mutually regulated ap2/erf gene clusters modulate · mutually regulated ap2/erf gene clusters...

Mutually Regulated AP2/ERF Gene Clusters ModulateBiosynthesis of Specialized Metabolites in Plants1[OPEN]

Priyanka Paul,a,2 Sanjay Kumar Singh,a,2 Barunava Patra,a Xiaoyu Liu,b Sitakanta Pattanaik,a,3 andLing Yuana,c,3,4

aDepartment of Plant and Soil Sciences and Kentucky Tobacco Research and Development Center, Universityof Kentucky, Lexington, Kentucky 40546bCollege of Life Sciences, Shanxi Agricultural University, Shanxi 030801, ChinacKey Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement, South ChinaBotanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China

ORCID IDs: 0000-0001-8530-7877 (P.P.); 0000-0001-7702-8341 (S.P.); 0000-0003-4767-5761 (L.Y.).

APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) gene clusters regulate the biosynthesis of diverse specializedmetabolites, including steroidal glycoalkaloids in tomato (Solanum lycopersicum) and potato (Solanum tuberosum), nicotine intobacco (Nicotiana tabacum), and pharmaceutically valuable terpenoid indole alkaloids in Madagascar periwinkle (Catharanthusroseus). However, the regulatory relationships between individual AP2/ERF genes within the cluster remain unexplored. Weuncovered intracluster regulation of the C. roseus AP2/ERF regulatory circuit, which consists of ORCA3, ORCA4, and ORCA5.ORCA3 and ORCA5 activate ORCA4 by directly binding to a GC-rich motif in the ORCA4 promoter. ORCA5 regulates its ownexpression through a positive autoregulatory loop and indirectly activates ORCA3. In determining the functional conservation ofAP2/ERF clusters in other plant species, we found that GC-rich motifs are present in the promoters of analogous AP2/ERFclusters in tobacco, tomato, and potato. Intracluster regulation is evident within the tobacco NICOTINE2 (NIC2) ERF cluster.Moreover, overexpression of ORCA5 in tobacco and of NIC2 ERF189 in C. roseus hairy roots activates nicotine and terpenoidindole alkaloid pathway genes, respectively, suggesting that the AP2/ERFs are functionally equivalent and are likely to beinterchangeable. Elucidation of the intracluster and mutual regulation of transcription factor gene clusters advances ourunderstanding of the underlying molecular mechanism governing regulatory gene clusters in plants.

Plants produce a vast array of bioactive specializedmetabolites in response to various biotic and abioticstresses. Many specialized metabolites with nutritionaland medicinal values are beneficial to animals andhumans. While significant progress has been madein discovering the genes encoding key enzymes inthe biosynthesis of specialized metabolites, molecularregulatory mechanisms controlling the metabolicpathways are insufficiently understood. Biosynthesis ofspecialized metabolites is primarily regulated at thetranscriptional level (Colinas and Goossens, 2018). The

APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) family transcription factors (TFs) have emerged askey regulators of specialized metabolite biosynthesis,including nicotine in tobacco (Nicotiana tabacum; Shojiet al., 2010; De Boer et al., 2011), terpenoid indole al-kaloids (TIAs) in Madagascar periwinkle (Catharanthusroseus; van der Fits and Memelink, 2000; Paul et al.,2017) and Ophiorrhiza pumila (Udomsom et al., 2016),artemisinin in Artemisia annua (Yu et al., 2012; Lu et al.,2013), and steroidal glycoalkaloids (SGAs) in tomato(Solanum lycopersicum) and potato (Solanum tuberosum;Cárdenas et al., 2016; Thagun et al., 2016; Nakayasuet al., 2018). AP2/ERFs are subdivided into 12 phylo-genetic groups (Nakano et al., 2006). Several group IXAP2/ERFs form physically linked gene clusters thatregulate the biosynthesis of specialized metabolites. TFgene clusters have been characterized in a limitednumber of plant species, including tobacco (Shoji et al.,2010; Kajikawa et al., 2017), tomato (Cárdenas et al.,2016; Thagun et al., 2016; Nakayasu et al., 2018), po-tato (Cárdenas et al., 2016), and C. roseus (Paul et al.,2017). The tobacco NICOTINE2 (NIC2) locus comprisesat least 10 AP2/ERFs that are homologous to the C.roseus ORCAs. Not all NIC2 ERFs are equally effec-tive in regulating nicotine biosynthesis; ERF189 andERF221/ORC1 play major roles in nicotine biosynthesis(Shoji et al., 2010; De Boer et al., 2011). The AP2/ERF

1This work was supported by the Harold R. Burton Endowed Pro-fessorship to L.Y. and by the National Science Foundation under co-operative agreement 1355438 to L.Y.

2These authors contributed equally to the article.3Senior authors.4Author for contact: [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Ling Yuan ([email protected]).

L.Y. and S.P. designed the research; P.P., S.K.S., B.P., X.L., and S.P.performed experiments; P.P., S.K.S., and S.P. analyzed data; P.P.,S.K.S., S.P., and L.Y. wrote the article.

[OPEN]Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.19.00772

840 Plant Physiology�, February 2020, Vol. 182, pp. 840–856, www.plantphysiol.org � 2020 American Society of Plant Biologists. All Rights Reserved.

https://plantphysiol.orgDownloaded on February 8, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://orcid.org/0000-0001-8530-7877

https://orcid.org/0000-0001-8530-7877

https://orcid.org/0000-0001-7702-8341

https://orcid.org/0000-0001-7702-8341

https://orcid.org/0000-0003-4767-5761

https://orcid.org/0000-0003-4767-5761

https://orcid.org/0000-0001-8530-7877

https://orcid.org/0000-0001-7702-8341

https://orcid.org/0000-0003-4767-5761

http://crossmark.crossref.org/dialog/?doi=10.1104/pp.19.00772&domain=pdf&date_stamp=2020-01-21

mailto:[email protected]

http://www.plantphysiol.org

mailto:[email protected]

http://www.plantphysiol.org/cgi/doi/10.1104/pp.19.00772

https://plantphysiol.org

gene clusters in tomato andpotato comprisefive and eightERFs, respectively. GLYCOALKALOID METABOLISM9(GAME9)/JASMONATE-RESPONSIVE ERF4 (JRE4),a member of the AP2/ERF gene clusters in tomatoand potato, is key to the biosynthesis of SGAs andthe upstream isoprenoids. Knockdown, knockout, oroverexpression of the GAME9 genes in tomato andpotato affects the SGA pathway gene expression andSGA production (Cárdenas et al., 2016; Thagun et al.,2016; Nakayasu et al., 2018). In C. roseus, the ORCAcluster consists of at least three AP2/ERFs, ORCA3,ORCA4, and ORCA5, of which ORCA3 and ORCA4 areknown to regulate the biosynthesis of the pharmaceuti-cally valuable TIAs (Fig. 1A; van der Fits and Memelink,2000; Paul et al., 2017).In addition to the group IX AP2/ERFs, TF gene clusters

have been identified in the group III AP2/ERFs, C-repeat

Binding Factors (CBFs; Gilmour et al., 1998; Zhanget al., 2004), Auxin Response Factors (ARFs; Hagenand Guilfoyle, 2002), R2R3 MYBs (Zhang et al., 2000,2019), and basic helix-loop-helix (bHLH) factors(Sánchez-Pérez et al., 2019). TF gene clusters likelyoriginated from tandem gene duplication events(Shoji et al., 2010; Kellner et al., 2015). Unlike theoperon-like, nonhomologous metabolic gene clus-ters (Boycheva et al., 2014; Nützmann and Osbourn,2014; Nützmann et al., 2016), TF gene clusters en-code homologous TFs with overlapping or uniquefunctions. It has been suggested that gene duplicationoffers the opportunity for mutual regulation among theduplicated genes (Shoji et al., 2010); however, mutualregulatory relationships among the members of any TFcluster remained unconfirmed. Furthermore, the ORCA,NIC2, and GAME9/JRE locus ERFs are phylogenetically

Figure 1. Expression ofORCA3,ORCA4, andORCA5 in response to JA and ACC. A, Simplified diagram of the TIA biosyntheticpathway in C. roseus. TIA pathway genes studied in this work are highlighted in blue, and genes regulated by ORCAs andCrMYC2a (van der Fits and Memelink, 2000; Paul et al., 2017; Schweizer et al., 2018; this study) are indicated by circles andtriangles, respectively. B, Ten-day-oldC. roseus seedlings were treatedwith 100mMMeJA (JA) and/or 50mMACC for 2 h, and geneexpression in whole seedling was measured by RT-qPCR. Mock-treated seedlings were used as controls (CN). C, Measurement ofajmalicine, catharanthine, and tabersonine in JA-, ACC-, and JA1ACC-treated C. roseus seedlings. Alkaloids were extracted andanalyzed using liquid chromatography-tandem mass spectrometry. The levels of alkaloids were estimated based on peak areascompared with standards. Data represent means 6 SD of three biological samples each with 15 to 17 seedlings. Different lettersdenote statistical differences as assessed by one-way ANOVA and Tukey’s honestly significant difference (HSD) test, P , 0.05.ASa, Anthranilate synthase; CPR, cytochrome P450 reductase; DW, dry weight; G10H, geraniol 10-hydroxylase; HL1/2/3/4,hydrolase 1/2/3/4; IS, iridoid synthase; LAMT, loganic acid methyltransferase; MAT, minovincine 19-O-acetyltransferase; SGD,strictosidine b-glucosidase; SLS, secologanin synthase; STR, strictosidine synthase; T19H, tabersonine 19-hydroxylase; TAT,tabersonine derivative 19-O-acetyltransferase; TEX1/TEX2, tabersonine 6,7-epoxidase isoforms 1 and 2; V19H, vincadifformine19-hydroxylase.

Plant Physiol. Vol. 182, 2020 841

Intracluster and Mutual Regulation of AP2/ERFs



related and commonly respond to the phytohormonejasmonic acid (JA), suggesting the evolution of similarregulatory mechanisms in diverse metabolic pathways(Shoji et al., 2010; Thagun et al., 2016). Question thus aroseas to whether AP2/ERFs from different clusters arefunctionally equivalent and interchangeable. Elucidationof the mutual regulatory relationship among the ERFgene clusters implies an evolutionarily conserved molec-ular mechanism that controls the biosynthesis of func-tionally and structurally diverse specialized metabolites.

In this study, we discovered a regulatory relationshipamong the members of the ORCA cluster. The directactivation ofORCA4 by ORCA3 and ORCA5, as well asself-regulation of ORCA5, highlight the presence offeed-forward and autoregulatory loops in the ORCAcluster. We also demonstrated the intracluster regula-tion among the tobacco NIC2 ERFs. Moreover, ORCA5overexpression in tobacco hairy roots up-regulatednicotine biosynthetic genes and nicotine accumula-tion, and reciprocal overexpression of NIC2 ERF189 inC. roseus hairy roots induced the TIA biosyntheticgenes, suggesting that the ORCAs and NIC2 ERFs arefunctionally equivalent and are likely interchangeable.

