mw 12:50-2:05pm in beckman b302 profs: serafim batzoglou & gill bejerano
DESCRIPTION
CS273A. Lecture 9: Repetitive Elements. MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos Achlioptas. Announcements. HW1 done. HW2 enroute . The Functional Genome. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/1.jpg)
010101100010010100001010101010011011100110001100101000100101
Human Population Genomics
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG
![Page 2: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/2.jpg)
• Cost• Killer apps• Roadblocks?
How soon will we all be sequenced?
Time
2015?2020?
Cost
Applications
![Page 3: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/3.jpg)
The Hominid Lineage
![Page 4: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/4.jpg)
Human population migrations
• Out of Africa, Replacement– Single mother of all humans (Eve)
~190,000yr– Single father of all humans (Adam)
~340,000yr– Humans out of Africa ~50000 years
ago replaced others (e.g., Neandertals)
• Multiregional Evolution– Generally debunked, however,– ~5% of human genome in Europeans,
Asians is Neanderthal, Denisova
![Page 5: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/5.jpg)
Coalescence
Y-chromosome coalescence
![Page 6: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/6.jpg)
Why humans are so similar
Out of Africa
Oppenheimer S Phil. Trans. R. Soc. B 2012;367:770-784
![Page 7: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/7.jpg)
Some Key DefinitionsMary: AGCCCGTACGJohn: AGCCCGTACGJosh: AGCCCGTACGKate: AGCCCGTACGPete: AGCCCGTACGAnne: AGCCCGTACGMimi: AGCCCGTACGMike: AGCCCTTACGOlga: AGCCCTTACGTony: AGCCCTTACG
Alleles: G, T
Major Allele: GMinor Allele: T
Heterozygosity:Prob[2 alleles picked at random with replacement are different]
2*.75*.25 = .375
H = 4Nu/(1+4Nu)
G/GG/GG/TG/GG/GG/GG/GT/TT/GT/G
Recombinations:At least 1/chromosomeOn average ~1/100 Mb
Linkage Disequilibrium:The degree of correlation between two SNP locations
Mom Dad
![Page 8: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/8.jpg)
Human Genome Variation
SNP TGCTGAGATGCCGAGA Novel Sequence TGCTCGGAGA
TGC - - - GAGA
Inversion Mobile Element orPseudogene Insertion
Translocation Tandem Duplication
Microdeletion TGC - - AGATGCCGAGA Transposition
Large Deletion Novel Sequenceat Breakpoint
TGC
![Page 9: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/9.jpg)
The Fall in Heterozygosity
H – HPOP
FST = ------------- H
![Page 10: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/10.jpg)
• From bones, compared genomes of three different Neanderthals with five genomes from modern humans from different areas of the world
The Neanderthal Genome
Figure 1- R. E. Green et al., Science 328, 710-722 (2010)
![Page 11: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/11.jpg)
Neanderthal Genome
![Page 12: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/12.jpg)
Neanderthal Genome
![Page 13: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/13.jpg)
Denisovan – Another human relative
![Page 14: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/14.jpg)
The Neanderthal Whole Genome
![Page 15: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/15.jpg)
The Neanderthal Whole Genome
![Page 16: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/16.jpg)
Aboriginal Australian
![Page 17: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/17.jpg)
Benefits of Admixture
![Page 18: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/18.jpg)
Out of Africa Revisited
Ann Gibbons Science 28 January 2011:
“Human uniqueness?”
![Page 19: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/19.jpg)
The HapMap ProjectASW African ancestry in Southwest USA 90CEU Northern and Western Europeans (Utah) 180CHB Han Chinese in Beijing, China 90CHD Chinese in Metropolitan Denver 100GIH Gujarati Indians in Houston, Texas 100JPT Japanese in Tokyo, Japan 91LWK Luhya in Webuye, Kenya 100MXL Mexican ancestry in Los Angeles 90MKK Maasai in Kinyawa, Kenya 180TSI Toscani in Italia 100YRI Yoruba in Ibadan, Nigeria 100
Genotyping:Probe a limited number (~1M) of known highly variable positions of the human genome
![Page 20: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/20.jpg)
Linkage Disequilibrium & Haplotype Blocks
pA pG
Linkage Disequilibrium (LD):
D = P(A and G) - pApG
Minor allele: A G
![Page 24: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/24.jpg)
Population Sequencing – UK10K
![Page 25: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/25.jpg)
Association Studies
Control
Disease
A/GA/GG/GG/GA/GG/GG/G
A/AA/GA/AA/GA/GA/AA/A
AA 0 4AG 3 3GG 4 0
p-value
![Page 26: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/26.jpg)
Wellcome Trust Case Control
Nature 447, 661-678(7 June 2007) Nature 464, 713-720(1 April 2010)
Many associations of small effect sizes (<1.5)
![Page 27: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/27.jpg)
Heritability & Environment
Bienvenu OJ, Davydow DS, & Kendler KS (2011). Psychological medicine, 41 (1), 33-40 PMID:
![Page 28: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/28.jpg)
Disease Clustering
• RA vs. ATD• RA vs. MS
– No recorded co-occurrence of RA and MS
SNP - Allele Gene Symbol
Genetic Variation Score (GVS)RA
(NARAC) RA AS T1D ATD MS (IMSGC) MS
rs11752919 - C ZSCAN23 -3.48 -3.21 -9.39 1.10 0.70 3.25 2.99
rs3130981 - A CDSN -0.46 -1.00 -9.47 -4.94 0.33 10.00 13.41
rs151719 - G HLA-DMB -6.71 -4.77 -1.08 -13.63 0.34 8.58 17.76
rs10484565 - T TAP2 25.52 8.37 1.34 15.74 -1.36 -0.56 -0.30
rs1264303 - G VARS2 11.51 7.36 18.76 0.89 -1.76 -1.85 -1.75
rs1265048 - C CDSN 6.59 2.97 50.13 6.34 -0.85 -2.39 -4.16
rs2071286 - A NOTCH4 5.30 0.78 6.42 4.04 -0.03 -1.89 -2.45
rs2076530 - G BTNL2 67.49 56.46 14.06 13.58 -6.41 -9.50 -18.52
rs757262 - T TRIM40 14.58 9.11 6.27 1.56 -0.79 -2.05 -7.34
![Page 29: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/29.jpg)
Global Ancestry Inference
Nature. 2008 November 6; 456(7218): 98–101.
