1Obura E, 1Midega C, 1Khan ZR, 2Pickett J and 1Masiga D 1ICIPE: International centre of Insect Physiology and Ecology 2Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK

Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya

Presented at the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010

Model of sustainable small-holder mixed farming at ICIPE, Mbita

Organic Manure

Non-chemical cereal pest management

Enough fodder for livestock

Soil conservation

Increased maize, milk and meat production

Napier stunt disease

Which leafhopper species is transmitting Napier stunt disease?

ICIPE collected 22 plant sucking Hoppers from Bungoma, Busia, Kitale and Suba areas, Kenya

The plant sucking hoppers were reared in cages at ICIPE, Mbita

22 plant sucking Hoppers and their phytoplasma status

Family Insect Species PCR Testing/Phytoplasma status

Cicadellidae Cofana spectra +

Cofana unimaculata -

Cofana polaris +

Cicadulina mbila +

Exitianus distanti +

Exitianus attenuatus +

Glossocratus afzelii +

Recilia banda +

Delphacidae Thriambus levis -

Thriambus strenuus +

Thriambus vegatatus -

Leptodelphax cyclops -

Leptodelphax maculigera -

Leptodelphax dymas +

Sogatella Manetho +

Sogatella nigrigenis -

Sogatella kolophon -

Rhinotettix fuscipennis +

Rhinotettix breviceps -

Tagosodes cubanus. -

Aphrophoridae Poophilus sp. -

Clovia sp. -

For full data contact authors

60 Days phytoplasma infection, 10 gravid

female insects

Disease monitoring cage

The Hoppers were tested for Phytoplasma transmission

Only R. banda transmitted phytoplasma

1.2-kb

Plants before phytoplasma inoculation

Plants after phytoplasma transmission

1.2-kb

M - + 1 2 3 4 5 6 7 8 9 10 11 12

M + - 1 2 3 4 5 6 7 8 9 10 1112

7/12 plants developed symptoms and died after 6 months

MBS

Transmitted phytoplasma formed clade with NGSNGS-E

BrGWL

BGWLSGGS

SCGSSCWL

RYD

NGS-KNGS-UNGS-Ex

NGS-D

NGS-Recilia SCYL

BDROL

The Genus Maiestas (=Recilia)

23 Species Afrotropical

R. mica: blast disease phytoplasma in oil palm seedlings (WA)

R. dorsalis: rice dwarf phytoreovirus, rice gall dwarf phytoreovirus, and rice orange leaf (ROL) phytoplasma (ASIA)

ICIPE has Barcoded Recilia banda

>Recilia banda COI partial sequenceatactttatcttagggagatgaactagaatcttggggatttctttaagaagattaatccgatttgaaatcaattcaatagatacaatctttgaagaaaaaagatcttataatattttaatcacttctcatgcaattattataatcttttttttagtaatacctgtaactataggtggatttggaaattgattagttcctttaatattaataactcctgacatagcttttccacgattaaataatttcaggttttgaattttactaccttctttaataatatttataagaagaataatattaaaaactggtgtaatagcaggatgaacaatttaccctcctttaacattacttaacagccatccagattactcaatagaattaactatttttaggcttcatttagcaggaatttcgtcaattttgagttcaattaattttataacaactacaattaacataagatccgtaaaatttataaaaattccattatttgtatgatcaattaattttactgctattttattaattttaacattgcctgtactagccggagcaattactatattattgtttgatcgaaattttaacacatcattttatgaccctacaggaagaggagatccaaggatgcagag

For full details please contact authors

Patterns of NGS phytoplasma acquisition and transmission by the leafhopper R. bandaPhytoplasma acquisition time longer: 1-3 days

Plant infection/inoculation time as short as 5 mins

Only 3 infected insects required to deliver enough phytoplasma dose to initiate infection to 1 potted Napier grass

Hoppers are infective for life (up to 60 days)

Life cycle of NSD in the region

Recilia banda

(1-3 days)

(≥5 mins)

(7-10 days)

R. Banda survives and breed well on diseased plants

The phytoplasma seems to confer survival advantage to the insect

R. banda density in the field

Up to 20 insects/m2 collected from Diseased Napier grass plot

Only up to 5 insects/m2 collected from Healthy Napier grass plot

Up to 100% of insects collected from Diseased Napier grass canopy are phytoplasma infected