RESULTS

Phylogenetic Analysis Positions ORCAs, GAME9, andNIC2 ERFs in the Same Clade

AP2/ERFs are divided into 12 groups based on do-main structure and other conserved motifs. The groupIX AP2/ERFs are involved in phytohormone signalingand defense response (Nakano et al., 2006). Phyloge-netic analysis of group IX ERFs from tomato, tobacco,potato, and C. roseus showed that ORCAs are groupedtogether with NIC2 and GAME9 ERFs, which are in-volved in nicotine and SGA biosynthesis in tobacco andtomato, respectively (Shoji et al., 2010; Cárdenas et al.,2016; Supplemental Fig. S1). Interestingly, this cladedoes not include ERFs from Arabidopsis (Arabidopsisthaliana), suggesting that the ERFs in this clade arepossibly evolved for the biosynthesis of structurallycomplex specialized metabolites.

ORCA Gene Cluster Is Differentially Induced by MethylJasmonate and Ethylene

Methyl jasmonate (MeJA) is a key elicitor of biosyn-thesis of a number of specialized metabolites, includingnicotine (Shoji et al., 2000), b-thujaplicin (Zhao et al.,2004), artemisinin (Shen et al., 2016), taxol (Mirjalili andLinden, 1996), and SGAs (Thagun et al., 2016; Nakayasuet al., 2018). Ethylene (ET) acts synergistically with MeJAto promote the biosynthesis of taxol in Taxus cuspidate(Mirjalili and Linden, 1996), b-thujaplicin in Cupressuslusitanica (Zhao et al., 2004), and hydroxycinnamic acidamides inArabidopsis (Li et al., 2018),while ET attenuatesthe effects of MeJA on nicotine and SGA biosynthetic

pathway gene expression in Nicotiana species (tobaccoand Nicotiana attenuata) and tomato, respectively (Shojiet al., 2000, 2010; Winz and Baldwin, 2001; Nakayasuet al., 2018). In C. roseus, MeJA induces the expression ofORCA3,ORCA4, andORCA5 as well as their targets (vander Fits and Memelink, 2000; Paul et al., 2017). To deter-mine the effects of ET alone or in combination withMeJAon ORCA gene expression, C. roseus seedlings were trea-ted with MeJA, 1-aminocyclopropane-1-carboxylic acid(ACC), or both for 2 h, and transcript accumulation wasmeasured by reverse transcription quantitative PCR (RT-qPCR). Expression of ORCA5 was induced 9.5-fold byMeJA but remained unaffected by ACC; however, MeJA-induced expression of ORCA5 was attenuated in thepresence of ACC, reduced to 7.5-fold. Expression ofORCA4 and ORCA3 was induced 7- and 12-fold, respec-tively, by MeJA and reduced to 0.2- to 0.3-fold by ACC(Fig. 1B). Similar to ORCA5, MeJA-responsive expressionof ORCA4 and ORCA3 was reduced to 2.5- and 7-fold,respectively, in the presence of ACC. Expression of STRand TDC, two key targets of ORCAs, and CrMYC2awereinduced 4-, 12-, and 5.7-fold, respectively, by MeJAtreatment. The MeJA-induced expression was reduced to2- to 4-fold in the presence of ACC (Fig. 1B). In addition,we measured the TIA contents in seedlings treated withMeJA and ACC either alone or in combination. MeJAinduced, whereas ACC repressed, the accumulation oftabersonine and ajmalicine. Moreover, MeJA-inducedaccumulation of tabersonine, but not of ajmalicine, wasattenuated by ACC. Accumulation of catharanthine wasreduced in MeJA or ACC-treated seedlings (Fig. 1C).

ORCA5 Is a Nucleus-Localized Transcriptional Activator

To determine the transactivation activity, ORCA3,ORCA4, or ORCA5, fused to the GAL4-DNA-bindingdomain, was coelectroporated into tobacco protoplastswith a luciferase reporter driven by a minimal cauliflowermosaic virus (CaMV) 35SpromoterwithGAL4-responsiveelements as described previously (Paul et al., 2017).Transactivation activities ofORCA3,ORCA4, andORCA5were 6.5-, 6.6-, and 12-fold, respectively, higher than thereporter-only control (Supplemental Fig. S2A). The sig-nificant inductions of reporter activity in plant cells sug-gest that three ORCAs are transcriptional activators. Todetermine the subcellular localization, ORCA5 coding se-quencewas fused in frame to the enhanced GFP (eGFP) andexpressed in tobacco protoplasts. Compared with theprotoplasts expressing the eGFP control, in which GFPwas detected throughout the cell, theORCA5-eGFP fusionprotein was localized to the nucleus (Supplemental Fig.S2B), consistent with its putative function as a TF.

ORCA4 and ORCA5 Bind to the JRE in the STR Promoter

We have shown that ORCA4 and ORCA5 activatethe promoters of key TIA pathway genes, includingSTR, TDC, and CPR in tobacco cells (Paul et al., 2017). A

842 Plant Physiol. Vol. 182, 2020

Paul et al.


http://www.plantphysiol.org/cgi/content/full/pp.19.00772/DC1





previous study has shown that ORCA3 binds to the JREin the STR promoter (van der Fits andMemelink, 2001).To determine whether ORCA4 and ORCA5 also bindthe same JRE in the STR promoter, we performed anelectrophoretic mobility shift assay (EMSA). We puri-fied the recombinant GST-taggedORCA3, ORCA4, andORCA5 (GST-ORCA3/4/5) and CrMYC2a (GST-CrMYC2a) proteins from Escherichia coli using GST af-finity chromatography as described previously (Paulet al., 2017; Patra et al., 2018; Fig. 2A; SupplementalFig. S3A). CrMYC2a, which binds the T/G-box motif,was used as a negative control. The purified ORCA3,ORCA4, ORCA5, or CrMYC2a protein was incubatedwith a 59 biotin-labeled probe covering the JRE of theSTR promoter. Similar to ORCA3, ORCA4 and ORCA5also bind to the JRE, resulting in a mobility shift(Fig. 2B). The binding of GST-tagged ORCA5 to the JREof the STR promoter was further confirmed by com-petition using 103 and 1003 excess of the unlabeled(cold) probe. The intensity of the signal decreased

gradually with the increase of the concentration of coldprobe (Supplemental Fig. S3B). As shown in Figure 2B,the unlabeled probe, 1,000-fold in excess, outcompetedthe labeled probe and abolished the signal, suggestingthat the shifted band was indeed the ORCA5-JREcomplex. We thus used 1,0003 excess of the cold probefor the competition experiments with ORCA3 andORCA4, and, similar to ORCA5, the cold probe com-pletely abolished the signals on the gel, indicating thatthe shifted band was indeed the ORCA3/ORCA4-JREcomplex (Fig. 2B). We did not detect any signal forCrMYC2a, suggesting that CrMYC2a does not bind toJRE in the STR promoter (Supplemental Fig. S3B).

ORCA TFs Differentially Activate TIA Pathway Genes

The ORCAs are known to regulate a number of genesof the indole pathway and downstream branches (vander Fits and Memelink, 2000; Paul et al., 2017). In this

Figure 2. ORCA binding to the GC-rich motif in the STR promoter and differential activation of TIA pathway gene promoters. A,ORCA3, ORCA4, and ORCA5 were expressed in E. coli, and the recombinant proteins were purified to homogeneity as dem-onstrated by SDS-PAGE. B, Binding of ORCA3, ORCA4, and ORCA5 to the GC-rich motif in the STR promoter. The nucleotidesequence of the GC-rich motif and the position of the jasmonate-responsive element (JRE; 2100 to 258) relative to the tran-scription start site (TSS) is shown at top. The autoradiograph shows the DNA-protein complex of the biotin-labeled GC-rich motifprobe with ORCA3, ORCA4, or ORCA5. The labeled probewas outcompeted by 1,0003 unlabeled probe (1). C, Transactivationof the LAMT and SLS promoters, fused to the firefly luciferase (LUC) reporter, by ORCA3, ORCA4, and ORCA5 in tobacco cells.Control (CN) represents reporter plasmid alone. A plasmid containing the GUS reporter, driven by the CaMV 35S promoter andrbcS terminator, was used as an internal control. LUC and GUS activities were measured 20 h after electroporation. LUC activitywas normalized against GUS activity. Data presented here are means 6 SD of three biological replicates. Statistical significancewas calculated using Student’s t test: *, P , 0.05 and **, P , 0.01.









study, we investigated their roles in the regulation ofadditional genes in the TIA pathway. Biosynthesis ofsecologanin in C. roseus (Fig. 1A) requires nine en-zymes, seven of which are involved in the conversionof geranyl diphosphate to loganic acid and are regu-lated by BIS1 (Van Moerkercke et al., 2015) and BIS2(VanMoerkercke et al., 2016). Loganic acid is convertedto secologanin by LAMT and SLS. We used protoplast-based transactivation assay to determine whetherLAMT and SLS are regulated ORCAs. The LAMT (1,376bp) or SLS (980 bp) promoter, fused to a firefly luciferasereporter gene, was coelectroporated into tobacco pro-toplasts with or without the constructs expressingORCA3,ORCA4, orORCA5 (Fig. 2C). ORCA3, ORCA4,and ORCA5 significantly activated the LAMT promotercompared with the control. ORCA5, but not ORCA3and ORCA4, significantly activated the SLS promoter(approximately 2.5-fold) compared with the control(Fig. 2C).

Derepressed CrMYC2a and ORCA5 Have SynergisticEffects on TIA Pathway Genes

A recent study has shown that mutation of a con-served Asp to Asn (D126N) in the JAZ interaction do-main of CrMYC2a prevents CrMYC2a from interactingwith CrJAZ3 and CrJAZ8, thus derepressingCrMYC2a from the inactive complex with the JAZproteins. In addition, coexpression of the dere-pressed CrMYC2a (CrMYC2aD126N) with ORCA3 hasa synergistic effect on the expression of several TIApathway genes (Schweizer et al., 2018). To determinewhether the derepressed CrMYC2a acts synergisticallywith ORCA5, we generated the CrMYC2aD126N mutantby site-directed mutagenesis and evaluated its effect onfour key TIA pathway gene promoters, TDC, STR,LAMT, and SLS, which are regulated by ORCA5. Asshown in Figure 3, CrMYC2a had no additive effect on

the STRpromoter activitywhen coexpressedwithORCA5.TheTDC,LAMT, andSLSpromoter activitieswere slightlyhigher when CrMYC2a was coexpressed with ORCA5.However, coexpression of CrMYC2aD126N with ORCA5had a synergistic effect on the activation of all fourpromoters (Fig. 3).