![Page 30: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/30.jpg)
Ancestry Painting
?Danish
French
Spanish
Mexican
![Page 31: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/31.jpg)
Modeling population haplotypes – VLMC
Browning, 2006
![Page 32: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/32.jpg)
Phasing
Browning & Browning, 2007
![Page 33: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/33.jpg)
Identity By Descent
{ {
.
.
.
.
.
.
![Page 34: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/34.jpg)
IBD detection
H2H1 H4H3
IBD = F
H1
IBD = TH2
Hs
h
FastIBD: sample haplotypes for each individual, check for IBD
Browning & Browining 2011
Parente
Rodriguez et al. 2013
![Page 35: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/35.jpg)
Fixation, Positive & Negative Selection
Neutral Drift Positive SelectionNegative Selection
How can we detect negative
selection?
How can we detect positive
selection?
![Page 36: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/36.jpg)
How can we detect positive selection?
Ka/Ks ratio:Ratio of nonsynonymous tosynonymous substitutions
Very old, persistent, strong positive selection for a protein that keeps adapting
Examples: immune response, spermatogenesis
![Page 37: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/37.jpg)
How can we detect positive selection?
![Page 38: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/38.jpg)
Positive Selection in Human Lineage
![Page 39: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/39.jpg)
Positive Selection in Human Lineage
![Page 40: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/40.jpg)
X
X
X
Mutations and LD
Slide Credits:Marc Schaub
![Page 41: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/41.jpg)
Long Haplotypes –EHS, iHS tests
Less time:• Fewer mutations• Fewer recombinations
![Page 42: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/42.jpg)
• Study of genes known to be implicated in the resistance to malaria.
• Infectious disease caused by protozoan parasites of the genus Plasmodium
• Frequent in tropical and subtropical regions
• Transmitted by the Anopheles mosquito
Image source: wikipedia.org
Application: Malaria
Slide Credits:Marc Schaub
![Page 43: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/43.jpg)
Image source: NIH - http://history.nih.gov/exhibits/bowman/images/malariacycleBig.jpg
Application: Malaria
Slide Credits:Marc Schaub
![Page 44: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/44.jpg)
Image source: CDC - http://www.dpd.cdc.gov/dpdx/images/ParasiteImages/M-R/Malaria/malaria_risk_2003.gif
Application: Malaria
Slide Credits:Marc Schaub
![Page 45: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/45.jpg)
Results: G6PD
Source: Sabeti et al. Nature 2002.Slide Credits:Marc Schaub
![Page 46: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/46.jpg)
Results: TNFSF5
Source: Sabeti et al. Nature 2002.Slide Credits:Marc Schaub
![Page 47: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/47.jpg)
Malaria and Sickle-cell Anemia
• Allison (1954): Sickle-cell anemia is limited to the region in Africa in which malaria is endemic.
Image source: wikipedia.org
Distribution of malaria Distribution of sickle-cell anemiaSlide Credits:Marc Schaub
![Page 48: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/48.jpg)
Malaria and Sickle-cell Anemia
• Single point mutation in the coding region of the Hemoglobin-B gene (glu → val).
• Heterozygote advantage:• Resistance to malaria• Slight anemia.
Image source: wikipedia.orgSlide Credits:Marc Schaub
![Page 49: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/49.jpg)
Source: Ingram and Swallow. Population Genetics of Encyclopedia of Life Sciences. 2007.
Slide Credits:Marc Schaub
Lactose Intolerance
![Page 50: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/50.jpg)
LCT, 5’
LCT, 3’
Source: Bersaglieri et al. Am. J. Hum. Genet. 2004.Slide Credits:Marc Schaub
Lactose Intolerance
![Page 51: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/51.jpg)
Lactase persistence (litterature) Predicted lactase persistence
13910*T distribution
Source: Ingram et al. Lactose digestion and the evolutionary genetics of lactase persistence. Hum Genet. 2009 Jan;124(6):579-91.
Slide Credits:Marc Schaub
![Page 52: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/52.jpg)
Positive Selection in Human Lineage
![Page 53: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/53.jpg)
Orthology and Paralogy
HB Human
WB Worm
HA1 Human
HA2 Human
Yeast
WA Worm
Orthologs:Derived by speciation
Paralogs:Everything else
![Page 54: MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano](https://reader036.vdocuments.mx/reader036/viewer/2022062812/5681641d550346895dd5d8b9/html5/thumbnails/54.jpg)
Orthology, Paralogy, Inparalogs, Outparalogs