Up to 20% of the insects in the healthy Napier grass plots are infected

There is up to 60% infected insects in nearby healthy plots after Rouging diseased plants by farmers

Up to 40% infected insects collected in healthy canopy after a farm activity (walking, weeding)

Eggs or Nymphs and adults are disseminated by farmers with Napier grass seed canes

R. banda dispersal

Loop mediated isothermal amplifcation of DNA for rapid detection of phytoplasma

M + - 1 2 3 4 5 6 7 8

M - + 1 2 3 4 5 6 7 8

A: Symptomatic B: Assymptomatic/-PCR

M - + 1 2 3 4 5 6 7 8

M + - 1 2 3 4 5 6 7 8

Assay Serial dilutions of DNA extracted from test plant

 

Initial DNA 1:102 1:104 1:106

Nested PCR

+ + - -

LAMP + + + -

LAMP gene target and Primers

30 cultivars are being screened for phytoplasma resistance at ICIPE, Mbita

18 cultivars confirmed susceptible

Variety Name Resistant/Susceptible

1. Kakamega 1 S

2. Kakamega 2 S

3. Kakamega3 S

4. Kakamega5 S

5. Kakamega8 S

6. Ex Bokole S

7. French Cameroon S

8. Pakistan Hybrid S

9. Ex Matuga S

10. Ex-Mariakani S

11. Clone 13 S

12. Congo Kinshasha S

13. Gold Coast ongoing

14. Uganda Border S

15. Uganda L14 S

16. Nigeria 14 S

17. Nairobi L8 ongoing

18. Machakos Hairless S

19. South Africa L3 ongoing

20. Gold Coast Ongoing

21. Malawi Ongoing

22. Bana grass S

Known GermplasmVariety Name Resistant/

Susceptible

BV S

BFTC Ongoing

RT1 Ongoing

RT2 Ongoing

LO Ongoing

OK Ongoing

O2 Ongoing

JO Ongoing

Farmer selectedFor full data contact the authors

For full data contact the authors

17 Wild host grasses are being screened for R. banda survival and phytoplasma transmission

1. Cynodon dactylon2. Digitaria scalarum3. Echinochloa pyramidalis4. Cenchrus ciliaris 5. Eragrostis superba6. Setaria incrisata7. Sporobolus pyramidalis 8. Eleusine indica9. Panicum maximum10. Heteropogon contortus11. Hyperrhenia rufa12. Bathrochloa bladhi13. Bathrochloa insculpta14. Themeda triandra15. Dactyloctenium aegyptum16. Sorghum sudanensis

For full data contact the authors

Phytoplasma diseased Cynodon dactylon in Busia area, western Kenya (Obura et al., NDR, 2010)

C. dactylon is Common/important grass for turf and wild rangeland in eastern Africa

Common Name

Scientific Name Survival

Maize Zea mays NS

Sugarcane Sacharum sp MS,P

Pearl Millet Pennisetum glaucum

S&B, P

Rice Oryzae sativa MS,P

Wheat Triticum aestivum

NS

Sorghum Sorghum vulgare NS

Finger Millet Eleusine corocana

NS

MS-Minimal survival (1 week)

S&B-Survival and Breeding

P-Successful phytoplasma transmission

NS-No survival

7 cereals have been screened for R. banda survival and NSD transmissionFor full data contact the

authors

3/12 pearl milet samples infected with phytoplasma

M - + 1 2 3 4 5 6 7 8 9 10 11 12

R. Banda breeds and transmit phytoplasma to Pearl millet

For full data contact the authors

Pearl millet is a very important cereal

At ICIPE

Discriminate R. banda in eastern Africa

Identify a phytoplasma resistant Napier grass cultivar

Develop genetic and Morphological markers for the selection of the resistant cultivar

Genetic transformation of Resistant cultivar

Study the wild grass host range of Napier stunt phytoplasma

Screen phytoplasma infection to other cereals

Study the genetic diversity of Recilia banda in eastern Africa

Dr. Mike Wilson, National Museum of Wales, Cardiff, UK

Dr. Tadashi Ishikawa, Tokyo University of Agriculture,

Japan.

Biotechnology Unit, ICIPE

The Kilimo Trust, East Africa, the Gatsby Charitable

Foundation, UK, and DAAD

ACKNOWLEDGEMENT

THANK YOU