ORCA5 Overexpression Activates TIA Pathway Genes andBoosts TIA Accumulation in C. roseus Hairy Roots

To further elucidate the regulatory role of ORCA5 inTIA biosynthesis, we generated transgenic C. roseushairy roots overexpressing ORCA5 (ORCA5-OE). Thetransgenic status of hairy roots was confirmed by PCR(Supplemental Fig. S4A). Two empty vector (EV) con-trol and two overexpression lines (OE-1 andOE-2) wereselected for further analysis. Compared with the EVcontrol, expression of ORCA5was 24- to 40-fold higherin the transgenic lines (Supplemental Fig. S4B). Ex-pression of a number of TIA pathway genes, includingASa, TDC, CPR, G10H, IS, SLS, STR, and SGD, wassignificantly higher in the ORCA5 overexpression linescompared with the EV control. In addition, expressionof the genes encoding C2H2 zinc finger repressors,ZCT1, ZCT2, and ZCT3, was also increased. Interest-ingly, expression of ORCA3 and ORCA4 was increasedsignificantly in ORCA5-overexpressing hairy roots,suggesting that ORCA5 possibly regulates othermembers in the ORCA cluster (Fig. 4A).

Previous studies have shown that overexpression ofORCA3 in C. roseus hairy roots does not result in in-creased TIA accumulation (Peebles et al., 2009; Wanget al., 2010; Zhou et al., 2010). In this study, over-expression of ORCA5 significantly increased the tran-scripts levels of genes in both indole (i.e. AS and TDC)and iridoid (i.e. CPR, G10H, IS, and SLS) branches of theTIA pathway. In addition, expression of the downstreampathway genes, STR and SGD, was also significantly

Figure 3. Derepressed CrMYC2a and ORCA5 syn-ergistically affect TIA pathway genes. Activation ofthe TDC, STR, LAMT, and SLS promoters, fused tothe firefly luciferase (LUC) reporter, by ORCA5,CrMYC2a, and CrMYC2aD126N in tobacco cells isshown. A reporter plasmid containing the promoter-LUC cassette was coelectroporated into tobaccoprotoplasts with effector plasmids harboring TFgenes. Control (CN) represents reporter plasmidalone. A plasmid containing the GUS reporter,driven by the CaMV 35S promoter and rbcS termi-nator, was used as an internal control. LUC andGUSactivities were measured 20 h after electroporation.The LUC activity was normalized against the GUSactivity. Data presented here aremeans6 SD of threebiological replicates. Different letters denote statis-tical differences as assessed by one-way ANOVAand Tukey’s HSD test: P, 0.05.


Paul et al.





increased. To determine the metabolic outcomes ofORCA5 overexpression, we measured the alkaloids inthe two independent hairy root lines. Accumulation oftabersonine, ajmalicine, and catharanthine increasedsignificantly inORCA5-OE lines compared with the EVlines (Fig. 4B).In C. roseus, tabersonine, ajmalicine, and cathar-

anthine are detected in roots and aerial parts, whilevindoline is only accumulated in aerial parts (van derHeijden et al., 2004). Recent studies have shown thatfour separate hydrolases (HL1–HL4) are involved inthe conversion of the unstable intermediate derivedfrom O-acetylstemmadenine to tabersonine by HL1,to catharanthine by HL2, and to vincadifformine byHL3/4 (Qu et al., 2018, 2019; Fig. 1A). In roots, thetabersonine is converted to hörhammericine catalyzedby T19H (Giddings et al., 2011) and MAT (Laflammeet al., 2001). Recently, a BADH acetyltransferase, TAT,

has been characterized in C. roseus. TAT is highly ex-pressed in roots and has been shown to acetylate 19-hydroxytabersonine derivatives from C. roseus roots at ahigher efficiency than MAT (Carqueijeiro et al., 2018b).In addition, two conserved cytochrome P450s, TEX1 andTEX2, have been identified in C. roseus. TEX1 is prefer-entially expressed in roots whereas TEX2 transcripts arepresent in stem, leaf, and flower (Carqueijeiro et al.,2018a). TEX1/2 catalyze the stereoselective epoxidationof tabersonine to lochnericine, which is then converted tohörhammericine by T19H and subsequently acetylatedby TAT to form 19-O-acetylhörhammericine. In a par-allel branch, a root-specific cytochrome P450, V19H,catalyzes the conversion of vincadifformine to mino-vincinine, which is then O-acetylated by MAT to formechitovenine (Williams et al., 2019). We found that,similar to other TIA pathway genes, expression of HL2,HL4, T19H, TAT,MAT, and TEX2was induced by 1.5- to

Figure 4. Relative expression of keyTIA pathway genes and alkaloid accu-mulation in ORCA5-overexpressingC. roseus hairy roots. A, Relative ex-pression of the TIA pathway genes andTF genes in two EV controls and twoORCA5-overexpressing hairy root lines(OE-1 andOE-2) asmeasured by RT-qPCR.B, Measurement of tabersonine, ajmali-cine, and catharanthine in EV con-trols, OE-1, and OE-2. Alkaloids wereextracted and analyzed using liquidchromatography-tandem mass spec-trometry, and the levels of alkaloidswere estimated based on peak areascompared with standards. Data pre-sented here are means 6 SD of threebiological replicates. Statistical sig-nificance was calculated using Stu-dent’s t test: *, P , 0.05; **, P , 0.01;and ***, P , 0.001. DW, Dry weight.





18-fold in MeJA-treated C. roseus seedlings (Fig. 5A).However, we did not observe significant change in theexpression of HL1, HL3, V19H, and TEX1 in response toMeJA treatment. Next, we measured the expression ofthese genes in EV and ORCA5-OE hairy root lines andfound that expression of MAT and T19H was inducedby 20- to 500-fold in ORCA5-OE compared withEV (Fig. 4A). Expression ofHL3,V19H, TEX1, TEX2, andTAT was also induced by twofold to 11-fold in theORCA5-OE lines (Fig. 5B), suggesting that these genesare likely regulated by ORCAs. In the ORCA5-OE lines,expression of HL1 and HL4 was slightly repressedwhereas HL2 expression did not change significantly.This is similar to a recent study where transient over-expression ofORCA3 and/orMYC2a in C. roseus flowerpetal had no effect onHL1 andHL2 expression, indicting

that additional factors are involved in the regulation ofthe TIA pathway (Schweizer et al., 2018).

ORCA5 Activates the ZCT3 Promoter

ZCTs are negative regulators of the TIA pathway(Pauw et al., 2004). In both ORCA4- (Paul et al., 2017)and ORCA5-overexpressing hairy root lines (Fig. 4A),expression of ZCTs was significantly increased. Weanalyzed the cis-elements in the ZCT promoters andfound that the ZCT3 promoter contains putative AP2/ERF-binding sites (GC-rich motif). The findings suggestthat ORCA5 regulates ZCT3 possibly by binding to itspromoter while indirectly regulating ZCT1 and ZCT2.We thus tested the activation of ZCT3 by ORCAs. The

Figure 5. Relative expression of TIApathway genes in response to MeJA andinORCA5-overexpressing hairy roots. A,Ten-day-old C. roseus seedlings (15–17seedlings in each replicate) were treatedwith 100 mM MeJA (JA) for 2 h, and ex-pression of HL1 to HL4, V19H, TEX1,TEX2, T19H, TAT, and MAT in seed-lings was measured by RT-qPCR.Mock-treated seedlings were used ascontrols (CN). B, Relative expressionofHL1 toHL4, V19H, TAT, TEX1, andTEX2 in EV controls and two ORCA5-overexpressing hairy root lines (OE-1and OE-2) was measured by RT-qPCR.C, Activation of the ZCT3 promoter,fused to the luciferase (LUC) reporter,by ORCA3, ORCA4, or ORCA5 in to-bacco cells. D, Transactivation of theORCA5 promoter, fused to the LUCreporter, in tobacco cells. Control (CN)represents reporter plasmid alone. Inboth C and D, a plasmid containing theGUS reporter, driven by the CaMV 35Spromoter and rbcS terminator, wasused as an internal control. LUC andGUS activities were measured 20 hafter electroporation. The LUC activitywas normalized against the GUS activ-ity. Data presented here are means6 SD

of three biological replicates each withfour to five samples. Statistical signifi-cance was calculated using Student’st test: *, P , 0.05 and **, P , 0.01.


Paul et al.



ZCT3 promoter (961 bp) was fused to a firefly luciferasereporter gene and coelectroporated into tobacco pro-toplasts with or without the constructs expressingORCA3, ORCA4, or ORCA5 (Fig. 5C). Only ORCA5moderately but significantly activated the ZCT3 pro-moter compared with the control. To test whetherORCA5 is regulated by ZCT3, the ORCA5 promoterwas fused to a firefly luciferase reporter gene and coe-lectroporated into tobacco protoplasts with or withoutthe construct expressing ZCT3. No significant repres-sion of the ORCA5 promoter was observed (Fig. 5D).To demonstrate that ORCA5 activates ZCT3 likely by

binding to its promoter, we performed a yeast one-hybridassay. Plasmids expressing the GAL4-AD-ORCA5 fusion,controlled by theADH promoter, and theHIS3 nutritionalreporter driven by the ZCT3 promoter were cotrans-formed into yeast cells. Transformed yeast cells, harboringthe ZCT3-HIS3 reporter and AD-ORCA5, grew onselection medium lacking His, Leu, and Trp with50 mM 3-amino-1,2,4-triazole (3-AT), indicating acti-vation of the ZCT3 promoter by ORCA5 (Fig. 6A).

ORCA5 Activates the ORCA4 Promoter

The expression of both ORCA3 and ORCA4 was in-creased significantly in ORCA5-OE hairy root lines(Fig. 4A), indicating that ORCA5 possibly regulates theexpression of ORCA3 and ORCA4. To test this possi-bility, ORCA3 (778 bp), ORCA4 (883 bp), and ORCA5(890 bp) promoters, fused to a firefly luciferase reporter,were coelectroporated into tobacco protoplasts with orwithout the plasmids expressing ORCA3, ORCA4, andORCA5. None of the ORCAs could activate the ORCA3promoter, suggesting that the ORCAs are unable tobind to the promoter despite the induction ofORCA3 inORCA5-OE lines (Fig. 6B). ORCA3 andORCA5, but notORCA4, significantly activated the ORCA4 promoter(Fig. 6C). In addition, ORCA5 activated its own pro-moter compared with the control (Fig. 6D). However,ORCA3 or ORCA4 had no effects on the transcriptionalactivity of theORCA5 promoter (Fig. 6D). The activationofORCA4 by ORCA3 and ORCA5, activation ofORCA3and ORCA4 by ORCA5, and self-regulation of ORCA5indicate the possible presence of autoregulatory andfeed-forward loops in the ORCA cluster.

