

tions, the level of expression of this gene under field

conditions is insufficient to modulate disease resis-

tance at the transcription level, making varieties like

cv. IR 50, a highly susceptible one.

With the limitation of resistant sources in the rice

germplasm, significant progress has been made in the

past in using molecular techniques to produce sheath

blight–resistant rice. Mostly, the antifungal genes like

chitinase (both native rice chitinase and from other

sources) and other PR proteins have been used to

transform rice with limited success. Nonetheless, dis-

ease resistance is a complex trait controlled by several

groups of genes. Hence, over-expression of a single PR

protein transgene could not be expected to confer

sufficient level of disease resistance on transformed

rice plants. The marginal and narrow spectrum

disease resistance conferred by single PR protein

transgene is one of the major reasons for the reported

Table 1 Primers used in for RT-PCR

Gene Primers

Expected

fragment size

in PCR

Osmyb4 5′ GCGTCGACTTCTGCGAGGAGGCCA

AGCTA 3′

5′ CGCGGATCCGCATAGGTGCAAGC

ATTAAGTC 3′

1006 bp

Rice actin 5′ GTATCCATGAGACTACATACAAC 3′

5′ TACTCAGCCTTGGCAATCCACA 3′

400 bp

� 2013 Blackwell Verlag GmbH 3

P. Singh et al. Rice Osmyb4 transcription factor and disease resistance

failures of disease-resistant transgenic plants, ranging

from poor performance of the green-house-proven

transformants in field conditions (Anand et al. 2003)

to serious failures as reported by Neuhaus et al.

(1991). However, the co-expression of more than one

PR protein genes, such as chitinase and b-1,3-glucan-ase, was shown to be much more effective against

several fungal diseases than expression of a single

gene (Zhu et al. 1994). Although molecular breeding

have proved efficient in developing bacterial leaf

blight–resistant rice varieties, bringing in resistance to

more than one disease in a given variety remains a

challenge. Engineering the regulatory genes like tran-

scription factors would be more valid future technol-

ogy because modulation of several defence/resistance

genes is expected which is likely to improve the per-

formance of disease-resistant transgenic plants under

field conditions.

Developing transgenic rice using one or more genes

to confer resistance to each disease in isolation is valu-

able, but it can be less sustainable and also misleading

because the defence response forms part of complex

networks. The transcriptome, proteome and genome

analysis in rice related to disease resistance have

resulted in identification of variety of genes in the dis-

ease responsive pathway and their regulators. Rather

than genetically engineering rice with single resistant

or defence gene for sheath blight and bacterial leaf

blight diseases, if a regulatory gene like Osmyb4 tran-

scription factor is over-expressed, there is possibility

that many proteins involved in defence/resistance

could be modulated and the plant could be made

resistant to multiple pathogens. This will also help in

encountering the emerging new virulent strains in

the pathogen as the pathogen would require longer

time to develop resistance against a multi-mechanism

defence. Our data suggest a possible role of Osmyb4 in

the sheath blight resistance. Evaluation of a role of

this gene against other diseases in rice may help to

engineer and over-express in high levels to achieve

multiple disease-resistant rice in addition to sheath

blight and bacterial leaf blight.

Acknowledgements

The funding provided by Department of Science and

Technology, Government of India under the project

‘Targeted proteomics based discovery and over-

expression of key cross-talking protein for multiple

stress tolerance in rice’ (No. SR/FT/LS-120/2010) is

gratefully acknowledged. The authors also acknowl-

edge the support rendered by the management, VIT

University, Vellore, India.

References

Anand A, Zhou T, Trick HN, Gill BS, Bockus WW, Muth-

ukrishanan S. (2003) Greenhouse and field testing of

Fig. 1 Reaction of selected

rice cultivars to R. solani and

Xoo challenge. Mean of three

replications. Bars on each

mean value represent standard

error.

Fig. 2 Expression of Osmyb4 in rice cultivars. (a) constitute level of

expression in normal plants; (b) expression after cold treatment; (c) rice

actin gene expression (internal control). Lanes 1 – cv. TRY 3; 2 – cv. IR

50; 3 – cv. IR 36.

� 2013 Blackwell Verlag GmbH4

Rice Osmyb4 transcription factor and disease resistance P. Singh et al.

transgenic wheat plants stably expressing genes for

thaumatin like protein, chitinase and glucanase against

Fusarium graminearum. J Exp Bot 54:1101–1111.

Delgado N, Rodriguez H. (2005) Creating a rice population

resistant to Rhizoctonia solani Kuhn. In: Guimaraes EP

(ed) Population Improvement: A Way of Exploring the

Rice Genetic Resources of Latin America. FAO of the

United Nations, Rome, pp 255–270.

IRRI (2007) IR 36, the World’s most popular rice, Interna-

tional Rice Research Institute, The Philippines. http://

archive.irri.org/about/images/IR36.pdf (Verified Dec 30,

2012).