ORCA3 and ORCA5 Bind to the ORCA4 Promoter

We identified a GC-rich motif (AGCCCGCCC) to bea putative AP2/ERF-binding site in the ORCA4 pro-moter andmutated it to AGCAAAACCby site-directedmutagenesis. The mutant promoter, mORCA4-pro, wasfused to the luciferase reporter to generate a reportervector. The reporter vectors harboring the wild-type ormutant ORCA4 promoter were coelectroporated intotobacco protoplasts with the plasmid expressingORCA5. Mutation in the GC-rich motif reduced acti-vation of the ORCA4 promoter by ORCA5 (Fig. 6C),

suggesting that ORCA5 activates ORCA4 likely bybinding to the GC-rich motif in its promoter.To further verify that ORCA3 and ORCA5 bind the

GC-rich element in theORCA4promoter,we performed ayeast one-hybrid assay. ORCA3 or ORCA5 fused to theGAL4-AD was cotransformed into yeast cells with theHIS3 reporter driven by theORCA4 promoter. Yeast cells,harboring the ORCA4-HIS3 reporter and AD-ORCA3 orAD-ORCA5, grew on selection medium lacking His, Leu,and Trp with 50 mM 3-AT, suggesting that ORCA3 andORCA5 can activate the ORCA4 promoter (Fig. 6A).We also carried out EMSA to validate the binding of

ORCA3 and ORCA5 to the GC-rich motif in the ORCA4promoter. Recombinant, GST-tagged ORCA3 or ORCA5protein was purified and incubated with 59 biotin-labeledprobes covering the GC-rich motif of the ORCA4 pro-moter. Figure 6E shows thatORCA3 andORCA5proteinsindividually interactedwith theGC-richmotif, resulting inamobility shift. The binding ofORCA3 andORCA5 to thelabeled probewas confirmed by a competition experimentusing unlabeled (cold) probes. The binding signals of thebiotin-labeled probes could be eliminated by excess con-centrations (1,0003) of cold probe (Fig. 6E), suggestingthat ORCA3 or ORCA5 binds to the GC-rich motif in theORCA4 promoter.

GC-Rich Motifs Are Present in the Promoters of AP2/ERFGene Clusters in Other Plants

AP2/ERFs are known to bind the GC-rich motifsin target gene promoters (Fujimoto et al., 2000; Shojiet al., 2013). Group IX ERFs bind differentially tothree GC-rich motifs, P-box (CCGCCCTCCA), CS1-box (TAGACCGCCT), and GCC-box (AGCCGCC; Shojiet al., 2013). A recent study has identified a consensus se-quence for GC-rich motifs ([A/C]GC[A/C]C[T/C][C/T]C) present in the promoters of nicotine biosynthetic genesin tobacco (Kajikawa et al., 2017). In addition, ORCA3 andORCA5 bind to a GC-richmotif (AGCCCGCC; this study)in the ORCA4 promoter. The question thus arose whetherGC-rich elements are also present in the promoters ofAP2/ERFgene clusters identified in other plant species. Toaddress this question, we manually searched for similarGC-richmotifs approximately 1 kb 59 of theprotein-codingregions ofNIC2 andGAME9 genes in tobacco, tomato, andpotato. Of the 10 NIC2 promoters, two GC-rich sequenceswere found each of ERF168, ERF115, and ERF179. Bothtomato GAME9-like1 (Solyc01g090300) and GAME9-like2(Solyc01g090310) contain a single GC-rich sequence,while potato GAME9-like2, GAME9-like3, GAME9-like4,andGAME9-like7 (Cárdenas et al., 2016) contain several intheir promoters (Supplemental Fig. S5).

Intracluster and Mutual Regulation in AP2/ERFGene Clusters

The conserved nature of the GC-rich elements in pro-moters of the AP2/ERF clusters indicates the possible






intracluster regulatory mechanisms that are mutuallyshared among different plant species. To test this possi-bility, the C. roseus ORCA4 promoter-luciferase reporterconstruct was coelectroporated into tobacco protoplastswith or without the plasmids expressing tobacco ERF189or ERF221. Both tobacco ERF189 and ERF221 signifi-cantly activated theORCA4 promoter comparedwith the

control (Fig. 7A). Similarly, the tobacco ERF115 (1,056 bp)or ERF179 (1,070 bp) promoter-luciferase reporter con-struct was coelectroporated into tobacco protoplasts withor without the construct expressing ERF189 or ORCA5.The activation of the ERF115 and ERF179 promoters byERF189 or ORCA5 was moderate but statistically sig-nificant (Fig. 7B). In addition, we found two potential

Figure 6. Intracluster regulatory relationship among the members of the ORCA cluster. A, Yeast one-hybrid assay demonstratingactivation of the ORCA4 promoter by ORCA3 or ORCA5 and the ZCT3 promoter by ORCA5. ORCA3 or ORCA5, fused to theGAL4 activation domain (pAD-ORCA3/ORCA5), was cotransformed into yeast cells with the pORCA4-HIS3 or pZCT3-HIS3reporter plasmid. The transformantswere grown in either the double synthetic dropout (SD) selectionmedium lacking Leu and Trp(SD-Leu-Trp) or triple selectionmedium lackingHis, Leu, and Trp (SD-Leu-Trp-His) with 50mM 3-AT. B toD, Transactivation of thepromoters ofORCA3 (B),ORCA4 andmutantORCA4 (m-ORCA4; C), andORCA5 (D) byORCA3,ORCA4, or ORCA5 in tobaccocells. Data presented here are means 6 SD of three biological replicates each with four to five samples. Control (CN) representsreporter plasmid alone. Statistical significance was calculated using Student’s t test: *, P , 0.05 and **, P , 0.01. E, Binding ofORCA3 andORCA5 to theGC-richmotif in theORCA4 promoter. Nucleotide sequence and position of the GC-richmotif relativeto the translation start site are shown at top. The autoradiograph shows the DNA-protein complex of the biotin-labeled probecovering the GC-rich motif with ORCA3 or ORCA5. The binding of the labeled probe was outcompeted by 1,0003 unlabeledprobe (1). F, Model summarizing the intracluster regulation among the ORCAs and coregulation of ORCAs and ZCTs of the TIApathway. The ORCA genes are activated by JA but repressed by ET. ORCA3 and ORCA5 regulate ORCA4. ORCA5 regulates itsown expression. ORCA5 activates ZCT3 whereas ORCAs indirectly regulate ZCT1 and ZCT2. Solid blue arrows indicate acti-vation by JA; solid yellow T-bars represent repression by ET. Solid black arrows represent direct activation, whereas broken blackarrows represent indirect or undetermined activation. ORCA5 activates whereas ZCT represses several genes in the indole andiridoid branches of the TIA pathway.


Paul et al.



ERF-binding motifs (GGCACCT and GGCCAAGC) intheERF115promoter.Mutation of either individualmotifdid not significantly affect the activation of ERF115-luciferase by ERF189; however, mutation of both motifsreduced the activity of ERF115-luciferase reporter by 70%compared with the wild-type promoter (Fig. 7C). Col-lectively, these findings suggest the presence of intra-cluster and mutual regulation in both NIC2 and ORCAclusters.

C. roseus ORCA ERFs and Tobacco NIC2-Locus ERFs AreLikely Interchangeable

C. roseus ORCA3/4/5 are homologous to tobaccoNIC2 locus AP2/ERFs, ERF189 and ERF221 (a.k.a.ORC1; Shoji et al., 2010; De Boer et al., 2011). In addi-tion, both ORCAs andNIC2 ERFs are induced byMeJAand recognize GC-rich motifs in target gene promotersin two diversemetabolic pathways (Shoji et al., 2010; DeBoer et al., 2011). It is thus intriguing to speculate thatC. roseus ORCAs and tobacco NIC2-locus ERFs arefunctionally equivalent and interchangeable. We tested

this assumption by coelectroporation of the putrescineN-methyltransferase (PMT; 1,500 bp) or quinolinate phos-phoribosyltransferase (QPT; 1,579 bp) promoter-luciferasereporter vector into tobacco protoplasts with or withoutthe plasmids expressing ERF221, ORCA3, ORCA4, orORCA5. As expected, ERF221 significantly activatedthe PMT and QPT promoters compared with the con-trol. ORCA3 and ORCA5 also activated the PMT andQPT promoters, although to lower levels comparedwith the activation by ERF221 (Fig. 8A). The STR pro-moter (587 bp) fused to the luciferase reporter was coe-lectroporated into tobacco protoplasts with or withoutthe construct expressing ORCA3, ERF189, or ERF221.Similar to ORCA3, a known STR activator, both ERF189and ERF221 significantly activated the STR promoter(Fig. 8A), suggesting that tobacco ERF189 and ERF221are functional equivalents of C. roseus ORCAs. To de-termine the activation specificity of PMT and QPT byNIC2 ERFs or ORCAs, we cloned a tobacco bZIP TFthat is not involved in the regulation of nicotine bio-synthesis (Yang et al., 2001) and used it as a negativecontrol. As shown in Supplemental Figure S6, the bZIPTF was unable to activate the PMT or QPT promoter in

Figure 7. Mutual regulatory relationship among C. roseus ORCA and tobacco NIC2 AP2/ERFs. A and B, Transactivation of theORCA4 promoter byNIC2 ERF, ERF189, or ERF221 (A) and the tobacco ERF115 and ERF179 promoters by ERF189 or ORCA5 (B).Data represent means 6 SD of three biological samples. Different letters denote statistical differences as assessed by one-wayANOVA and Tukey’s HSD test: P , 0.05. C, Transactivation of the mutant ERF115 promoter by ERF189 in a tobacco protoplast-based transactivation assay. A plasmid containing theGUS reporter, driven by the CaMV 35S promoter and rbcS terminator, wasused as an internal control. Control (CN) represents reporter plasmid alone. The luciferase (LUC) and GUS activities weremeasured 20 h after electroporation. The LUC activity was normalized against the GUS activity. Data presented here are means6 SD of three biological replicates each with four to five samples. Statistical significance was calculated using Student’s t test: *,P , 0.05. WT, Wild type.






Figure 8. C. roseus ORCAs and tobacco NIC2 ERFs are likely interchangeable. A, Transactivation of C. roseus STR promoter byORCA3, ERF189, or ERF221 and tobacco PMT and QPT promoters by ERF221, ORCA3, ORCA4, or ORCA5 in the tobaccoprotoplast assay. A plasmid containing theGUS reporter, driven by the CaMV 35S promoter and rbcS terminator, was used as aninternal control. Control (CN) represents reporter plasmid alone. The luciferase (LUC) and GUS activities were measured 20 hafter electroporation. The LUC activity was normalized against the GUS activity. Data represent means 6 SD of three biologicalreplicates each with four to five samples. Different letters denote statistical differences as assessed by one-way ANOVA andTukey’s HSD test: P , 0.05. B, Relative expression of PMT and QPT in two EV control (EV1 and EV2) and two ORCA5-overexpressing (OE-1 and OE-2) tobacco hairy root lines, as measured by RT-qPCR. Tobacco elongation factor1a (EF1a) wasused as an internal control. C, Nicotine contents in two EV control (EV1 and EV2) and twoORCA5-overexpressing (OE-1 andOE-2) tobacco hairy root lines. Nicotine concentrations are presented as percentage dryweight (%DW). D, Relative expression of STRin EV1 and EV2 (control) and two ERF189-overexpressing (189-OE-1 and 189-OE-2)C. roseus hairy root lines, as measured by RT-qPCR. C. roseus EF1awas used as an internal control. E, Measurement of ajmalicine, catharanthine, and tabersonine in EV1 andEV2 controls, OE-1, and OE-2. Alkaloids were extracted and analyzed using liquid chromatography-tandem mass spectrometry,and the levels of alkaloids were estimated based on peak areas compared with standards. Data presented here are means 6 SD

of three biological replicates. Statistical significance was calculated using Student’s t test: *, P , 0.05; **, P , 0.01; and ***,


Paul et al.



tobacco cells. Similarly, CrMYC1, a C. roseus bHLH TFnot known to regulate the TIA pathway (Chatel et al.,2003), was unable to activate the STR promoter intobacco cells.To functionally verify the conserved regulatory

roles of AP2/ERFs of different clusters, we generatedtobacco hairy roots overexpressing ORCA5. Thetransgenic status of the hairy roots was confirmed byPCR (Supplemental Fig. S7), and two hairy root lineswere used for further analysis. Expression of PMTand QPT was 2.5- to 3- fold higher in ORCA5-expressing hairy roots compared with the EV con-trol (Fig. 8B). Moreover, nicotine contents in the twoORCA5-overexpressing lines were threefold to four-fold higher compared with the control lines (Fig. 8C),a result that is consistent with a previous studyshowing that overexpression of ERF189 in tobaccohairy roots resulted in 2- to 3-fold increases in PMTandQPT expression and alkaloid accumulation (Shojiet al., 2010). We also generated C. roseus hairy rootsoverexpressing ERF189, and two transgenic lineswere used for further analysis (Supplemental Fig. S8). STRexpression was approximately 2-fold higher in ERF189-expressing hairy roots compared with the EV control(Fig. 8D). In addition, the two ERF189-overexpressinglines accumulated 2- to 7-fold higher ajamalicine,catharanthine, and tabersonine compared with thecontrols (Fig. 8E).

DISCUSSION

Physically linked clusters of nonhomologous, struc-tural genes have been identified in numerous plantspecies, including Arabidopsis, rice (Oryza sativa),maize (Zea mays), oat (Avena sativa), tomato, potato, andopium poppy (Papaver somniferum; Boycheva et al.,2014; Nützmann and Osbourn, 2014; Nützmann et al.,2016). These gene clusters generally encode enzymesthat are involved in the biosynthesis of specializedmetabolites (Boycheva et al., 2014; Nützmann andOsbourn, 2014; Nützmann et al., 2016). Unlike thestructural gene clusters, TF gene clusters comprise ho-mologous genes that likely arose as the result of du-plication events. It is unclear whether the duplicated TFgenes are functionally redundant and coregulated bythe same transcriptional circuit or if they have evolvedthrough gene divergence to possess unique functions,including differential responses to hormonal signalsand regulation of one another.We showed that ORCAs and key TIA pathway genes

exhibit two distinct expression patterns in response to ETalone or the combined treatment of ET andMeJA (Fig. 1B).CrMYC2a,ORCA5, and TDCwere up-regulated byMeJA

but not affected by ET. On the other hand, expression ofORCA3, ORCA4, and STR was significantly induced byMeJA and repressed by ET. Moreover, when treated si-multaneously, ET antagonizes the MeJA-induced expres-sion ofORCA3,ORCA4,ORCA5, TDC, and STR (Fig. 1B).Expression divergence has been observed among the to-bacco NIC2 ERFs (Shoji et al., 2010) and tomato JREs(Nakayasu et al., 2018) in response toMeJA andET.MeJA-induced expression of ERF189/199 is antagonized by ET,whereas the expressionof otherNIC2ERFs is insensitive toET treatment (Shoji et al., 2010). Other duplicated regula-tory genes in Arabidopsis also exhibit expression diver-gence (Ganko et al., 2007). The plant genomes sequencedto date have shown whole-genome, tandem, and/or seg-mental duplications that result in neofunctionalization,subfunctionalization, or pseudofunctionalization ofduplicated genes (Rensing et al., 2008; Chae et al.,2014). These findings suggest that duplicated regu-latory genes, including ORCA and NIC2 ERFs, experi-ence subfunctionalization (Shoji et al., 2010).We demonstrated that ORCA5 has a broader trans-

activation specificity than ORCA3 and ORCA4(Fig. 2C). Overexpression of ORCA5 in C. roseus hairyroots significantly induced the expression of genes inthe indole branch and downstream of the iridoidbranch, such as SLS, resulting in increased TIA accu-mulation (Fig. 4A). In addition, expression of CrMYC2awas also up-regulated in ORCA5-overexpressing hairyroots. In tobacco, not all NIC2 ERFs are equally effectivein activating nicotine pathway genes. This functionaldivergence among the ERFs may be attributed to thesequence differences in the AP2 DNA-binding domainand/or the region outside of the AP2 domain (Shojiet al., 2010). MYC2 is known to regulate plant special-ized metabolites, including nicotine, TIAs, and SGA.Previously, we have demonstrated that CrMYC2a ex-pression strongly correlateswith those of TIA structuraland regulatory genes. Similar to MYC2 regulation ofnicotine biosynthesis in tobacco (Shoji and Hashimoto,2011), CrMYC2a coregulates TIA pathway genes withORCA3 (Paul et al., 2017). In addition, CrMYC2a expres-sion is induced in response to JA (Fig. 1B) and increased inORCA5-overexpressing hairy roots (Fig. 4A). A recentstudy has shown that transient co-overexpression of aderepressed CrMYC2a (CrMYC2aD126N) with ORCA3synergistically affects the expression of several TIApathway genes (Schweizer et al., 2018). Similar to theprevious study, we found that CrMYC2aD126N, whencoexpressed with ORCA5, has additive effects on theactivation of TIA pathway genes. Collectively, thesefindings suggest that CrMYC2a andORCAs are part ofa regulatory network that modulates TIA biosynthesisin C. roseus. Transient overexpression of CrMYC2a orCrMYC2aD126N alone or in combination with ORCA3

Figure 8. (Continued.)P, 0.001. F, Model depicting the mutual regulatory relationship among and between the ORCA and NIC2 locus AP2/ERFs. Thinsolid arrows represent direct activation, and thin broken arrows represent indirect activation within a cluster. Thick arrows in-dicate the interspecies mutual regulation of the ERFs.







activates a limited number of TIA pathway genes,suggesting that additional but unidentified TFs arelikely involved in the TIA gene regulatory network.

Positive and negative regulatory loops are thehallmarks of metabolic pathways in plants. In theArabidopsis JA signaling pathway, MYC2 activatesthe expression of JAZ repressors, which, in turn, in-teract with MYC2 to attenuate the intensity of the JAsignal (Chini et al., 2007; Kazan and Manners, 2013).AtMYBL2, a repressor of anthocyanin biosynthesis inArabidopsis, is regulated by the bHLH activator,TRANSPARENT TESTA8 (TT8). AtMYBL2 competeswith the R2R3 MYBs, PAP1 and PAP2, to form acomplex with TT8 that represses anthocyanin accu-mulation (Matsui et al., 2008). Recently, we demon-strated that in C. roseus, CrMYC2a and BIS1 activatethe expression of the bHLH TF, RMT1, which acts asa repressor of CrMYC2a targets (Patra et al., 2018).Similarly, in tomato, MYC2 regulates the expressionof a small group of JA-responsive bHLH TFs, MYC2-targeted bHLH1 (MTB1), MTB2, and MTB3. MTBproteins inhibit the formation of the MYC2-MED25complex and compete with MYC2 to bind to its tar-gets (Liu et al., 2019). Here, we showed that, similarto ORCA4 (Paul et al., 2017), overexpression ofORCA5 significantly activates ZCTs in C. roseus hairyroots (Fig. 4A). Moreover, we demonstrated thatORCA5 activates ZCT3 possibly by binding to theGC-rich element in the promoter (Figs. 5C and 6A).In C. roseus cells, ZCTs repress STR and TDC, thedirect targets of ORCAs, by binding to their pro-moters (Pauw et al., 2004). The up-regulation of ZCTsby ORCA4 or ORCA5 overexpression suggests theexistence of a negative regulatory loop that is prob-ably involved in the fine-tuning of TIA biosynthesis(Fig. 6F).

Individual genes in the tobacco and C. roseus ERFgene clusters play overlapping and unique roles incontrolling the structural genes in nicotine and TIAbiosynthetic pathways, respectively (Shoji et al., 2010;Paul et al., 2017). However, the regulatory relation-ship among the members within an ERF cluster, orany known plant TF clusters, has not been elucidatedprior to this study. Here, we demonstrated that anintracluster regulatory mechanism exists in both theC. roseus ORCA cluster and the tobacco NIC2 cluster.The self-regulated ORCA5 activates ORCA4 bybinding to its promoter and ORCA3, likely throughan uncharacterized TF. ORCA3 also activates ORCA4by binding to the GC-rich motif in its promoter(Fig. 6). In tobacco, ERF189 activates both the ERF115and ERF179 promoters (Fig. 7B). GC-rich sequencesare not found within the 1-kb promoter regions ofERF189 and GAME9. The fact that GC-rich motifs arepresent only in the promoters of some ERFs indicatesthat certain key regulators, such as ERF189, likelyplay important roles in controlling the amplificationloop in the ERF cluster. The intracluster regulationof ERF clusters implies that the individual compo-nents within a cluster are not simply redundant

duplications of one another. The positive amplifica-tion loops help plants to make sufficient precursorsrequired for the spatiotemporal biosynthesis of spe-cialized metabolites. The mechanism is likely con-served in other ERF clusters in plants. It is alsoreasonable to predict that similar self-regulationmechanisms exist in other TF clusters, such as thoseformed by group III AP2/ERFs, CBFs (Zhang et al.,2004), and ARFs (Hagen and Guilfoyle, 2002).