Kauffman HE, Reddy APK, Hsieh SPY, Merca SD. (1973)

An improved technique for evaluating resistance in rice

varieties to X. oryzae. Plant Dis Rep 57:537–541.

Khong G, Richaud F, Coudert Y et al. (2008) Modulating

rice stress tolerance by transcription factors. Biotechnol

Genet Eng Rev 25:381–403.

Laura M, Consonni R, Locatelli F, Fumagalli E, Allavena

A, Coraggio I, Mattana M. (2010) Metabolic response to

cold and freezing of Osteospermum ecklonis over-

expressing Osmyb4. Plant Physiol Biochem 48:764–771.

Mattana M, Biazzi E, Consonni R, Locatelli F, Vannini C,

Provera S, Coraggio I. (2005) Overexpression of Osmyb4

enhances compatible solute accumulation and increases

stress tolerance of Arabisopsis thaliana. Physiol Plant

125:212–213.

Nakashima K, Ito Y, Yamaguchi-Shinozaki K. (2009)

Transcriptional regulatory networks in response to

abiotic stresses in Arabidopsis and grasses. Plant Physiol

149:88–95.

Nandakumar R, Babu S, Viswanathan R, Raguchander T,

Samiyappan R. (2001) Induction of systemic resistance

in rice against sheath blight disease by Pseudomonas

fluorescens. Soil Biol Biochem 33:603–612.

Nandakumar R, Babu S, Radjacommare R, Raguchander T,

Samiyappan R. (2002) Pseudomonas fluorescensmediated

antifungal activity against R. solani, sheath blight patho-

gen. Phytopathol Mediterr 41:109–119.

Neuhaus JM, Ahl-Goy P, Hinz U, Flores S, Meins FJ. (1991)

High-level expression of a tobacco chitinase gene in Nico-

tiana sylestris: susceptibility of transgenic plants of Cercos-

pora nicotianae infection. Plant Mol Biol 16:141–151.

Park MR, Yun KY, Mohanty B, Herath V, Xu F, Wijaya E,

Bajic VB, Yun SJ, De Los Reyes BG. (2010) Supra-

optimal expression of the cold-regulated Osmyb4

transcription factor in transgenic rice changes the com-

plexity of transcriptional network with major effects on

stress tolerance and panicle development. Plant, Cell

Environ 33:2209–2230.

Pasquali G, Biricolti S, Locatelli F, Baldoni E, Mattana M.

(2008) Osmyb4 expression improves adaptive responses

to drought and cold stress in transgenic apples. Plant Cell

Rep 27:1677–1686.

Saibo NJ, Lourenco T, Oliveira MM. (2009) Transcription

factors and regulation of photosynthetic and related

metabolism under environmental stresses. Ann Bot

103:609–623.

Soltesz A, Vagujfalvi A, Rizza F, Kerepesi I, Galiba G, Catti-

velli L, Coraggio I, Crosatti C. (2012) The rice Osmyb4

gene enhances tolerance to frost and improves germina-

tion under unfavorable conditions in transgenic barley

plants. J Appl Genetics 53:133–143.

Sriram S, Raguchander T, Vidyasekaran P, Muthukrishnan

S, Samiyappan R. (1997) Genetic relatedness with

special reference to virulence among the isolates of

Rhizoctonia solani causing sheath blight in rice. J Plant Dis

Protect 104:160–171.

TNAU (2010) Tamil Nadu Agricultural University variety

releases – 2010, Coimbatore, India. http://agritech.tnau.

ac.in/pdf/farmers_day/variety_release_2010.pdf

(Verified Dec 30, 2012).

Vannini C, Locatelli F, Bracale M, Magnani E, Marsoni M,

Osnato M, Mattana M, Baldoni E, Coraggio I. (2004)

Overexpression of the rice Osmyb4 gene increases chill-

ing and freezing tolerance of Arabidopsis thaliana plants.

Plant J 37:115–127.

Vannini C, Iriti M, Bracale M, Locatelli F, Faoro F, Croce P,

Pirona R, Maro AD, Coraggio I, Genga A. (2006) The

ectopic expression of the rice Osmyb4 gene in Arabidopsis

increases tolerance to abiotic, environmental and biotic

stress. Physiol Mol Plant Pathol 69:26–42.

Vannini C, Campa M, Iriti M, Genga A, Faoro F, Carravieri

S, Rotino GL, Rossoni M, Spinardi A, Bracale M. (2007)

Evaluation of transgenic tomato plants ectopically

expressing rice Osmyb4 gene. Plant Sci 173:231–239.

Zhang JZ. (2003) Overexpression analysis of plant tran-

scription factors. Curr Opin Plant Biol 6:430–440.

Zhu Q, Maher EA, Masoud S, Dixon RA, Lamb CJ. (1994)

Enhanced protection against fungal attack by constitu-

tive co-expression of chitinase and glucanase genes in

transgenic tobacco. Biotechnology 12:807–812.

� 2013 Blackwell Verlag GmbH 5

P. Singh et al. Rice Osmyb4 transcription factor and disease resistance