The conserved nature of the intra-ERF-clusterregulation prompted us to speculate that ERFs fromgene clusters of different plant species are function-ally equivalent and interchangeable, despite low se-quence similarity (35% to 51%). In this study, weshowed that C. roseus ORCA5 can activate both to-bacco ERF115 and ERF179, and tobacco ERF189 andERF221 can activate the C. roseus ORCA4 promoter(Fig. 7, A and B). Furthermore, ORCA3 and ORCA5can activate the PMT and QPT promoters (Fig. 8A).Similarly, the STR promoter in the TIA pathwaycan be activated by tobacco ERF189 and ERF221(Fig. 8A). Moreover, ORCA5 overexpression in to-bacco hairy roots induced the expression of PMT andQPT, resulting in increased nicotine accumulation(Fig. 8, B and C). Similarly, ERF189 overexpression inC. roseus hairy roots activated the expression of STRand induced TIA accumulation (Fig. 8, D and E). Themutual activations of two distinct metabolic path-ways by the ORCA and NIC2 clusters support ourhypothesis that the AP2/ERFs are functionallyequivalent and are likely interchangeable (Fig. 8F).Other ERF gene clusters, such as GAME9 ERFs oftomato and potato (Supplemental Fig. S5), also con-tain the GC-rich elements in their promoters andrespond to JA induction similar to the ORCA andNIC2 clusters. We thus propose that the intraclusterand mutual regulatory functions are widely con-served among the ERF gene clusters of diverse plantspecies, although additional experimental verifica-tions are required.

TF gene clusters have been identified in nonplantorganisms, including nematodes, Drosophila, mouse,and human. The nonplant, homeodomain HOX TFclusters, which play critical roles in invertebrate andvertebrate development, have been characterized(Lappin et al., 2006; Montavon and Duboule, 2013).By comparison, the plant TF clusters are poorly in-vestigated. As more and more TF clusters are beingidentified, the unique functions and mutual regula-tory relationships of the clustered TFs require in-depth examination. Central to the knowledge gapsis the regulatory relationship within a cluster andamong different species. Understanding of such re-lationships will shed light on TF evolution as wellas the functional equivalence and divergence of TFsinvolved in specialized metabolism. This studydemonstrates intracluster and mutual regulation ofAP2/ERF gene clusters, suggesting that a conservedregulatory mechanism modulates the biosynthesis ofdiverse groups of plant specialized metabolites.


Paul et al.




MATERIALS AND METHODS

Plant Materials

Catharanthus roseus ‘Little Bright Eye’ (NE Seed) was used for cloning, geneexpression, and generation of transgenic hairy roots. The tobacco (Nicotianatabacum) ‘Xanthi’ cell line was used for protoplast-based transient expressionassays. Tobacco ‘Samsun NN’ was used for the generation of hairy roots.

RNA Isolation and cDNA Synthesis

C. roseus ‘Little Bright Eye’ seeds were surface sterilized using 30% (v/v)commercial bleach for 15 min, washed five times with sterile water, and inoc-ulated on one-half-strength Murashige and Skoog (MS) medium (CaissonLabs). The plates were kept at 28°C in the dark for 2 d and then transferred to agrowth room at 28°C with constant light (Patra et al., 2018). Ten-day-oldseedlings were immersed in one-half-strength MS medium with 100 mM MeJAand/or 50 mM ET precursor, ACC, for 2 h. Mock-treated seedlings were used ascontrols. Total RNA isolated from the seedlingswas used for cDNA synthesis asdescribed previously (Suttipanta et al., 2007).

RT-qPCR

RT-qPCR was performed as described previously (Suttipanta et al., 2011).The primers used in RT-qPCR are listed in Supplemental Table S1. In additionto the C. roseus EF1a, 40S Ribosomal Protein S9 was used as a second internalcontrol (Liscombe et al., 2010). All PCRs were performed in triplicate and re-peated at least twice.

Total RNAs isolated fromEV control andORCA5-overexpressing hairy rootswere used for cDNA synthesis and RT-qPCR as previously described(Suttipanta et al., 2011). The comparative cycle threshold method (AppliedBiosystems) was used to measure transcript levels. In addition to tobacco EF1a(Shoji et al., 2010; GenBank accession no. D63396), a-tubulin (GenBank acces-sion no. AJ421411) was also used as a reference gene.

Subcellular Localization

For subcellular localization, the full-length cDNAofORCA5was fused to theN terminus of the eGFP driven by the CaMV 35S promoter and rbcS terminatorin a pBS plasmid to generate pORCA5-eGFP. A pBS plasmid containing onlyeGFP was used as a control. The plasmids containing either eGFP or ORCA5-eGFP were individually electroporated into tobacco protoplasts as describedpreviously (Pattanaik et al., 2010b) and visualized after 20 h of incubation in thedark with a fluorescence microscope (Eclipse TE200; Nikon).

Tobacco Protoplast Isolation and Electroporation

The 59 flanking regions of LAMT (21,375 to 21; relative to the ATG), SLS(2979 to 21), STR (2586 to 21), ZCT3 (2960 to 21), ORCA3 (2777 to 21),ORCA4 (2882 to21), andORCA5 (2889 to21) promoters were PCR amplifiedfrom C. roseus genomic DNA. The PMT (21,499 to 21), QPT (21,578 to 21),ERF115 (21,055 to 23), and ERF179 (21,069 to 23) promoters were amplifiedfrom tobacco genomic DNA using gene-specific primers. The two GC-richmotifs, TGGCACCT and GGCCAAGC, in the ERF115 promoter were mu-tated to aaaACCT and GaaaAAGC using site-directed mutagenesis. The re-porter plasmids for transient protoplast assays were generated by cloningLAMT, SLS, STR, ZCT3,ORCA3/4/5, PMT, ERF115, and ERF179 promoters in amodified pUC vector containing a firefly luciferase and rbcS terminator. Theeffector plasmids were constructed by cloning ORCA3/4/5, ERF189/221, andZCT3 into a modified pBS vector under the control of the CaMV 35S promoterand rbcS terminator. The GUS driven by the CaMV 35S promoter and rbcSterminator was used as an internal control in the protoplast assay. For thetransactivation assay, ORCA3, ORCA4, and ORCA5 were fused to theGAL4 DNA-binding domain in a pBS plasmid containing a mirabilis mosaicvirus promoter and rbcS terminator. The reporter plasmid used in the assaycontains firefly luciferase driven by a minimal CaMV 35S promoter with fivetandem repeats of GAL4 Response Elements and rbcS terminator fused. Proto-plast isolation from tobacco cell suspension cultures and electroporation withsupercoiled plasmid DNA were performed using previously described proto-cols (Pattanaik et al., 2010b). The reporter, effector, and internal control plas-mids were electroporated into tobacco protoplasts in different combinations;

luciferase and GUS activities in transfected protoplasts were measured as de-scribed previously (Suttipanta et al., 2007). Each experiment was repeatedthree times.

Construction of a Plant Expression Vector and Generationof Hairy Roots

For plant transformation, ORCA5 and ERF189 were PCR amplified from C.roseus and tobacco seedling cDNA, respectively, and cloned in pCAMBIA2301vector containing the CaMV 35S promoter and the rbcS terminator (Pattanaiket al., 2010a). The pCAMBIA2301 vector alone was used as an EV control. Theplasmids were mobilized into Agrobacterium rhizogenes R1000 by freeze-thaw.Transformation of C. roseus seedlings and generation of hairy roots were per-formed using the protocol described previously (Suttipanta et al., 2011; Paulet al., 2017). The transgenic status of the hairy root lines was verified by PCRamplification of rolB, rolC, virC, nptII, andGUS genes. Primers used in this studyare listed in Supplemental Table S1. Two independent hairy root lines wereselected for further analysis.

Alkaloid Extraction and Analysis

For extraction of alkaloids, 10-d-old seedlings were immersed in one-half-strength MS medium with 100 mM MeJA and/or 50 mM ACC for 24 h. MeJA-and/or ACC-treated seedlings and transgenic hairy roots were frozen in liquidnitrogen and ground to powder. Samples were extracted in methanol (1:100,w/v) twice for 24 h on a shaker. Pooled extracts were then dried via a rotaryevaporator and diluted in methanol (10 mL mg21 of the initial sample). Thesamples were then analyzed using HPLC, followed by electrospray injection ina tandem mass spectrometer, as previously described (Suttipanta et al., 2011;Paul et al., 2017). The known alkaloid standards were run to identify elutiontimes and mass fragments.

Yeast One-Hybrid Assay

The ORCA4 (883 bp)/ZCT3 (961 bp) promoter was cloned in the pHIS2vector (Clontech), containing the HIS3 reporter gene, to generate the reporterplasmid (pORCA4/ZCT3-HIS3). The full-length ORCA3 and ORCA5 cDNAswere cloned into the yeast expression plasmid, pAD-GAL4-2.1 (Stratagene), togenerate the effector plasmids (pORCA3/ORCA5-AD). The reporter and ef-fector plasmids were transformed into yeast strain Y187, and transformantswere selected on SD medium lacking Leu and Trp. Transformed colonies werethen streaked on SD medium lacking His, Leu, and Trp with 50 mM 3-AT tocheck promoter activation.

Recombinant Protein Production and EMSA

The ORCA3, ORCA4, and ORCA5 genes were cloned into the pGEX 4T-1 vector (GE Healthcare Biosciences) to generate GST fusion proteins. Theconstructs were verified by DNA sequencing and transformed into Escherichiacoli BL21 cells containing pRIL (Agilent). Protein expression was induced byadding isopropyl b-D-thiogalactopyranoside to a final concentration of 0.1 mM

to the cell cultures at A600 ; 0.8 and induced for 2 h at 37°C. The cells wereharvested by centrifugation and lysed using CelLytic B (Sigma) according to themanufacturer’s instructions. The GST fusion proteins were bound to Gluta-thione Sepharose 4B columns (Amersham) and eluted by using 10 mM reducedglutathione in 50 mM Tris-HCl (pH 8) buffer. Bacterial expression and purifi-cation of recombinant CrMYC2a protein were performed as previously de-scribed (Patra et al., 2018). For EMSA experiments, biotin-labeled DNA probeswere synthesized by Integrated DNA Technologies and annealed to producedouble-stranded probes. cDNAprobeswere designed to include the jasmonate-responsive elements of the STR promoter (2100ACATCACTCTTAGACCGCCTTCTTTGAAAGTGATTTCCCTTGGACCTT258 relative to the transcrip-tion start site; van der Fits andMemelink, 2001) and putativeGC-rich element oftheORCA4 promoter (2106CCTTCATAGCCCGCCCAATTGGTAAACGTGCACCAACCTCC266 relative to the translation start, ATG). The EMSA experimentwas carried out using a light-shift chemiluminescent EMSA kit (Thermo FisherScientific). For the binding reactions, 40 fmol of double-stranded DNA wasincubated with purified protein (500 ng of each protein) for 60 min at roomtemperature. The protein-DNA binding for ORCA5 was further confirmed byperforming competition experiments, where 10-, 100-, and 1,000-fold excessamounts of cold probe (without biotin label) were added to the binding







reactions. For ORCA3 and ORCA4, a 1,000-fold excess amount of cold probewas added to the binding reactions. Recombinant CrMYC2a protein was usedas a negative control on biotin-labeled STR probe. The DNA-protein complexeswere resolved by electrophoresis on 6% nondenaturing polyacrylamide gelsand then transferred to BiodyneB modified membrane (0.45 mm; Pierce). Theband shifts were detected by a chemiluminescent nucleic acid detectionmodule(Pierce) and exposed to x-ray films.

Phylogenetic Analysis of Group IX AP2/ERFs

Protein sequences for tobacco, tomato (Solanum lycopersicum), and potato(Solanum tuberosum) were downloaded from the Sol Genomics Network data-base (Fernandez-Pozo et al., 2015), and protein sequences for C. roseus wereobtained from the Medicinal Plant Genomics Resource database (http://medicinalplantgenomics.msu.edu/). The Arabidopsis (Arabidopsis thaliana)AP2/ERFs sequences were obtained from a previously published report(Nakano et al., 2006). The group IX AP2/ERF protein sequences from Arabi-dopsis were used as queries using BLAST (Camacho et al., 2009) to identify theAP2/ERFs from tobacco, tomato, potato, and C. roseus. Putative AP2/ERF se-quences were screened using the Pfam database for the AP2/ERF domain (Finnet al., 2016). The group IX AP2/ERF protein sequences were aligned usingClustalW with the default settings, and MEGA6.0 was used to construct thephylogenetic tree using the neighbor-joining method with bootstrap values setas 1,000 replicates. The tree image was generated with the Evolview v2 (Heet al., 2016).

Generation of Tobacco Hairy Roots and Measurementof Nicotine

Leaf discs of in vitro-grown tobacco ‘Samsun NN’ plantlets were infectedwith A. rhizogenes strain R1000 harboring the pCAMBIA2301-ORCA5 over-expression construct. After 2 d of co-cultivation, leaf discs were transferred toMSmedium supplemented with 400 mg L21 cefotaxime and kept at 25°C in thedark. Hairy roots developed from the leaf discs were transferred toMSmediumwith 400 mg L21 cefotaxime and 100 mg L21 kanamycin for furtherproliferation.

Freeze-dried EV control and ORCA5-overexpressing hairy roots were ex-haustively extracted for pyridine alkaloids by methyl tert-butyl alcohol andaqueous sodium hydroxide. Alkaloid contents were determined using gaschromatography with flame ionization detection (Perkin Elmer; Lewis et al.,2008). Nicotine content was reported as percentages on a dry tobaccoweight basis.

Statistical Analyses

The data presented herewere statistically analyzed by Student’s t test or one-way ANOVA and Tukey’s HSD test for multiple comparisons. The significancelevels (P values) are described in the figure legends.

Accession Numbers

Accession numbers are as follows: AJ251249 (ORCA3), KR703577 (ORCA4),KR703578 (ORCA5), AB827951 (ERF189), and XM_016622819 (ERF221).

Supplemental Data

The following supplemental materials are available.

Supplemental Figure S1. Phylogenetic analysis of group IX AP2/ERFs intobacco, tomato, potato, and C. roseus.

Supplemental Figure S2. Subcellular localization of ORCA5 and transac-tivation assay of ORCAs in tobacco cells.

Supplemental Figure S3. ORCA5 and CrMYC2a binding to the GC-richmotif in the STR promoter.

Supplemental Figure S4. Molecular analysis of ORCA5-overexpressing C.roseus hairy roots.

Supplemental Figure S5. Positions and sequences of GC-rich motifs in theAP2/ERF promoters of C. roseus, tobacco, tomato, and potato.

Supplemental Figure S6. Activation assays of the QPT, PMT, and STRpromoters using tobacco bZIP and CrMYC1.

Supplemental Figure S7. Molecular analysis of ORCA5-overexpressingtobacco hairy roots.

Supplemental Figure S8. Molecular analysis of ERF189-overexpressing C.roseus hairy roots.

Supplemental Table S1. Oligonucleotides used in this study.

ACKNOWLEDGMENTS

We thank John May (Department of Civil Engineering and EnvironmentalResearch Training Laboratories, University of Kentucky) for assistance onliquid chromatography-tandem mass spectrometry and Huihua Ji (KentuckyTobacco Research and Development Center, University of Kentucky) for assis-tance on nicotine measurement.

Received June 25, 2019; accepted October 28, 2019; published November 14,2019.

LITERATURE CITED

Boycheva S, Daviet L, Wolfender JL, Fitzpatrick TB (2014) The rise ofoperon-like gene clusters in plants. Trends Plant Sci 19: 447–459

Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K,Madden TL (2009) BLAST1: Architecture and applications. BMC Bio-informatics 10: 421

Cárdenas PD, Sonawane PD, Pollier J, Vanden Bossche R, Dewangan V,Weithorn E, Tal L, Meir S, Rogachev I, Malitsky S, et al (2016) GAME9regulates the biosynthesis of steroidal alkaloids and upstream isopre-noids in the plant mevalonate pathway. Nat Commun 7: 10654

Carqueijeiro I, Brown S, Chung K, Dang TT, Walia M, Besseau S, Dugéde Bernonville T, Oudin A, Lanoue A, Billet K, et al (2018a) Twotabersonine 6,7-epoxidases initiate lochnericine-derived alkaloid bio-synthesis in Catharanthus roseus. Plant Physiol 177: 1473–1486

Carqueijeiro I, Dugé de Bernonville T, Lanoue A, Dang TT, Teijaro CN,Paetz C, Billet K, Mosquera A, Oudin A, Besseau S, et al (2018b) ABAHD acyltransferase catalyzing 19-O-acetylation of tabersonine de-rivatives in roots of Catharanthus roseus enables combinatorial syn-thesis of monoterpene indole alkaloids. Plant J 94: 469–484

Chae L, Kim T, Nilo-Poyanco R, Rhee SY (2014) Genomic signatures ofspecialized metabolism in plants. Science 344: 510–513

Chatel G, Montiel G, Pré M, Memelink J, Thiersault M, Saint-Pierre B,Doireau P, Gantet P (2003) CrMYC1, a Catharanthus roseus elicitor- andjasmonate-responsive bHLH transcription factor that binds the G-boxelement of the strictosidine synthase gene promoter. J Exp Bot 54:2587–2588

Chini A, Fonseca S, Fernández G, Adie B, Chico JM, Lorenzo O, García-Casado G, López-Vidriero I, Lozano FM, Ponce MR, et al (2007) TheJAZ family of repressors is the missing link in jasmonate signalling.Nature 448: 666–671

Colinas M, Goossens A (2018) Combinatorial transcriptional control ofplant specialized metabolism. Trends Plant Sci 23: 324–336

De Boer K, Tilleman S, Pauwels L, Vanden Bossche R, De Sutter V,Vanderhaeghen R, Hilson P, Hamill JD, Goossens A (2011) APE-TALA2/ETHYLENE RESPONSE FACTOR and basic helix-loop-helixtobacco transcription factors cooperatively mediate jasmonate-elicitednicotine biosynthesis. Plant J 66: 1053–1065

Fernandez-Pozo N, Menda N, Edwards JD, Saha S, Tecle IY, Strickler SR,Bombarely A, Fisher-York T, Pujar A, Foerster H, et al (2015) The SolGenomics Network (SGN): From genotype to phenotype to breeding.Nucleic Acids Res 43: D1036–D1041

Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, PotterSC, Punta M, Qureshi M, Sangrador-Vegas A, et al (2016) The Pfamprotein families database: Towards a more sustainable future. NucleicAcids Res 44: D279–D285

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Ara-bidopsis ethylene-responsive element binding factors act as transcrip-tional activators or repressors of GCC box-mediated gene expression.Plant Cell 12: 393–404


Paul et al.


http://medicinalplantgenomics.msu.edu/

http://medicinalplantgenomics.msu.edu/











Ganko EW, Meyers BC, Vision TJ (2007) Divergence in expression be-tween duplicated genes in Arabidopsis. Mol Biol Evol 24: 2298–2309

Giddings LA, Liscombe DK, Hamilton JP, Childs KL, DellaPenna D,Buell CR, O’Connor SE (2011) A stereoselective hydroxylation step ofalkaloid biosynthesis by a unique cytochrome P450 in Catharanthusroseus. J Biol Chem 286: 16751–16757

Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM,Thomashow MF (1998) Low temperature regulation of the ArabidopsisCBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 16: 433–442

Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: Genes,promoters and regulatory factors. Plant Mol Biol 49: 373–385

He Z, Zhang H, Gao S, Lercher MJ, Chen WH, Hu S (2016) Evolview v2:An online visualization and management tool for customized and an-notated phylogenetic trees. Nucleic Acids Res 44: W236–W241

Kajikawa M, Sierro N, Kawaguchi H, Bakaher N, Ivanov NV, HashimotoT, Shoji T (2017) Genomic insights into the evolution of the nicotinebiosynthesis pathway in tobacco. Plant Physiol 174: 999–1011

Kazan K, Manners JM (2013) MYC2: The master in action. Mol Plant 6:686–703

Kellner F, Kim J, Clavijo BJ, Hamilton JP, Childs KL, Vaillancourt B,Cepela J, Habermann M, Steuernagel B, Clissold L, et al (2015)Genome-guided investigation of plant natural product biosynthesis.Plant J 82: 680–692

Laflamme P, St-Pierre B, De Luca V (2001) Molecular and biochemicalanalysis of a Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase. Plant Physiol 125: 189–198

Lappin TR, Grier DG, Thompson A, Halliday HL (2006) HOX genes: Se-ductive science, mysterious mechanisms. Ulster Med J 75: 23–31

Lewis RS, Jack AM, Morris JW, Robert VJ, Gavilano LB, Siminszky B,Bush LP, Hayes AJ, Dewey RE (2008) RNA interference (RNAi)-in-duced suppression of nicotine demethylase activity reduces levels of akey carcinogen in cured tobacco leaves. Plant Biotechnol J 6: 346–354

Li J, Zhang K, Meng Y, Hu J, Ding M, Bian J, Yan M, Han J, Zhou M(2018) Jasmonic acid/ethylene signaling coordinates hydroxycinnamicacid amides biosynthesis through ORA59 transcription factor. Plant J 95:444–457

Liscombe DK, Usera AR, O’Connor SE (2010) Homolog of tocopherol Cmethyltransferases catalyzes N methylation in anticancer alkaloid bio-synthesis. Proc Natl Acad Sci USA 107: 18793–18798

Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, ZhaiQ (2019) MYC2 regulates the termination of jasmonate signaling via anautoregulatory negative feedback loop. Plant Cell 31: 106–127

Lu X, Zhang L, Zhang F, Jiang W, Shen Q, Zhang L, Lv Z, Wang G, TangK (2013) AaORA, a trichome-specific AP2/ERF transcription factor ofArtemisia annua, is a positive regulator in the artemisinin biosyntheticpathway and in disease resistance to Botrytis cinerea. New Phytol 198:1191–1202

Matsui K, Umemura Y, Ohme-Takagi M (2008) AtMYBL2, a protein with asingle MYB domain, acts as a negative regulator of anthocyanin bio-synthesis in Arabidopsis. Plant J 55: 954–967

Mirjalili N, Linden JC (1996) Methyl jasmonate induced production oftaxol in suspension cultures of Taxus cuspidata: Ethylene interactionand induction models. Biotechnol Prog 12: 110–118

Montavon T, Duboule D (2013) Chromatin organization and global reg-ulation of Hox gene clusters. Philos Trans R Soc Lond B Biol Sci 368:20120367

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysisof the ERF gene family in Arabidopsis and rice. Plant Physiol 140:411–432

Nakayasu M, Shioya N, Shikata M, Thagun C, Abdelkareem A, Okabe Y,Ariizumi T, Arimura GI, Mizutani M, Ezura H, et al (2018) JRE4 is amaster transcriptional regulator of defense-related steroidal glyco-alkaloids in tomato. Plant J 94: 975–990

Nützmann HW, Huang A, Osbourn A (2016) Plant metabolic clusters:From genetics to genomics. New Phytol 211: 771–789

Nützmann HW, Osbourn A (2014) Gene clustering in plant specializedmetabolism. Curr Opin Biotechnol 26: 91–99

Patra B, Pattanaik S, Schluttenhofer C, Yuan L (2018) A network ofjasmonate-responsive bHLH factors modulate monoterpenoid indolealkaloid biosynthesis in Catharanthus roseus. New Phytol 217:1566–1581

Pattanaik S, Kong Q, Zaitlin D, Werkman JR, Xie CH, Patra B, Yuan L(2010a) Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta 231: 1061–1076

Pattanaik S, Werkman JR, Kong Q, Yuan L (2010b) Site-directed muta-genesis and saturation mutagenesis for the functional study of tran-scription factors involved in plant secondary metabolite biosynthesis. InAG Fett-Neto, ed, Plant Secondary Metabolism Engineering: Methodsand Applications. Humana Press, Totowa, NJ, pp 47–57

Paul P, Singh SK, Patra B, Sui X, Pattanaik S, Yuan L (2017) A differen-tially regulated AP2/ERF transcription factor gene cluster acts down-stream of a MAP kinase cascade to modulate terpenoid indole alkaloidbiosynthesis in Catharanthus roseus. New Phytol 213: 1107–1123

Pauw B, Hilliou FAO, Martin VS, Chatel G, de Wolf CJF, Champion A,Pré M, van Duijn B, Kijne JW, van der Fits L, et al (2004) Zinc fingerproteins act as transcriptional repressors of alkaloid biosynthesis genesin Catharanthus roseus. J Biol Chem 279: 52940–52948

Peebles CA, Hughes EH, Shanks JV, San KY (2009) Transcriptional re-sponse of the terpenoid indole alkaloid pathway to the overexpressionof ORCA3 along with jasmonic acid elicitation of Catharanthus roseushairy roots over time. Metab Eng 11: 76–86

Qu Y, Easson MEAM, Simionescu R, Hajicek J, Thamm AMK, Salim V,De Luca V (2018) Solution of the multistep pathway for assembly ofcorynanthean, strychnos, iboga, and aspidosperma monoterpenoid in-dole alkaloids from 19E-geissoschizine. Proc Natl Acad Sci USA 115:3180–3185

Qu Y, Safonova O, De Luca V (2019) Completion of the canonical pathwayfor assembly of anticancer drugs vincristine/vinblastine in Catharanthusroseus. Plant J 97: 257–266

Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H,Nishiyama T, Perroud PF, Lindquist EA, Kamisugi Y, et al (2008) ThePhyscomitrella genome reveals evolutionary insights into the conquestof land by plants. Science 319: 64–69

Sánchez-Pérez R, Pavan S, Mazzeo R, Moldovan C, Aiese Cigliano R, DelCueto J, Ricciardi F, Lotti C, Ricciardi L, Dicenta F, et al (2019) Mu-tation of a bHLH transcription factor allowed almond domestication.Science 364: 1095–1098

Schweizer F, Colinas M, Pollier J, Van Moerkercke A, Vanden Bossche R,de Clercq R, Goossens A (2018) An engineered combinatorial module oftranscription factors boosts production of monoterpenoid indole alka-loids in Catharanthus roseus. Metab Eng 48: 150–162

Shen Q, Lu X, Yan T, Fu X, Lv Z, Zhang F, Pan Q, Wang G, Sun X, Tang K(2016) The jasmonate-responsive AaMYC2 transcription factor posi-tively regulates artemisinin biosynthesis in Artemisia annua. New Phytol210: 1269–1281

Shoji T, Hashimoto T (2011) Tobacco MYC2 regulates jasmonate-induciblenicotine biosynthesis genes directly and by way of the NIC2-locus ERFgenes. Plant Cell Physiol 52: 1117–1130

Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factorgenes regulate nicotine biosynthesis in tobacco. Plant Cell 22: 3390–3409

Shoji T, Mishima M, Hashimoto T (2013) Divergent DNA-binding speci-ficities of a group of ETHYLENE RESPONSE FACTOR transcriptionfactors involved in plant defense. Plant Physiol 162: 977–990

Shoji T, Nakajima K, Hashimoto T (2000) Ethylene suppresses jasmonate-induced gene expression in nicotine biosynthesis. Plant Cell Physiol 41:1072–1076

Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L (2007)Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylasegene involved in terpenoid indole alkaloid biosynthesis. Biochim Bio-phys Acta 1769: 139–148

Suttipanta N, Pattanaik S, Kulshrestha M, Patra B, Singh SK, Yuan L(2011) The transcription factor CrWRKY1 positively regulates the ter-penoid indole alkaloid biosynthesis in Catharanthus roseus. Plant Physiol157: 2081–2093

Thagun C, Imanishi S, Kudo T, Nakabayashi R, Ohyama K, Mori T,Kawamoto K, Nakamura Y, Katayama M, Nonaka S, et al (2016)Jasmonate-responsive ERF transcription factors regulate steroidal gly-coalkaloid biosynthesis in tomato. Plant Cell Physiol 57: 961–975

Udomsom N, Rai A, Suzuki H, Okuyama J, Imai R, Mori T, NakabayashiR, Saito K, Yamazaki M (2016) Function of AP2/ERF transcriptionfactors involved in the regulation of specialized metabolism in Ophior-rhiza pumila revealed by transcriptomics and metabolomics. Front PlantSci 7: 1861





van der Fits L, Memelink J (2000) ORCA3, a jasmonate-responsive tran-scriptional regulator of plant primary and secondary metabolism. Sci-ence 289: 295–297

van der Fits L, Memelink J (2001) The jasmonate-inducible AP2/ERF-do-main transcription factor ORCA3 activates gene expression via inter-action with a jasmonate-responsive promoter element. Plant J 25: 43–53

van der Heijden R, Jacobs DI, Snoeijer W, Hallard D, Verpoorte R (2004)The Catharanthus alkaloids: Pharmacognosy and biotechnology. CurrMed Chem 11: 607–628

Van Moerkercke A, Steensma P, Gariboldi I, Espoz J, Purnama PC,Schweizer F, Miettinen K, Vanden Bossche R, De Clercq R, MemelinkJ, et al (2016) The basic helix-loop-helix transcription factor BIS2 is es-sential for monoterpenoid indole alkaloid production in the medicinalplant Catharanthus roseus. Plant J 88: 3–12

Van Moerkercke A, Steensma P, Schweizer F, Pollier J, Gariboldi I,Payne R, Vanden Bossche R, Miettinen K, Espoz J, Purnama PC, et al(2015) The bHLH transcription factor BIS1 controls the iridoid branch ofthe monoterpenoid indole alkaloid pathway in Catharanthus roseus. ProcNatl Acad Sci USA 112: 8130–8135

Wang CT, Liu H, Gao XS, Zhang HX (2010) Overexpression of G10H andORCA3 in the hairy roots of Catharanthus roseus improves cathar-anthine production. Plant Cell Rep 29: 887–894

Williams D, Qu Y, Simionescu R, De Luca V (2019) The assembly of (1)-vincadifformine- and (2)-tabersonine-derived monoterpenoid indolealkaloids in Catharanthus roseus involves separate branch pathways.Plant J 99: 626–636

Winz RA, Baldwin IT (2001) Molecular interactions between the specialistherbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural hostNicotiana attenuata. IV. Insect-induced ethylene reduces jasmonate-induced

nicotine accumulation by regulating putrescine N-methyltransferase tran-scripts. Plant Physiol 125: 2189–2202

Yang SH, Berberich T, Sano H, Kusano T (2001) Specific association oftranscripts of tbzF and tbz17, tobacco genes encoding basic region leu-cine zipper-type transcriptional activators, with guard cells of senescingleaves and/or flowers. Plant Physiol 127: 23–32

Yu ZX, Li JX, Yang CQ, Hu WL, Wang LJ, Chen XY (2012) The jasmonate-responsive AP2/ERF transcription factors AaERF1 and AaERF2 posi-tively regulate artemisinin biosynthesis in Artemisia annua L. Mol Plant5: 353–365

Zhang H, Koes R, Shang H, Fu Z, Wang L, Dong X, Zhang J, Passeri V, LiY, Jiang H, et al (2019) Identification and functional analysis of threenew anthocyanin R2R3-MYB genes in Petunia. Plant Direct 3: e00114

Zhang P, Chopra S, Peterson T (2000) A segmental gene duplicationgenerated differentially expressed myb-homologous genes in maize.Plant Cell 12: 2311–2322

Zhang X, Fowler SG, Cheng H, Lou Y, Rhee SY, Stockinger EJ,Thomashow MF (2004) Freezing-sensitive tomato has a functional CBFcold response pathway, but a CBF regulon that differs from that offreezing-tolerant Arabidopsis. Plant J 39: 905–919

Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene sig-nalling and their interaction are integral parts of the elicitor signallingpathway leading to b-thujaplicin biosynthesis in Cupressus lusitanica cellcultures. J Exp Bot 55: 1003–1012

Zhou ML, Zhu XM, Shao JR, Wu YM, Tang YX (2010) Transcriptionalresponse of the catharanthine biosynthesis pathway to methyl jasmo-nate/nitric oxide elicitation in Catharanthus roseus hairy root culture.Appl Microbiol Biotechnol 88: 737–750


Paul et al.



mutually regulated ap2/erf gene clusters modulate · mutually regulated ap2/erf gene clusters...

Documents